>ref|XM_750301.1| Aspergillus fumigatus Af293 COPI vesicle coat subunit beta'
           (Afu2g10610) partial mRNA
          Length = 2568

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 173 tgggactgggagaaaggctgga 194
           ||||||||||||||||||||||
Sbjct: 370 tgggactgggagaaaggctgga 391

>emb|AL591662.6| Human DNA sequence from clone RP11-28P17 on chromosome 9 Contains part
             of the TMC1 gene for transmembrane cochlear-expressed 1, a
             ribosomal protein S20 (RPS20) pseudogene and a ribosomal
             protein S27a (RPS27A) pseudogene, complete sequence
          Length = 170815

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 311   aagatctgggatatttcctta 331
             |||||||||||||||||||||
Sbjct: 16550 aagatctgggatatttcctta 16570

>gb|AC079243.7| Mus musculus strain C57BL6/J chromosome 6 clone RP23-64M7, complete
             sequence
          Length = 205508

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 169   gctttgggactgggagaaaggctgg 193
             ||||||||||||| |||||||||||
Sbjct: 63441 gctttgggactggaagaaaggctgg 63465

>emb|Z49705.1|SC8520X S.cerevisiae chromosome XIII cosmid 8520
          Length = 41200

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 67   ggtcaagaaattcaaagctca 87
            |||||||||||||||||||||
Sbjct: 6038 ggtcaagaaattcaaagctca 6058

>dbj|AK085854.1| Mus musculus 16 days neonate heart cDNA, RIKEN full-length enriched
            library, clone:D830017O21 product:corticotropin releasing
            hormone receptor 2, full insert sequence
          Length = 2927

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 169  gctttgggactgggagaaaggctgg 193
            ||||||||||||| |||||||||||
Sbjct: 1812 gctttgggactggaagaaaggctgg 1788

>gb|AC007463.3| Homo sapiens BAC clone RP11-244L12 from 2, complete sequence
          Length = 166892

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 680   agaagtgtcgtgattggattt 700
             |||||||||||||||||||||
Sbjct: 39558 agaagtgtcgtgattggattt 39538

>ref|XM_957384.1| Neurospora crassa OR74A hypothetical protein (NCU07319.1) partial
           mRNA
          Length = 2577

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 163 gatcaagctttgggactgggagaa 186
           ||||||||||||||| ||||||||
Sbjct: 360 gatcaagctttgggattgggagaa 383

>ref|XM_327604.1| Neurospora crassa OR74A hypothetical protein (NCU07319.1) partial
           mRNA
          Length = 2577

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 163 gatcaagctttgggactgggagaa 186
           ||||||||||||||| ||||||||
Sbjct: 360 gatcaagctttgggattgggagaa 383

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 372      tgattgatctcgattatttt 391
                ||||||||||||||||||||
Sbjct: 32994707 tgattgatctcgattatttt 32994726

>ref|NM_182821.1| Rattus norvegicus PX domain containing serine/threonine kinase
           (Pxk), mRNA
          Length = 2797

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 555 cgttgctgattagaaccttt 574
           ||||||||||||||||||||
Sbjct: 746 cgttgctgattagaaccttt 765

>gb|AY327408.1| Rattus norvegicus PX serine/threonine kinase (Pxk) mRNA, complete
           cds
          Length = 2797

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 555 cgttgctgattagaaccttt 574
           ||||||||||||||||||||
Sbjct: 746 cgttgctgattagaaccttt 765

>gb|DQ122786.1| Medicago sativa clone H47 coatomer protein complex subunit beta 2
           mRNA, partial cds
          Length = 545

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 167 aagctttgggactgggagaaaggctgga 194
           ||||||||||| ||||| ||||||||||
Sbjct: 511 aagctttgggattgggaaaaaggctgga 538

>gb|BC098901.1| Rattus norvegicus PX domain containing serine/threonine kinase,
           mRNA (cDNA clone MGC:114238 IMAGE:7127537), complete cds
          Length = 2774

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 555 cgttgctgattagaaccttt 574
           ||||||||||||||||||||
Sbjct: 688 cgttgctgattagaaccttt 707

>emb|AL161536.2|ATCHRIV36 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 36
          Length = 199634

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 378    atctcgattattttcttccg 397
              ||||||||||||||||||||
Sbjct: 148527 atctcgattattttcttccg 148508

>emb|AL049656.1|ATT6G15 Arabidopsis thaliana DNA chromosome 4, BAC clone  T6G15 (ESSA project)
          Length = 113970

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 378   atctcgattattttcttccg 397
             ||||||||||||||||||||
Sbjct: 46319 atctcgattattttcttccg 46300

>gb|AC079457.14| Homo sapiens 12 BAC RP11-632M17 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 120449

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 137    ctgtcaggaggatgcaacca 156
              ||||||||||||||||||||
Sbjct: 107158 ctgtcaggaggatgcaacca 107177

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 372      tgattgatctcgattatttt 391
                ||||||||||||||||||||
Sbjct: 33085217 tgattgatctcgattatttt 33085236

>gb|AC009336.13|AC009336 Homo sapiens chromosome 2, clone RP11-387A1, complete sequence
          Length = 175667

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 287    agtgctgccttggatggcaaagca 310
              |||||||||| |||||||||||||
Sbjct: 118320 agtgctgcctgggatggcaaagca 118297

>gb|AC138336.3| Homo sapiens chromosome 17, clone CTC-386K3, complete sequence
          Length = 94400

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 41    tcatgcaagacattggggttggag 64
             ||||| ||||||||||||||||||
Sbjct: 44943 tcatggaagacattggggttggag 44920

>gb|AC104321.7| Oryza sativa chromosome 3 BAC OSJNBa0052F07 genomic sequence, complete
              sequence
          Length = 139823

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 372    tgattgatctcgattatttt 391
              ||||||||||||||||||||
Sbjct: 128601 tgattgatctcgattatttt 128582

>emb|CR361565.8| Zebrafish DNA sequence from clone CH211-242L1 in linkage group 22,
             complete sequence
          Length = 164475

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 73    gaaattcaaagctcacaacg 92
             ||||||||||||||||||||
Sbjct: 39162 gaaattcaaagctcacaacg 39181


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,779,687
Number of Sequences: 3902068
Number of extensions: 5779687
Number of successful extensions: 102161
Number of sequences better than 10.0: 21
Number of HSP's better than 10.0 without gapping: 21
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 102058
Number of HSP's gapped (non-prelim): 103
length of query: 726
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 703
effective length of database: 17,143,297,704
effective search space: 12051738285912
effective search space used: 12051738285912
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)