ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name basd11p17
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AJ001161.1|HVJ001161 Hordeum vulgare S28 ribosomal protein 729 0.0
2ref|NM_196464.1| Oryza sativa (japonica cultivar-group) unknown ... 287 2e-74
3dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 287 2e-74
4gb|AC027659.1| Oryza sativa (japonica cultivar-group) BAC nbxb00... 287 2e-74
5gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 287 2e-74
6gb|AF479045.1| Triticum aestivum S28 ribosomal protein mRNA, par... 283 3e-73
7dbj|AK121099.1| Oryza sativa (japonica cultivar-group) cDNA clon... 283 3e-73
8dbj|AK058209.1| Oryza sativa (japonica cultivar-group) cDNA clon... 276 7e-71
9gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 256 6e-65
10dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 256 6e-65
11gb|AC107225.2| Oryza sativa (japonica cultivar-group) chromosome... 256 6e-65
12emb|X82124.1|ZMRPS28 Z.mays mRNA for ribosomal protein S28 252 1e-63
13gb|BT019221.1| Zea mays clone Contig894.F mRNA sequence 244 2e-61
14emb|AJ012654.1|PPE012654 Prunus persica mRNA for ribosomal prote... 103 6e-19
15emb|AJ012656.1|PPE012656 Prunus persica rps28.2 gene 101 2e-18
16gb|AC147482.2| Medicago truncatula chromosome 7 BAC clone mth2-9... 86 1e-13
17gb|AF522185.1| Helianthus annuus ribosomal protein small subunit... 84 5e-13
18gb|AY496124.1| Capsicum annuum 28 kDa small subunit ribosomal pr... 76 1e-10
19dbj|AB180425.1| Plutella xylostella mRNA for Ribosomal protein S... 74 5e-10
20emb|AJ012655.1|PPE012655 Prunus persica rps28.1 gene 72 2e-09
21emb|AJ012653.1|PPE012653 Prunus persica mRNA for ribosomal prote... 72 2e-09
22emb|BX066090.1|CNS09N5Q Single read from an extremity of a full-... 68 3e-08
23emb|BX066089.1|CNS09N5P Single read from an extremity of a full-... 68 3e-08
24emb|BX063862.1|CNS09LFU Single read from an extremity of a full-... 68 3e-08
25emb|BX059621.1|CNS09I61 Single read from an extremity of a full-... 68 3e-08
26emb|BX059620.1|CNS09I60 Single read from an extremity of a full-... 68 3e-08
27emb|BX050720.1|CNS09BAS Single read from an extremity of a full-... 68 3e-08
28emb|BX047727.1|CNS098ZN Single read from an extremity of a full-... 68 3e-08
29emb|BX037730.1|CNS0919Y Single read from an extremity of a full-... 68 3e-08
30emb|BX035423.1|CNS08ZHV Single read from an extremity of a full-... 68 3e-08
31emb|BX034299.1|CNS08YMN Single read from an extremity of a full-... 68 3e-08
32emb|BX031963.1|CNS08WTR Single read from an extremity of a full-... 68 3e-08
33emb|BX030446.1|CNS08VNM Single read from an extremity of a full-... 68 3e-08
34emb|BX029903.1|CNS08V8J Single read from an extremity of a full-... 68 3e-08
35emb|BX029902.1|CNS08V8I Single read from an extremity of a full-... 68 3e-08
36emb|BX029104.1|CNS08UMC Single read from an extremity of a full-... 68 3e-08
37emb|BX029103.1|CNS08UMB Single read from an extremity of a full-... 68 3e-08
38emb|BX022359.1|CNS08PEZ Single read from an extremity of a full-... 68 3e-08
39emb|BX027183.1|CNS08T4Z Single read from an extremity of a full-... 68 3e-08
40emb|BX026501.1|CNS08SM1 Single read from an extremity of a full-... 68 3e-08
41emb|BX026025.1|CNS08S8T Single read from an extremity of a full-... 68 3e-08
42emb|BX024671.1|CNS08R77 Single read from an extremity of a full-... 68 3e-08
43emb|BX024628.1|CNS08R60 Single read from an extremity of a full-... 68 3e-08
44emb|BX024105.1|CNS08QRH Single read from an extremity of a full-... 68 3e-08
45emb|BX019678.1|CNS08NCI Single read from an extremity of a full-... 68 3e-08
46emb|BX019677.1|CNS08NCH Single read from an extremity of a full-... 68 3e-08
47emb|BX017869.1|CNS08LY9 Single read from an extremity of a full-... 68 3e-08
48emb|BX017868.1|CNS08LY8 Single read from an extremity of a full-... 68 3e-08
49emb|BX018569.1|CNS08MHP Single read from an extremity of a full-... 68 3e-08
50emb|BX016768.1|CNS08L3O Single read from an extremity of a full-... 68 3e-08
51emb|BX016767.1|CNS08L3N Single read from an extremity of a full-... 68 3e-08
52emb|BX016605.1|CNS08KZ5 Single read from an extremity of a full-... 68 3e-08
53emb|BX016604.1|CNS08KZ4 Single read from an extremity of a full-... 68 3e-08
54emb|BX013539.1|CNS08ILZ Single read from an extremity of a full-... 68 3e-08
55emb|BX011311.1|CNS08GW3 Single read from an extremity of a full-... 68 3e-08
56emb|BX011310.1|CNS08GW2 Single read from an extremity of a full-... 68 3e-08
57emb|BX011303.1|CNS08GVV Single read from an extremity of a full-... 68 3e-08
58emb|BX011122.1|CNS08GQU Single read from an extremity of a full-... 68 3e-08
59emb|BX010770.1|CNS08GH2 Single read from an extremity of a full-... 68 3e-08
60emb|BX010769.1|CNS08GH1 Single read from an extremity of a full-... 68 3e-08
61emb|BX010433.1|CNS08G7P Single read from an extremity of a full-... 68 3e-08
62emb|BX009493.1|CNS08FHL Single read from an extremity of a full-... 68 3e-08
63emb|BX006409.1|CNS08D3X Single read from an extremity of a full-... 68 3e-08
64ref|XM_311696.2| Anopheles gambiae str. PEST ENSANGP00000015156 ... 68 3e-08
65ref|XM_306927.2| Anopheles gambiae str. PEST ENSANGP00000013820 ... 68 3e-08
66emb|BX035088.1|CNS08Z8K Single read from an extremity of a full-... 66 1e-07
67emb|BX005651.1|CNS08CIV Single read from an extremity of a full-... 66 1e-07
68gb|AY263406.1| Branchiostoma belcheri tsingtaunese ribosomal pro... 66 1e-07
69gb|DQ413211.1| Acyrthosiphon pisum isolate WHAP0115 ribosomal pr... 64 5e-07
70gb|AY769344.1| Bombyx mori ribosomal protein S28 (RpS28) mRNA, c... 62 2e-06
71gb|AY583363.1| Bombyx mori ribosomal protein S28 mRNA, complete cds 62 2e-06
72gb|AC105292.3| Drosophila melanogaster X BAC RP98-18F10 (Roswell... 62 2e-06
73ref|NM_132340.2| Drosophila melanogaster Ribosomal protein S28b ... 62 2e-06
74gb|AY061320.1| Drosophila melanogaster LD23674 full length cDNA 62 2e-06
75gb|AE003447.5| Drosophila melanogaster chromosome X, section 31 ... 62 2e-06
76emb|BX035089.1|CNS08Z8L Single read from an extremity of a full-... 60 7e-06
77emb|BX030447.1|CNS08VNN Single read from an extremity of a full-... 60 7e-06
78dbj|AB225419.1| Aspergillus oryzae cDNA, contig sequence: AoEST2272 60 7e-06
79dbj|AB225891.1| Aspergillus oryzae cDNA, contig sequence: AoEST2746 60 7e-06
80gb|DQ213718.1| Taeniopygia guttata clone 0061P0003F01 40S riboso... 56 1e-04
81gb|DQ213717.1| Taeniopygia guttata clone 0064P0018H11 40S riboso... 56 1e-04
82emb|CR711605.2|CNS0GC0X Tetraodon nigroviridis full-length cDNA 56 1e-04
83emb|CR722751.2|CNS0GKMD Tetraodon nigroviridis full-length cDNA 56 1e-04
84ref|XM_659144.1| Aspergillus nidulans FGSC A4 hypothetical prote... 52 0.002
85emb|BX050719.1|CNS09BAR Single read from an extremity of a full-... 52 0.002
86ref|NM_001025316.1| Bos taurus ribosomal protein S28 (RPS28), mRNA 48 0.028
87emb|CR734300.2|CNS0GTD7 Tetraodon nigroviridis full-length cDNA 48 0.028
88emb|CR734460.2|CNS0GTHN Tetraodon nigroviridis full-length cDNA 48 0.028
89emb|CR733784.1|CNS0GSYV Tetraodon nigroviridis full-length cDNA 48 0.028
90emb|CR723021.2|CNS0GKTV Tetraodon nigroviridis full-length cDNA 48 0.028
91emb|CR708356.2|CNS0G9IO Tetraodon nigroviridis full-length cDNA 48 0.028
92emb|CR691078.2|CNS0FW6Q Tetraodon nigroviridis full-length cDNA 48 0.028
93emb|CR654910.2|CNS0F4AS Tetraodon nigroviridis full-length cDNA 48 0.028
94emb|CR645761.2|CNS0EX8N Tetraodon nigroviridis full-length cDNA 48 0.028
95emb|CR644968.2|CNS0EWMM Tetraodon nigroviridis full-length cDNA 48 0.028
96emb|CR638452.2|CNS0ERLM Tetraodon nigroviridis full-length cDNA 48 0.028
97gb|BC102565.1| Bos taurus ribosomal protein S28, mRNA (cDNA clon... 48 0.028
98emb|CR390505.1| Gallus gallus finished cDNA, clone ChEST305m10 48 0.028
99emb|BX931766.2| Gallus gallus finished cDNA, clone ChEST799i14 48 0.028
100emb|CR353804.1| Gallus gallus finished cDNA, clone ChEST917j22 48 0.028
101gb|AY911353.1| Bos taurus clone IMAGE:7961492 ribosomal protein ... 48 0.028
102ref|NM_125810.2| Arabidopsis thaliana RPS28 (RIBOSOMAL PROTEIN S... 46 0.11
103ref|XM_365049.1| Magnaporthe grisea 70-15 hypothetical protein (... 46 0.11
104ref|XM_955468.1| Neurospora crassa OR74A hypothetical protein (N... 46 0.11
105ref|XM_325453.1| Neurospora crassa OR74A hypothetical protein (N... 46 0.11
106ref|XM_381438.1| Gibberella zeae PH-1 chromosome 1 hypothetical ... 46 0.11
107gb|AY081679.1| Arabidopsis thaliana 40S ribosomal protein S28 (A... 46 0.11
108gb|AY059859.1| Arabidopsis thaliana 40S ribosomal protein S28 (A... 46 0.11
109emb|BX833027.1|CNS0A0MP Arabidopsis thaliana Full-length cDNA Co... 46 0.11
110emb|BX833714.1|CNS0A0F7 Arabidopsis thaliana Full-length cDNA Co... 46 0.11
111gb|AF400224.1| Spodoptera frugiperda ribosomal protein S28 mRNA,... 46 0.11
112gb|AY087546.1| Arabidopsis thaliana clone 36501 mRNA, complete s... 46 0.11
113dbj|AB008266.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 46 0.11
114gb|AY849705.1| Magnaporthe grisea 40S ribosomal protein S28-like... 46 0.11
115gb|L09755.1|ATHRP28A Arabidopsis thaliana ribosomal protein S28 ... 46 0.11
116gb|AC004896.1| Homo sapiens PAC clone RP4-811H12 from 7, complet... 44 0.44
117gb|AY232136.1| Drosophila yakuba clone yak-ad_CG2998 mRNA sequence 44 0.44
118gb|AY231975.1| Drosophila yakuba clone yak-em_CG2998 mRNA sequence 44 0.44
119dbj|AP007151.1| Aspergillus oryzae RIB40 genomic DNA, SC005 44 0.44
120emb|AJ554098.1|DSI554098 Drosophila simulans CG15527 gene, strai... 44 0.44
121gb|AY431390.1| Aedes aegypti ASAP ID: 34581 cytosolic small ribo... 42 1.7
122gb|DQ440266.1| Aedes aegypti clone AET-3303 ribosomal protein S2... 42 1.7
123emb|AL590822.36| Human DNA sequence from clone RP11-181G12 on ch... 42 1.7
124emb|AL359643.27| Human DNA sequence from clone RP11-428J1 on chr... 42 1.7
125dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.7
126dbj|AP004613.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.7
127gb|AY443099.2| Haloarcula sp. AS7094 plasmid pSCM201, complete s... 42 1.7
128emb|AL604025.15| Mouse DNA sequence from clone RP23-455K6 on chr... 42 1.7
129ref|NM_111844.3| Arabidopsis thaliana structural constituent of ... 40 6.9
130gb|AC144926.6| Mus musculus chromosome 8, clone RP23-8E24, compl... 40 6.9
131ref|XM_954446.1| Neurospora crassa OR74A hypothetical protein (N... 40 6.9
132gb|AC106595.9| Rattus norvegicus 7 BAC CH230-237N20 (Children's ... 40 6.9
133ref|XM_331186.1| Neurospora crassa OR74A hypothetical protein (N... 40 6.9
134gb|AC156554.13| Mus musculus chromosome 8, clone RP23-15O21, com... 40 6.9
135gb|BT011253.1| Arabidopsis thaliana At3g10090 gene, complete cds 40 6.9
136gb|AC140212.2| Mus musculus BAC clone RP23-267G14 from chromosom... 40 6.9
137gb|BT010782.1| Arabidopsis thaliana At3g10090 mRNA, complete cds 40 6.9
138ref|XM_538458.2| PREDICTED: Canis familiaris similar to DNA repa... 40 6.9
139gb|AC010927.5|ATAC010927 Arabidopsis thaliana chromosome III BAC... 40 6.9
140emb|CR734767.2|CNS0GTQ6 Tetraodon nigroviridis full-length cDNA 40 6.9
141emb|CR749176.14| Zebrafish DNA sequence from clone DKEY-43B13 in... 40 6.9
142ref|XM_793349.1| PREDICTED: Strongylocentrotus purpuratus simila... 40 6.9
143emb|AL359831.9| Human DNA sequence from clone RP11-251L4 on chro... 40 6.9
144emb|AL358074.22| Human DNA sequence from clone RP11-423C15 on ch... 40 6.9
145emb|AL354828.12| Human DNA sequence from clone RP11-274P12 on ch... 40 6.9
146emb|AL133257.17| Human DNA sequence from clone RP1-166D18 on chr... 40 6.9
147gb|AC125503.3| Oryctolagus cuniculus clone LB1-115H21, complete ... 40 6.9
148ref|XM_794087.1| PREDICTED: Strongylocentrotus purpuratus simila... 40 6.9
149emb|BX640548.14| Zebrafish DNA sequence from clone CH211-198E12 ... 40 6.9
150gb|AC163654.2| Mus musculus BAC clone RP23-259M14 from chromosom... 40 6.9
151gb|AC100800.2| Homo sapiens chromosome 8, clone RP11-161I2, comp... 40 6.9
152gb|AC090420.6| Homo sapiens chromosome 8, clone RP11-346L6, comp... 40 6.9
153gb|DP000006.1| Oryctolagus cuniculus target 1 genomic scaffold 40 6.9
154gb|AC026779.5| Homo sapiens chromosome 5 clone CTC-430I8, comple... 40 6.9
155emb|AL116032.1|CNS01CVC Botrytis cinerea strain T4 cDNA library 40 6.9
156emb|AL115331.1|CNS01CBV Botrytis cinerea strain T4 cDNA library 40 6.9
157emb|AL114930.1|CNS01C0Q Botrytis cinerea strain T4 cDNA library 40 6.9
158emb|AL114877.1|CNS01BZ9 Botrytis cinerea strain T4 cDNA library 40 6.9
159emb|AL114703.1|CNS01BUF Botrytis cinerea strain T4 cDNA library 40 6.9
160emb|AL114380.1|CNS01BLG Botrytis cinerea strain T4 cDNA library 40 6.9
161emb|AL112446.1|CNS01A3Q Botrytis cinerea strain T4 cDNA library 40 6.9
162emb|AL112026.1|CNS019S2 Botrytis cinerea strain T4 cDNA library 40 6.9
163emb|AL110780.1|CNS018TH Botrytis cinerea strain T4 cDNA library 40 6.9
164emb|AL110956.1|CNS018YD Botrytis cinerea strain T4 cDNA library 40 6.9
165dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.9
166dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.9
167emb|BX826230.1|CNS0A6FW Arabidopsis thaliana Full-length cDNA Co... 40 6.9
168gb|AC122152.3| Oryctolagus cuniculus clone LB1-297M16, complete ... 40 6.9
169gb|AC012449.7| Homo sapiens BAC clone RP11-321K13 from 2, comple... 40 6.9
170gb|AC008482.5|AC008482 Homo sapiens chromosome 5 clone CTC-402A1... 40 6.9
171dbj|BA000019.2| Nostoc sp. PCC 7120 DNA, complete genome 40 6.9
172dbj|AP003846.2| Oryza sativa (japonica cultivar-group) genomic D... 40 6.9
173emb|BX088724.6| Zebrafish DNA sequence from clone DKEY-15G22, co... 40 6.9
174dbj|AB012248.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 40 6.9
175emb|AJ277600.1|QSU277600 Quercus suber mRNA for small subunit ri... 40 6.9
176dbj|AP003031.3| Homo sapiens genomic DNA, chromosome 11q clone:R... 40 6.9
177gb|AC135425.3| Oryza sativa (japonica cultivar-group) chromosome... 40 6.9

>emb|AJ001161.1|HVJ001161 Hordeum vulgare S28 ribosomal protein
          Length = 496

 Score =  729 bits (368), Expect = 0.0
 Identities = 413/426 (96%), Gaps = 4/426 (0%)
 Strand = Plus / Plus

                                                                       
Query: 40  cgccaacagccgaagaaaggcagcatggatactcaggtgaagcttgcagtggtggtgaag 99
           |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 71  cgccaacagccgaagaaaggcagcatggatacccaggtgaagcttgcagtggtggtgaag 130

                                                                       
Query: 100 gtgatgggccgcacgggctccaggggtcaggtgacccaggtgagagtcaagttcctggat 159
           |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 131 gtgatgggccgcactggctccaggggtcaggtgacccaggtgagagtcaagttcctggat 190

                                                                       
Query: 160 gaccagaaccgtctcatcatgaggaacgtcaagggacccgtccgtgagggcgacatcctc 219
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 191 caccagaaccgtctcatcatgaggaacgtcaagggacccgtccgtgagggcgacatcctc 250

                                                                       
Query: 220 accctgcttgagtctgagcgggaggccaggaggctgcgctaagaagtttctttactgtct 279
           |||||||| |||||||||||||||||||||||||||||||||||||||| |||||   ||
Sbjct: 251 accctgctcgagtctgagcgggaggccaggaggctgcgctaagaagtttttttac---ct 307

                                                                       
Query: 280 gtctgtcttgggaagtaaaatgctgtgctgttgccttcgtactctatatactgcttccgt 339
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 308 gtctgtcttgggaagtaaaatgctgtgctgttgccttcgtactctatatactgcttccat 367

                                                                       
Query: 340 cttttgcctaggctatggagatttaatgagttttcttgtgttgtctgaattaaagtgcac 399
           ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 368 cttttgcctaggctatggagatttaatgagttttcttgtgttgcctgaattaaagtgcac 427

                                                                       
Query: 400 ttgatgttgtgagacttgatcattgtttcgcacctgtgggtaatgtta-acgactatgtt 458
           ||||||||||||||||||||||||||||||||||| ||||||||||||  ||||||||||
Sbjct: 428 ttgatgttgtgagacttgatcattgtttcgcacctctgggtaatgttagtcgactatgtt 487

                 
Query: 459 ggattc 464
           ||||||
Sbjct: 488 ggattc 493



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                  
Query: 16 gcttgcgccgccgcctccgtcctc 39
          |||||||||||||||||| |||||
Sbjct: 24 gcttgcgccgccgcctccatcctc 47



to top

>ref|NM_196464.1| Oryza sativa (japonica cultivar-group) unknown protein
            (OSJNBa0015J03.20), mRNA
          Length = 2142

 Score =  287 bits (145), Expect = 2e-74
 Identities = 187/201 (93%)
 Strand = Plus / Minus

                                                                        
Query: 59   gcagcatggatactcaggtgaagcttgcagtggtggtgaaggtgatgggccgcacgggct 118
            ||||||||||||| ||||| || ||||| || ||||||||||||||||||||||| ||||
Sbjct: 2012 gcagcatggatacccaggtcaaacttgccgtcgtggtgaaggtgatgggccgcaccggct 1953

                                                                        
Query: 119  ccaggggtcaggtgacccaggtgagagtcaagttcctggatgaccagaaccgtctcatca 178
            |||||||||||||||||||||| ||||| |||||||| || |||||||||||||||||||
Sbjct: 1952 ccaggggtcaggtgacccaggtcagagtgaagttcctcgacgaccagaaccgtctcatca 1893

                                                                        
Query: 179  tgaggaacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagc 238
            |||||||||||||||| || ||||||||||||||||||||||||||||| ||||||||| 
Sbjct: 1892 tgaggaacgtcaagggcccggtccgtgagggcgacatcctcaccctgctcgagtctgaga 1833

                                 
Query: 239  gggaggccaggaggctgcgct 259
            |||||||||||||||||||||
Sbjct: 1832 gggaggccaggaggctgcgct 1812



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score =  287 bits (145), Expect = 2e-74
 Identities = 187/201 (93%)
 Strand = Plus / Minus

                                                                            
Query: 59       gcagcatggatactcaggtgaagcttgcagtggtggtgaaggtgatgggccgcacgggct 118
                ||||||||||||| ||||| || ||||| || ||||||||||||||||||||||| ||||
Sbjct: 13808755 gcagcatggatacccaggtcaaacttgccgtcgtggtgaaggtgatgggccgcaccggct 13808696

                                                                            
Query: 119      ccaggggtcaggtgacccaggtgagagtcaagttcctggatgaccagaaccgtctcatca 178
                |||||||||||||||||||||| ||||| |||||||| || |||||||||||||||||||
Sbjct: 13808695 ccaggggtcaggtgacccaggtcagagtgaagttcctcgacgaccagaaccgtctcatca 13808636

                                                                            
Query: 179      tgaggaacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagc 238
                |||||||||||||||| || ||||||||||||||||||||||||||||| ||||||||| 
Sbjct: 13808635 tgaggaacgtcaagggcccggtccgtgagggcgacatcctcaccctgctcgagtctgaga 13808576

                                     
Query: 239      gggaggccaggaggctgcgct 259
                |||||||||||||||||||||
Sbjct: 13808575 gggaggccaggaggctgcgct 13808555



to top

>gb|AC027659.1| Oryza sativa (japonica cultivar-group) BAC nbxb0015J03 chromosome 10,
              complete sequence
          Length = 172742

 Score =  287 bits (145), Expect = 2e-74
 Identities = 187/201 (93%)
 Strand = Plus / Minus

                                                                          
Query: 59     gcagcatggatactcaggtgaagcttgcagtggtggtgaaggtgatgggccgcacgggct 118
              ||||||||||||| ||||| || ||||| || ||||||||||||||||||||||| ||||
Sbjct: 135284 gcagcatggatacccaggtcaaacttgccgtcgtggtgaaggtgatgggccgcaccggct 135225

                                                                          
Query: 119    ccaggggtcaggtgacccaggtgagagtcaagttcctggatgaccagaaccgtctcatca 178
              |||||||||||||||||||||| ||||| |||||||| || |||||||||||||||||||
Sbjct: 135224 ccaggggtcaggtgacccaggtcagagtgaagttcctcgacgaccagaaccgtctcatca 135165

                                                                          
Query: 179    tgaggaacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagc 238
              |||||||||||||||| || ||||||||||||||||||||||||||||| ||||||||| 
Sbjct: 135164 tgaggaacgtcaagggcccggtccgtgagggcgacatcctcaccctgctcgagtctgaga 135105

                                   
Query: 239    gggaggccaggaggctgcgct 259
              |||||||||||||||||||||
Sbjct: 135104 gggaggccaggaggctgcgct 135084



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score =  287 bits (145), Expect = 2e-74
 Identities = 187/201 (93%)
 Strand = Plus / Minus

                                                                            
Query: 59       gcagcatggatactcaggtgaagcttgcagtggtggtgaaggtgatgggccgcacgggct 118
                ||||||||||||| ||||| || ||||| || ||||||||||||||||||||||| ||||
Sbjct: 13816097 gcagcatggatacccaggtcaaacttgccgtcgtggtgaaggtgatgggccgcaccggct 13816038

                                                                            
Query: 119      ccaggggtcaggtgacccaggtgagagtcaagttcctggatgaccagaaccgtctcatca 178
                |||||||||||||||||||||| ||||| |||||||| || |||||||||||||||||||
Sbjct: 13816037 ccaggggtcaggtgacccaggtcagagtgaagttcctcgacgaccagaaccgtctcatca 13815978

                                                                            
Query: 179      tgaggaacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagc 238
                |||||||||||||||| || ||||||||||||||||||||||||||||| ||||||||| 
Sbjct: 13815977 tgaggaacgtcaagggcccggtccgtgagggcgacatcctcaccctgctcgagtctgaga 13815918

                                     
Query: 239      gggaggccaggaggctgcgct 259
                |||||||||||||||||||||
Sbjct: 13815917 gggaggccaggaggctgcgct 13815897



to top

>gb|AF479045.1| Triticum aestivum S28 ribosomal protein mRNA, partial cds
          Length = 261

 Score =  283 bits (143), Expect = 3e-73
 Identities = 185/199 (92%)
 Strand = Plus / Plus

                                                                       
Query: 61  agcatggatactcaggtgaagcttgcagtggtggtgaaggtgatgggccgcacgggctcc 120
           ||||||||||| ||||| ||||| ||||| |||||||||||||||||||| || ||||||
Sbjct: 61  agcatggatacccaggtcaagctcgcagtcgtggtgaaggtgatgggccggaccggctcc 120

                                                                       
Query: 121 aggggtcaggtgacccaggtgagagtcaagttcctggatgaccagaaccgtctcatcatg 180
           |||||||||||||||||||| || || |||||||||||||||||||||||||||||||||
Sbjct: 121 aggggtcaggtgacccaggtcagggtgaagttcctggatgaccagaaccgtctcatcatg 180

                                                                       
Query: 181 aggaacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgg 240
           |||||||||||||| || || |||||||||||||||||||||||||| ||||| ||||||
Sbjct: 181 aggaacgtcaagggccctgttcgtgagggcgacatcctcaccctgctcgagtccgagcgg 240

                              
Query: 241 gaggccaggaggctgcgct 259
           |||||||||||||||||||
Sbjct: 241 gaggccaggaggctgcgct 259



to top

>dbj|AK121099.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023069E23, full
           insert sequence
          Length = 564

 Score =  283 bits (143), Expect = 3e-73
 Identities = 185/199 (92%)
 Strand = Plus / Plus

                                                                       
Query: 61  agcatggatactcaggtgaagcttgcagtggtggtgaaggtgatgggccgcacgggctcc 120
           ||||||||||| ||||| || ||||| || ||||||||||||||||||||||| ||||||
Sbjct: 96  agcatggatacccaggtcaaacttgccgtcgtggtgaaggtgatgggccgcaccggctcc 155

                                                                       
Query: 121 aggggtcaggtgacccaggtgagagtcaagttcctggatgaccagaaccgtctcatcatg 180
           |||||||||||||||||||| ||||| |||||||| || |||||||||||||||||||||
Sbjct: 156 aggggtcaggtgacccaggtcagagtgaagttcctcgacgaccagaaccgtctcatcatg 215

                                                                       
Query: 181 aggaacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgg 240
           |||||||||||||| || ||||||||||||||||||||||||||||| ||||||||| ||
Sbjct: 216 aggaacgtcaagggcccggtccgtgagggcgacatcctcaccctgctcgagtctgagagg 275

                              
Query: 241 gaggccaggaggctgcgct 259
           |||||||||||||||||||
Sbjct: 276 gaggccaggaggctgcgct 294



to top

>dbj|AK058209.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-010-B09, full
           insert sequence
          Length = 566

 Score =  276 bits (139), Expect = 7e-71
 Identities = 184/199 (92%)
 Strand = Plus / Plus

                                                                       
Query: 61  agcatggatactcaggtgaagcttgcagtggtggtgaaggtgatgggccgcacgggctcc 120
           ||||||||||| ||||| || ||||| ||  |||||||||||||||||||||| ||||||
Sbjct: 95  agcatggatacccaggtcaaacttgccgtcttggtgaaggtgatgggccgcaccggctcc 154

                                                                       
Query: 121 aggggtcaggtgacccaggtgagagtcaagttcctggatgaccagaaccgtctcatcatg 180
           |||||||||||||||||||| ||||| |||||||| || |||||||||||||||||||||
Sbjct: 155 aggggtcaggtgacccaggtcagagtgaagttcctcgacgaccagaaccgtctcatcatg 214

                                                                       
Query: 181 aggaacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgg 240
           |||||||||||||| || ||||||||||||||||||||||||||||| ||||||||| ||
Sbjct: 215 aggaacgtcaagggcccggtccgtgagggcgacatcctcaccctgctcgagtctgagagg 274

                              
Query: 241 gaggccaggaggctgcgct 259
           |||||||||||||||||||
Sbjct: 275 gaggccaggaggctgcgct 293



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  256 bits (129), Expect = 6e-65
 Identities = 183/201 (91%)
 Strand = Plus / Plus

                                                                           
Query: 59      gcagcatggatactcaggtgaagcttgcagtggtggtgaaggtgatgggccgcacgggct 118
               |||||||||| || ||||||||||| || || ||||||||||||||||| || || ||||
Sbjct: 3612513 gcagcatggacacccaggtgaagctggctgttgtggtgaaggtgatggggcgtaccggct 3612572

                                                                           
Query: 119     ccaggggtcaggtgacccaggtgagagtcaagttcctggatgaccagaaccgtctcatca 178
               ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 3612573 ccaggggtcaggtgacccaggtgagagtcaagttcttggatgaccagaaccgtctcatca 3612632

                                                                           
Query: 179     tgaggaacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagc 238
               |||||||||||||||| || || || |||||||||||||||||| |||| ||||| ||| 
Sbjct: 3612633 tgaggaacgtcaagggcccggttcgagagggcgacatcctcaccttgctcgagtccgaga 3612692

                                    
Query: 239     gggaggccaggaggctgcgct 259
               |||||||||||||||| ||||
Sbjct: 3612693 gggaggccaggaggcttcgct 3612713



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score =  256 bits (129), Expect = 6e-65
 Identities = 183/201 (91%)
 Strand = Plus / Plus

                                                                           
Query: 59      gcagcatggatactcaggtgaagcttgcagtggtggtgaaggtgatgggccgcacgggct 118
               |||||||||| || ||||||||||| || || ||||||||||||||||| || || ||||
Sbjct: 3612624 gcagcatggacacccaggtgaagctggctgttgtggtgaaggtgatggggcgtaccggct 3612683

                                                                           
Query: 119     ccaggggtcaggtgacccaggtgagagtcaagttcctggatgaccagaaccgtctcatca 178
               ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 3612684 ccaggggtcaggtgacccaggtgagagtcaagttcttggatgaccagaaccgtctcatca 3612743

                                                                           
Query: 179     tgaggaacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagc 238
               |||||||||||||||| || || || |||||||||||||||||| |||| ||||| ||| 
Sbjct: 3612744 tgaggaacgtcaagggcccggttcgagagggcgacatcctcaccttgctcgagtccgaga 3612803

                                    
Query: 239     gggaggccaggaggctgcgct 259
               |||||||||||||||| ||||
Sbjct: 3612804 gggaggccaggaggcttcgct 3612824



to top

>gb|AC107225.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0026H19,
              complete sequence
          Length = 150620

 Score =  256 bits (129), Expect = 6e-65
 Identities = 183/201 (91%)
 Strand = Plus / Plus

                                                                          
Query: 59     gcagcatggatactcaggtgaagcttgcagtggtggtgaaggtgatgggccgcacgggct 118
              |||||||||| || ||||||||||| || || ||||||||||||||||| || || ||||
Sbjct: 130166 gcagcatggacacccaggtgaagctggctgttgtggtgaaggtgatggggcgtaccggct 130225

                                                                          
Query: 119    ccaggggtcaggtgacccaggtgagagtcaagttcctggatgaccagaaccgtctcatca 178
              ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 130226 ccaggggtcaggtgacccaggtgagagtcaagttcttggatgaccagaaccgtctcatca 130285

                                                                          
Query: 179    tgaggaacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagc 238
              |||||||||||||||| || || || |||||||||||||||||| |||| ||||| ||| 
Sbjct: 130286 tgaggaacgtcaagggcccggttcgagagggcgacatcctcaccttgctcgagtccgaga 130345

                                   
Query: 239    gggaggccaggaggctgcgct 259
              |||||||||||||||| ||||
Sbjct: 130346 gggaggccaggaggcttcgct 130366



to top

>emb|X82124.1|ZMRPS28 Z.mays mRNA for ribosomal protein S28
          Length = 406

 Score =  252 bits (127), Expect = 1e-63
 Identities = 181/199 (90%)
 Strand = Plus / Plus

                                                                       
Query: 61  agcatggatactcaggtgaagcttgcagtggtggtgaaggtgatgggccgcacgggctcc 120
           |||||||| || |||||||||||||| || |||||||| ||||||||| | || ||||||
Sbjct: 73  agcatggacacccaggtgaagcttgctgttgtggtgaaagtgatgggcaggaccggctcc 132

                                                                       
Query: 121 aggggtcaggtgacccaggtgagagtcaagttcctggatgaccagaaccgtctcatcatg 180
           |||||||||||||||||||| ||||| |||||| ||||||||||||||||||||||||||
Sbjct: 133 aggggtcaggtgacccaggtcagagtgaagttcttggatgaccagaaccgtctcatcatg 192

                                                                       
Query: 181 aggaacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgg 240
           |||||||||||||| || ||  ||||||| ||||||||||||||||| ||||||||| ||
Sbjct: 193 aggaacgtcaagggtcctgtttgtgagggtgacatcctcaccctgctcgagtctgagagg 252

                              
Query: 241 gaggccaggaggctgcgct 259
           |||||||||||||||||||
Sbjct: 253 gaggccaggaggctgcgct 271



to top

>gb|BT019221.1| Zea mays clone Contig894.F mRNA sequence
          Length = 540

 Score =  244 bits (123), Expect = 2e-61
 Identities = 180/199 (90%)
 Strand = Plus / Minus

                                                                       
Query: 61  agcatggatactcaggtgaagcttgcagtggtggtgaaggtgatgggccgcacgggctcc 120
           |||||||| || |||||||||||||| || |||||||||||||||||| | || ||||||
Sbjct: 441 agcatggacacccaggtgaagcttgctgttgtggtgaaggtgatgggcaggaccggctcc 382

                                                                       
Query: 121 aggggtcaggtgacccaggtgagagtcaagttcctggatgaccagaaccgtctcatcatg 180
           |||||||||||||||||||| ||||| |||||| |||||||||||||||| |||||||||
Sbjct: 381 aggggtcaggtgacccaggtcagagttaagttcttggatgaccagaaccggctcatcatg 322

                                                                       
Query: 181 aggaacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgg 240
           ||||| |||||||| |||||||| ||||| ||||||||| ||||||| ||||| ||| ||
Sbjct: 321 aggaatgtcaaggggcccgtccgcgagggtgacatcctccccctgctcgagtccgagagg 262

                              
Query: 241 gaggccaggaggctgcgct 259
           |||||||||||||||||||
Sbjct: 261 gaggccaggaggctgcgct 243



to top

>emb|AJ012654.1|PPE012654 Prunus persica mRNA for ribosomal protein S28 (rps28.2)
          Length = 288

 Score =  103 bits (52), Expect = 6e-19
 Identities = 100/116 (86%)
 Strand = Plus / Plus

                                                                       
Query: 127 caggtgacccaggtgagagtcaagttcctggatgaccagaaccgtctcatcatgaggaac 186
           |||||||| || || ||||||||||| ||||||||||| |||||  ||||||||||||||
Sbjct: 154 caggtgactcaagttagagtcaagtttctggatgaccaaaaccggttcatcatgaggaac 213

                                                                   
Query: 187 gtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcggga 242
           ||||||||||| ||  | ||||| || ||||| |||||||| ||||||||| ||||
Sbjct: 214 gtcaagggaccagtgagggagggggatatccttaccctgctcgagtctgagaggga 269



to top

>emb|AJ012656.1|PPE012656 Prunus persica rps28.2 gene
          Length = 969

 Score =  101 bits (51), Expect = 2e-18
 Identities = 138/167 (82%)
 Strand = Plus / Plus

                                                                       
Query: 76  gtgaagcttgcagtggtggtgaaggtgatgggccgcacgggctccaggggtcaggtgacc 135
           ||||||| ||| || |||||||| || |||||||| || || ||  | || |||||||| 
Sbjct: 784 gtgaagcatgctgttgtggtgaaagttatgggccggactggatctcgtgggcaggtgact 843

                                                                       
Query: 136 caggtgagagtcaagttcctggatgaccagaaccgtctcatcatgaggaacgtcaaggga 195
           || || ||||||||||| |||| ||||||||||||  |||||||||||||||||||||||
Sbjct: 844 caagttagagtcaagtttctgggtgaccagaaccggttcatcatgaggaacgtcaaggga 903

                                                          
Query: 196 cccgtccgtgagggcgacatcctcaccctgcttgagtctgagcggga 242
           || ||  | ||||| || ||||| ||| |||| ||||||||| ||||
Sbjct: 904 ccagtgagggagggggatatccttaccttgctcgagtctgagaggga 950



to top

>gb|AC147482.2| Medicago truncatula chromosome 7 BAC clone mth2-93e11, complete
             sequence
          Length = 119127

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 127/155 (81%)
 Strand = Plus / Plus

                                                                         
Query: 79    aagcttgcagtggtggtgaaggtgatgggccgcacgggctccaggggtcaggtgacccag 138
             |||| ||| ||||| ||||| || ||||| || ||||| ||||| || || || || |||
Sbjct: 26663 aagcatgctgtggttgtgaaagttatgggtcgtacgggatccagaggacaagtcactcag 26722

                                                                         
Query: 139   gtgagagtcaagttcctggatgaccagaaccgtctcatcatgaggaacgtcaagggaccc 198
             || ||||| |||||  |||| || |||||||||| |||||||||||| ||||||||||| 
Sbjct: 26723 gttagagtgaagtttttggacgatcagaaccgtcacatcatgaggaatgtcaagggacca 26782

                                                
Query: 199   gtccgtgagggcgacatcctcaccctgcttgagtc 233
             ||  | ||||| |||||||| ||||| ||||||||
Sbjct: 26783 gttagggagggagacatccttaccctccttgagtc 26817



to top

>gb|AF522185.1| Helianthus annuus ribosomal protein small subunit 28 (SRPS28) mRNA,
           complete cds
          Length = 502

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 124 ggtcaggtgacccaggtgagagtcaagttcctggatgaccagaaccgtctcatcatgagg 183
           ||||||||||| || |||||||| |||||  ||||||||||||||||  | |||||||||
Sbjct: 128 ggtcaggtgacacaagtgagagtgaagtttttggatgaccagaaccggtttatcatgagg 187

                                                                       
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgggag 243
           || ||||||||||| ||| | ||||| ||  | || ||| |||| ||||||||| |||| 
Sbjct: 188 aatgtcaagggaccagtcagagagggtgatgttcttaccttgctcgagtctgagagggaa 247

                         
Query: 244 gccaggaggctgcg 257
           || |||||| ||||
Sbjct: 248 gctaggaggttgcg 261



to top

>gb|AY496124.1| Capsicum annuum 28 kDa small subunit ribosomal protein mRNA,
           complete cds
          Length = 428

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 110/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 118 tccaggggtcaggtgacccaggtgagagtcaagttcctggatgaccagaaccgtctcatc 177
           ||||| || |||||||| ||||||||||| ||||| || || ||||||||| |  | |||
Sbjct: 79  tccagaggacaggtgactcaggtgagagttaagtttcttgacgaccagaacaggtttatc 138

                                                                       
Query: 178 atgaggaacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgag 237
           ||||| || ||||||||||| ||| | ||||| || || ||||| ||| | |||||||||
Sbjct: 139 atgagaaatgtcaagggaccagtcagagagggtgatattctcacactgttggagtctgag 198

                         
Query: 238 cgggaggccaggag 251
            | |||||||||||
Sbjct: 199 agagaggccaggag 212



to top

>dbj|AB180425.1| Plutella xylostella mRNA for Ribosomal protein S28, complete cds
          Length = 437

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 70/81 (86%)
 Strand = Plus / Plus

                                                                       
Query: 175 atcatgaggaacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtct 234
           ||||| ||||| ||||||||||||||  | || || |||||||| |||||||| ||||||
Sbjct: 196 atcatcaggaatgtcaagggacccgtgagggacggagacatcctgaccctgctcgagtct 255

                                
Query: 235 gagcgggaggccaggaggctg 255
           ||||| || ||||||||||||
Sbjct: 256 gagcgtgaagccaggaggctg 276



to top

>emb|AJ012655.1|PPE012655 Prunus persica rps28.1 gene
          Length = 1134

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 96/116 (82%)
 Strand = Plus / Plus

                                                                       
Query: 127 caggtgacccaggtgagagtcaagttcctggatgaccagaaccgtctcatcatgaggaac 186
           |||||||| || || |||||||||||  ||||||||||||| ||  ||||||||||||| 
Sbjct: 715 caggtgactcaagtaagagtcaagtttttggatgaccagaatcggttcatcatgaggaat 774

                                                                   
Query: 187 gtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcggga 242
           || |||||||| ||  | ||||| || ||||| ||| |||| ||||||||| ||||
Sbjct: 775 gtgaagggaccagtgagggagggggatatccttaccttgctcgagtctgagaggga 830



to top

>emb|AJ012653.1|PPE012653 Prunus persica mRNA for ribosomal protein S28 (rps28.1)
          Length = 589

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 96/116 (82%)
 Strand = Plus / Plus

                                                                       
Query: 127 caggtgacccaggtgagagtcaagttcctggatgaccagaaccgtctcatcatgaggaac 186
           |||||||| || || |||||||||||  ||||||||||||| ||  ||||||||||||| 
Sbjct: 155 caggtgactcaagtaagagtcaagtttttggatgaccagaatcggttcatcatgaggaat 214

                                                                   
Query: 187 gtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcggga 242
           || |||||||| ||  | ||||| || ||||| ||| |||| ||||||||| ||||
Sbjct: 215 gtgaagggaccagtgagggagggggatatccttaccttgctcgagtctgagaggga 270



to top

>emb|BX066090.1|CNS09N5Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5BA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 815

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgggag 243
           ||||| ||||||||||| || |||||||||||||| |||||||| |||||||| || |||
Sbjct: 728 aacgttaagggacccgtgcgcgagggcgacatcctgaccctgctggagtctgaacgtgag 669

             
Query: 244 gc 245
           ||
Sbjct: 668 gc 667



to top

>emb|BX066089.1|CNS09N5P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5BA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 617

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgggag 243
           ||||| ||||||||||| || |||||||||||||| |||||||| |||||||| || |||
Sbjct: 197 aacgttaagggacccgtgcgcgagggcgacatcctgaccctgctggagtctgaacgtgag 256

             
Query: 244 gc 245
           ||
Sbjct: 257 gc 258



to top

>emb|BX063862.1|CNS09LFU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45DF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 444

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgggag 243
           ||||| ||||||||||| || |||||||||||||| |||||||| |||||||| || |||
Sbjct: 203 aacgttaagggacccgtgcgcgagggcgacatcctgaccctgctggagtctgaacgtgag 144

             
Query: 244 gc 245
           ||
Sbjct: 143 gc 142



to top

>emb|BX059621.1|CNS09I61 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC4CC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 987

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgggag 243
           ||||| ||||||||||| || |||||||||||||| |||||||| |||||||| || |||
Sbjct: 744 aacgttaagggacccgtgcgcgagggcgacatcctgaccctgctggagtctgaacgtgag 685

             
Query: 244 gc 245
           ||
Sbjct: 684 gc 683



to top

>emb|BX059620.1|CNS09I60 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4CC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 979

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgggag 243
           ||||| ||||||||||| || |||||||||||||| |||||||| |||||||| || |||
Sbjct: 206 aacgttaagggacccgtgcgcgagggcgacatcctgaccctgctggagtctgaacgtgag 265

             
Query: 244 gc 245
           ||
Sbjct: 266 gc 267



to top

>emb|BX050720.1|CNS09BAS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC27BD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 418

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgggag 243
           ||||| ||||||||||| || |||||||||||||| |||||||| |||||||| || |||
Sbjct: 251 aacgttaagggacccgtgcgcgagggcgacatcctgaccctgctggagtctgaacgtgag 192

             
Query: 244 gc 245
           ||
Sbjct: 191 gc 190



to top

>emb|BX047727.1|CNS098ZN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC22BF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 560

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgggag 243
           ||||| ||||||||||| || |||||||||||||| |||||||| |||||||| || |||
Sbjct: 193 aacgttaagggacccgtgcgcgagggcgacatcctgaccctgctggagtctgaacgtgag 252

             
Query: 244 gc 245
           ||
Sbjct: 253 gc 254



to top

>emb|BX037730.1|CNS0919Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB1BC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 539

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgggag 243
           ||||| ||||||||||| || |||||||||||||| |||||||| |||||||| || |||
Sbjct: 213 aacgttaagggacccgtgcgcgagggcgacatcctgaccctgctggagtctgaacgtgag 272

             
Query: 244 gc 245
           ||
Sbjct: 273 gc 274



to top

>emb|BX035423.1|CNS08ZHV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA6DA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 579

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgggag 243
           ||||| ||||||||||| || |||||||||||||| |||||||| |||||||| || |||
Sbjct: 207 aacgttaagggacccgtgcgcgagggcgacatcctgaccctgctggagtctgaacgtgag 266

             
Query: 244 gc 245
           ||
Sbjct: 267 gc 268



to top

>emb|BX034299.1|CNS08YMN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA50AF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 550

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgggag 243
           ||||| ||||||||||| || |||||||||||||| |||||||| |||||||| || |||
Sbjct: 197 aacgttaagggacccgtgcgcgagggcgacatcctgaccctgctggagtctgaacgtgag 256

             
Query: 244 gc 245
           ||
Sbjct: 257 gc 258



to top

>emb|BX031963.1|CNS08WTR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA47CE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 536

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgggag 243
           ||||| ||||||||||| || |||||||||||||| |||||||| |||||||| || |||
Sbjct: 302 aacgttaagggacccgtgcgcgagggcgacatcctgaccctgctggagtctgaacgtgag 243

             
Query: 244 gc 245
           ||
Sbjct: 242 gc 241



to top

>emb|BX030446.1|CNS08VNM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA45BG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 558

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgggag 243
           ||||| ||||||||||| || |||||||||||||| |||||||| |||||||| || |||
Sbjct: 191 aacgttaagggacccgtgcgcgagggcgacatcctgaccctgctggagtctgaacgtgag 250

             
Query: 244 gc 245
           ||
Sbjct: 251 gc 252



to top

>emb|BX029903.1|CNS08V8J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA44CF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 562

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgggag 243
           ||||| ||||||||||| || |||||||||||||| |||||||| |||||||| || |||
Sbjct: 318 aacgttaagggacccgtgcgcgagggcgacatcctgaccctgctggagtctgaacgtgag 259

             
Query: 244 gc 245
           ||
Sbjct: 258 gc 257



to top

>emb|BX029902.1|CNS08V8I Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA44CF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 556

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgggag 243
           ||||| ||||||||||| || |||||||||||||| |||||||| |||||||| || |||
Sbjct: 201 aacgttaagggacccgtgcgcgagggcgacatcctgaccctgctggagtctgaacgtgag 260

             
Query: 244 gc 245
           ||
Sbjct: 261 gc 262



to top

>emb|BX029104.1|CNS08UMC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA43CB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 435

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgggag 243
           ||||| ||||||||||| || |||||||||||||| |||||||| |||||||| || |||
Sbjct: 309 aacgttaagggacccgtgcgcgagggcgacatcctgaccctgctggagtctgaacgtgag 250

             
Query: 244 gc 245
           ||
Sbjct: 249 gc 248



to top

>emb|BX029103.1|CNS08UMB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA43CB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 543

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgggag 243
           ||||| ||||||||||| || |||||||||||||| |||||||| |||||||| || |||
Sbjct: 193 aacgttaagggacccgtgcgcgagggcgacatcctgaccctgctggagtctgaacgtgag 252

             
Query: 244 gc 245
           ||
Sbjct: 253 gc 254



to top

>emb|BX022359.1|CNS08PEZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA34BA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 558

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgggag 243
           ||||| ||||||||||| || |||||||||||||| |||||||| |||||||| || |||
Sbjct: 311 aacgttaagggacccgtgcgcgagggcgacatcctgaccctgctggagtctgaacgtgag 252

             
Query: 244 gc 245
           ||
Sbjct: 251 gc 250



to top

>emb|BX027183.1|CNS08T4Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA40DA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 534

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgggag 243
           ||||| ||||||||||| || |||||||||||||| |||||||| |||||||| || |||
Sbjct: 198 aacgttaagggacccgtgcgcgagggcgacatcctgaccctgctggagtctgaacgtgag 257

             
Query: 244 gc 245
           ||
Sbjct: 258 gc 259



to top

>emb|BX026501.1|CNS08SM1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA4DC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 537

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgggag 243
           ||||| ||||||||||| || |||||||||||||| |||||||| |||||||| || |||
Sbjct: 194 aacgttaagggacccgtgcgcgagggcgacatcctgaccctgctggagtctgaacgtgag 253

             
Query: 244 gc 245
           ||
Sbjct: 254 gc 255



to top

>emb|BX026025.1|CNS08S8T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA4AE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 584

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgggag 243
           ||||| ||||||||||| || |||||||||||||| |||||||| |||||||| || |||
Sbjct: 211 aacgttaagggacccgtgcgcgagggcgacatcctgaccctgctggagtctgaacgtgag 270

             
Query: 244 gc 245
           ||
Sbjct: 271 gc 272



to top

>emb|BX024671.1|CNS08R77 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA37DA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 566

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgggag 243
           ||||| ||||||||||| || |||||||||||||| |||||||| |||||||| || |||
Sbjct: 187 aacgttaagggacccgtgcgcgagggcgacatcctgaccctgctggagtctgaacgtgag 246

             
Query: 244 gc 245
           ||
Sbjct: 247 gc 248



to top

>emb|BX024628.1|CNS08R60 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA37CE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 556

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgggag 243
           ||||| ||||||||||| || |||||||||||||| |||||||| |||||||| || |||
Sbjct: 188 aacgttaagggacccgtgcgcgagggcgacatcctgaccctgctggagtctgaacgtgag 247

             
Query: 244 gc 245
           ||
Sbjct: 248 gc 249



to top

>emb|BX024105.1|CNS08QRH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA36DB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 524

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgggag 243
           ||||| ||||||||||| || |||||||||||||| |||||||| |||||||| || |||
Sbjct: 153 aacgttaagggacccgtgcgcgagggcgacatcctgaccctgctggagtctgaacgtgag 212

             
Query: 244 gc 245
           ||
Sbjct: 213 gc 214



to top

>emb|BX019678.1|CNS08NCI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA3AB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 403

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgggag 243
           ||||| ||||||||||| || |||||||||||||| |||||||| |||||||| || |||
Sbjct: 166 aacgttaagggacccgtgcgcgagggcgacatcctgaccctgctggagtctgaacgtgag 107

             
Query: 244 gc 245
           ||
Sbjct: 106 gc 105



to top

>emb|BX019677.1|CNS08NCH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA3AB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 551

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgggag 243
           ||||| ||||||||||| || |||||||||||||| |||||||| |||||||| || |||
Sbjct: 183 aacgttaagggacccgtgcgcgagggcgacatcctgaccctgctggagtctgaacgtgag 242

             
Query: 244 gc 245
           ||
Sbjct: 243 gc 244



to top

>emb|BX017869.1|CNS08LY9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA27AB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 558

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgggag 243
           ||||| ||||||||||| || |||||||||||||| |||||||| |||||||| || |||
Sbjct: 313 aacgttaagggacccgtgcgcgagggcgacatcctgaccctgctggagtctgaacgtgag 254

             
Query: 244 gc 245
           ||
Sbjct: 253 gc 252



to top

>emb|BX017868.1|CNS08LY8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA27AB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 546

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgggag 243
           ||||| ||||||||||| || |||||||||||||| |||||||| |||||||| || |||
Sbjct: 185 aacgttaagggacccgtgcgcgagggcgacatcctgaccctgctggagtctgaacgtgag 244

             
Query: 244 gc 245
           ||
Sbjct: 245 gc 246



to top

>emb|BX018569.1|CNS08MHP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA28AH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 589

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgggag 243
           ||||| ||||||||||| || |||||||||||||| |||||||| |||||||| || |||
Sbjct: 215 aacgttaagggacccgtgcgcgagggcgacatcctgaccctgctggagtctgaacgtgag 274

             
Query: 244 gc 245
           ||
Sbjct: 275 gc 276



to top

>emb|BX016768.1|CNS08L3O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA25AH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 561

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgggag 243
           ||||| ||||||||||| || |||||||||||||| |||||||| |||||||| || |||
Sbjct: 329 aacgttaagggacccgtgcgcgagggcgacatcctgaccctgctggagtctgaacgtgag 270

             
Query: 244 gc 245
           ||
Sbjct: 269 gc 268



to top

>emb|BX016767.1|CNS08L3N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA25AH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 574

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgggag 243
           ||||| ||||||||||| || |||||||||||||| |||||||| |||||||| || |||
Sbjct: 211 aacgttaagggacccgtgcgcgagggcgacatcctgaccctgctggagtctgaacgtgag 270

             
Query: 244 gc 245
           ||
Sbjct: 271 gc 272



to top

>emb|BX016605.1|CNS08KZ5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA25AA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 579

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgggag 243
           ||||| ||||||||||| || |||||||||||||| |||||||| |||||||| || |||
Sbjct: 329 aacgttaagggacccgtgcgcgagggcgacatcctgaccctgctggagtctgaacgtgag 270

             
Query: 244 gc 245
           ||
Sbjct: 269 gc 268



to top

>emb|BX016604.1|CNS08KZ4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA25AA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 578

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgggag 243
           ||||| ||||||||||| || |||||||||||||| |||||||| |||||||| || |||
Sbjct: 211 aacgttaagggacccgtgcgcgagggcgacatcctgaccctgctggagtctgaacgtgag 270

             
Query: 244 gc 245
           ||
Sbjct: 271 gc 272



to top

>emb|BX013539.1|CNS08ILZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA20BD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 537

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgggag 243
           ||||| ||||||||||| || |||||||||||||| |||||||| |||||||| || |||
Sbjct: 179 aacgttaagggacccgtgcgcgagggcgacatcctgaccctgctggagtctgaacgtgag 238

             
Query: 244 gc 245
           ||
Sbjct: 239 gc 240



to top

>emb|BX011311.1|CNS08GW3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA18AC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 558

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgggag 243
           ||||| ||||||||||| || |||||||||||||| |||||||| |||||||| || |||
Sbjct: 311 aacgttaagggacccgtgcgcgagggcgacatcctgaccctgctggagtctgaacgtgag 252

             
Query: 244 gc 245
           ||
Sbjct: 251 gc 250



to top

>emb|BX011310.1|CNS08GW2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA18AC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 556

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgggag 243
           ||||| ||||||||||| || |||||||||||||| |||||||| |||||||| || |||
Sbjct: 195 aacgttaagggacccgtgcgcgagggcgacatcctgaccctgctggagtctgaacgtgag 254

             
Query: 244 gc 245
           ||
Sbjct: 255 gc 256



to top

>emb|BX011303.1|CNS08GVV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA18AC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 575

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgggag 243
           ||||| ||||||||||| || |||||||||||||| |||||||| |||||||| || |||
Sbjct: 208 aacgttaagggacccgtgcgcgagggcgacatcctgaccctgctggagtctgaacgtgag 267

             
Query: 244 gc 245
           ||
Sbjct: 268 gc 269



to top

>emb|BX011122.1|CNS08GQU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA17DB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 572

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgggag 243
           ||||| ||||||||||| || |||||||||||||| |||||||| |||||||| || |||
Sbjct: 204 aacgttaagggacccgtgcgcgagggcgacatcctgaccctgctggagtctgaacgtgag 263

             
Query: 244 gc 245
           ||
Sbjct: 264 gc 265



to top

>emb|BX010770.1|CNS08GH2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA17BB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 552

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgggag 243
           ||||| ||||||||||| || |||||||||||||| |||||||| |||||||| || |||
Sbjct: 311 aacgttaagggacccgtgcgcgagggcgacatcctgaccctgctggagtctgaacgtgag 252

             
Query: 244 gc 245
           ||
Sbjct: 251 gc 250



to top

>emb|BX010769.1|CNS08GH1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA17BB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 552

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgggag 243
           ||||| ||||||||||| || |||||||||||||| |||||||| |||||||| || |||
Sbjct: 199 aacgttaagggacccgtgcgcgagggcgacatcctgaccctgctggagtctgaacgtgag 258

             
Query: 244 gc 245
           ||
Sbjct: 259 gc 260



to top

>emb|BX010433.1|CNS08G7P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA16DB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 393

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgggag 243
           ||||| ||||||||||| || |||||||||||||| |||||||| |||||||| || |||
Sbjct: 196 aacgttaagggacccgtgcgcgagggcgacatcctgaccctgctggagtctgaacgtgag 255

             
Query: 244 gc 245
           ||
Sbjct: 256 gc 257



to top

>emb|BX009493.1|CNS08FHL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA15BE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 418

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgggag 243
           ||||| ||||||||||| || |||||||||||||| |||||||| |||||||| || |||
Sbjct: 315 aacgttaagggacccgtgcgcgagggcgacatcctgaccctgctggagtctgaacgtgag 256

             
Query: 244 gc 245
           ||
Sbjct: 255 gc 254



to top

>emb|BX006409.1|CNS08D3X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA10DE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 556

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgggag 243
           ||||| ||||||||||| || |||||||||||||| |||||||| |||||||| || |||
Sbjct: 192 aacgttaagggacccgtgcgcgagggcgacatcctgaccctgctggagtctgaacgtgag 251

             
Query: 244 gc 245
           ||
Sbjct: 252 gc 253



to top

>ref|XM_311696.2| Anopheles gambiae str. PEST ENSANGP00000015156
           (ENSANGG00000012667), partial mRNA
          Length = 198

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgggag 243
           ||||| ||||||||||| || |||||||||||||| |||||||| |||||||| || |||
Sbjct: 121 aacgttaagggacccgtgcgcgagggcgacatcctgaccctgctggagtctgaacgtgag 180

             
Query: 244 gc 245
           ||
Sbjct: 181 gc 182



to top

>ref|XM_306927.2| Anopheles gambiae str. PEST ENSANGP00000013820
           (ENSANGG00000011331), partial mRNA
          Length = 189

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgggag 243
           ||||| ||||||||||| || |||||||||||||| |||||||| |||||||| || |||
Sbjct: 112 aacgttaagggacccgtgcgcgagggcgacatcctgaccctgctggagtctgaacgtgag 171

             
Query: 244 gc 245
           ||
Sbjct: 172 gc 173



to top

>emb|BX035088.1|CNS08Z8K Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA6BB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 390

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctga 236
           ||||| ||||||||||| || |||||||||||||| |||||||| ||||||||
Sbjct: 177 aacgttaagggacccgtgcgcgagggcgacatcctgaccctgctggagtctga 229



to top

>emb|BX005651.1|CNS08CIV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA1BA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 501

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctga 236
           ||||| ||||||||||| || |||||||||||||| |||||||| ||||||||
Sbjct: 148 aacgttaagggacccgtgcgcgagggcgacatcctgaccctgctggagtctga 200



to top

>gb|AY263406.1| Branchiostoma belcheri tsingtaunese ribosomal protein S28 mRNA,
           complete cds
          Length = 460

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                
Query: 196 cccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgggaggccag 248
           ||||| || ||||||||||||||||||||||| ||||||||| | ||||||||
Sbjct: 173 cccgttcgggagggcgacatcctcaccctgctggagtctgagagagaggccag 225



to top

>gb|DQ413211.1| Acyrthosiphon pisum isolate WHAP0115 ribosomal protein S28e-like
           mRNA, complete cds
          Length = 198

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 62/72 (86%)
 Strand = Plus / Plus

                                                                       
Query: 166 aaccgtctcatcatgaggaacgtcaagggacccgtccgtgagggcgacatcctcaccctg 225
           |||||||  ||||| ||||||||||| |||||||| || ||||| ||||| ||||| |||
Sbjct: 103 aaccgtcagatcatcaggaacgtcaaaggacccgtgcgcgagggtgacattctcacgctg 162

                       
Query: 226 cttgagtctgag 237
           || |||||||||
Sbjct: 163 ctcgagtctgag 174



to top

>gb|AY769344.1| Bombyx mori ribosomal protein S28 (RpS28) mRNA, complete cds
          Length = 430

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                       
Query: 175 atcatgaggaacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtct 234
           ||||| || ||||| || |||||||||||||| || ||||||||||| || ||||| |||
Sbjct: 193 atcatcagaaacgtgaaaggacccgtccgtgacggagacatcctcactcttcttgaatct 252

                                  
Query: 235 gagcgggaggccaggaggctgcg 257
           || || || || |||||||||||
Sbjct: 253 gaacgtgaagctaggaggctgcg 275



to top

>gb|AY583363.1| Bombyx mori ribosomal protein S28 mRNA, complete cds
          Length = 411

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                       
Query: 175 atcatgaggaacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtct 234
           ||||| || ||||| || |||||||||||||| || ||||||||||| || ||||| |||
Sbjct: 179 atcatcagaaacgtgaaaggacccgtccgtgacggagacatcctcactcttcttgaatct 238

                                  
Query: 235 gagcgggaggccaggaggctgcg 257
           || || || || |||||||||||
Sbjct: 239 gaacgtgaagctaggaggctgcg 261



to top

>gb|AC105292.3| Drosophila melanogaster X BAC RP98-18F10 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 161360

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 133/167 (79%)
 Strand = Plus / Minus

                                                                         
Query: 95    tgaaggtgatgggccgcacgggctccaggggtcaggtgacccaggtgagagtcaagttcc 154
             |||||||  |||||||||| ||||||  |||||||   ||||||||||  ||| ||||||
Sbjct: 53751 tgaaggttctgggccgcaccggctcccagggtcagtgtacccaggtgaaggtcgagttcc 53692

                                                                         
Query: 155   tggatgaccagaaccgtctcatcatgaggaacgtcaagggacccgtccgtgagggcgaca 214
             |||  || |||||||| |  || ||  | ||||| |||||||| || || ||||||||||
Sbjct: 53691 tgggcgagcagaaccgccagattatccgaaacgtgaagggaccagttcgcgagggcgaca 53632

                                                            
Query: 215   tcctcaccctgcttgagtctgagcgggaggccaggaggctgcgctaa 261
             |||| |||||  | || || || || || ||||||||||||||||||
Sbjct: 53631 tcctgacccttttggaatccgaacgtgaagccaggaggctgcgctaa 53585



to top

>ref|NM_132340.2| Drosophila melanogaster Ribosomal protein S28b CG2998-RA (RpS28b),
           mRNA
          Length = 536

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 133/167 (79%)
 Strand = Plus / Plus

                                                                       
Query: 95  tgaaggtgatgggccgcacgggctccaggggtcaggtgacccaggtgagagtcaagttcc 154
           |||||||  |||||||||| ||||||  |||||||   ||||||||||  ||| ||||||
Sbjct: 123 tgaaggttctgggccgcaccggctcccagggtcagtgtacccaggtgaaggtcgagttcc 182

                                                                       
Query: 155 tggatgaccagaaccgtctcatcatgaggaacgtcaagggacccgtccgtgagggcgaca 214
           |||  || |||||||| |  || ||  | ||||| |||||||| || || ||||||||||
Sbjct: 183 tgggcgagcagaaccgccagattatccgaaacgtgaagggaccagttcgcgagggcgaca 242

                                                          
Query: 215 tcctcaccctgcttgagtctgagcgggaggccaggaggctgcgctaa 261
           |||| |||||  | || || || || || ||||||||||||||||||
Sbjct: 243 tcctgacccttttggaatccgaacgtgaagccaggaggctgcgctaa 289



to top

>gb|AY061320.1| Drosophila melanogaster LD23674 full length cDNA
          Length = 518

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 133/167 (79%)
 Strand = Plus / Plus

                                                                       
Query: 95  tgaaggtgatgggccgcacgggctccaggggtcaggtgacccaggtgagagtcaagttcc 154
           |||||||  |||||||||| ||||||  |||||||   ||||||||||  ||| ||||||
Sbjct: 93  tgaaggttctgggccgcaccggctcccagggtcagtgtacccaggtgaaggtcgagttcc 152

                                                                       
Query: 155 tggatgaccagaaccgtctcatcatgaggaacgtcaagggacccgtccgtgagggcgaca 214
           |||  || |||||||| |  || ||  | ||||| |||||||| || || ||||||||||
Sbjct: 153 tgggcgagcagaaccgccagattatccgaaacgtgaagggaccagttcgcgagggcgaca 212

                                                          
Query: 215 tcctcaccctgcttgagtctgagcgggaggccaggaggctgcgctaa 261
           |||| |||||  | || || || || || ||||||||||||||||||
Sbjct: 213 tcctgacccttttggaatccgaacgtgaagccaggaggctgcgctaa 259



to top

>gb|AE003447.5| Drosophila melanogaster chromosome X, section 31 of 74 of the complete
              sequence
          Length = 288721

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 133/167 (79%)
 Strand = Plus / Plus

                                                                          
Query: 95     tgaaggtgatgggccgcacgggctccaggggtcaggtgacccaggtgagagtcaagttcc 154
              |||||||  |||||||||| ||||||  |||||||   ||||||||||  ||| ||||||
Sbjct: 214804 tgaaggttctgggccgcaccggctcccagggtcagtgtacccaggtgaaggtcgagttcc 214863

                                                                          
Query: 155    tggatgaccagaaccgtctcatcatgaggaacgtcaagggacccgtccgtgagggcgaca 214
              |||  || |||||||| |  || ||  | ||||| |||||||| || || ||||||||||
Sbjct: 214864 tgggcgagcagaaccgccagattatccgaaacgtgaagggaccagttcgcgagggcgaca 214923

                                                             
Query: 215    tcctcaccctgcttgagtctgagcgggaggccaggaggctgcgctaa 261
              |||| |||||  | || || || || || ||||||||||||||||||
Sbjct: 214924 tcctgacccttttggaatccgaacgtgaagccaggaggctgcgctaa 214970



to top

>emb|BX035089.1|CNS08Z8L Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA6BB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 326

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                       
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgggag 243
           ||||| ||||||||||| || |||||||||||||| |||||||| |||| ||| || |||
Sbjct: 297 aacgttaagggacccgtgcgcgagggcgacatcctgaccctgctggagtttgaacgtgag 238

             
Query: 244 gc 245
           ||
Sbjct: 237 gc 236



to top

>emb|BX030447.1|CNS08VNN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA45BG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 155

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                       
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgggag 243
           ||||| ||||||||||| || |||||||||| ||| |||||||| |||||||| || |||
Sbjct: 64  aacgttaagggacccgtgcgcgagggcgacaacctgaccctgctggagtctgaacgtgag 5

             
Query: 244 gc 245
           ||
Sbjct: 4   gc 3



to top

>dbj|AB225419.1| Aspergillus oryzae cDNA, contig sequence: AoEST2272
          Length = 725

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 75/90 (83%)
 Strand = Plus / Plus

                                                                       
Query: 130 gtgacccaggtgagagtcaagttcctggatgaccagaaccgtctcatcatgaggaacgtc 189
           |||||||||||  | ||| ||||| |||||||||||| ||||  ||||||  | ||||||
Sbjct: 197 gtgacccaggtccgtgtcgagttcatggatgaccagagccgttccatcatccgtaacgtc 256

                                         
Query: 190 aagggacccgtccgtgagggcgacatcctc 219
           ||||| ||||||||||  | ||||||||||
Sbjct: 257 aagggccccgtccgtgtcgacgacatcctc 286



to top

>dbj|AB225891.1| Aspergillus oryzae cDNA, contig sequence: AoEST2746
          Length = 483

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 75/90 (83%)
 Strand = Plus / Plus

                                                                       
Query: 130 gtgacccaggtgagagtcaagttcctggatgaccagaaccgtctcatcatgaggaacgtc 189
           |||||||||||  | ||| ||||| |||||||||||| ||||  ||||||  | ||||||
Sbjct: 138 gtgacccaggtccgtgtcgagttcatggatgaccagagccgttccatcatccgtaacgtc 197

                                         
Query: 190 aagggacccgtccgtgagggcgacatcctc 219
           ||||| ||||||||||  | ||||||||||
Sbjct: 198 aagggccccgtccgtgtcgacgacatcctc 227



to top

>gb|DQ213718.1| Taeniopygia guttata clone 0061P0003F01 40S ribosomal protein
           S28-like mRNA, complete sequence
          Length = 376

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 64/76 (84%)
 Strand = Plus / Plus

                                                                       
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgggag 243
           ||||| ||||| || || || ||||||||| | ||||||||||| ||||| ||||| |||
Sbjct: 156 aacgtgaaggggccggtgcgcgagggcgacgttctcaccctgctggagtcggagcgcgag 215

                           
Query: 244 gccaggaggctgcgct 259
           ||| || |||||||||
Sbjct: 216 gcccggcggctgcgct 231



to top

>gb|DQ213717.1| Taeniopygia guttata clone 0064P0018H11 40S ribosomal protein
           S28-like mRNA, complete sequence
          Length = 375

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 64/76 (84%)
 Strand = Plus / Plus

                                                                       
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgggag 243
           ||||| ||||| || || || ||||||||| | ||||||||||| ||||| ||||| |||
Sbjct: 156 aacgtgaaggggccggtgcgcgagggcgacgttctcaccctgctggagtcggagcgcgag 215

                           
Query: 244 gccaggaggctgcgct 259
           ||| || |||||||||
Sbjct: 216 gcccggcggctgcgct 231



to top

>emb|CR711605.2|CNS0GC0X Tetraodon nigroviridis full-length cDNA
          Length = 357

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 70/84 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 catcatgaggaacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtc 233
           |||||| |||||||| ||||| |||||| | ||||||||| | || || || || |||||
Sbjct: 143 catcatcaggaacgtgaagggccccgtcagagagggcgacgtgctgacgcttctggagtc 202

                                   
Query: 234 tgagcgggaggccaggaggctgcg 257
            ||| | |||||||||||||||||
Sbjct: 203 cgagagagaggccaggaggctgcg 226



to top

>emb|CR722751.2|CNS0GKMD Tetraodon nigroviridis full-length cDNA
          Length = 362

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 70/84 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 catcatgaggaacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtc 233
           |||||| |||||||| ||||| |||||| | ||||||||| | || || || || |||||
Sbjct: 144 catcatcaggaacgtgaagggccccgtcagagagggcgacgtgctgacgcttctggagtc 203

                                   
Query: 234 tgagcgggaggccaggaggctgcg 257
            ||| | |||||||||||||||||
Sbjct: 204 cgagagagaggccaggaggctgcg 227



to top

>ref|XM_659144.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN6632.2), mRNA
          Length = 207

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 92/114 (80%)
 Strand = Plus / Plus

                                                                       
Query: 133 acccaggtgagagtcaagttcctggatgaccagaaccgtctcatcatgaggaacgtcaag 192
           ||||||||| | ||| ||||| ||||||| |||| ||||   |||||  | |||||||||
Sbjct: 79  acccaggtgcgcgtcgagttcatggatgatcagacccgttctatcatccgtaacgtcaag 138

                                                                 
Query: 193 ggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgggaggcc 246
           |||||||||||||  | |||||| |||  |||||| ||||| || || ||||||
Sbjct: 139 ggacccgtccgtgtcgacgacattctctgcctgctcgagtccgaacgtgaggcc 192



to top

>emb|BX050719.1|CNS09BAR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC27BD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 834

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Plus

                                                                       
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgggag 243
           ||||| ||||||||||| || |||||||| ||||| |||||||| |||| ||| || |||
Sbjct: 709 aacgttaagggacccgtgcgcgagggcgaaatcctgaccctgctggagtttgaacgtgag 768

             
Query: 244 gc 245
           ||
Sbjct: 769 gc 770



to top

>ref|NM_001025316.1| Bos taurus ribosomal protein S28 (RPS28), mRNA
          Length = 333

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 54/64 (84%)
 Strand = Plus / Plus

                                                                       
Query: 196 cccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgggaggccaggaggctg 255
           ||||| || ||||||||| | ||||||||| | ||||| ||||| |||||  ||||||||
Sbjct: 177 cccgtgcgcgagggcgacgtgctcaccctgttggagtcagagcgagaggctcggaggctg 236

               
Query: 256 cgct 259
           ||||
Sbjct: 237 cgct 240



to top

>emb|CR734300.2|CNS0GTD7 Tetraodon nigroviridis full-length cDNA
          Length = 344

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 69/84 (82%)
 Strand = Plus / Plus

                                                                       
Query: 174 catcatgaggaacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtc 233
           |||||| |||||||| ||||| |||||| | ||||| ||| | || || || || |||||
Sbjct: 142 catcatcaggaacgtgaagggccccgtcagagagggagacgtgctgacgcttctggagtc 201

                                   
Query: 234 tgagcgggaggccaggaggctgcg 257
           |||| | || ||||||||||||||
Sbjct: 202 tgagagagaagccaggaggctgcg 225



to top

>emb|CR734460.2|CNS0GTHN Tetraodon nigroviridis full-length cDNA
          Length = 342

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 69/84 (82%)
 Strand = Plus / Plus

                                                                       
Query: 174 catcatgaggaacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtc 233
           |||||| |||||||| ||||| |||||| | ||||| ||| | || || || || |||||
Sbjct: 143 catcatcaggaacgtgaagggccccgtcagagagggagacgtgctgacgcttctggagtc 202

                                   
Query: 234 tgagcgggaggccaggaggctgcg 257
           |||| | || ||||||||||||||
Sbjct: 203 tgagagagaagccaggaggctgcg 226



to top

>emb|CR733784.1|CNS0GSYV Tetraodon nigroviridis full-length cDNA
          Length = 337

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 69/84 (82%)
 Strand = Plus / Plus

                                                                       
Query: 174 catcatgaggaacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtc 233
           |||||| |||||||| ||||| |||||| | ||||| ||| | || || || || |||||
Sbjct: 144 catcatcaggaacgtgaagggccccgtcagagagggagacgtgctgacgcttctggagtc 203

                                   
Query: 234 tgagcgggaggccaggaggctgcg 257
           |||| | || ||||||||||||||
Sbjct: 204 tgagagagaagccaggaggctgcg 227



to top

>emb|CR723021.2|CNS0GKTV Tetraodon nigroviridis full-length cDNA
          Length = 343

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 69/84 (82%)
 Strand = Plus / Plus

                                                                       
Query: 174 catcatgaggaacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtc 233
           |||||| |||||||| ||||| |||||| | ||||| ||| | || || || || |||||
Sbjct: 145 catcatcaggaacgtgaagggccccgtcagagagggagacgtgctgacgcttctggagtc 204

                                   
Query: 234 tgagcgggaggccaggaggctgcg 257
           |||| | || ||||||||||||||
Sbjct: 205 tgagagagaagccaggaggctgcg 228



to top

>emb|CR708356.2|CNS0G9IO Tetraodon nigroviridis full-length cDNA
          Length = 501

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 69/84 (82%)
 Strand = Plus / Plus

                                                                       
Query: 174 catcatgaggaacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtc 233
           |||||| ||||||||  |||| |||||| | ||||||||| | || || || || |||||
Sbjct: 287 catcatcaggaacgtggagggccccgtcagagagggcgacgtgctgacgcttctggagtc 346

                                   
Query: 234 tgagcgggaggccaggaggctgcg 257
            ||| | |||||||||||||||||
Sbjct: 347 cgagagagaggccaggaggctgcg 370



to top

>emb|CR691078.2|CNS0FW6Q Tetraodon nigroviridis full-length cDNA
          Length = 365

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 69/84 (82%)
 Strand = Plus / Plus

                                                                       
Query: 174 catcatgaggaacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtc 233
           |||||| |||||||| ||||| |||||| | ||||| ||| | || || || || |||||
Sbjct: 147 catcatcaggaacgtgaagggccccgtcagagagggagacgtgctgacgcttctggagtc 206

                                   
Query: 234 tgagcgggaggccaggaggctgcg 257
           |||| | || ||||||||||||||
Sbjct: 207 tgagagagaagccaggaggctgcg 230



to top

>emb|CR654910.2|CNS0F4AS Tetraodon nigroviridis full-length cDNA
          Length = 744

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 69/84 (82%)
 Strand = Plus / Plus

                                                                       
Query: 174 catcatgaggaacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtc 233
           |||||| |||||||| ||||| |||||| | ||||| ||| | || || || || |||||
Sbjct: 348 catcatcaggaacgtgaagggccccgtcagagagggagacgtgctgacgcttctggagtc 407

                                   
Query: 234 tgagcgggaggccaggaggctgcg 257
           |||| | || ||||||||||||||
Sbjct: 408 tgagagagaagccaggaggctgcg 431



to top

>emb|CR645761.2|CNS0EX8N Tetraodon nigroviridis full-length cDNA
          Length = 744

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 69/84 (82%)
 Strand = Plus / Plus

                                                                       
Query: 174 catcatgaggaacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtc 233
           |||||| |||||||| ||||| |||||| | ||||| ||| | || || || || |||||
Sbjct: 348 catcatcaggaacgtgaagggccccgtcagagagggagacgtgctgacgcttctggagtc 407

                                   
Query: 234 tgagcgggaggccaggaggctgcg 257
           |||| | || ||||||||||||||
Sbjct: 408 tgagagagaagccaggaggctgcg 431



to top

>emb|CR644968.2|CNS0EWMM Tetraodon nigroviridis full-length cDNA
          Length = 358

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 69/84 (82%)
 Strand = Plus / Plus

                                                                       
Query: 174 catcatgaggaacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtc 233
           |||||| |||||||| ||||| |||||| | ||||| ||| | || || || || |||||
Sbjct: 144 catcatcaggaacgtgaagggccccgtcagagagggagacgtgctgacgcttctggagtc 203

                                   
Query: 234 tgagcgggaggccaggaggctgcg 257
           |||| | || ||||||||||||||
Sbjct: 204 tgagagagaagccaggaggctgcg 227



to top

>emb|CR638452.2|CNS0ERLM Tetraodon nigroviridis full-length cDNA
          Length = 341

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 69/84 (82%)
 Strand = Plus / Plus

                                                                       
Query: 174 catcatgaggaacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtc 233
           |||||| |||||||| ||||| |||||| | ||||| ||| | || || || || |||||
Sbjct: 143 catcatcaggaacgtgaagggccccgtcagagagggagacgtgctgacgcttctggagtc 202

                                   
Query: 234 tgagcgggaggccaggaggctgcg 257
           |||| | || ||||||||||||||
Sbjct: 203 tgagagagaagccaggaggctgcg 226



to top

>gb|BC102565.1| Bos taurus ribosomal protein S28, mRNA (cDNA clone MGC:127739
           IMAGE:7963167), complete cds
          Length = 351

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 54/64 (84%)
 Strand = Plus / Plus

                                                                       
Query: 196 cccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgggaggccaggaggctg 255
           ||||| || ||||||||| | ||||||||| | ||||| ||||| |||||  ||||||||
Sbjct: 178 cccgtgcgcgagggcgacgtgctcaccctgttggagtcagagcgagaggctcggaggctg 237

               
Query: 256 cgct 259
           ||||
Sbjct: 238 cgct 241



to top

>emb|CR390505.1| Gallus gallus finished cDNA, clone ChEST305m10
          Length = 378

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 63/76 (82%)
 Strand = Plus / Plus

                                                                       
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgggag 243
           ||||| ||||| || || || ||||| ||| ||||||||||||| ||||| ||||| |||
Sbjct: 138 aacgtgaaggggccggtgcgggagggagacgtcctcaccctgctcgagtcggagcgcgag 197

                           
Query: 244 gccaggaggctgcgct 259
           ||  || |||||||||
Sbjct: 198 gcgcggcggctgcgct 213



to top

>emb|BX931766.2| Gallus gallus finished cDNA, clone ChEST799i14
          Length = 1187

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 63/76 (82%)
 Strand = Plus / Plus

                                                                       
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgggag 243
           ||||| ||||| || || || ||||| ||| ||||||||||||| ||||| ||||| |||
Sbjct: 132 aacgtgaaggggccggtgcgggagggagacgtcctcaccctgctcgagtcggagcgcgag 191

                           
Query: 244 gccaggaggctgcgct 259
           ||  || |||||||||
Sbjct: 192 gcgcggcggctgcgct 207



to top

>emb|CR353804.1| Gallus gallus finished cDNA, clone ChEST917j22
          Length = 373

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 63/76 (82%)
 Strand = Plus / Plus

                                                                       
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgggag 243
           ||||| ||||| || || || ||||| ||| ||||||||||||| ||||| ||||| |||
Sbjct: 133 aacgtgaaggggccggtgcgggagggagacgtcctcaccctgctcgagtcggagcgcgag 192

                           
Query: 244 gccaggaggctgcgct 259
           ||  || |||||||||
Sbjct: 193 gcgcggcggctgcgct 208



to top

>gb|AY911353.1| Bos taurus clone IMAGE:7961492 ribosomal protein S28 mRNA, complete
           cds
          Length = 333

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 54/64 (84%)
 Strand = Plus / Plus

                                                                       
Query: 196 cccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgggaggccaggaggctg 255
           ||||| || ||||||||| | ||||||||| | ||||| ||||| |||||  ||||||||
Sbjct: 177 cccgtgcgcgagggcgacgtgctcaccctgttggagtcagagcgagaggctcggaggctg 236

               
Query: 256 cgct 259
           ||||
Sbjct: 237 cgct 240



to top

>ref|NM_125810.2| Arabidopsis thaliana RPS28 (RIBOSOMAL PROTEIN S28); structural
           constituent of ribosome AT5G64140 (RPS28) mRNA, complete
           cds
          Length = 480

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 167 accgtctcatcatgaggaacgtcaagggacccgtc 201
           ||||| |||||||||||||||| || |||||||||
Sbjct: 181 accgtttcatcatgaggaacgtgaaaggacccgtc 215



to top

>ref|XM_365049.1| Magnaporthe grisea 70-15 hypothetical protein (MG09894.4) partial
           mRNA
          Length = 207

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 229 gagtctgagcgggaggccaggaggctg 255
           ||||||||||| |||||||||||||||
Sbjct: 175 gagtctgagcgtgaggccaggaggctg 201



to top

>ref|XM_955468.1| Neurospora crassa OR74A hypothetical protein (NCU05599.1) partial
           mRNA
          Length = 207

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcct 218
           ||||||||||| || |||||||||| |||||||||
Sbjct: 130 aacgtcaagggccctgtccgtgaggacgacatcct 164



to top

>ref|XM_325453.1| Neurospora crassa OR74A hypothetical protein (NCU05599.1) partial
           mRNA
          Length = 207

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcct 218
           ||||||||||| || |||||||||| |||||||||
Sbjct: 130 aacgtcaagggccctgtccgtgaggacgacatcct 164



to top

>ref|XM_381438.1| Gibberella zeae PH-1 chromosome 1 hypothetical protein (FG01262.1)
           partial mRNA
          Length = 516

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcct 218
           ||||||||||| || |||||||||| |||||||||
Sbjct: 130 aacgtcaagggcccagtccgtgaggacgacatcct 164



to top

>gb|AY081679.1| Arabidopsis thaliana 40S ribosomal protein S28 (At5g64140) mRNA,
           complete cds
          Length = 266

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 167 accgtctcatcatgaggaacgtcaagggacccgtc 201
           ||||| |||||||||||||||| || |||||||||
Sbjct: 101 accgtttcatcatgaggaacgtgaaaggacccgtc 135



to top

>gb|AY059859.1| Arabidopsis thaliana 40S ribosomal protein S28 (At5g64140;
           MHJ24.12) mRNA, complete cds
          Length = 436

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 167 accgtctcatcatgaggaacgtcaagggacccgtc 201
           ||||| |||||||||||||||| || |||||||||
Sbjct: 169 accgtttcatcatgaggaacgtgaaaggacccgtc 203



to top

>emb|BX833027.1|CNS0A0MP Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL30ZC03 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 420

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 167 accgtctcatcatgaggaacgtcaagggacccgtc 201
           ||||| |||||||||||||||| || |||||||||
Sbjct: 150 accgtttcatcatgaggaacgtgaaaggacccgtc 184



to top

>emb|BX833714.1|CNS0A0F7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL72ZD08 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 430

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 167 accgtctcatcatgaggaacgtcaagggacccgtc 201
           ||||| |||||||||||||||| || |||||||||
Sbjct: 160 accgtttcatcatgaggaacgtgaaaggacccgtc 194



to top

>gb|AF400224.1| Spodoptera frugiperda ribosomal protein S28 mRNA, complete cds
          Length = 405

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 68/83 (81%)
 Strand = Plus / Plus

                                                                       
Query: 175 atcatgaggaacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtct 234
           ||||| ||||| || || ||||| || ||||| || ||||||||||| || || ||||||
Sbjct: 169 atcatcaggaatgtgaaaggaccagtgcgtgatggtgacatcctcacactcctcgagtct 228

                                  
Query: 235 gagcgggaggccaggaggctgcg 257
           ||||| || ||||| || |||||
Sbjct: 229 gagcgtgaagccagaagactgcg 251



to top

>gb|AY087546.1| Arabidopsis thaliana clone 36501 mRNA, complete sequence
          Length = 480

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 167 accgtctcatcatgaggaacgtcaagggacccgtc 201
           ||||| |||||||||||||||| || |||||||||
Sbjct: 182 accgtttcatcatgaggaacgtgaaaggacccgtc 216



to top

>dbj|AB008266.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MHJ24
          Length = 48622

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                
Query: 167   accgtctcatcatgaggaacgtcaagggacccgtc 201
             ||||| |||||||||||||||| || |||||||||
Sbjct: 41029 accgtttcatcatgaggaacgtgaaaggacccgtc 40995



to top

>gb|AY849705.1| Magnaporthe grisea 40S ribosomal protein S28-like protein mRNA,
           complete cds
          Length = 699

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 229 gagtctgagcgggaggccaggaggctg 255
           ||||||||||| |||||||||||||||
Sbjct: 392 gagtctgagcgtgaggccaggaggctg 418



to top

>gb|L09755.1|ATHRP28A Arabidopsis thaliana ribosomal protein S28 mRNA, complete cds
          Length = 463

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 167 accgtctcatcatgaggaacgtcaagggacccgtc 201
           ||||| |||||||||||||||| || |||||||||
Sbjct: 165 accgtttcatcatgaggaacgtgaaaggacccgtc 199



to top

>gb|AC004896.1| Homo sapiens PAC clone RP4-811H12 from 7, complete sequence
          Length = 162215

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 329   actgcttccgtcttttgcctag 350
             ||||||||||||||||||||||
Sbjct: 22585 actgcttccgtcttttgcctag 22564



to top

>gb|AY232136.1| Drosophila yakuba clone yak-ad_CG2998 mRNA sequence
          Length = 174

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 103/130 (79%)
 Strand = Plus / Plus

                                                                       
Query: 95  tgaaggtgatgggccgcacgggctccaggggtcaggtgacccaggtgagagtcaagttcc 154
           |||||||  |||||||||| ||||||  |||||||   || |||||||  ||  ||||||
Sbjct: 32  tgaaggttctgggccgcaccggctcccagggtcagtgtactcaggtgaaggttgagttcc 91

                                                                       
Query: 155 tggatgaccagaaccgtctcatcatgaggaacgtcaagggacccgtccgtgagggcgaca 214
           |||  || |||||||| |  |||||  | ||||| |||||||| || || ||||||||||
Sbjct: 92  tgggcgagcagaaccgccagatcatccgcaacgtgaagggaccagttcgcgagggcgaca 151

                     
Query: 215 tcctcaccct 224
           |||| |||||
Sbjct: 152 tcctgaccct 161



to top

>gb|AY231975.1| Drosophila yakuba clone yak-em_CG2998 mRNA sequence
          Length = 174

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 103/130 (79%)
 Strand = Plus / Plus

                                                                       
Query: 95  tgaaggtgatgggccgcacgggctccaggggtcaggtgacccaggtgagagtcaagttcc 154
           |||||||  |||||||||| ||||||  |||||||   || |||||||  ||  ||||||
Sbjct: 32  tgaaggttctgggccgcaccggctcccagggtcagtgtactcaggtgaaggttgagttcc 91

                                                                       
Query: 155 tggatgaccagaaccgtctcatcatgaggaacgtcaagggacccgtccgtgagggcgaca 214
           |||  || |||||||| |  |||||  | ||||| |||||||| || || ||||||||||
Sbjct: 92  tgggcgagcagaaccgccagatcatccgcaacgtgaagggaccagttcgcgagggcgaca 151

                     
Query: 215 tcctcaccct 224
           |||| |||||
Sbjct: 152 tcctgaccct 161



to top

>dbj|AP007151.1| Aspergillus oryzae RIB40 genomic DNA, SC005
          Length = 4429080

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 58/70 (82%)
 Strand = Plus / Minus

                                                                           
Query: 130     gtgacccaggtgagagtcaagttcctggatgaccagaaccgtctcatcatgaggaacgtc 189
               |||||||||||  | ||| ||||| |||||||||||| ||||  ||||||  | ||||||
Sbjct: 2938472 gtgacccaggtccgtgtcgagttcatggatgaccagagccgttccatcatccgtaacgtc 2938413

                         
Query: 190     aagggacccg 199
               ||||| ||||
Sbjct: 2938412 aagggccccg 2938403



to top

>emb|AJ554098.1|DSI554098 Drosophila simulans CG15527 gene, strain Mz12
          Length = 596

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 61/74 (82%)
 Strand = Plus / Plus

                                                                       
Query: 187 gtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtctgagcgggaggcc 246
           ||||| ||||| || |||| ||||||||||||  | ||||| ||  |||| || ||||||
Sbjct: 386 gtcaaaggacctgttcgtgtgggcgacatcctgtcgctgctggaaactgaacgcgaggcc 445

                         
Query: 247 aggaggctgcgcta 260
           ||||| ||||||||
Sbjct: 446 aggagactgcgcta 459



to top

>gb|AY431390.1| Aedes aegypti ASAP ID: 34581 cytosolic small ribosomal subunit S28
           mRNA sequence
          Length = 448

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 163 cagaaccgtctcatcatgaggaacgtcaagggacccgtccgtgagggcgacatcctcacc 222
           ||||||||||  |||||  | ||||||||||| || || || || ||||||||||| |||
Sbjct: 165 cagaaccgtcagatcatccgcaacgtcaagggcccagttcgcgaaggcgacatcctgacc 224

                
Query: 223 ctgct 227
           |||||
Sbjct: 225 ctgct 229



to top

>gb|DQ440266.1| Aedes aegypti clone AET-3303 ribosomal protein S28E mRNA, complete
           cds
          Length = 198

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 163 cagaaccgtctcatcatgaggaacgtcaagggacccgtccgtgagggcgacatcctcacc 222
           ||||||||||  |||||  | ||||||||||| || || || || ||||||||||| |||
Sbjct: 100 cagaaccgtcagatcatccgcaacgtcaagggcccagttcgcgaaggcgacatcctgacc 159

                
Query: 223 ctgct 227
           |||||
Sbjct: 160 ctgct 164



to top

>emb|AL590822.36| Human DNA sequence from clone RP11-181G12 on chromosome 1 Contains the
             3' end of the PRKCZ gene for protein kinase C zeta, a
             novel gene, a novel gene (FLJ31031), the SKI gene for
             v-ski sarcoma viral oncogene homolog (avian) and five CpG
             islands, complete sequence
          Length = 179836

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 86    cagtggtggtgaaggtgatgg 106
             |||||||||||||||||||||
Sbjct: 14490 cagtggtggtgaaggtgatgg 14510



to top

>emb|AL359643.27| Human DNA sequence from clone RP11-428J1 on chromosome 6 Contains the
             CDYL gene for a Y chromosome-like chromodomain protein, a
             ribosomal protein S18 (RPS18) pseudogene, the gene for
             ribonuclease P 40kD subunit (RPP40) and CpG islands,
             complete sequence
          Length = 166863

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 170   gtctcatcatgaggaacgtca 190
             |||||||||||||||||||||
Sbjct: 50946 gtctcatcatgaggaacgtca 50966



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 170      gtctcatcatgaggaacgtcaaggg 194
                ||||||||||||| |||||||||||
Sbjct: 16428210 gtctcatcatgagaaacgtcaaggg 16428186



to top

>dbj|AP004613.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:OJ1123_G09
          Length = 107491

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 170   gtctcatcatgaggaacgtcaaggg 194
             ||||||||||||| |||||||||||
Sbjct: 35807 gtctcatcatgagaaacgtcaaggg 35783



to top

>gb|AY443099.2| Haloarcula sp. AS7094 plasmid pSCM201, complete sequence
          Length = 3463

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 306  gctgttgccttcgtactctatatactgct 334
            |||||||||||||||||||| | ||||||
Sbjct: 2514 gctgttgccttcgtactctacaaactgct 2542



to top

>emb|AL604025.15| Mouse DNA sequence from clone RP23-455K6 on chromosome 11, complete
              sequence
          Length = 151207

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 71     ctcaggtgaagcttgcagtgg 91
              |||||||||||||||||||||
Sbjct: 121718 ctcaggtgaagcttgcagtgg 121698



to top

>ref|NM_111844.3| Arabidopsis thaliana structural constituent of ribosome AT3G10090
           mRNA, complete cds
          Length = 440

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 50/60 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 catcatgaggaacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtc 233
           ||||||||||||||| || ||||| ||| | ||||| || || |||||| |||| |||||
Sbjct: 203 catcatgaggaacgttaaaggacctgtcagagagggagatattctcaccttgctggagtc 262



to top

>gb|AC144926.6| Mus musculus chromosome 8, clone RP23-8E24, complete sequence
          Length = 214694

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 340    cttttgcctaggctatggagattt 363
              |||||||||||||||||| |||||
Sbjct: 140962 cttttgcctaggctatggggattt 140939



to top

>ref|XM_954446.1| Neurospora crassa OR74A hypothetical protein (NCU02411.1) partial
            mRNA
          Length = 4476

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 87   agtggtggtgaaggtgatgg 106
            ||||||||||||||||||||
Sbjct: 4324 agtggtggtgaaggtgatgg 4343



to top

>gb|AC106595.9| Rattus norvegicus 7 BAC CH230-237N20 (Children's Hospital Oakland
              Research Institute) complete sequence
          Length = 214961

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 266    tttctttactgtctgtctgtcttg 289
              ||||| ||||||||||||||||||
Sbjct: 149542 tttctgtactgtctgtctgtcttg 149519



to top

>ref|XM_331186.1| Neurospora crassa OR74A hypothetical protein (NCU02411.1) partial
            mRNA
          Length = 4476

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 87   agtggtggtgaaggtgatgg 106
            ||||||||||||||||||||
Sbjct: 4324 agtggtggtgaaggtgatgg 4343



to top

>gb|AC156554.13| Mus musculus chromosome 8, clone RP23-15O21, complete sequence
          Length = 221400

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 340  cttttgcctaggctatggagattt 363
            |||||||||||||||||| |||||
Sbjct: 5379 cttttgcctaggctatggggattt 5356



to top

>gb|BT011253.1| Arabidopsis thaliana At3g10090 gene, complete cds
          Length = 195

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 50/60 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 catcatgaggaacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtc 233
           ||||||||||||||| || ||||| ||| | ||||| || || |||||| |||| |||||
Sbjct: 108 catcatgaggaacgttaaaggacctgtcagagagggagatattctcaccttgctggagtc 167



to top

>gb|AC140212.2| Mus musculus BAC clone RP23-267G14 from chromosome 15, complete
             sequence
          Length = 177379

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 260   aagaagtttctttactgtct 279
             ||||||||||||||||||||
Sbjct: 88041 aagaagtttctttactgtct 88060



to top

>gb|BT010782.1| Arabidopsis thaliana At3g10090 mRNA, complete cds
          Length = 381

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 50/60 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 catcatgaggaacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtc 233
           ||||||||||||||| || ||||| ||| | ||||| || || |||||| |||| |||||
Sbjct: 196 catcatgaggaacgttaaaggacctgtcagagagggagatattctcaccttgctggagtc 255



to top

>ref|XM_538458.2| PREDICTED: Canis familiaris similar to DNA repair protein REV1
           (Rev1-like terminal deoxycytidyl transferase) (Alpha
           integrin binding protein 80) (AIBP80) (LOC481337), mRNA
          Length = 4809

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 235 gagcgggaggccaggaggctgcgc 258
           |||||||||||||| |||||||||
Sbjct: 510 gagcgggaggccagcaggctgcgc 533



to top

>gb|AC010927.5|ATAC010927 Arabidopsis thaliana chromosome III BAC T22K18 genomic sequence,
             complete sequence
          Length = 96232

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 50/60 (83%)
 Strand = Plus / Plus

                                                                         
Query: 174   catcatgaggaacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtc 233
             ||||||||||||||| || ||||| ||| | ||||| || || |||||| |||| |||||
Sbjct: 34490 catcatgaggaacgttaaaggacctgtcagagagggagatattctcaccttgctggagtc 34549



to top

>emb|CR734767.2|CNS0GTQ6 Tetraodon nigroviridis full-length cDNA
          Length = 312

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 68/84 (80%)
 Strand = Plus / Plus

                                                                       
Query: 174 catcatgaggaacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtc 233
           |||||| |||||||| ||||| |||||| | ||||| ||| | || || || || |||| 
Sbjct: 143 catcatcaggaacgtgaagggccccgtcagagagggagacgtgctgacgcttctggagtt 202

                                   
Query: 234 tgagcgggaggccaggaggctgcg 257
           |||| | || ||||||||||||||
Sbjct: 203 tgagagagaagccaggaggctgcg 226



to top

>emb|CR749176.14| Zebrafish DNA sequence from clone DKEY-43B13 in linkage group 19,
             complete sequence
          Length = 237649

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 359   gatttaatgagttttcttgt 378
             ||||||||||||||||||||
Sbjct: 77002 gatttaatgagttttcttgt 77021



to top

>ref|XM_793349.1| PREDICTED: Strongylocentrotus purpuratus similar to transcriptional
           adaptor 3-like (LOC593894), mRNA
          Length = 601

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 121 aggggtcaggtgacccaggt 140
           ||||||||||||||||||||
Sbjct: 527 aggggtcaggtgacccaggt 508



to top

>emb|AL359831.9| Human DNA sequence from clone RP11-251L4 on chromosome 13, complete
             sequence
          Length = 65321

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 277   tctgtctgtcttgggaagta 296
             ||||||||||||||||||||
Sbjct: 57060 tctgtctgtcttgggaagta 57041



to top

>emb|AL358074.22| Human DNA sequence from clone RP11-423C15 on chromosome 9 Contains the
             5' end of the MAPKAP1 gene for mitogen-activated protein
             kinase associated protein 1, a novel gene, the 5' end of
             the PBX3 gene for pre-B-cell leukemia transcription factor
             3 and three CpG islands, complete sequence
          Length = 109081

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 33/36 (91%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                 
Query: 9     gagggcagcttgcgccgccgcctccgtcctccgcca 44
             |||||||||  ||||||||||||||| |||||||||
Sbjct: 65574 gagggcagcgggcgccgccgcctccg-cctccgcca 65608



to top

>emb|AL354828.12| Human DNA sequence from clone RP11-274P12 on chromosome 13 Contains a
             ferritin heavy polypeptide 1 (FTH1) pseudogene and a
             DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 39 (DDX39)
             (DDXL, MGC8471, MGC8203) pseudogene, complete sequence
          Length = 168114

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 88    gtggtggtgaaggtgatggg 107
             ||||||||||||||||||||
Sbjct: 82988 gtggtggtgaaggtgatggg 82969



to top

>emb|AL133257.17| Human DNA sequence from clone RP1-166D18 on chromosome 6q22.1-22.33
             Contains part of the TRDN gene for triadin (TDN, TRIADIN),
             complete sequence
          Length = 130748

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 83    ttgcagtggtggtgaaggtg 102
             ||||||||||||||||||||
Sbjct: 21374 ttgcagtggtggtgaaggtg 21355



to top

>gb|AC125503.3| Oryctolagus cuniculus clone LB1-115H21, complete sequence
          Length = 176296

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 397    cacttgatgttgtgagactt 416
              ||||||||||||||||||||
Sbjct: 152719 cacttgatgttgtgagactt 152738



to top

>ref|XM_794087.1| PREDICTED: Strongylocentrotus purpuratus similar to Transcriptional
            adapter 3-like (ADA3-like protein) (ADA3 homolog) (hADA3)
            (LOC594653), mRNA
          Length = 1453

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 121  aggggtcaggtgacccaggt 140
            ||||||||||||||||||||
Sbjct: 1379 aggggtcaggtgacccaggt 1360



to top

>emb|BX640548.14| Zebrafish DNA sequence from clone CH211-198E12 in linkage group 11,
              complete sequence
          Length = 231587

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 359    gatttaatgagttttcttgt 378
              ||||||||||||||||||||
Sbjct: 226584 gatttaatgagttttcttgt 226565



to top

>gb|AC163654.2| Mus musculus BAC clone RP23-259M14 from chromosome 16, complete sequence
          Length = 159273

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 265    gtttctttactgtctgtctgtctt 288
              |||||||| |||||||||||||||
Sbjct: 111232 gtttcttttctgtctgtctgtctt 111255



to top

>gb|AC100800.2| Homo sapiens chromosome 8, clone RP11-161I2, complete sequence
          Length = 196849

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 281    tctgtcttgggaagtaaaatgctg 304
              |||| |||||||||||||||||||
Sbjct: 156316 tctgccttgggaagtaaaatgctg 156293



to top

>gb|AC090420.6| Homo sapiens chromosome 8, clone RP11-346L6, complete sequence
          Length = 216706

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 281   tctgtcttgggaagtaaaatgctg 304
             |||| |||||||||||||||||||
Sbjct: 95444 tctgccttgggaagtaaaatgctg 95421



to top

>gb|DP000006.1| Oryctolagus cuniculus target 1 genomic scaffold
          Length = 1889755

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 397     cacttgatgttgtgagactt 416
               ||||||||||||||||||||
Sbjct: 1582164 cacttgatgttgtgagactt 1582183



to top

>gb|AC026779.5| Homo sapiens chromosome 5 clone CTC-430I8, complete sequence
          Length = 117213

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 354   atggagatttaatgagtttt 373
             ||||||||||||||||||||
Sbjct: 36647 atggagatttaatgagtttt 36628



to top

>emb|AL116032.1|CNS01CVC Botrytis cinerea strain T4 cDNA library
          Length = 300

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctc 219
           ||||||||||| || |||||||| | ||||||||||
Sbjct: 123 aacgtcaagggcccagtccgtgaagacgacatcctc 158



to top

>emb|AL115331.1|CNS01CBV Botrytis cinerea strain T4 cDNA library
          Length = 579

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctc 219
           ||||||||||| || |||||||| | ||||||||||
Sbjct: 192 aacgtcaagggcccagtccgtgaagacgacatcctc 227



to top

>emb|AL114930.1|CNS01C0Q Botrytis cinerea strain T4 cDNA library
          Length = 350

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctc 219
           ||||||||||| || |||||||| | ||||||||||
Sbjct: 173 aacgtcaagggcccagtccgtgaagacgacatcctc 208



to top

>emb|AL114877.1|CNS01BZ9 Botrytis cinerea strain T4 cDNA library
          Length = 420

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctc 219
           ||||||||||| || |||||||| | ||||||||||
Sbjct: 173 aacgtcaagggcccagtccgtgaagacgacatcctc 208



to top

>emb|AL114703.1|CNS01BUF Botrytis cinerea strain T4 cDNA library
          Length = 396

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctc 219
           ||||||||||| || |||||||| | ||||||||||
Sbjct: 162 aacgtcaagggcccagtccgtgaagacgacatcctc 197



to top

>emb|AL114380.1|CNS01BLG Botrytis cinerea strain T4 cDNA library
          Length = 360

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctc 219
           ||||||||||| || |||||||| | ||||||||||
Sbjct: 171 aacgtcaagggcccagtccgtgaagacgacatcctc 206



to top

>emb|AL112446.1|CNS01A3Q Botrytis cinerea strain T4 cDNA library
          Length = 420

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctc 219
           ||||||||||| || |||||||| | ||||||||||
Sbjct: 219 aacgtcaagggcccagtccgtgaagacgacatcctc 254



to top

>emb|AL112026.1|CNS019S2 Botrytis cinerea strain T4 cDNA library
          Length = 420

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctc 219
           ||||||||||| || |||||||| | ||||||||||
Sbjct: 194 aacgtcaagggcccagtccgtgaagacgacatcctc 229



to top

>emb|AL110780.1|CNS018TH Botrytis cinerea strain T4 cDNA library
          Length = 720

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctc 219
           ||||||||||| || |||||||| | ||||||||||
Sbjct: 190 aacgtcaagggcccagtccgtgaagacgacatcctc 225



to top

>emb|AL110956.1|CNS018YD Botrytis cinerea strain T4 cDNA library
          Length = 720

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 184 aacgtcaagggacccgtccgtgagggcgacatcctc 219
           ||||||||||| || |||||||| | ||||||||||
Sbjct: 188 aacgtcaagggcccagtccgtgaagacgacatcctc 223



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 317      cgtactctatatactgcttc 336
                ||||||||||||||||||||
Sbjct: 24140295 cgtactctatatactgcttc 24140276



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
               sequence
          Length = 29737217

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 20      gcgccgccgcctccgtcctccgcc 43
               |||||||||||||| |||||||||
Sbjct: 4879638 gcgccgccgcctccctcctccgcc 4879615



to top

>emb|BX826230.1|CNS0A6FW Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL92ZG09 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 347

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 50/60 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 catcatgaggaacgtcaagggacccgtccgtgagggcgacatcctcaccctgcttgagtc 233
           ||||||||||||||| || ||||| ||| | ||||| || || |||||| |||| |||||
Sbjct: 109 catcatgaggaacgttaaaggacctgtcagagagggagatattctcaccttgctggagtc 168



to top

>gb|AC122152.3| Oryctolagus cuniculus clone LB1-297M16, complete sequence
          Length = 189392

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 397   cacttgatgttgtgagactt 416
             ||||||||||||||||||||
Sbjct: 33961 cacttgatgttgtgagactt 33980



to top

>gb|AC012449.7| Homo sapiens BAC clone RP11-321K13 from 2, complete sequence
          Length = 109335

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 84    tgcagtggtggtgaaggtga 103
             ||||||||||||||||||||
Sbjct: 74928 tgcagtggtggtgaaggtga 74947



to top

>gb|AC008482.5|AC008482 Homo sapiens chromosome 5 clone CTC-402A15, complete sequence
          Length = 172004

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 354   atggagatttaatgagtttt 373
             ||||||||||||||||||||
Sbjct: 66672 atggagatttaatgagtttt 66691



to top

>dbj|BA000019.2| Nostoc sp. PCC 7120 DNA, complete genome
          Length = 6413771

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 457     ttggattctatgatttgggt 476
               ||||||||||||||||||||
Sbjct: 1469625 ttggattctatgatttgggt 1469644



to top

>dbj|AP003846.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1710_H11
          Length = 136107

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 317   cgtactctatatactgcttc 336
             ||||||||||||||||||||
Sbjct: 73710 cgtactctatatactgcttc 73691



to top

>emb|BX088724.6| Zebrafish DNA sequence from clone DKEY-15G22, complete sequence
          Length = 198368

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 274   ctgtctgtctgtcttgggaa 293
             ||||||||||||||||||||
Sbjct: 60328 ctgtctgtctgtcttgggaa 60309



to top

>dbj|AB012248.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MXI22
          Length = 80115

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 354   atggagatttaatgagtttt 373
             ||||||||||||||||||||
Sbjct: 16969 atggagatttaatgagtttt 16988



to top

>emb|AJ277600.1|QSU277600 Quercus suber mRNA for small subunit ribosomal protein (rps gene)
          Length = 362

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 73/88 (82%), Gaps = 2/88 (2%)
 Strand = Plus / Plus

                                                                       
Query: 71  ctcaggtgaagcttgcagtggtggtgaaggtgatgggccgcacgggctccaggggtcagg 130
           ||||||||||||  ||||| |||||||| || ||||| || || || || || |||||||
Sbjct: 91  ctcaggtgaagcacgcagtcgtggtgaaagttatgggtcggactggatc-agaggtcagg 149

                                       
Query: 131 -tgacccaggtgagagtcaagttcctgg 157
            |||| ||||| ||||||||||| ||||
Sbjct: 150 gtgactcaggtcagagtcaagtttctgg 177



to top

>dbj|AP003031.3| Homo sapiens genomic DNA, chromosome 11q clone:RP11-535A19, complete
             sequences
          Length = 95585

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 372   ttcttgtgttgtctgaattaaagt 395
             |||||||||||| |||||||||||
Sbjct: 71216 ttcttgtgttgtttgaattaaagt 71193



to top

>gb|AC135425.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0453H11,
              complete sequence
          Length = 187956

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 20     gcgccgccgcctccgtcctccgcc 43
              |||||||||||||| |||||||||
Sbjct: 152046 gcgccgccgcctccctcctccgcc 152023


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,969,345
Number of Sequences: 3902068
Number of extensions: 4969345
Number of successful extensions: 293863
Number of sequences better than 10.0: 177
Number of HSP's better than 10.0 without gapping: 174
Number of HSP's successfully gapped in prelim test: 3
Number of HSP's that attempted gapping in prelim test: 293193
Number of HSP's gapped (non-prelim): 666
length of query: 511
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 488
effective length of database: 17,143,297,704
effective search space: 8365929279552
effective search space used: 8365929279552
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top