ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name basd13c08
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AE009286.1| Agrobacterium tumefaciens str. C58 linear chromos... 42 2.1
2gb|AE008326.1| Agrobacterium tumefaciens str. C58 linear chromos... 42 2.1
3gb|AY277973.1| Takifugu rubripes transcription factor Sox5 (Sox5... 42 2.1
4ref|XM_789052.1| PREDICTED: Strongylocentrotus purpuratus simila... 42 2.1
5gb|AC148814.1| Oryza sativa (japonica cultivar-group) chromosome... 40 8.2
6ref|XM_750449.1| Aspergillus fumigatus Af293 hypothetical protei... 40 8.2
7emb|Z77664.1|CEF53H10 Caenorhabditis elegans Cosmid F53H10, comp... 40 8.2
8gb|AC079316.15| Homo sapiens 12 BAC RP11-43D4 (Roswell Park Canc... 40 8.2
9gb|AC122300.3| Mus musculus BAC clone RP23-275E20 from 7, comple... 40 8.2
10ref|XM_651789.1| Entamoeba histolytica HM-1:IMSS Beige/BEACH dom... 40 8.2
11gb|AC137677.24| Mus musculus chromosome 1, clone RP23-257D12, co... 40 8.2
12emb|AJ748131.1| Streptomyces ribosidificus ribostamycin biosynth... 40 8.2
13gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome 40 8.2
14ref|XM_776740.1| PREDICTED: Strongylocentrotus purpuratus simila... 40 8.2
15emb|AL670364.5| Mouse DNA sequence from clone RP23-239H8 on chro... 40 8.2
16gb|AC183383.2| Pan troglodytes BAC clone CH251-394M21 from chrom... 40 8.2
17dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.2
18ref|XM_340945.2| PREDICTED: Rattus norvegicus 5-azacytidine indu... 40 8.2
19dbj|BA000035.2| Corynebacterium efficiens YS-314 DNA, complete g... 40 8.2
20dbj|BS000116.1| Pan troglodytes chromosome 22 clone:RP43-103F17,... 40 8.2
21dbj|AP001726.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 40 8.2
22emb|AJ744850.1| Streptomyces ribosidificus ribostamycin biosynth... 40 8.2
23dbj|AB024006.1| Hordeum vulgare naat-B and naat-A genes for nico... 40 8.2
24dbj|AB005788.1| Hordeum vulgare mRNA for nicotianamine aminotran... 40 8.2
25dbj|AP000697.1| Homo sapiens genomic DNA, chromosome 21q22.2, BA... 40 8.2

>gb|AE009286.1| Agrobacterium tumefaciens str. C58 linear chromosome, section 56 of
            187 of the complete sequence
          Length = 10883

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 127  cggcggcagccacgcgggcgt 147
            |||||||||||||||||||||
Sbjct: 7997 cggcggcagccacgcgggcgt 7977



to top

>gb|AE008326.1| Agrobacterium tumefaciens str. C58 linear chromosome, section 130 of
            187 of the complete sequence
          Length = 11474

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 127  cggcggcagccacgcgggcgt 147
            |||||||||||||||||||||
Sbjct: 3461 cggcggcagccacgcgggcgt 3481



to top

>gb|AY277973.1| Takifugu rubripes transcription factor Sox5 (Sox5) gene, complete cds
          Length = 61929

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 313   ggaggaggacagcgatgacag 333
             |||||||||||||||||||||
Sbjct: 54546 ggaggaggacagcgatgacag 54526



to top

>ref|XM_789052.1| PREDICTED: Strongylocentrotus purpuratus similar to nucleolar
           protein with MIF4G domain 1 (LOC589410), mRNA
          Length = 2379

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 335 gagggtagtgatgaggaggaggata 359
           ||||||||||| |||||||||||||
Sbjct: 577 gagggtagtgaggaggaggaggata 601



to top

>gb|AC148814.1| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBa0077J22, complete sequence
          Length = 173903

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 334   ggagggtagtgatgaggaggagga 357
             |||||||||||| |||||||||||
Sbjct: 97684 ggagggtagtgaggaggaggagga 97661



to top

>ref|XM_750449.1| Aspergillus fumigatus Af293 hypothetical protein (Afu2g12100)
           partial mRNA
          Length = 747

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 334 ggagggtagtgatgaggagg 353
           ||||||||||||||||||||
Sbjct: 39  ggagggtagtgatgaggagg 20



to top

>emb|Z77664.1|CEF53H10 Caenorhabditis elegans Cosmid F53H10, complete sequence
          Length = 22916

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 500   gaagaagcagatgaaataga 519
             ||||||||||||||||||||
Sbjct: 14117 gaagaagcagatgaaataga 14136



to top

>gb|AC079316.15| Homo sapiens 12 BAC RP11-43D4 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 178905

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 258   ctgagctcgtgaacacacaggtgg 281
             ||||||| ||||||||||||||||
Sbjct: 27796 ctgagctggtgaacacacaggtgg 27819



to top

>gb|AC122300.3| Mus musculus BAC clone RP23-275E20 from 7, complete sequence
          Length = 182032

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 218   ctcgtctccacagaatcaga 237
             ||||||||||||||||||||
Sbjct: 44336 ctcgtctccacagaatcaga 44317



to top

>ref|XM_651789.1| Entamoeba histolytica HM-1:IMSS Beige/BEACH domain protein, putative
            (7.t00041) partial mRNA
          Length = 7095

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 497  aaggaagaagcagatgaaatagag 520
            ||||||||||||||||||| ||||
Sbjct: 5209 aaggaagaagcagatgaaaaagag 5232



to top

>gb|AC137677.24| Mus musculus chromosome 1, clone RP23-257D12, complete sequence
          Length = 189162

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 313    ggaggaggacagcgatgacaggga 336
              ||||||||||| ||||||||||||
Sbjct: 147908 ggaggaggacaacgatgacaggga 147885



to top

>emb|AJ748131.1| Streptomyces ribosidificus ribostamycin biosynthetic gene cluster
          Length = 31892

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 201   cccgtgatgaccaggcgctc 220
             ||||||||||||||||||||
Sbjct: 30242 cccgtgatgaccaggcgctc 30261



to top

>gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome
          Length = 4892717

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 114    tcctttctgttcacggcggcagcc 137
              |||||||| |||||||||||||||
Sbjct: 394985 tcctttcttttcacggcggcagcc 394962



to top

>ref|XM_776740.1| PREDICTED: Strongylocentrotus purpuratus similar to Excitatory amino
            acid transporter 3 (Sodium-dependent glutamate/aspartate
            transporter 3) (Excitatory amino-acid carrier 1)
            (Neuronal and epithelial glutamate transporter)
            (LOC576432), mRNA
          Length = 1779

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 342  gtgatgaggaggaggataccaatg 365
            |||||||||| |||||||||||||
Sbjct: 1022 gtgatgaggaagaggataccaatg 999



to top

>emb|AL670364.5| Mouse DNA sequence from clone RP23-239H8 on chromosome 11 Contains a
              novel pseudogene, complete sequence
          Length = 136025

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 333    gggagggtagtgatgaggag 352
              ||||||||||||||||||||
Sbjct: 133405 gggagggtagtgatgaggag 133386



to top

>gb|AC183383.2| Pan troglodytes BAC clone CH251-394M21 from chromosome 7, complete
             sequence
          Length = 146307

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 230   gaatcagatcagatttcctt 249
             ||||||||||||||||||||
Sbjct: 64469 gaatcagatcagatttcctt 64450



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
               sequence
          Length = 29737217

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 334     ggagggtagtgatgaggaggagga 357
               |||||||||||| |||||||||||
Sbjct: 2651164 ggagggtagtgaggaggaggagga 2651141



to top

>ref|XM_340945.2| PREDICTED: Rattus norvegicus 5-azacytidine induced gene 1 (predicted)
            (Azi1_predicted), mRNA
          Length = 3306

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 344  gatgaggaggaggataccaa 363
            ||||||||||||||||||||
Sbjct: 1432 gatgaggaggaggataccaa 1451



to top

>dbj|BA000035.2| Corynebacterium efficiens YS-314 DNA, complete genome
          Length = 3147090

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 275     caggtggacagcgacgacca 294
               ||||||||||||||||||||
Sbjct: 1143345 caggtggacagcgacgacca 1143364



to top

>dbj|BS000116.1| Pan troglodytes chromosome 22 clone:RP43-103F17, map 22, complete
             sequences
          Length = 35832

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 497   aaggaagaagcagatgaaat 516
             ||||||||||||||||||||
Sbjct: 22496 aaggaagaagcagatgaaat 22515



to top

>dbj|AP001726.1| Homo sapiens genomic DNA, chromosome 21q, section 70/105
          Length = 340000

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 497    aaggaagaagcagatgaaat 516
              ||||||||||||||||||||
Sbjct: 243378 aaggaagaagcagatgaaat 243397



to top

>emb|AJ744850.1| Streptomyces ribosidificus ribostamycin biosynthesis gene cluster,
             strain NRRL B-11466
          Length = 43190

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 201   cccgtgatgaccaggcgctc 220
             ||||||||||||||||||||
Sbjct: 35972 cccgtgatgaccaggcgctc 35991



to top

>dbj|AB024006.1| Hordeum vulgare naat-B and naat-A genes for nicotianamine
           aminotransferase, complete cds
          Length = 10966

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 122 gttcacggcggcagccacgc 141
           ||||||||||||||||||||
Sbjct: 754 gttcacggcggcagccacgc 735



to top

>dbj|AB005788.1| Hordeum vulgare mRNA for nicotianamine aminotransferase B, complete
           cds
          Length = 1895

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 122 gttcacggcggcagccacgc 141
           ||||||||||||||||||||
Sbjct: 180 gttcacggcggcagccacgc 161



to top

>dbj|AP000697.1| Homo sapiens genomic DNA, chromosome 21q22.2, BAC clone:KB594G10,
             CBR1-HLCS region
          Length = 136219

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 497   aaggaagaagcagatgaaat 516
             ||||||||||||||||||||
Sbjct: 59071 aaggaagaagcagatgaaat 59090


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,758,961
Number of Sequences: 3902068
Number of extensions: 4758961
Number of successful extensions: 83587
Number of sequences better than 10.0: 25
Number of HSP's better than 10.0 without gapping: 25
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 83445
Number of HSP's gapped (non-prelim): 142
length of query: 600
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 577
effective length of database: 17,143,297,704
effective search space: 9891682775208
effective search space used: 9891682775208
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top