ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name basd11d23
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|X56136.1|HVASPROT Barley mRNA for aspartic proteinase 1084 0.0
2dbj|AB219968.1| Triticum aestivum WAP1 mRNA for aspartic protein... 910 0.0
3dbj|AK104838.1| Oryza sativa (japonica cultivar-group) cDNA clon... 480 e-132
4dbj|AK103421.1| Oryza sativa (japonica cultivar-group) cDNA clon... 480 e-132
5dbj|AK100749.1| Oryza sativa (japonica cultivar-group) cDNA clon... 480 e-132
6dbj|AK098911.1| Oryza sativa (japonica cultivar-group) cDNA clon... 480 e-132
7dbj|AK098906.1| Oryza sativa (japonica cultivar-group) cDNA clon... 480 e-132
8dbj|AK067742.1| Oryza sativa (japonica cultivar-group) cDNA clon... 480 e-132
9dbj|AK066453.1| Oryza sativa (japonica cultivar-group) cDNA clon... 472 e-130
10dbj|D32144.1|RICAPA Rice mRNA for aspartic protease, complete cds 472 e-130
11gb|AY112455.1| Zea mays CL6331_1 mRNA sequence 313 3e-82
12gb|BT017963.1| Zea mays clone EL01N0523D02.c mRNA sequence 293 3e-76
13ref|NM_192504.1| Oryza sativa (japonica cultivar-group), predic... 246 7e-62
14dbj|AK072283.1| Oryza sativa (japonica cultivar-group) cDNA clon... 246 7e-62
15dbj|AK072645.1| Oryza sativa (japonica cultivar-group) cDNA clon... 238 2e-59
16gb|AF285164.1| Oryza sativa subsp. japonica aspartic protease mR... 236 6e-59
17gb|AC120986.2| Oryza sativa (japonica cultivar-group) chromosome... 151 3e-33
18dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 151 3e-33
19dbj|D32165.1|RICAP Rice gene for aspartic protease, complete cds 151 3e-33
20dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 119 1e-23
21dbj|AP003284.3| Oryza sativa (japonica cultivar-group) genomic D... 119 1e-23
22dbj|AB002695.1| Pumpkin mRNA for aspartic endopeptidase, complet... 98 4e-17
23emb|AJ313385.1|TCA313385 Theobroma cacao mRNA for aspartic prote... 94 6e-16
24gb|BT013775.1| Lycopersicon esculentum clone 132663F, mRNA sequence 68 3e-08
25emb|Y09123.1|CCY09123 C.calcitrapa mRNA for aspartic proteinase 68 3e-08
26emb|AJ313384.1|TCA313384 Theobroma cacao mRNA for aspartic prote... 68 3e-08
27gb|AF287258.1| Vigna unguiculata aspartic proteinase gene, compl... 66 1e-07
28gb|L46681.1|TOMAPP Lycopersicon esculentum aspartic protease pre... 66 1e-07
29gb|AY792822.1| Sus scrofa cathepsin D protein mRNA, partial cds 64 5e-07
30dbj|AB219969.1| Triticum aestivum WAP2 mRNA for aspartic protein... 64 5e-07
31gb|DQ018729.1|DQ018728S2 Sus scrofa cathepsin D (CTSD) gene, exo... 64 5e-07
32gb|DQ018727.1| Sus scrofa cathepsin D mRNA, complete cds 64 5e-07
33ref|NM_001037721.1| Sus scrofa cathepsin D (CTSD), mRNA 64 5e-07
34dbj|AB045892.1| Nepenthes alata NaAP2 mRNA for aspartic proteina... 64 5e-07
35ref|NM_205177.1| Gallus gallus cathepsin D (lysosomal aspartyl p... 62 2e-06
36gb|BT020155.1| Homo sapiens cathepsin D (lysosomal aspartyl prot... 62 2e-06
37ref|NM_001909.3| Homo sapiens cathepsin D (lysosomal aspartyl pe... 62 2e-06
38gb|BC001574.1| Homo sapiens cathepsin D (lysosomal aspartyl pept... 62 2e-06
39gb|BC016320.2| Homo sapiens cathepsin D (lysosomal aspartyl pept... 62 2e-06
40emb|X05344.1|HSCATDC Human mRNA for cathepsin D from oestrogen r... 62 2e-06
41emb|CR456947.1| Homo sapiens full open reading frame cDNA clone ... 62 2e-06
42gb|BT007637.1| Synthetic construct Homo sapiens cathepsin D (lys... 62 2e-06
43gb|BT006910.1| Homo sapiens cathepsin D (lysosomal aspartyl prot... 62 2e-06
44emb|CR858646.1| Pongo pygmaeus mRNA; cDNA DKFZp469J0315 (from cl... 62 2e-06
45emb|CR623521.1| full-length cDNA clone CS0DI064YA16 of Placenta ... 62 2e-06
46emb|CR613410.1| full-length cDNA clone CS0DE003YB18 of Placenta ... 62 2e-06
47emb|CR612133.1| full-length cDNA clone CS0DF002YC21 of Fetal bra... 62 2e-06
48emb|CR609839.1| full-length cDNA clone CS0DI057YH09 of Placenta ... 62 2e-06
49emb|CR597228.1| full-length cDNA clone CS0DN004YA05 of Adult bra... 62 2e-06
50gb|U61396.2| Vigna unguiculata aspartic proteinase mRNA, complet... 62 2e-06
51dbj|AB169854.1| Macaca fascicularis brain cDNA, clone: QccE-1124... 62 2e-06
52gb|S49650.1| prepro-cathepsin D [chickens, follicles, mRNA, 1448... 62 2e-06
53ref|NM_213873.1| Sus scrofa pepsin (LOC396892), mRNA 62 2e-06
54gb|AC068580.23| Homo sapiens chromosome 11, clone RP11-295K3, co... 62 2e-06
55gb|AY892734.1| Synthetic construct Homo sapiens clone FLH024310.... 62 2e-06
56gb|AY890251.1| Synthetic construct Homo sapiens clone FLH024315.... 62 2e-06
57gb|AY890417.1| Synthetic construct Homo sapiens clone FLH031241.... 62 2e-06
58gb|AY888315.1| Synthetic construct Homo sapiens clone FLH008539.... 62 2e-06
59dbj|AK130178.1| Homo sapiens cDNA FLJ26668 fis, clone MPG03026, ... 62 2e-06
60gb|AY893487.1| Synthetic construct Homo sapiens clone FLH127809.... 62 2e-06
61gb|AY892880.1| Synthetic construct Homo sapiens clone FLH031237.... 62 2e-06
62gb|AC160647.1| Gallus gallus BAC clone CH261-14N23 from chromoso... 62 2e-06
63gb|M11233.1|HUMCTHD Human cathepsin D mRNA, complete cds 62 2e-06
64gb|M63138.1|HUMCATD5 Human cathepsin D (catD) gene, exons 7, 8, ... 62 2e-06
65gb|J04601.1|PIGPEPA Pig pepsinogen A mRNA, complete cds 62 2e-06
66gb|M20920.1|PIGPEP Swine pepsinogen A mRNA, complete cds 62 2e-06
67ref|NM_001025621.1| Canis familiaris cathepsin D (lysosomal aspa... 60 8e-06
68ref|XM_863994.1| PREDICTED: Bos taurus cathepsin D (lysosomal as... 60 8e-06
69ref|XM_609913.2| PREDICTED: Bos taurus cathepsin D (lysosomal as... 60 8e-06
70ref|XM_871709.1| PREDICTED: Bos taurus cathepsin D (lysosomal as... 60 8e-06
71ref|XM_871611.1| PREDICTED: Bos taurus cathepsin D (lysosomal as... 60 8e-06
72ref|XM_871531.1| PREDICTED: Bos taurus cathepsin D (lysosomal as... 60 8e-06
73emb|AM048627.1| Canis familiaris mRNA for cathepsin D (ctsd gene) 60 8e-06
74dbj|AB055312.1| Bos taurus cat-D mRNA for cathepsin D, partial cds 60 8e-06
75ref|NM_101062.2| Arabidopsis thaliana aspartic-type endopeptidas... 58 3e-05
76gb|AY063974.1| Arabidopsis thaliana putative aspartic proteinase... 58 3e-05
77gb|AY056403.1| Arabidopsis thaliana At1g11910/F12F1_24 mRNA, com... 58 3e-05
78gb|AY056387.1| Arabidopsis thaliana At1g11910/F12F1_24 mRNA, com... 58 3e-05
79dbj|AK221098.1| Arabidopsis thaliana mRNA for putative aspartic ... 58 3e-05
80dbj|AK221202.1| Arabidopsis thaliana mRNA for putative aspartic ... 58 3e-05
81gb|AY088657.1| Arabidopsis thaliana clone 8972 mRNA, complete se... 58 3e-05
82gb|BT001980.1| Arabidopsis thaliana clone U11602 putative aspart... 58 3e-05
83gb|U51036.1|ATU51036 Arabidopsis thaliana aspartic proteinase mR... 58 3e-05
84gb|AY672651.1| Solanum tuberosum Asp mRNA, complete cds 58 3e-05
85gb|DQ241852.1| Solanum tuberosum clone 188C11 aspartic protease ... 58 3e-05
86emb|CR662614.2|CNS0FA8S Tetraodon nigroviridis full-length cDNA 56 1e-04
87emb|CR660862.2|CNS0F8W4 Tetraodon nigroviridis full-length cDNA 56 1e-04
88emb|X88774.1|BORNAPAP B.oleracea mRNA for putative aspartic prot... 56 1e-04
89dbj|AB091762.1| Glycine max soyAP4 mRNA for aspartic proteinase ... 56 1e-04
90gb|AF082029.1|AF082029 Hemerocallis hybrid cultivar senescence-a... 56 1e-04
91gb|AY389666.1| Hyacinthus orientalis aspartic proteinase mRNA, p... 54 5e-04
92emb|X77260.1|BOASPR B. oleracea L. gene for aspartic protease (p... 54 5e-04
93dbj|AB045891.1| Nepenthes alata NaAP1 mRNA for aspartic proteina... 54 5e-04
94gb|AF156788.1| Pleuronectes americanus pepsinogen A form IIb pre... 52 0.002
95dbj|AB120129.1| Paralichthys olivaceus pep mRNA for pepsinogen, ... 52 0.002
96emb|X81984.1|CCCYPRSN C.cardunculus mRNA for cyprosin 50 0.008
97gb|AY103665.1| Zea mays PCO108960 mRNA sequence 50 0.008
98dbj|AB025359.2| Helianthus annuus mRNA for aspartic proteinase, ... 50 0.008
99gb|AY826351.2| Fagopyrum esculentum aspartic proteinase 9 mRNA, ... 48 0.031
100emb|X69193.1|VCCYNA V.cardunculus mRNA for cynarase 48 0.031
101gb|AC169788.4| Medicago truncatula clone mth2-28c18, complete se... 48 0.031
102gb|AC134967.20| Medicago truncatula clone mth2-26b8, complete se... 48 0.031
103dbj|AB069959.1| Glycine max soyAP1 mRNA for aspartic proteinase ... 48 0.031
104emb|AJ550951.1|TBE550951 Trematomus bernacchii mRNA for pepsin A3 46 0.12
105emb|AJ131678.1|CDR131678 Camelus dromedarius mRNA for pepsin 46 0.12
106dbj|AB089792.1| Oryctolagus cuniculus mRNA for pepsinogen III, c... 46 0.12
107dbj|AB089791.1| Oryctolagus cuniculus mRNA for pepsinogen II-4, ... 46 0.12
108dbj|AB089790.1| Oryctolagus cuniculus mRNA for pepsinogen II-1, ... 46 0.12
109gb|M59237.1|RABPEPIII Rabbit pepsinogen III mRNA, complete cds 46 0.12
110gb|M59235.1|RABPEPII23 Rabbit pepsinogen 11-2/3 mRNA, complete cds 46 0.12
111dbj|AB047245.1| Rhinolophus ferrumequinum pgnA mRNA for pepsinog... 46 0.12
112dbj|AB047244.1| Sorex unguiculatus pgnA mRNA for pepsinogen A, c... 46 0.12
113ref|XM_475576.1| Oryza sativa (japonica cultivar-group), predic... 44 0.48
114gb|BT018637.1| Zea mays clone EL01N0504C03.d mRNA sequence 44 0.48
115ref|XM_545694.2| PREDICTED: Canis familiaris similar to cathepsi... 44 0.48
116gb|AC161241.18| Medicago truncatula clone mth2-193c3, complete s... 44 0.48
117emb|AL450337.24| Human DNA sequence from clone RP11-51B10 on chr... 44 0.48
118emb|AJ579366.1|CRE579366 Chlamydomonas reinhardtii mRNA for aspa... 44 0.48
119emb|AJ550949.2|TBE550949 Trematomus bernacchii mRNA for pepsin A1 44 0.48
120emb|AJ550950.1|TBE550950 Trematomus bernacchii partial mRNA for ... 44 0.48
121ref|NM_205054.1| Gallus gallus pepsinogen (LOC395926), mRNA 44 0.48
122gb|AF164143.1|AF164143 Ovis aries cathepsin D (CTSD) mRNA, parti... 44 0.48
123dbj|AK065206.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.48
124gb|AY103982.1| Zea mays PCO140262 mRNA sequence 44 0.48
125dbj|D12777.1|RICASPPRO Oryza sativa (japonica cultivar-group) mR... 44 0.48
126dbj|D00215.1|CHKPSN Gallus gallus mRNA for pepsinogen, complete cds 44 0.48
127dbj|AB045893.1| Nepenthes alata NaAP3 mRNA for aspartic proteina... 44 0.48
128dbj|AB028888.1| Oryza sativa RAP mRNA for aspartic proteinase, p... 44 0.48
129dbj|AB047243.1| Suncus murinus pgnA mRNA for pepsinogen A, compl... 44 0.48
130ref|NM_116684.3| Arabidopsis thaliana aspartic-type endopeptidas... 42 1.9
131ref|XM_657624.1| Aspergillus nidulans FGSC A4 hypothetical prote... 42 1.9
132emb|AL365502.57| Human DNA sequence from clone RP11-48C7 on chro... 42 1.9
133emb|AL118509.9|HSJ770C23 Human DNA sequence from clone RP4-770C2... 42 1.9
134emb|AJ009838.1|PSI9838 Podarcis sicula mRNA for ovarian Cathepsin D 42 1.9
135emb|AL832856.1|HSM804167 Homo sapiens mRNA; cDNA DKFZp667P1625 (... 42 1.9
136dbj|AK221179.1| Arabidopsis thaliana mRNA for putative aspartic ... 42 1.9
137gb|AF372974.1|AF372974 Arabidopsis thaliana AT4g04460/T26N6_7 mR... 42 1.9
138emb|BX827174.1|CNS0A2UE Arabidopsis thaliana Full-length cDNA Co... 42 1.9
139emb|BX829292.1|CNS0A2OQ Arabidopsis thaliana Full-length cDNA Co... 42 1.9
140dbj|AK024443.1| Homo sapiens mRNA for FLJ00033 protein, partial cds 42 1.9
141gb|AY961419.1| Phytophthora infestans clone PB005D3 aspartic pro... 42 1.9
142gb|AE016877.1| Bacillus cereus ATCC 14579, complete genome 42 1.9
143gb|AF036319.1|AF036319 Sparus aurata cathepsin D mRNA, complete cds 42 1.9
144dbj|AB021787.1| Pyrus pyrifolia PPFRU11 mRNA for aspartic endope... 42 1.9
145gb|AC005105.3| Homo sapiens BAC clone CTA-491N20 from 7, complet... 40 7.5
146emb|CT009567.9| Mouse DNA sequence from clone RP23-50H13 on chro... 40 7.5
147gb|AC161500.4| Mus musculus chromosome 7, clone RP23-145H5, comp... 40 7.5
148emb|AL359641.10| Human DNA sequence from clone RP11-402K9 on chr... 40 7.5
149emb|AL110503.2|HSJ1100I6 Human DNA sequence from clone RP5-1100I... 40 7.5
150gb|AC092211.7| Oryza sativa chromosome 10 P0031G09 genomic sequ... 40 7.5
151gb|AC091953.3| Homo sapiens chromosome 5 clone RP11-417J1, compl... 40 7.5
152gb|AC110785.2| Homo sapiens BAC clone RP11-455I7 from 4, complet... 40 7.5
153gb|AC027328.4| Homo sapiens chromosome 5 clone CTD-2136J7, compl... 40 7.5
154gb|AF259982.1|AF259982 Ipomoea batatas putative aspartic proteas... 40 7.5
155ref|XM_397192.2| PREDICTED: Apis mellifera similar to ENSANGP000... 40 7.5
156dbj|AB080684.1| Xenopus laevis CE1 mRNA for cathepsin E1, comple... 40 7.5
157dbj|AB179551.1| Takifugu rubripes NTS mRNA for nothepsin, comple... 40 7.5
158dbj|AB179548.1| Takifugu rubripes CTSD1 mRNA for cathepsin D1, c... 40 7.5
159gb|AC002087.1|HSAC002087 Human BAC clone GS1-113D4 from 5p15.2, ... 40 7.5
160gb|AC138272.11| Mus musculus chromosome 7, clone RP23-91H13, com... 40 7.5
161gb|AC002131.1|F12F1 Arabidopsis thaliana chromosome 1 BAC F12F1 ... 40 7.5
162gb|U55032.1|BNU55032 Brassica napus aspartic protease gene, comp... 40 7.5
163gb|AC093490.2| Oryza sativa (japonica cultivar-group) chromosome... 40 7.5

>emb|X56136.1|HVASPROT Barley mRNA for aspartic proteinase
          Length = 1800

 Score = 1084 bits (547), Expect = 0.0
 Identities = 554/555 (99%), Gaps = 1/555 (0%)
 Strand = Plus / Plus

                                                                        
Query: 2    aattgtttctcaatatggacaacagnatcctcgacctgttgctagcagagacacagccca 61
            ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 998  aattgtttctcaatatggacaacag-atcctcgacctgttgctagcagagacacagccca 1056

                                                                        
Query: 62   aaaagatctgctcccaggttggtctgtgcacctttgatgggactcgtggtgttagtgccg 121
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1057 aaaagatctgctcccaggttggtctgtgcacctttgatgggactcgtggtgttagtgccg 1116

                                                                        
Query: 122  gaattcggagcgtggtcgatgatgaacctgtgaaatcaaatggcctccgtgccgatccca 181
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1117 gaattcggagcgtggtcgatgatgaacctgtgaaatcaaatggcctccgtgccgatccca 1176

                                                                        
Query: 182  tgtgcagtgcctgtgagatggctgttgtatggatgcagaaccaacttgcacagaacaaga 241
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1177 tgtgcagtgcctgtgagatggctgttgtatggatgcagaaccaacttgcacagaacaaga 1236

                                                                        
Query: 242  cccaggatctcatactagattacgttaaccagctgtgcaaccgtctcccaagtcccatgg 301
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1237 cccaggatctcatactagattacgttaaccagctgtgcaaccgtctcccaagtcccatgg 1296

                                                                        
Query: 302  gagaatcagccgtggactgcggcagccttgggtccatgcctgacattgagttcaccattg 361
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1297 gagaatcagccgtggactgcggcagccttgggtccatgcctgacattgagttcaccattg 1356

                                                                        
Query: 362  gtggcaagaagtttgcgctgaaaccagaagagtatatcctgaaggttggtgaaggagctg 421
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1357 gtggcaagaagtttgcgctgaaaccagaagagtatatcctgaaggttggtgaaggagctg 1416

                                                                        
Query: 422  ctgcccagtgcatcagtggattcacagccatggacatcccgcctcctcgcggtcctctct 481
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1417 ctgcccagtgcatcagtggattcacagccatggacatcccgcctcctcgcggtcctctct 1476

                                                                        
Query: 482  ggatcctgggagacgtcttcatgggcccgtaccacaccgtctttgactacggcaagctgc 541
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1477 ggatcctgggagacgtcttcatgggcccgtaccacaccgtctttgactacggcaagctgc 1536

                           
Query: 542  gtattggctttgcca 556
            |||||||||||||||
Sbjct: 1537 gtattggctttgcca 1551



to top

>dbj|AB219968.1| Triticum aestivum WAP1 mRNA for aspartic proteinase, complete cds
          Length = 1527

 Score =  910 bits (459), Expect = 0.0
 Identities = 532/555 (95%), Gaps = 1/555 (0%)
 Strand = Plus / Plus

                                                                        
Query: 2    aattgtttctcaatatggacaacagnatcctcgacctgttgctagcagagacacagccca 61
            |||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 963  aattgtttctcagtatggacaacag-atcctcgacctgttgctagcagagacacagccca 1021

                                                                        
Query: 62   aaaagatctgctcccaggttggtctgtgcacctttgatgggactcgtggtgttagtgccg 121
            ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 1022 aaaaggtctgctcccaggttggtctgtgcacctttgatgggactcgtggtgttagtgctg 1081

                                                                        
Query: 122  gaattcggagcgtggtcgatgatgaacctgtgaaatcaaatggcctccgtgccgatccca 181
            ||||||||||||||||||||||||| ||||||||||| |||||||||| | |||||||||
Sbjct: 1082 gaattcggagcgtggtcgatgatgagcctgtgaaatcgaatggcctccataccgatccca 1141

                                                                        
Query: 182  tgtgcagtgcctgtgagatggctgttgtatggatgcagaaccaacttgcacagaacaaga 241
            |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1142 tgtgcagtgcctgtgagatggctgttgtgtggatgcagaaccaacttgcacagaacaaga 1201

                                                                        
Query: 242  cccaggatctcatactagattacgttaaccagctgtgcaaccgtctcccaagtcccatgg 301
            |||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||
Sbjct: 1202 cccaggatctcatactagattacgttaaccagctgtgcaaccgtctgccaagccccatgg 1261

                                                                        
Query: 302  gagaatcagccgtggactgcggcagccttgggtccatgcctgacattgagttcaccattg 361
            |||||||||| |||||||| | ||||||||| ||||||||||||||||||||||||||| 
Sbjct: 1262 gagaatcagctgtggactgtgccagccttggatccatgcctgacattgagttcaccatta 1321

                                                                        
Query: 362  gtggcaagaagtttgcgctgaaaccagaagagtatatcctgaaggttggtgaaggagctg 421
            ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 1322 gtggcaagaagtttgcgctgaaaccagaagagtatatcctgaaggttggcgaaggagctg 1381

                                                                        
Query: 422  ctgcccagtgcatcagtggattcacagccatggacatcccgcctcctcgcggtcctctct 481
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1382 ctgcccagtgcatcagtggattcacagccatggacatcccgcctcctcgcggtcctctct 1441

                                                                        
Query: 482  ggatcctgggagacgtcttcatgggcccgtaccacaccgtctttgactacggcaagctgc 541
            |||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||
Sbjct: 1442 ggatcctgggagacgttttcatgggcccctaccacaccgtcttcgactacggcaagctgc 1501

                           
Query: 542  gtattggctttgcca 556
            || | ||||| ||||
Sbjct: 1502 gtgtcggcttcgcca 1516



to top

>dbj|AK104838.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-042-E12, full
            insert sequence
          Length = 1777

 Score =  480 bits (242), Expect = e-132
 Identities = 462/534 (86%), Gaps = 1/534 (0%)
 Strand = Plus / Plus

                                                                        
Query: 4    ttgtttctcaatatggacaacagnatcctcgacctgttgctagcagagacacagcccaaa 63
            ||||||||||||||||||||||| ||||| || |||||||| || |||||||||||   |
Sbjct: 1031 ttgtttctcaatatggacaacag-atcctagatctgttgcttgctgagacacagccatca 1089

                                                                        
Query: 64   aagatctgctcccaggttggtctgtgcacctttgatgggactcgtggtgttagtgccgga 123
            || |||||||| |||||||||||||| || ||||||||||  | |||||||||||| |||
Sbjct: 1090 aaaatctgctctcaggttggtctgtgtacttttgatgggaagcatggtgttagtgctgga 1149

                                                                        
Query: 124  attcggagcgtggtcgatgatgaacctgtgaaatcaaatggcctccgtgccgatcccatg 183
            |||  |||||| || ||||||||| ||| | |||| ||||| ||||     | |||||||
Sbjct: 1150 attaagagcgtagtagatgatgaagctggggaatcgaatggtctccaaagtggtcccatg 1209

                                                                        
Query: 184  tgcagtgcctgtgagatggctgttgtatggatgcagaaccaacttgcacagaacaagacc 243
            |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 1210 tgcaatgcctgtgagatggctgttgtatggatgcagaaccaacttgcacagaacaagact 1269

                                                                        
Query: 244  caggatctcatactagattacgttaaccagctgtgcaaccgtctcccaagtcccatggga 303
            |||||||||||  |  | ||| |||| ||||| ||  ||   ||||||||||| ||||||
Sbjct: 1270 caggatctcatcttgaactacattaatcagctctgtgacaagctcccaagtccaatggga 1329

                                                                        
Query: 304  gaatcagccgtggactgcggcagccttgggtccatgcctgacattgagttcaccattggt 363
            |||||| | |||||||| ||||||||||  ||||||||||| |||   ||||||||||| 
Sbjct: 1330 gaatcatctgtggactgtggcagccttgcatccatgcctgagatttcattcaccattgga 1389

                                                                        
Query: 364  ggcaagaagtttgcgctgaaaccagaagagtatatcctgaaggttggtgaaggagctgct 423
            ||||| |||||||| ||||| |||||||||||||| ||||||||||||||||||||||||
Sbjct: 1390 ggcaaaaagtttgcactgaagccagaagagtatattctgaaggttggtgaaggagctgct 1449

                                                                        
Query: 424  gcccagtgcatcagtggattcacagccatggacatcccgcctcctcgcggtcctctctgg 483
            |||||||||||||||||||||||||||||||||||||| ||||| || ||||||||||||
Sbjct: 1450 gcccagtgcatcagtggattcacagccatggacatccctcctccccgtggtcctctctgg 1509

                                                                  
Query: 484  atcctgggagacgtcttcatgggcccgtaccacaccgtctttgactacggcaag 537
            |||||||| ||||| ||||||||  | ||||| ||||| || ||||||||||||
Sbjct: 1510 atcctgggtgacgttttcatgggtgcctaccataccgtgttcgactacggcaag 1563



to top

>dbj|AK103421.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033128K05, full
            insert sequence
          Length = 1818

 Score =  480 bits (242), Expect = e-132
 Identities = 462/534 (86%), Gaps = 1/534 (0%)
 Strand = Plus / Plus

                                                                        
Query: 4    ttgtttctcaatatggacaacagnatcctcgacctgttgctagcagagacacagcccaaa 63
            ||||||||||||||||||||||| ||||| || |||||||| || |||||||||||   |
Sbjct: 1032 ttgtttctcaatatggacaacag-atcctagatctgttgcttgctgagacacagccatca 1090

                                                                        
Query: 64   aagatctgctcccaggttggtctgtgcacctttgatgggactcgtggtgttagtgccgga 123
            || |||||||| |||||||||||||| || ||||||||||  | |||||||||||| |||
Sbjct: 1091 aaaatctgctctcaggttggtctgtgtacttttgatgggaagcatggtgttagtgctgga 1150

                                                                        
Query: 124  attcggagcgtggtcgatgatgaacctgtgaaatcaaatggcctccgtgccgatcccatg 183
            |||  |||||| || ||||||||| ||| | |||| ||||| ||||     | |||||||
Sbjct: 1151 attaagagcgtagtagatgatgaagctggggaatcgaatggtctccaaagtggtcccatg 1210

                                                                        
Query: 184  tgcagtgcctgtgagatggctgttgtatggatgcagaaccaacttgcacagaacaagacc 243
            |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 1211 tgcaatgcctgtgagatggctgttgtatggatgcagaaccaacttgcacagaacaagact 1270

                                                                        
Query: 244  caggatctcatactagattacgttaaccagctgtgcaaccgtctcccaagtcccatggga 303
            |||||||||||  |  | ||| |||| ||||| ||  ||   ||||||||||| ||||||
Sbjct: 1271 caggatctcatcttgaactacattaatcagctctgtgacaagctcccaagtccaatggga 1330

                                                                        
Query: 304  gaatcagccgtggactgcggcagccttgggtccatgcctgacattgagttcaccattggt 363
            |||||| | |||||||| ||||||||||  ||||||||||| |||   ||||||||||| 
Sbjct: 1331 gaatcatctgtggactgtggcagccttgcatccatgcctgagatttcattcaccattgga 1390

                                                                        
Query: 364  ggcaagaagtttgcgctgaaaccagaagagtatatcctgaaggttggtgaaggagctgct 423
            ||||| |||||||| ||||| |||||||||||||| ||||||||||||||||||||||||
Sbjct: 1391 ggcaaaaagtttgcactgaagccagaagagtatattctgaaggttggtgaaggagctgct 1450

                                                                        
Query: 424  gcccagtgcatcagtggattcacagccatggacatcccgcctcctcgcggtcctctctgg 483
            |||||||||||||||||||||||||||||||||||||| ||||| || ||||||||||||
Sbjct: 1451 gcccagtgcatcagtggattcacagccatggacatccctcctccccgtggtcctctctgg 1510

                                                                  
Query: 484  atcctgggagacgtcttcatgggcccgtaccacaccgtctttgactacggcaag 537
            |||||||| ||||| ||||||||  | ||||| ||||| || ||||||||||||
Sbjct: 1511 atcctgggtgacgttttcatgggtgcctaccataccgtgttcgactacggcaag 1564



to top

>dbj|AK100749.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023118K01, full
           insert sequence
          Length = 1086

 Score =  480 bits (242), Expect = e-132
 Identities = 462/534 (86%), Gaps = 1/534 (0%)
 Strand = Plus / Plus

                                                                       
Query: 4   ttgtttctcaatatggacaacagnatcctcgacctgttgctagcagagacacagcccaaa 63
           ||||||||||||||||||||||| ||||| || |||||||| || |||||||||||   |
Sbjct: 240 ttgtttctcaatatggacaacag-atcctagatctgttgcttgctgagacacagccatca 298

                                                                       
Query: 64  aagatctgctcccaggttggtctgtgcacctttgatgggactcgtggtgttagtgccgga 123
           || |||||||| |||||||||||||| || ||||||||||  | |||||||||||| |||
Sbjct: 299 aaaatctgctctcaggttggtctgtgtacttttgatgggaagcatggtgttagtgctgga 358

                                                                       
Query: 124 attcggagcgtggtcgatgatgaacctgtgaaatcaaatggcctccgtgccgatcccatg 183
           |||  |||||| || ||||||||| ||| | |||| ||||| ||||     | |||||||
Sbjct: 359 attaagagcgtagtagatgatgaagctggggaatcgaatggtctccaaagtggtcccatg 418

                                                                       
Query: 184 tgcagtgcctgtgagatggctgttgtatggatgcagaaccaacttgcacagaacaagacc 243
           |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 419 tgcaatgcctgtgagatggctgttgtatggatgcagaaccaacttgcacagaacaagact 478

                                                                       
Query: 244 caggatctcatactagattacgttaaccagctgtgcaaccgtctcccaagtcccatggga 303
           |||||||||||  |  | ||| |||| ||||| ||  ||   ||||||||||| ||||||
Sbjct: 479 caggatctcatcttgaactacattaatcagctctgtgacaagctcccaagtccaatggga 538

                                                                       
Query: 304 gaatcagccgtggactgcggcagccttgggtccatgcctgacattgagttcaccattggt 363
           |||||| | |||||||| ||||||||||  ||||||||||| |||   ||||||||||| 
Sbjct: 539 gaatcatctgtggactgtggcagccttgcatccatgcctgagatttcattcaccattgga 598

                                                                       
Query: 364 ggcaagaagtttgcgctgaaaccagaagagtatatcctgaaggttggtgaaggagctgct 423
           ||||| |||||||| ||||| |||||||||||||| ||||||||||||||||||||||||
Sbjct: 599 ggcaaaaagtttgcactgaagccagaagagtatattctgaaggttggtgaaggagctgct 658

                                                                       
Query: 424 gcccagtgcatcagtggattcacagccatggacatcccgcctcctcgcggtcctctctgg 483
           |||||||||||||||||||||||||||||||||||||| ||||| || ||||||||||||
Sbjct: 659 gcccagtgcatcagtggattcacagccatggacatccctcctccccgtggtcctctctgg 718

                                                                 
Query: 484 atcctgggagacgtcttcatgggcccgtaccacaccgtctttgactacggcaag 537
           |||||||| ||||| ||||||||  | ||||| ||||| || ||||||||||||
Sbjct: 719 atcctgggtgacgttttcatgggtgcctaccataccgtgttcgactacggcaag 772



to top

>dbj|AK098911.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002H22, full
            insert sequence
          Length = 1844

 Score =  480 bits (242), Expect = e-132
 Identities = 462/534 (86%), Gaps = 1/534 (0%)
 Strand = Plus / Plus

                                                                        
Query: 4    ttgtttctcaatatggacaacagnatcctcgacctgttgctagcagagacacagcccaaa 63
            ||||||||||||||||||||||| ||||| || |||||||| || |||||||||||   |
Sbjct: 1034 ttgtttctcaatatggacaacag-atcctagatctgttgcttgctgagacacagccatca 1092

                                                                        
Query: 64   aagatctgctcccaggttggtctgtgcacctttgatgggactcgtggtgttagtgccgga 123
            || |||||||| |||||||||||||| || ||||||||||  | |||||||||||| |||
Sbjct: 1093 aaaatctgctctcaggttggtctgtgtacttttgatgggaagcatggtgttagtgctgga 1152

                                                                        
Query: 124  attcggagcgtggtcgatgatgaacctgtgaaatcaaatggcctccgtgccgatcccatg 183
            |||  |||||| || ||||||||| ||| | |||| ||||| ||||     | |||||||
Sbjct: 1153 attaagagcgtagtagatgatgaagctggggaatcgaatggtctccaaagtggtcccatg 1212

                                                                        
Query: 184  tgcagtgcctgtgagatggctgttgtatggatgcagaaccaacttgcacagaacaagacc 243
            |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 1213 tgcaatgcctgtgagatggctgttgtatggatgcagaaccaacttgcacagaacaagact 1272

                                                                        
Query: 244  caggatctcatactagattacgttaaccagctgtgcaaccgtctcccaagtcccatggga 303
            |||||||||||  |  | ||| |||| ||||| ||  ||   ||||||||||| ||||||
Sbjct: 1273 caggatctcatcttgaactacattaatcagctctgtgacaagctcccaagtccaatggga 1332

                                                                        
Query: 304  gaatcagccgtggactgcggcagccttgggtccatgcctgacattgagttcaccattggt 363
            |||||| | |||||||| ||||||||||  ||||||||||| |||   ||||||||||| 
Sbjct: 1333 gaatcatctgtggactgtggcagccttgcatccatgcctgagatttcattcaccattgga 1392

                                                                        
Query: 364  ggcaagaagtttgcgctgaaaccagaagagtatatcctgaaggttggtgaaggagctgct 423
            ||||| |||||||| ||||| |||||||||||||| ||||||||||||||||||||||||
Sbjct: 1393 ggcaaaaagtttgcactgaagccagaagagtatattctgaaggttggtgaaggagctgct 1452

                                                                        
Query: 424  gcccagtgcatcagtggattcacagccatggacatcccgcctcctcgcggtcctctctgg 483
            |||||||||||||||||||||||||||||||||||||| ||||| || ||||||||||||
Sbjct: 1453 gcccagtgcatcagtggattcacagccatggacatccctcctccccgtggtcctctctgg 1512

                                                                  
Query: 484  atcctgggagacgtcttcatgggcccgtaccacaccgtctttgactacggcaag 537
            |||||||| ||||| ||||||||  | ||||| ||||| || ||||||||||||
Sbjct: 1513 atcctgggtgacgttttcatgggtgcctaccataccgtgttcgactacggcaag 1566



to top

>dbj|AK098906.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002D14, full
            insert sequence
          Length = 1843

 Score =  480 bits (242), Expect = e-132
 Identities = 462/534 (86%), Gaps = 1/534 (0%)
 Strand = Plus / Plus

                                                                        
Query: 4    ttgtttctcaatatggacaacagnatcctcgacctgttgctagcagagacacagcccaaa 63
            ||||||||||||||||||||||| ||||| || |||||||| || |||||||||||   |
Sbjct: 1029 ttgtttctcaatatggacaacag-atcctagatctgttgcttgctgagacacagccatca 1087

                                                                        
Query: 64   aagatctgctcccaggttggtctgtgcacctttgatgggactcgtggtgttagtgccgga 123
            || |||||||| |||||||||||||| || ||||||||||  | |||||||||||| |||
Sbjct: 1088 aaaatctgctctcaggttggtctgtgtacttttgatgggaagcatggtgttagtgctgga 1147

                                                                        
Query: 124  attcggagcgtggtcgatgatgaacctgtgaaatcaaatggcctccgtgccgatcccatg 183
            |||  |||||| || ||||||||| ||| | |||| ||||| ||||     | |||||||
Sbjct: 1148 attaagagcgtagtagatgatgaagctggggaatcgaatggtctccaaagtggtcccatg 1207

                                                                        
Query: 184  tgcagtgcctgtgagatggctgttgtatggatgcagaaccaacttgcacagaacaagacc 243
            |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 1208 tgcaatgcctgtgagatggctgttgtatggatgcagaaccaacttgcacagaacaagact 1267

                                                                        
Query: 244  caggatctcatactagattacgttaaccagctgtgcaaccgtctcccaagtcccatggga 303
            |||||||||||  |  | ||| |||| ||||| ||  ||   ||||||||||| ||||||
Sbjct: 1268 caggatctcatcttgaactacattaatcagctctgtgacaagctcccaagtccaatggga 1327

                                                                        
Query: 304  gaatcagccgtggactgcggcagccttgggtccatgcctgacattgagttcaccattggt 363
            |||||| | |||||||| ||||||||||  ||||||||||| |||   ||||||||||| 
Sbjct: 1328 gaatcatctgtggactgtggcagccttgcatccatgcctgagatttcattcaccattgga 1387

                                                                        
Query: 364  ggcaagaagtttgcgctgaaaccagaagagtatatcctgaaggttggtgaaggagctgct 423
            ||||| |||||||| ||||| |||||||||||||| ||||||||||||||||||||||||
Sbjct: 1388 ggcaaaaagtttgcactgaagccagaagagtatattctgaaggttggtgaaggagctgct 1447

                                                                        
Query: 424  gcccagtgcatcagtggattcacagccatggacatcccgcctcctcgcggtcctctctgg 483
            |||||||||||||||||||||||||||||||||||||| ||||| || ||||||||||||
Sbjct: 1448 gcccagtgcatcagtggattcacagccatggacatccctcctccccgtggtcctctctgg 1507

                                                                  
Query: 484  atcctgggagacgtcttcatgggcccgtaccacaccgtctttgactacggcaag 537
            |||||||| ||||| ||||||||  | ||||| ||||| || ||||||||||||
Sbjct: 1508 atcctgggtgacgttttcatgggtgcctaccataccgtgttcgactacggcaag 1561



to top

>dbj|AK067742.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013116C15, full
            insert sequence
          Length = 1869

 Score =  480 bits (242), Expect = e-132
 Identities = 462/534 (86%), Gaps = 1/534 (0%)
 Strand = Plus / Plus

                                                                        
Query: 4    ttgtttctcaatatggacaacagnatcctcgacctgttgctagcagagacacagcccaaa 63
            ||||||||||||||||||||||| ||||| || |||||||| || |||||||||||   |
Sbjct: 1032 ttgtttctcaatatggacaacag-atcctagatctgttgcttgctgagacacagccatca 1090

                                                                        
Query: 64   aagatctgctcccaggttggtctgtgcacctttgatgggactcgtggtgttagtgccgga 123
            || |||||||| |||||||||||||| || ||||||||||  | |||||||||||| |||
Sbjct: 1091 aaaatctgctctcaggttggtctgtgtacttttgatgggaagcatggtgttagtgctgga 1150

                                                                        
Query: 124  attcggagcgtggtcgatgatgaacctgtgaaatcaaatggcctccgtgccgatcccatg 183
            |||  |||||| || ||||||||| ||| | |||| ||||| ||||     | |||||||
Sbjct: 1151 attaagagcgtagtagatgatgaagctggggaatcgaatggtctccaaagtggtcccatg 1210

                                                                        
Query: 184  tgcagtgcctgtgagatggctgttgtatggatgcagaaccaacttgcacagaacaagacc 243
            |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 1211 tgcaatgcctgtgagatggctgttgtatggatgcagaaccaacttgcacagaacaagact 1270

                                                                        
Query: 244  caggatctcatactagattacgttaaccagctgtgcaaccgtctcccaagtcccatggga 303
            |||||||||||  |  | ||| |||| ||||| ||  ||   ||||||||||| ||||||
Sbjct: 1271 caggatctcatcttgaactacattaatcagctctgtgacaagctcccaagtccaatggga 1330

                                                                        
Query: 304  gaatcagccgtggactgcggcagccttgggtccatgcctgacattgagttcaccattggt 363
            |||||| | |||||||| ||||||||||  ||||||||||| |||   ||||||||||| 
Sbjct: 1331 gaatcatctgtggactgtggcagccttgcatccatgcctgagatttcattcaccattgga 1390

                                                                        
Query: 364  ggcaagaagtttgcgctgaaaccagaagagtatatcctgaaggttggtgaaggagctgct 423
            ||||| |||||||| ||||| |||||||||||||| ||||||||||||||||||||||||
Sbjct: 1391 ggcaaaaagtttgcactgaagccagaagagtatattctgaaggttggtgaaggagctgct 1450

                                                                        
Query: 424  gcccagtgcatcagtggattcacagccatggacatcccgcctcctcgcggtcctctctgg 483
            |||||||||||||||||||||||||||||||||||||| ||||| || ||||||||||||
Sbjct: 1451 gcccagtgcatcagtggattcacagccatggacatccctcctccccgtggtcctctctgg 1510

                                                                  
Query: 484  atcctgggagacgtcttcatgggcccgtaccacaccgtctttgactacggcaag 537
            |||||||| ||||| ||||||||  | ||||| ||||| || ||||||||||||
Sbjct: 1511 atcctgggtgacgttttcatgggtgcctaccataccgtgttcgactacggcaag 1564



to top

>dbj|AK066453.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013059L24, full
            insert sequence
          Length = 2543

 Score =  472 bits (238), Expect = e-130
 Identities = 461/534 (86%), Gaps = 1/534 (0%)
 Strand = Plus / Plus

                                                                        
Query: 4    ttgtttctcaatatggacaacagnatcctcgacctgttgctagcagagacacagcccaaa 63
            ||||||||||||||||||||||| ||||| || |||||||| || ||| |||||||   |
Sbjct: 1663 ttgtttctcaatatggacaacag-atcctagatctgttgcttgctgaggcacagccatca 1721

                                                                        
Query: 64   aagatctgctcccaggttggtctgtgcacctttgatgggactcgtggtgttagtgccgga 123
            || |||||||| |||||||||||||| || ||||||||||  | |||||||||||| |||
Sbjct: 1722 aaaatctgctctcaggttggtctgtgtacttttgatgggaagcatggtgttagtgctgga 1781

                                                                        
Query: 124  attcggagcgtggtcgatgatgaacctgtgaaatcaaatggcctccgtgccgatcccatg 183
            |||  |||||| || ||||||||| ||| | |||| ||||| ||||     | |||||||
Sbjct: 1782 attaagagcgtagtagatgatgaagctggggaatcgaatggtctccaaagtggtcccatg 1841

                                                                        
Query: 184  tgcagtgcctgtgagatggctgttgtatggatgcagaaccaacttgcacagaacaagacc 243
            |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 1842 tgcaatgcctgtgagatggctgttgtatggatgcagaaccaacttgcacagaacaagact 1901

                                                                        
Query: 244  caggatctcatactagattacgttaaccagctgtgcaaccgtctcccaagtcccatggga 303
            |||||||||||  |  | ||| |||| ||||| ||  ||   ||||||||||| ||||||
Sbjct: 1902 caggatctcatcttgaactacattaatcagctctgtgacaagctcccaagtccaatggga 1961

                                                                        
Query: 304  gaatcagccgtggactgcggcagccttgggtccatgcctgacattgagttcaccattggt 363
            |||||| | |||||||| ||||||||||  ||||||||||| |||   ||||||||||| 
Sbjct: 1962 gaatcatctgtggactgtggcagccttgcatccatgcctgagatttcattcaccattgga 2021

                                                                        
Query: 364  ggcaagaagtttgcgctgaaaccagaagagtatatcctgaaggttggtgaaggagctgct 423
            ||||| |||||||| ||||| |||||||||||||| ||||||||||||||||||||||||
Sbjct: 2022 ggcaaaaagtttgcactgaagccagaagagtatattctgaaggttggtgaaggagctgct 2081

                                                                        
Query: 424  gcccagtgcatcagtggattcacagccatggacatcccgcctcctcgcggtcctctctgg 483
            |||||||||||||||||||||||||||||||||||||| ||||| || ||||||||||||
Sbjct: 2082 gcccagtgcatcagtggattcacagccatggacatccctcctccccgtggtcctctctgg 2141

                                                                  
Query: 484  atcctgggagacgtcttcatgggcccgtaccacaccgtctttgactacggcaag 537
            |||||||| ||||| ||||||||  | ||||| ||||| || ||||||||||||
Sbjct: 2142 atcctgggtgacgttttcatgggtgcctaccataccgtgttcgactacggcaag 2195



to top

>dbj|D32144.1|RICAPA Rice mRNA for aspartic protease, complete cds
          Length = 2030

 Score =  472 bits (238), Expect = e-130
 Identities = 461/534 (86%), Gaps = 1/534 (0%)
 Strand = Plus / Plus

                                                                        
Query: 4    ttgtttctcaatatggacaacagnatcctcgacctgttgctagcagagacacagcccaaa 63
            ||||||||||||||||||||||| ||||| || |||||||| || |||||||||||   |
Sbjct: 1021 ttgtttctcaatatggacaacag-atcctagatctgttgcttgctgagacacagccatca 1079

                                                                        
Query: 64   aagatctgctcccaggttggtctgtgcacctttgatgggactcgtggtgttagtgccgga 123
            || |||||||| |||||||||||||| || ||||||||||  | |||||||||||| |||
Sbjct: 1080 aaaatctgctctcaggttggtctgtgtacttttgatgggaagcatggtgttagtgctgga 1139

                                                                        
Query: 124  attcggagcgtggtcgatgatgaacctgtgaaatcaaatggcctccgtgccgatcccatg 183
            |||  |||||| || ||||||||| ||| | |||| ||||| ||||     | |||||||
Sbjct: 1140 attaagagcgtagtagatgatgaagctggggaatcgaatggtctccaaagtggtcccatg 1199

                                                                        
Query: 184  tgcagtgcctgtgagatggctgttgtatggatgcagaaccaacttgcacagaacaagacc 243
            |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 1200 tgcaatgcctgtgagatggctgttgtatggatgcagaaccaacttgcacagaacaagact 1259

                                                                        
Query: 244  caggatctcatactagattacgttaaccagctgtgcaaccgtctcccaagtcccatggga 303
            |||||||||||  |  | ||| |||| ||||| ||  ||   ||||||||||| ||||||
Sbjct: 1260 caggatctcatcttgaactacattaatcagctctgtgacaagctcccaagtccaatggga 1319

                                                                        
Query: 304  gaatcagccgtggactgcggcagccttgggtccatgcctgacattgagttcaccattggt 363
            |||||| | |||||||| ||||||||||  ||||||||||| |||   ||||||||||| 
Sbjct: 1320 gaatcatctgtggactgtggcagccttgcatccatgcctgagatttcattcaccattgga 1379

                                                                        
Query: 364  ggcaagaagtttgcgctgaaaccagaagagtatatcctgaaggttggtgaaggagctgct 423
            | ||| |||||||| ||||| |||||||||||||| ||||||||||||||||||||||||
Sbjct: 1380 gccaaaaagtttgcactgaagccagaagagtatattctgaaggttggtgaaggagctgct 1439

                                                                        
Query: 424  gcccagtgcatcagtggattcacagccatggacatcccgcctcctcgcggtcctctctgg 483
            |||||||||||||||||||||||||||||||||||||| ||||| || ||||||||||||
Sbjct: 1440 gcccagtgcatcagtggattcacagccatggacatccctcctccccgtggtcctctctgg 1499

                                                                  
Query: 484  atcctgggagacgtcttcatgggcccgtaccacaccgtctttgactacggcaag 537
            |||||||| ||||| ||||||||  | ||||| ||||| || ||||||||||||
Sbjct: 1500 atcctgggtgacgttttcatgggtgcctaccataccgtgttcgactacggcaag 1553



to top

>gb|AY112455.1| Zea mays CL6331_1 mRNA sequence
          Length = 1071

 Score =  313 bits (158), Expect = 3e-82
 Identities = 314/366 (85%)
 Strand = Plus / Plus

                                                                       
Query: 175 gatcccatgtgcagtgcctgtgagatggctgttgtatggatgcagaaccaacttgcacag 234
           ||||| ||||||| |||||||||||||||||| ||||||||||||||||||||||| |||
Sbjct: 388 gatccaatgtgcaatgcctgtgagatggctgtggtatggatgcagaaccaacttgcccag 447

                                                                       
Query: 235 aacaagacccaggatctcatactagattacgttaaccagctgtgcaaccgtctcccaagt 294
           |||||||| ||||| ||||| ||  | ||| |||| ||||| ||| | ||||| || |||
Sbjct: 448 aacaagacacaggagctcatcctgaactacattaatcagctttgcgagcgtcttccgagt 507

                                                                       
Query: 295 cccatgggagaatcagccgtggactgcggcagccttgggtccatgcctgacattgagttc 354
           || ||||||||||||||||||||||| ||||| |||| ||||||||||||||||| ||||
Sbjct: 508 ccaatgggagaatcagccgtggactgtggcagtcttgcgtccatgcctgacattgcgttc 567

                                                                       
Query: 355 accattggtggcaagaagtttgcgctgaaaccagaagagtatatcctgaaggttggtgaa 414
           |||||||| ||||| |||||   ||||||||||||  |||| || |||||||||||||||
Sbjct: 568 accattggaggcaataagttcaagctgaaaccagagcagtacattctgaaggttggtgaa 627

                                                                       
Query: 415 ggagctgctgcccagtgcatcagtggattcacagccatggacatcccgcctcctcgcggt 474
           |||   ||||||||||||||||| ||||||||||| ||||| ||||| || || || || 
Sbjct: 628 ggacaggctgcccagtgcatcagcggattcacagctatggatatcccaccaccccgtggc 687

                                                                       
Query: 475 cctctctggatcctgggagacgtcttcatgggcccgtaccacaccgtctttgactacggc 534
           |||||||||||| |||| || || ||||||||    |||||||||||||| ||||| |||
Sbjct: 688 cctctctggatcttgggtgatgttttcatgggagtctaccacaccgtcttcgactatggc 747

                 
Query: 535 aagctg 540
           ||||||
Sbjct: 748 aagctg 753



 Score =  129 bits (65), Expect = 1e-26
 Identities = 138/161 (85%), Gaps = 1/161 (0%)
 Strand = Plus / Plus

                                                                       
Query: 4   ttgtttctcaatatggacaacagnatcctcgacctgttgctagcagagacacagcccaaa 63
           ||||||||||||||||||| ||| ||||| || || |||||||| |||||||| ||    
Sbjct: 215 ttgtttctcaatatggacagcag-atcctagatcttttgctagctgagacacaaccagcg 273

                                                                       
Query: 64  aagatctgctcccaggttggtctgtgcacctttgatgggactcgtggtgttagtgccgga 123
           |||||||| || ||||||||||||||||| |||||||| |||| |||||| || || |||
Sbjct: 274 aagatctgttctcaggttggtctgtgcacttttgatggcactcatggtgtcagcgctgga 333

                                                    
Query: 124 attcggagcgtggtcgatgatgaacctgtgaaatcaaatgg 164
           ||||||||||| || ||||||||| ||| ||||||||||||
Sbjct: 334 attcggagcgtagtggatgatgaagctgggaaatcaaatgg 374



to top

>gb|BT017963.1| Zea mays clone EL01N0523D02.c mRNA sequence
          Length = 1169

 Score =  293 bits (148), Expect = 3e-76
 Identities = 286/332 (86%)
 Strand = Plus / Plus

                                                                       
Query: 175 gatcccatgtgcagtgcctgtgagatggctgttgtatggatgcagaaccaacttgcacag 234
           ||||| ||||||| |||||||||||||||||| ||||||||||||||||||||||| |||
Sbjct: 483 gatccaatgtgcaatgcctgtgagatggctgtggtatggatgcagaaccaacttgcccag 542

                                                                       
Query: 235 aacaagacccaggatctcatactagattacgttaaccagctgtgcaaccgtctcccaagt 294
           |||||||| ||||| ||||| ||  | ||| |||| ||||| ||| | ||||| || |||
Sbjct: 543 aacaagacacaggagctcatcctgaactacattaatcagctttgcgagcgtcttccgagt 602

                                                                       
Query: 295 cccatgggagaatcagccgtggactgcggcagccttgggtccatgcctgacattgagttc 354
           || ||||||||||||||||||||||| ||||| |||| ||||||||||||||||| ||||
Sbjct: 603 ccaatgggagaatcagccgtggactgtggcagtcttgcgtccatgcctgacattgcgttc 662

                                                                       
Query: 355 accattggtggcaagaagtttgcgctgaaaccagaagagtatatcctgaaggttggtgaa 414
           |||||||| ||||| |||||   ||||||||||||  |||| || |||||||||||||||
Sbjct: 663 accattggaggcaataagttcaagctgaaaccagagcagtacattctgaaggttggtgaa 722

                                                                       
Query: 415 ggagctgctgcccagtgcatcagtggattcacagccatggacatcccgcctcctcgcggt 474
           |||   ||||||||||||||||| ||||||||||| ||||| ||||| || || || || 
Sbjct: 723 ggacaggctgcccagtgcatcagcggattcacagctatggatatcccaccaccccgtggc 782

                                           
Query: 475 cctctctggatcctgggagacgtcttcatggg 506
           |||||||||||| |||| || || ||||||||
Sbjct: 783 cctctctggatcttgggtgatgttttcatggg 814



 Score =  121 bits (61), Expect = 3e-24
 Identities = 137/161 (85%), Gaps = 1/161 (0%)
 Strand = Plus / Plus

                                                                       
Query: 4   ttgtttctcaatatggacaacagnatcctcgacctgttgctagcagagacacagcccaaa 63
           |||||||||||||| |||| ||| ||||| || || |||||||| |||||||| ||    
Sbjct: 310 ttgtttctcaatattgacagcag-atcctagatcttttgctagctgagacacaaccagcg 368

                                                                       
Query: 64  aagatctgctcccaggttggtctgtgcacctttgatgggactcgtggtgttagtgccgga 123
           |||||||| || ||||||||||||||||| |||||||| |||| |||||| || || |||
Sbjct: 369 aagatctgttctcaggttggtctgtgcacttttgatggcactcatggtgtcagcgctgga 428

                                                    
Query: 124 attcggagcgtggtcgatgatgaacctgtgaaatcaaatgg 164
           ||||||||||| || ||||||||| ||| ||||||||||||
Sbjct: 429 attcggagcgtagtggatgatgaagctgggaaatcaaatgg 469



to top

>ref|NM_192504.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1560

 Score =  246 bits (124), Expect = 7e-62
 Identities = 298/356 (83%)
 Strand = Plus / Plus

                                                                        
Query: 181  atgtgcagtgcctgtgagatggctgttgtatggatgcagaaccaacttgcacagaacaag 240
            ||||||| ||| |||||||  ||||||||||||||||| | |||||||||||| ||  | 
Sbjct: 1174 atgtgcaatgcttgtgagacagctgttgtatggatgcatacccaacttgcacaaaatcaa 1233

                                                                        
Query: 241  acccaggatctcatactagattacgttaaccagctgtgcaaccgtctcccaagtcccatg 300
            || ||||||||| || |  | ||| || | ||||| ||  ||||||| || ||||| |||
Sbjct: 1234 actcaggatctcgtattgcagtacattgatcagctatgtgaccgtcttcctagtcctatg 1293

                                                                        
Query: 301  ggagaatcagccgtggactgcggcagccttgggtccatgcctgacattgagttcaccatt 360
            ||||||||| | || |||||| |||||||||  ||||||||||||||||  ||||| || 
Sbjct: 1294 ggagaatcatctgttgactgcagcagccttgcatccatgcctgacattgccttcacaatc 1353

                                                                        
Query: 361  ggtggcaagaagtttgcgctgaaaccagaagagtatatcctgaaggttggtgaaggagct 420
            |||||||| |||||||  || ||||||||| | || ||||||||||||||||| ||| ||
Sbjct: 1354 ggtggcaacaagtttgttctcaaaccagaacaatacatcctgaaggttggtgagggaact 1413

                                                                        
Query: 421  gctgcccagtgcatcagtggattcacagccatggacatcccgcctcctcgcggtcctctc 480
            ||| ||||||||||||||||||||||||| |||||||| || |||||||| |||||||||
Sbjct: 1414 gctacccagtgcatcagtggattcacagctatggacattcctcctcctcgtggtcctctc 1473

                                                                    
Query: 481  tggatcctgggagacgtcttcatgggcccgtaccacaccgtctttgactacggcaa 536
            |||||| ||||||| ||||| |||||  | ||||| ||||| |||||||| |||||
Sbjct: 1474 tggatcttgggagatgtctttatgggagcctaccataccgtgtttgactatggcaa 1529



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 48/54 (88%)
 Strand = Plus / Plus

                                                                  
Query: 94   tttgatgggactcgtggtgttagtgccggaattcggagcgtggtcgatgatgaa 147
            |||||||| |||| |||||||||||| || |||||||| ||||| |||||||||
Sbjct: 1087 tttgatggtactcatggtgttagtgctggtattcggagtgtggtggatgatgaa 1140



to top

>dbj|AK072283.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023016B15, full
            insert sequence
          Length = 1862

 Score =  246 bits (124), Expect = 7e-62
 Identities = 298/356 (83%)
 Strand = Plus / Plus

                                                                        
Query: 181  atgtgcagtgcctgtgagatggctgttgtatggatgcagaaccaacttgcacagaacaag 240
            ||||||| ||| |||||||  ||||||||||||||||| | |||||||||||| ||  | 
Sbjct: 1299 atgtgcaatgcttgtgagacagctgttgtatggatgcatacccaacttgcacaaaatcaa 1358

                                                                        
Query: 241  acccaggatctcatactagattacgttaaccagctgtgcaaccgtctcccaagtcccatg 300
            || ||||||||| || |  | ||| || | ||||| ||  ||||||| || ||||| |||
Sbjct: 1359 actcaggatctcgtattgcagtacattgatcagctatgtgaccgtcttcctagtcctatg 1418

                                                                        
Query: 301  ggagaatcagccgtggactgcggcagccttgggtccatgcctgacattgagttcaccatt 360
            ||||||||| | || |||||| |||||||||  ||||||||||||||||  ||||| || 
Sbjct: 1419 ggagaatcatctgttgactgcagcagccttgcatccatgcctgacattgccttcacaatc 1478

                                                                        
Query: 361  ggtggcaagaagtttgcgctgaaaccagaagagtatatcctgaaggttggtgaaggagct 420
            |||||||| |||||||  || ||||||||| | || ||||||||||||||||| ||| ||
Sbjct: 1479 ggtggcaacaagtttgttctcaaaccagaacaatacatcctgaaggttggtgagggaact 1538

                                                                        
Query: 421  gctgcccagtgcatcagtggattcacagccatggacatcccgcctcctcgcggtcctctc 480
            ||| ||||||||||||||||||||||||| |||||||| || |||||||| |||||||||
Sbjct: 1539 gctacccagtgcatcagtggattcacagctatggacattcctcctcctcgtggtcctctc 1598

                                                                    
Query: 481  tggatcctgggagacgtcttcatgggcccgtaccacaccgtctttgactacggcaa 536
            |||||| ||||||| ||||| |||||  | ||||| ||||| |||||||| |||||
Sbjct: 1599 tggatcttgggagatgtctttatgggagcctaccataccgtgtttgactatggcaa 1654



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 48/54 (88%)
 Strand = Plus / Plus

                                                                  
Query: 94   tttgatgggactcgtggtgttagtgccggaattcggagcgtggtcgatgatgaa 147
            |||||||| |||| |||||||||||| || |||||||| ||||| |||||||||
Sbjct: 1212 tttgatggtactcatggtgttagtgctggtattcggagtgtggtggatgatgaa 1265



to top

>dbj|AK072645.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023131B07, full
            insert sequence
          Length = 1576

 Score =  238 bits (120), Expect = 2e-59
 Identities = 297/356 (83%)
 Strand = Plus / Plus

                                                                        
Query: 181  atgtgcagtgcctgtgagatggctgttgtatggatgcagaaccaacttgcacagaacaag 240
            ||||||| ||| |||||||  ||||||||||||||||| | |||||||||||| ||  | 
Sbjct: 953  atgtgcaatgcttgtgagacagctgttgtatggatgcatacccaacttgcacaaaatcaa 1012

                                                                        
Query: 241  acccaggatctcatactagattacgttaaccagctgtgcaaccgtctcccaagtcccatg 300
            || ||||||||| || |  | ||| || | || || ||  ||||||| || ||||| |||
Sbjct: 1013 actcaggatctcgtattgcagtacattgatcaactatgtgaccgtcttcctagtcctatg 1072

                                                                        
Query: 301  ggagaatcagccgtggactgcggcagccttgggtccatgcctgacattgagttcaccatt 360
            ||||||||| | || |||||| |||||||||  ||||||||||||||||  ||||| || 
Sbjct: 1073 ggagaatcatctgttgactgcagcagccttgcatccatgcctgacattgccttcacaatc 1132

                                                                        
Query: 361  ggtggcaagaagtttgcgctgaaaccagaagagtatatcctgaaggttggtgaaggagct 420
            |||||||| |||||||  || ||||||||| | || ||||||||||||||||| ||| ||
Sbjct: 1133 ggtggcaacaagtttgttctcaaaccagaacaatacatcctgaaggttggtgagggaact 1192

                                                                        
Query: 421  gctgcccagtgcatcagtggattcacagccatggacatcccgcctcctcgcggtcctctc 480
            ||| ||||||||||||||||||||||||| |||||||| || |||||||| |||||||||
Sbjct: 1193 gctacccagtgcatcagtggattcacagctatggacattcctcctcctcgtggtcctctc 1252

                                                                    
Query: 481  tggatcctgggagacgtcttcatgggcccgtaccacaccgtctttgactacggcaa 536
            |||||| ||||||| ||||| |||||  | ||||| ||||| |||||||| |||||
Sbjct: 1253 tggatcttgggagatgtctttatgggagcctaccataccgtgtttgactatggcaa 1308



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 48/54 (88%)
 Strand = Plus / Plus

                                                                 
Query: 94  tttgatgggactcgtggtgttagtgccggaattcggagcgtggtcgatgatgaa 147
           |||||||| |||| |||||||||||| || |||||||| ||||| |||||||||
Sbjct: 866 tttgatggtactcatggtgttagtgctggtattcggagtgtggtggatgatgaa 919



to top

>gb|AF285164.1| Oryza sativa subsp. japonica aspartic protease mRNA, partial cds
          Length = 562

 Score =  236 bits (119), Expect = 6e-59
 Identities = 218/251 (86%)
 Strand = Plus / Plus

                                                                       
Query: 287 tcccaagtcccatgggagaatcagccgtggactgcggcagccttgggtccatgcctgaca 346
           |||||||||| |||| ||| ||| | |||||||| | ||||||||  ||||||||||| |
Sbjct: 77  tcccaagtccaatggaagattcatctgtggactgtgccagccttgcatccatgcctgaga 136

                                                                       
Query: 347 ttgagttcaccattggtggcaagaagtttgcgctgaaaccagaagagtatatcctgaagg 406
           ||   ||||||||||  | ||| |||||||| ||||| |||||||||||||| |||||||
Sbjct: 137 tttcattcaccattgaagccaaaaagtttgcactgaagccagaagagtatattctgaagg 196

                                                                       
Query: 407 ttggtgaaggagctgctgcccagtgcatcagtggattcacagccatggacatcccgcctc 466
           ||||| ||| ||||||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 197 ttggtaaagaagctgctgcccagtgcatcagtggattcacagccatggacatccctcctc 256

                                                                       
Query: 467 ctcgcggtcctctctggatcctgggagacgtcttcatgggcccgtaccacaccgtctttg 526
           | || |||||||||||||||||||| ||||| ||||||||  | ||||| ||||| || |
Sbjct: 257 cccgtggtcctctctggatcctgggtgacgttttcatgggtgcctaccataccgtgttcg 316

                      
Query: 527 actacggcaag 537
           |||||||||||
Sbjct: 317 actacggcaag 327



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 212 ggatgcagaaccaacttgcacagaacaagacccaggatctcat 254
           |||| ||||||| ||||||||||| |||||| |||||||||||
Sbjct: 2   ggatccagaacccacttgcacagaccaagactcaggatctcat 44



to top

>gb|AC120986.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1781_H11,
             complete sequence
          Length = 204649

 Score =  151 bits (76), Expect = 3e-33
 Identities = 88/92 (95%)
 Strand = Plus / Plus

                                                                         
Query: 392   agtatatcctgaaggttggtgaaggagctgctgcccagtgcatcagtggattcacagcca 451
             ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 96610 agtatattctgaaggttggtgaaggagctgctgcccagtgcatcagtggattcacagcca 96669

                                             
Query: 452   tggacatcccgcctcctcgcggtcctctctgg 483
             |||||||||| ||||| || ||||||||||||
Sbjct: 96670 tggacatccctcctccccgtggtcctctctgg 96701



 Score =  139 bits (70), Expect = 1e-29
 Identities = 76/78 (97%)
 Strand = Plus / Plus

                                                                         
Query: 177   tcccatgtgcagtgcctgtgagatggctgttgtatggatgcagaaccaacttgcacagaa 236
             ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 96152 tcccatgtgcaatgcctgtgagatggctgttgtatggatgcagaaccaacttgcacagaa 96211

                               
Query: 237   caagacccaggatctcat 254
             |||||| |||||||||||
Sbjct: 96212 caagactcaggatctcat 96229



 Score =  103 bits (52), Expect = 6e-19
 Identities = 94/108 (87%)
 Strand = Plus / Plus

                                                                         
Query: 286   ctcccaagtcccatgggagaatcagccgtggactgcggcagccttgggtccatgcctgac 345
             ||||||||||| |||||||||||| | |||||||| ||||||||||  ||||||||||| 
Sbjct: 96344 ctcccaagtccaatgggagaatcatctgtggactgtggcagccttgcatccatgcctgag 96403

                                                             
Query: 346   attgagttcaccattggtggcaagaagtttgcgctgaaaccagaagag 393
             |||   ||||||||||| ||||| |||||||| ||||| |||||||||
Sbjct: 96404 atttcattcaccattggaggcaaaaagtttgcactgaagccagaagag 96451



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 57/67 (85%)
 Strand = Plus / Plus

                                                                         
Query: 50    agacacagcccaaaaagatctgctcccaggttggtctgtgcacctttgatgggactcgtg 109
             ||||||||||   ||| |||||||| |||||||||||||| || ||||||||||  | ||
Sbjct: 95850 agacacagccatcaaaaatctgctctcaggttggtctgtgtacttttgatgggaagcatg 95909

                    
Query: 110   gtgttag 116
             |||||||
Sbjct: 95910 gtgttag 95916



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 38/41 (92%), Gaps = 1/41 (2%)
 Strand = Plus / Plus

                                                      
Query: 4     ttgtttctcaatatggacaacagnatcctcgacctgttgct 44
             ||||||||||||||||||||||| ||||| || ||||||||
Sbjct: 95717 ttgtttctcaatatggacaacag-atcctagatctgttgct 95756



 Score = 48.1 bits (24), Expect = 0.031
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                     
Query: 482   ggatcctgggagacgtcttcatgggcccgtaccacaccgtctttgactacggcaag 537
             |||||||||| ||||| ||||||||  | ||||| ||||| || ||||||||||||
Sbjct: 96795 ggatcctgggtgacgttttcatgggtgcctaccataccgtgttcgactacggcaag 96850



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  151 bits (76), Expect = 3e-33
 Identities = 88/92 (95%)
 Strand = Plus / Plus

                                                                            
Query: 392      agtatatcctgaaggttggtgaaggagctgctgcccagtgcatcagtggattcacagcca 451
                ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 28016445 agtatattctgaaggttggtgaaggagctgctgcccagtgcatcagtggattcacagcca 28016504

                                                
Query: 452      tggacatcccgcctcctcgcggtcctctctgg 483
                |||||||||| ||||| || ||||||||||||
Sbjct: 28016505 tggacatccctcctccccgtggtcctctctgg 28016536



 Score =  139 bits (70), Expect = 1e-29
 Identities = 76/78 (97%)
 Strand = Plus / Plus

                                                                            
Query: 177      tcccatgtgcagtgcctgtgagatggctgttgtatggatgcagaaccaacttgcacagaa 236
                ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 28015987 tcccatgtgcaatgcctgtgagatggctgttgtatggatgcagaaccaacttgcacagaa 28016046

                                  
Query: 237      caagacccaggatctcat 254
                |||||| |||||||||||
Sbjct: 28016047 caagactcaggatctcat 28016064



 Score =  103 bits (52), Expect = 6e-19
 Identities = 94/108 (87%)
 Strand = Plus / Plus

                                                                            
Query: 286      ctcccaagtcccatgggagaatcagccgtggactgcggcagccttgggtccatgcctgac 345
                ||||||||||| |||||||||||| | |||||||| ||||||||||  ||||||||||| 
Sbjct: 28016179 ctcccaagtccaatgggagaatcatctgtggactgtggcagccttgcatccatgcctgag 28016238

                                                                
Query: 346      attgagttcaccattggtggcaagaagtttgcgctgaaaccagaagag 393
                |||   ||||||||||| ||||| |||||||| ||||| |||||||||
Sbjct: 28016239 atttcattcaccattggaggcaaaaagtttgcactgaagccagaagag 28016286



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 57/67 (85%)
 Strand = Plus / Plus

                                                                            
Query: 50       agacacagcccaaaaagatctgctcccaggttggtctgtgcacctttgatgggactcgtg 109
                ||||||||||   ||| |||||||| |||||||||||||| || ||||||||||  | ||
Sbjct: 28015685 agacacagccatcaaaaatctgctctcaggttggtctgtgtacttttgatgggaagcatg 28015744

                       
Query: 110      gtgttag 116
                |||||||
Sbjct: 28015745 gtgttag 28015751



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 38/41 (92%), Gaps = 1/41 (2%)
 Strand = Plus / Plus

                                                         
Query: 4        ttgtttctcaatatggacaacagnatcctcgacctgttgct 44
                ||||||||||||||||||||||| ||||| || ||||||||
Sbjct: 28015552 ttgtttctcaatatggacaacag-atcctagatctgttgct 28015591



 Score = 48.1 bits (24), Expect = 0.031
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                        
Query: 482      ggatcctgggagacgtcttcatgggcccgtaccacaccgtctttgactacggcaag 537
                |||||||||| ||||| ||||||||  | ||||| ||||| || ||||||||||||
Sbjct: 28016630 ggatcctgggtgacgttttcatgggtgcctaccataccgtgttcgactacggcaag 28016685



 Score = 40.1 bits (20), Expect = 7.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                               
Query: 193     tgtgagatggctgttgtatggatgcagaacca 224
               ||||||||||||||||| |||||  |||||||
Sbjct: 2117386 tgtgagatggctgttgtgtggatagagaacca 2117417



to top

>dbj|D32165.1|RICAP Rice gene for aspartic protease, complete cds
          Length = 6782

 Score =  151 bits (76), Expect = 3e-33
 Identities = 88/92 (95%)
 Strand = Plus / Plus

                                                                        
Query: 392  agtatatcctgaaggttggtgaaggagctgctgcccagtgcatcagtggattcacagcca 451
            ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 5974 agtatattctgaaggttggtgaaggagctgctgcccagtgcatcagtggattcacagcca 6033

                                            
Query: 452  tggacatcccgcctcctcgcggtcctctctgg 483
            |||||||||| ||||| || ||||||||||||
Sbjct: 6034 tggacatccctcctccccgtggtcctctctgg 6065



 Score =  139 bits (70), Expect = 1e-29
 Identities = 76/78 (97%)
 Strand = Plus / Plus

                                                                        
Query: 177  tcccatgtgcagtgcctgtgagatggctgttgtatggatgcagaaccaacttgcacagaa 236
            ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 5516 tcccatgtgcaatgcctgtgagatggctgttgtatggatgcagaaccaacttgcacagaa 5575

                              
Query: 237  caagacccaggatctcat 254
            |||||| |||||||||||
Sbjct: 5576 caagactcaggatctcat 5593



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                        
Query: 286  ctcccaagtcccatgggagaatcagccgtggactgcggcagccttgggtccatgcctgac 345
            ||||||||||| |||||||||||| | |||||||| ||||||||||  ||||||||||| 
Sbjct: 5708 ctcccaagtccaatgggagaatcatctgtggactgtggcagccttgcatccatgcctgag 5767

                                                            
Query: 346  attgagttcaccattggtggcaagaagtttgcgctgaaaccagaagag 393
            |||   ||||||||||| | ||| |||||||| ||||| |||||||||
Sbjct: 5768 atttcattcaccattggagccaaaaagtttgcactgaagccagaagag 5815



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 57/67 (85%)
 Strand = Plus / Plus

                                                                        
Query: 50   agacacagcccaaaaagatctgctcccaggttggtctgtgcacctttgatgggactcgtg 109
            ||||||||||   ||| |||||||| |||||||||||||| || ||||||||||  | ||
Sbjct: 5214 agacacagccatcaaaaatctgctctcaggttggtctgtgtacttttgatgggaagcatg 5273

                   
Query: 110  gtgttag 116
            |||||||
Sbjct: 5274 gtgttag 5280



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 38/41 (92%), Gaps = 1/41 (2%)
 Strand = Plus / Plus

                                                     
Query: 4    ttgtttctcaatatggacaacagnatcctcgacctgttgct 44
            ||||||||||||||||||||||| ||||| || ||||||||
Sbjct: 5081 ttgtttctcaatatggacaacag-atcctagatctgttgct 5120



 Score = 48.1 bits (24), Expect = 0.031
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                    
Query: 482  ggatcctgggagacgtcttcatgggcccgtaccacaccgtctttgactacggcaag 537
            |||||||||| ||||| ||||||||  | ||||| ||||| || ||||||||||||
Sbjct: 6159 ggatcctgggtgacgttttcatgggtgcctaccataccgtgttcgactacggcaag 6214



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  119 bits (60), Expect = 1e-23
 Identities = 84/92 (91%)
 Strand = Plus / Minus

                                                                            
Query: 392      agtatatcctgaaggttggtgaaggagctgctgcccagtgcatcagtggattcacagcca 451
                |||| ||||||||||||||||| ||| ||||| ||||||||||||||||||||||||| |
Sbjct: 27079752 agtacatcctgaaggttggtgagggaactgctacccagtgcatcagtggattcacagcta 27079693

                                                
Query: 452      tggacatcccgcctcctcgcggtcctctctgg 483
                ||||||| || |||||||| ||||||||||||
Sbjct: 27079692 tggacattcctcctcctcgtggtcctctctgg 27079661



 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 93/110 (84%)
 Strand = Plus / Minus

                                                                            
Query: 281      accgtctcccaagtcccatgggagaatcagccgtggactgcggcagccttgggtccatgc 340
                ||||||| || ||||| |||||||||||| | || |||||| |||||||||  |||||||
Sbjct: 27080652 accgtcttcctagtcctatgggagaatcatctgttgactgcagcagccttgcatccatgc 27080593

                                                                  
Query: 341      ctgacattgagttcaccattggtggcaagaagtttgcgctgaaaccagaa 390
                |||||||||  ||||| || |||||||| |||||||  || |||||||||
Sbjct: 27080592 ctgacattgccttcacaatcggtggcaacaagtttgttctcaaaccagaa 27080543



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                     
Query: 181      atgtgcagtgcctgtgagatggctgttgtatggatgcagaaccaacttgcaca 233
                ||||||| ||| |||||||  ||||||||||||||||| | ||||||||||||
Sbjct: 27080830 atgtgcaatgcttgtgagacagctgttgtatggatgcatacccaacttgcaca 27080778



to top

>dbj|AP003284.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0671D01
          Length = 163006

 Score =  119 bits (60), Expect = 1e-23
 Identities = 84/92 (91%)
 Strand = Plus / Minus

                                                                          
Query: 392    agtatatcctgaaggttggtgaaggagctgctgcccagtgcatcagtggattcacagcca 451
              |||| ||||||||||||||||| ||| ||||| ||||||||||||||||||||||||| |
Sbjct: 138583 agtacatcctgaaggttggtgagggaactgctacccagtgcatcagtggattcacagcta 138524

                                              
Query: 452    tggacatcccgcctcctcgcggtcctctctgg 483
              ||||||| || |||||||| ||||||||||||
Sbjct: 138523 tggacattcctcctcctcgtggtcctctctgg 138492



 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 93/110 (84%)
 Strand = Plus / Minus

                                                                          
Query: 281    accgtctcccaagtcccatgggagaatcagccgtggactgcggcagccttgggtccatgc 340
              ||||||| || ||||| |||||||||||| | || |||||| |||||||||  |||||||
Sbjct: 139483 accgtcttcctagtcctatgggagaatcatctgttgactgcagcagccttgcatccatgc 139424

                                                                
Query: 341    ctgacattgagttcaccattggtggcaagaagtttgcgctgaaaccagaa 390
              |||||||||  ||||| || |||||||| |||||||  || |||||||||
Sbjct: 139423 ctgacattgccttcacaatcggtggcaacaagtttgttctcaaaccagaa 139374



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                   
Query: 181    atgtgcagtgcctgtgagatggctgttgtatggatgcagaaccaacttgcaca 233
              ||||||| ||| |||||||  ||||||||||||||||| | ||||||||||||
Sbjct: 139661 atgtgcaatgcttgtgagacagctgttgtatggatgcatacccaacttgcaca 139609



to top

>dbj|AB002695.1| Pumpkin mRNA for aspartic endopeptidase, complete cds
          Length = 1776

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 130/157 (82%)
 Strand = Plus / Plus

                                                                        
Query: 384  accagaagagtatatcctgaaggttggtgaaggagctgctgcccagtgcatcagtggatt 443
            ||||||||||||||| || ||||||||||| ||  |||  || |||||||| ||||||||
Sbjct: 1437 accagaagagtatatactcaaggttggtgagggtcctgtagctcagtgcataagtggatt 1496

                                                                        
Query: 444  cacagccatggacatcccgcctcctcgcggtcctctctggatcctgggagacgtcttcat 503
             || ||  | || ||||| |||||||| || || ||||||||| ||||||| ||||||||
Sbjct: 1497 tactgcatttgatatccctcctcctcgtggacccctctggatcttgggagatgtcttcat 1556

                                                 
Query: 504  gggcccgtaccacaccgtctttgactacggcaagctg 540
            ||| |  ||||||||||||||||| |  |||||||||
Sbjct: 1557 gggtcgctaccacaccgtctttgattttggcaagctg 1593



to top

>emb|AJ313385.1|TCA313385 Theobroma cacao mRNA for aspartic proteinase (ap2 gene)
          Length = 1828

 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 119/143 (83%)
 Strand = Plus / Plus

                                                                        
Query: 385  ccagaagagtatatcctgaaggttggtgaaggagctgctgcccagtgcatcagtggattc 444
            |||||||||||||| || ||||| ||||||||  |||  || |||||||||||||| || 
Sbjct: 1424 ccagaagagtatattctcaaggtgggtgaaggttctgaagcacagtgcatcagtggcttt 1483

                                                                        
Query: 445  acagccatggacatcccgcctcctcgcggtcctctctggatcctgggagacgtcttcatg 504
            || ||  |||| || || |||||||| || ||||||||||| ||||||||  ||||||||
Sbjct: 1484 actgctttggatattcctcctcctcgtggacctctctggattctgggagatatcttcatg 1543

                                   
Query: 505  ggcccgtaccacaccgtctttga 527
            || |  |||||||||||||||||
Sbjct: 1544 ggtcgctaccacaccgtctttga 1566



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                             
Query: 193  tgtgagatggctgttgtatggatgcagaaccaa 225
            ||||||||||| ||||| |||||||||||||||
Sbjct: 1232 tgtgagatggcagttgtgtggatgcagaaccaa 1264



to top

>gb|BT013775.1| Lycopersicon esculentum clone 132663F, mRNA sequence
          Length = 1929

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 52/58 (89%)
 Strand = Plus / Plus

                                                                      
Query: 193  tgtgagatggctgttgtatggatgcagaaccaacttgcacagaacaagacccaggatc 250
            ||||| ||||| ||||||||||||||||||||||||  ||||||| |||| |||||||
Sbjct: 1360 tgtgaaatggcagttgtatggatgcagaaccaacttagacagaaccagactcaggatc 1417



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                              
Query: 64   aagatctgctcccaggttggtctgtgcacctttgatgggactcgtggtgt 113
            |||||||| || ||||||||  |||||||||||||||| ||||| |||||
Sbjct: 1234 aagatctgttcacaggttgggttgtgcacctttgatggaactcgaggtgt 1283



to top

>emb|Y09123.1|CCY09123 C.calcitrapa mRNA for aspartic proteinase
          Length = 1721

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 91/110 (82%)
 Strand = Plus / Plus

                                                                        
Query: 385  ccagaagagtatatcctgaaggttggtgaaggagctgctgcccagtgcatcagtggattc 444
            |||||| |||| ||||||||  ||||||| ||||  || || || |||||||||||||||
Sbjct: 1382 ccagaacagtacatcctgaaaattggtgagggagaagccgcacaatgcatcagtggattc 1441

                                                              
Query: 445  acagccatggacatcccgcctcctcgcggtcctctctggatcctgggaga 494
            ||||| |||||  || | |||||||| || ||||| |||||| |||||||
Sbjct: 1442 acagctatggatgtcgcccctcctcgtggacctctatggatcttgggaga 1491



to top

>emb|AJ313384.1|TCA313384 Theobroma cacao mRNA for aspartic proteinase (ap1 gene)
          Length = 1784

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 121/150 (80%)
 Strand = Plus / Plus

                                                                        
Query: 392  agtatatcctgaaggttggtgaaggagctgctgcccagtgcatcagtggattcacagcca 451
            ||||| ||||||| || ||||| |||| ||  || || ||| ||||||||||||| ||  
Sbjct: 1432 agtatgtcctgaaagtgggtgagggagatgtagctcaatgcctcagtggattcactgctc 1491

                                                                        
Query: 452  tggacatcccgcctcctcgcggtcctctctggatcctgggagacgtcttcatgggcccgt 511
            ||||  | || |||||||| || |||||||||||| |||| |||||||| ||||||| ||
Sbjct: 1492 tggatgtgccacctcctcgtggacctctctggatcttgggcgacgtctttatgggccagt 1551

                                          
Query: 512  accacaccgtctttgactacggcaagctgc 541
             ||| || || |||||||| ||||| ||||
Sbjct: 1552 tccatacagtatttgactatggcaacctgc 1581



to top

>gb|AF287258.1| Vigna unguiculata aspartic proteinase gene, complete cds
          Length = 7087

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Plus

                                                                        
Query: 50   agacacagcccaaaaagatctgctcccaggttggtctgtgcacctttgatgggactcgtg 109
            |||||||||| || |||||||| || ||  ||||  ||||||||||||||||||||||||
Sbjct: 4783 agacacagccgaagaagatctgttctcaaattggattgtgcacctttgatgggactcgtg 4842

                 
Query: 110  gtgtt 114
            |||||
Sbjct: 4843 gtgtt 4847



 Score = 40.1 bits (20), Expect = 7.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 193  tgtgagatggctgttgtatggatgcagaacca 224
            ||||||||||| ||||| ||| ||||||||||
Sbjct: 5039 tgtgagatggcggttgtttgggtgcagaacca 5070



to top

>gb|L46681.1|TOMAPP Lycopersicon esculentum aspartic protease precursor mRNA, complete
            cds
          Length = 1740

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Plus

                                                                        
Query: 466  cctcgcggtcctctctggatcctgggagacgtcttcatgggcccgtaccacaccgtcttt 525
            |||||||||||||| ||||| || ||||| || |||||||| ||||| ||||| ||||||
Sbjct: 1438 cctcgcggtcctctttggattcttggagatgtattcatggggccgtatcacactgtcttt 1497

                 
Query: 526  gacta 530
            |||||
Sbjct: 1498 gacta 1502



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                       
Query: 182  tgtgcagtgcctgtgagatggctgttgtatggatgcagaacca 224
            |||||| ||||||||||||||| ||||| |||||||| |||||
Sbjct: 1154 tgtgcactgcctgtgagatggcagttgtttggatgcaaaacca 1196



to top

>gb|AY792822.1| Sus scrofa cathepsin D protein mRNA, partial cds
          Length = 1894

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 62/72 (86%)
 Strand = Plus / Plus

                                                                        
Query: 450  catggacatcccgcctcctcgcggtcctctctggatcctgggagacgtcttcatgggccc 509
            ||||||||||||||| ||  |||| || |||||||||||||||||||| ||||| |||| 
Sbjct: 1065 catggacatcccgccgcccggcgggccgctctggatcctgggagacgttttcatcggccg 1124

                        
Query: 510  gtaccacaccgt 521
             ||| |||||||
Sbjct: 1125 ctactacaccgt 1136



to top

>dbj|AB219969.1| Triticum aestivum WAP2 mRNA for aspartic proteinase, complete cds
          Length = 1560

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 71/84 (84%)
 Strand = Plus / Plus

                                                                        
Query: 454  gacatcccgcctcctcgcggtcctctctggatcctgggagacgtcttcatgggcccgtac 513
            ||||| ||||| || || |||||||||||||| || || || |||||||||||| | |||
Sbjct: 1406 gacataccgcccccacgtggtcctctctggattcttggggatgtcttcatgggcgcttac 1465

                                    
Query: 514  cacaccgtctttgactacggcaag 537
            |||||||| || |||| |||||||
Sbjct: 1466 cacaccgtgttcgacttcggcaag 1489



 Score = 48.1 bits (24), Expect = 0.031
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                        
Query: 181  atgtgcagtgcctgtgagatggctgttgtatggatgcagaacca 224
            |||||||  |||||||||||||||||||| |||||  |||||||
Sbjct: 1133 atgtgcacagcctgtgagatggctgttgtgtggatagagaacca 1176



to top

>gb|DQ018729.1|DQ018728S2 Sus scrofa cathepsin D (CTSD) gene, exons 7 through 9 and partial
           cds
          Length = 1274

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 62/72 (86%)
 Strand = Plus / Plus

                                                                       
Query: 450 catggacatcccgcctcctcgcggtcctctctggatcctgggagacgtcttcatgggccc 509
           ||||||||||||||| ||  |||| || |||||||||||||||||||| ||||| |||| 
Sbjct: 464 catggacatcccgccgcccggcgggccgctctggatcctgggagacgttttcatcggccg 523

                       
Query: 510 gtaccacaccgt 521
            ||| |||||||
Sbjct: 524 ctactacaccgt 535



to top

>gb|DQ018727.1| Sus scrofa cathepsin D mRNA, complete cds
          Length = 2032

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 62/72 (86%)
 Strand = Plus / Plus

                                                                        
Query: 450  catggacatcccgcctcctcgcggtcctctctggatcctgggagacgtcttcatgggccc 509
            ||||||||||||||| ||  |||| || |||||||||||||||||||| ||||| |||| 
Sbjct: 1203 catggacatcccgccgcccggcgggccgctctggatcctgggagacgttttcatcggccg 1262

                        
Query: 510  gtaccacaccgt 521
             ||| |||||||
Sbjct: 1263 ctactacaccgt 1274



to top

>ref|NM_001037721.1| Sus scrofa cathepsin D (CTSD), mRNA
          Length = 2032

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 62/72 (86%)
 Strand = Plus / Plus

                                                                        
Query: 450  catggacatcccgcctcctcgcggtcctctctggatcctgggagacgtcttcatgggccc 509
            ||||||||||||||| ||  |||| || |||||||||||||||||||| ||||| |||| 
Sbjct: 1203 catggacatcccgccgcccggcgggccgctctggatcctgggagacgttttcatcggccg 1262

                        
Query: 510  gtaccacaccgt 521
             ||| |||||||
Sbjct: 1263 ctactacaccgt 1274



to top

>dbj|AB045892.1| Nepenthes alata NaAP2 mRNA for aspartic proteinase 2, complete cds
          Length = 1839

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 104/128 (81%)
 Strand = Plus / Plus

                                                                        
Query: 406  gttggtgaaggagctgctgcccagtgcatcagtggattcacagccatggacatcccgcct 465
            ||||| ||||| | |||||| || ||||| |||||||||| |||  | |||||  | |||
Sbjct: 1450 gttggcgaaggtgttgctgcacaatgcattagtggattcatagctttagacattgcccct 1509

                                                                        
Query: 466  cctcgcggtcctctctggatcctgggagacgtcttcatgggcccgtaccacaccgtcttt 525
            ||||| || || ||||||||| |||||||| | |||||||| |  ||||||||||| || 
Sbjct: 1510 cctcgtggacccctctggatcttgggagacattttcatgggtcaataccacaccgtgttc 1569

                    
Query: 526  gactacgg 533
            ||||||||
Sbjct: 1570 gactacgg 1577



to top

>ref|NM_205177.1| Gallus gallus cathepsin D (lysosomal aspartyl peptidase) (CTSD), mRNA
          Length = 1448

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                               
Query: 478  ctctggatcctgggagacgtcttcatgggcccgtaccacaccgtctttgac 528
            ||||||||||||||||| |||||||| ||||| ||| |||| |||||||||
Sbjct: 1233 ctctggatcctgggagatgtcttcattggcccctactacactgtctttgac 1283



to top

>gb|BT020155.1| Homo sapiens cathepsin D (lysosomal aspartyl protease) mRNA, complete
            cds
          Length = 1239

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                       
Query: 450  catggacatcccgcctcctcgcggtcctctctggatcctgggagacgtcttcatgggcc 508
            ||||||||||||||| ||  |||| || |||||||||||||| ||||||||||| ||||
Sbjct: 1116 catggacatcccgccacccagcgggccactctggatcctgggcgacgtcttcatcggcc 1174



to top

>ref|NM_001909.3| Homo sapiens cathepsin D (lysosomal aspartyl peptidase) (CTSD), mRNA
          Length = 2205

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                       
Query: 450  catggacatcccgcctcctcgcggtcctctctggatcctgggagacgtcttcatgggcc 508
            ||||||||||||||| ||  |||| || |||||||||||||| ||||||||||| ||||
Sbjct: 1249 catggacatcccgccacccagcgggccactctggatcctgggcgacgtcttcatcggcc 1307



to top

>gb|BC001574.1| Homo sapiens cathepsin D (lysosomal aspartyl peptidase), mRNA (cDNA
           clone IMAGE:3455250)
          Length = 1494

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                      
Query: 450 catggacatcccgcctcctcgcggtcctctctggatcctgggagacgtcttcatgggcc 508
           ||||||||||||||| ||  |||| || |||||||||||||| ||||||||||| ||||
Sbjct: 588 catggacatcccgccacccagcgggccactctggatcctgggcgacgtcttcatcggcc 646



to top

>gb|BC016320.2| Homo sapiens cathepsin D (lysosomal aspartyl peptidase), mRNA (cDNA
            clone MGC:2311 IMAGE:3506977), complete cds
          Length = 2117

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                       
Query: 450  catggacatcccgcctcctcgcggtcctctctggatcctgggagacgtcttcatgggcc 508
            ||||||||||||||| ||  |||| || |||||||||||||| ||||||||||| ||||
Sbjct: 1161 catggacatcccgccacccagcgggccactctggatcctgggcgacgtcttcatcggcc 1219



to top

>emb|X05344.1|HSCATDC Human mRNA for cathepsin D from oestrogen responsive breast cancer
            cells
          Length = 1988

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                       
Query: 450  catggacatcccgcctcctcgcggtcctctctggatcctgggagacgtcttcatgggcc 508
            ||||||||||||||| ||  |||| || |||||||||||||| ||||||||||| ||||
Sbjct: 1118 catggacatcccgccacccagcgggccactctggatcctgggcgacgtcttcatcggcc 1176



to top

>emb|CR456947.1| Homo sapiens full open reading frame cDNA clone RZPDo834E1218D for
            gene CTSD, cathepsin D (lysosomal aspartyl protease);
            complete cds, incl. stopcodon
          Length = 1239

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                       
Query: 450  catggacatcccgcctcctcgcggtcctctctggatcctgggagacgtcttcatgggcc 508
            ||||||||||||||| ||  |||| || |||||||||||||| ||||||||||| ||||
Sbjct: 1116 catggacatcccgccacccagcgggccactctggatcctgggcgacgtcttcatcggcc 1174



to top

>gb|BT007637.1| Synthetic construct Homo sapiens cathepsin D (lysosomal aspartyl
            protease) mRNA, partial cds
          Length = 1239

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                       
Query: 450  catggacatcccgcctcctcgcggtcctctctggatcctgggagacgtcttcatgggcc 508
            ||||||||||||||| ||  |||| || |||||||||||||| ||||||||||| ||||
Sbjct: 1116 catggacatcccgccacccagcgggccactctggatcctgggcgacgtcttcatcggcc 1174



to top

>gb|BT006910.1| Homo sapiens cathepsin D (lysosomal aspartyl protease) mRNA, complete
            cds
          Length = 1239

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                       
Query: 450  catggacatcccgcctcctcgcggtcctctctggatcctgggagacgtcttcatgggcc 508
            ||||||||||||||| ||  |||| || |||||||||||||| ||||||||||| ||||
Sbjct: 1116 catggacatcccgccacccagcgggccactctggatcctgggcgacgtcttcatcggcc 1174



to top

>emb|CR858646.1| Pongo pygmaeus mRNA; cDNA DKFZp469J0315 (from clone DKFZp469J0315)
          Length = 2023

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                       
Query: 450  catggacatcccgcctcctcgcggtcctctctggatcctgggagacgtcttcatgggcc 508
            ||||||||||||||| ||  |||| || |||||||||||||| ||||||||||| ||||
Sbjct: 1133 catggacatcccgccacccagcggaccactctggatcctgggcgacgtcttcatcggcc 1191



to top

>emb|CR623521.1| full-length cDNA clone CS0DI064YA16 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 2032

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                       
Query: 450  catggacatcccgcctcctcgcggtcctctctggatcctgggagacgtcttcatgggcc 508
            ||||||||||||||| ||  |||| || |||||||||||||| ||||||||||| ||||
Sbjct: 1197 catggacatcccgccacccagcgggccactctggatcctgggcgacgtcttcatcggcc 1255



to top

>emb|CR613410.1| full-length cDNA clone CS0DE003YB18 of Placenta of Homo sapiens
            (human)
          Length = 2061

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                       
Query: 450  catggacatcccgcctcctcgcggtcctctctggatcctgggagacgtcttcatgggcc 508
            ||||||||||||||| ||  |||| || |||||||||||||| ||||||||||| ||||
Sbjct: 1215 catggacatcccgccacccagcgggccactctggatcctgggcgacgtcttcatcggcc 1273



to top

>emb|CR612133.1| full-length cDNA clone CS0DF002YC21 of Fetal brain of Homo sapiens
            (human)
          Length = 2006

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                       
Query: 450  catggacatcccgcctcctcgcggtcctctctggatcctgggagacgtcttcatgggcc 508
            ||||||||||||||| ||  |||| || |||||||||||||| ||||||||||| ||||
Sbjct: 1155 catggacatcccgccacccagcgggccactctggatcctgggcgacgtcttcatcggcc 1213



to top

>emb|CR609839.1| full-length cDNA clone CS0DI057YH09 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 2026

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                       
Query: 450  catggacatcccgcctcctcgcggtcctctctggatcctgggagacgtcttcatgggcc 508
            ||||||||||||||| ||  |||| || |||||||||||||| ||||||||||| ||||
Sbjct: 1222 catggacatcccgccacccagcgggccactctggatcctgggcgacgtcttcatcggcc 1280



to top

>emb|CR597228.1| full-length cDNA clone CS0DN004YA05 of Adult brain of Homo sapiens
            (human)
          Length = 2051

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                       
Query: 450  catggacatcccgcctcctcgcggtcctctctggatcctgggagacgtcttcatgggcc 508
            ||||||||||||||| ||  |||| || |||||||||||||| ||||||||||| ||||
Sbjct: 1215 catggacatcccgccacccagcgggccactctggatcctgggcgacgtcttcatcggcc 1273



to top

>gb|U61396.2| Vigna unguiculata aspartic proteinase mRNA, complete cds
          Length = 1842

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 55/63 (87%)
 Strand = Plus / Plus

                                                                        
Query: 52   acacagcccaaaaagatctgctcccaggttggtctgtgcacctttgatgggactcgtggt 111
            |||||||| || |||||||| || ||  ||||  ||||||||||||||||||||||||||
Sbjct: 1150 acacagccgaagaagatctgttctcaaattggattgtgcacctttgatgggactcgtggt 1209

               
Query: 112  gtt 114
            |||
Sbjct: 1210 gtt 1212



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                        
Query: 463  cctcctcgcggtcctctctggatcctgggagacgtcttcatggg 506
            |||||||| || |||||||||||||| || ||||||||||||||
Sbjct: 1561 cctcctcgtggccctctctggatccttggggacgtcttcatggg 1604



 Score = 40.1 bits (20), Expect = 7.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 193  tgtgagatggctgttgtatggatgcagaacca 224
            ||||||||||| ||||| ||| ||||||||||
Sbjct: 1291 tgtgagatggcggttgtttgggtgcagaacca 1322



to top

>dbj|AB169854.1| Macaca fascicularis brain cDNA, clone: QccE-11243, similar to human
            cathepsin D (lysosomal aspartyl protease) (CTSD), mRNA,
            RefSeq: NM_001909.3
          Length = 2199

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                       
Query: 450  catggacatcccgcctcctcgcggtcctctctggatcctgggagacgtcttcatgggcc 508
            ||||||||||||||| ||  |||| || |||||||||||||| ||||||||||| ||||
Sbjct: 1253 catggacatcccgccacccagcgggccactctggatcctgggcgacgtcttcatcggcc 1311



to top

>gb|S49650.1| prepro-cathepsin D [chickens, follicles, mRNA, 1448 nt]
          Length = 1448

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                               
Query: 478  ctctggatcctgggagacgtcttcatgggcccgtaccacaccgtctttgac 528
            ||||||||||||||||| |||||||| ||||| ||| |||| |||||||||
Sbjct: 1233 ctctggatcctgggagatgtcttcattggcccctactacactgtctttgac 1283



to top

>ref|NM_213873.1| Sus scrofa pepsin (LOC396892), mRNA
          Length = 1398

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                               
Query: 478  ctctggatcctgggagacgtcttcatgggcccgtaccacaccgtctttgac 528
            |||||||||||||| |||||||||||  ||| |||| ||||||||||||||
Sbjct: 1144 ctctggatcctgggtgacgtcttcatccgccagtactacaccgtctttgac 1194



to top

>gb|AC068580.23| Homo sapiens chromosome 11, clone RP11-295K3, complete sequence
          Length = 120298

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                        
Query: 450   catggacatcccgcctcctcgcggtcctctctggatcctgggagacgtcttcatgggcc 508
             ||||||||||||||| ||  |||| || |||||||||||||| ||||||||||| ||||
Sbjct: 53716 catggacatcccgccacccagcgggccactctggatcctgggcgacgtcttcatcggcc 53774



to top

>gb|AY892734.1| Synthetic construct Homo sapiens clone FLH024310.01L cathepsin D
            (CTSD) mRNA, partial cds
          Length = 1239

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                       
Query: 450  catggacatcccgcctcctcgcggtcctctctggatcctgggagacgtcttcatgggcc 508
            ||||||||||||||| ||  |||| || |||||||||||||| ||||||||||| ||||
Sbjct: 1116 catggacatcccgccacccagcgggccactctggatcctgggcgacgtcttcatcggcc 1174



to top

>gb|AY890251.1| Synthetic construct Homo sapiens clone FLH024315.01X cathepsin D
            (CTSD) mRNA, complete cds
          Length = 1239

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                       
Query: 450  catggacatcccgcctcctcgcggtcctctctggatcctgggagacgtcttcatgggcc 508
            ||||||||||||||| ||  |||| || |||||||||||||| ||||||||||| ||||
Sbjct: 1116 catggacatcccgccacccagcgggccactctggatcctgggcgacgtcttcatcggcc 1174



to top

>gb|AY890417.1| Synthetic construct Homo sapiens clone FLH031241.01X cathepsin D
            (CTSD) mRNA, complete cds
          Length = 1239

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                       
Query: 450  catggacatcccgcctcctcgcggtcctctctggatcctgggagacgtcttcatgggcc 508
            ||||||||||||||| ||  |||| || |||||||||||||| ||||||||||| ||||
Sbjct: 1116 catggacatcccgccacccagcgggccactctggatcctgggcgacgtcttcatcggcc 1174



to top

>gb|AY888315.1| Synthetic construct Homo sapiens clone FLH008539.01X cathepsin D
            (CTSD) mRNA, complete cds
          Length = 1239

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                       
Query: 450  catggacatcccgcctcctcgcggtcctctctggatcctgggagacgtcttcatgggcc 508
            ||||||||||||||| ||  |||| || |||||||||||||| ||||||||||| ||||
Sbjct: 1116 catggacatcccgccacccagcgggccactctggatcctgggcgacgtcttcatcggcc 1174



to top

>dbj|AK130178.1| Homo sapiens cDNA FLJ26668 fis, clone MPG03026, highly similar to
            Cathepsin D precursor (EC 3.4.23.5)
          Length = 1906

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                       
Query: 450  catggacatcccgcctcctcgcggtcctctctggatcctgggagacgtcttcatgggcc 508
            ||||||||||||||| ||  |||| || |||||||||||||| ||||||||||| ||||
Sbjct: 1141 catggacatcccgccacccagcgggccactctggatcctgggcgacgtcttcatcggcc 1199



to top

>gb|AY893487.1| Synthetic construct Homo sapiens clone FLH127809.01X cathepsin D
            (CTSD) mRNA, complete cds
          Length = 1239

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                       
Query: 450  catggacatcccgcctcctcgcggtcctctctggatcctgggagacgtcttcatgggcc 508
            ||||||||||||||| ||  |||| || |||||||||||||| ||||||||||| ||||
Sbjct: 1116 catggacatcccgccacccagcgggccactctggatcctgggcgacgtcttcatcggcc 1174



to top

>gb|AY892880.1| Synthetic construct Homo sapiens clone FLH031237.01L cathepsin D
            (CTSD) mRNA, partial cds
          Length = 1239

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                       
Query: 450  catggacatcccgcctcctcgcggtcctctctggatcctgggagacgtcttcatgggcc 508
            ||||||||||||||| ||  |||| || |||||||||||||| ||||||||||| ||||
Sbjct: 1116 catggacatcccgccacccagcgggccactctggatcctgggcgacgtcttcatcggcc 1174



to top

>gb|AC160647.1| Gallus gallus BAC clone CH261-14N23 from chromosome unknown, complete
              sequence
          Length = 237526

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                                 
Query: 478    ctctggatcctgggagacgtcttcatgggcccgtaccacaccgtctttgac 528
              ||||||||||||||||| |||||||| ||||| ||| |||| |||||||||
Sbjct: 132613 ctctggatcctgggagatgtcttcattggcccctactacactgtctttgac 132663



to top

>gb|M11233.1|HUMCTHD Human cathepsin D mRNA, complete cds
          Length = 2038

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                       
Query: 450  catggacatcccgcctcctcgcggtcctctctggatcctgggagacgtcttcatgggcc 508
            ||||||||||||||| ||  |||| || |||||||||||||| ||||||||||| ||||
Sbjct: 1167 catggacatcccgccacccagcgggccactctggatcctgggcgacgtcttcatcggcc 1225



to top

>gb|M63138.1|HUMCATD5 Human cathepsin D (catD) gene, exons 7, 8, and 9
          Length = 2062

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                      
Query: 450 catggacatcccgcctcctcgcggtcctctctggatcctgggagacgtcttcatgggcc 508
           ||||||||||||||| ||  |||| || |||||||||||||| ||||||||||| ||||
Sbjct: 762 catggacatcccgccacccagcgggccactctggatcctgggcgacgtcttcatcggcc 820



to top

>gb|J04601.1|PIGPEPA Pig pepsinogen A mRNA, complete cds
          Length = 1363

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                               
Query: 478  ctctggatcctgggagacgtcttcatgggcccgtaccacaccgtctttgac 528
            |||||||||||||| |||||||||||  ||| |||| ||||||||||||||
Sbjct: 1105 ctctggatcctgggtgacgtcttcatccgccagtactacaccgtctttgac 1155



to top

>gb|M20920.1|PIGPEP Swine pepsinogen A mRNA, complete cds
          Length = 1398

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                               
Query: 478  ctctggatcctgggagacgtcttcatgggcccgtaccacaccgtctttgac 528
            |||||||||||||| |||||||||||  ||| |||| ||||||||||||||
Sbjct: 1144 ctctggatcctgggtgacgtcttcatccgccagtactacaccgtctttgac 1194



to top

>ref|NM_001025621.1| Canis familiaris cathepsin D (lysosomal aspartyl peptidase) (CTSD),
            mRNA
          Length = 1524

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 48/54 (88%)
 Strand = Plus / Plus

                                                                  
Query: 450  catggacatcccgcctcctcgcggtcctctctggatcctgggagacgtcttcat 503
            |||||||||||| || ||| |||| ||||||||||||||||| || ||||||||
Sbjct: 1179 catggacatccccccacctggcgggcctctctggatcctgggtgatgtcttcat 1232



to top

>ref|XM_863994.1| PREDICTED: Bos taurus cathepsin D (lysosomal aspartyl protease),
            transcript variant 2 (CTSD), mRNA
          Length = 1907

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 48/54 (88%)
 Strand = Plus / Plus

                                                                  
Query: 450  catggacatcccgcctcctcgcggtcctctctggatcctgggagacgtcttcat 503
            |||||||||||| || ||| |||| || |||||||||||||| |||||||||||
Sbjct: 1132 catggacatccccccgcctggcgggccgctctggatcctgggcgacgtcttcat 1185



to top

>ref|XM_609913.2| PREDICTED: Bos taurus cathepsin D (lysosomal aspartyl protease),
            transcript variant 1 (CTSD), mRNA
          Length = 1901

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 48/54 (88%)
 Strand = Plus / Plus

                                                                  
Query: 450  catggacatcccgcctcctcgcggtcctctctggatcctgggagacgtcttcat 503
            |||||||||||| || ||| |||| || |||||||||||||| |||||||||||
Sbjct: 1126 catggacatccccccgcctggcgggccgctctggatcctgggcgacgtcttcat 1179



to top

>ref|XM_871709.1| PREDICTED: Bos taurus cathepsin D (lysosomal aspartyl protease),
            transcript variant 5 (CTSD), mRNA
          Length = 1919

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 48/54 (88%)
 Strand = Plus / Plus

                                                                  
Query: 450  catggacatcccgcctcctcgcggtcctctctggatcctgggagacgtcttcat 503
            |||||||||||| || ||| |||| || |||||||||||||| |||||||||||
Sbjct: 1144 catggacatccccccgcctggcgggccgctctggatcctgggcgacgtcttcat 1197



to top

>ref|XM_871611.1| PREDICTED: Bos taurus cathepsin D (lysosomal aspartyl protease),
            transcript variant 4 (CTSD), mRNA
          Length = 1910

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 48/54 (88%)
 Strand = Plus / Plus

                                                                  
Query: 450  catggacatcccgcctcctcgcggtcctctctggatcctgggagacgtcttcat 503
            |||||||||||| || ||| |||| || |||||||||||||| |||||||||||
Sbjct: 1135 catggacatccccccgcctggcgggccgctctggatcctgggcgacgtcttcat 1188



to top

>ref|XM_871531.1| PREDICTED: Bos taurus cathepsin D (lysosomal aspartyl protease),
            transcript variant 3 (CTSD), mRNA
          Length = 1955

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 48/54 (88%)
 Strand = Plus / Plus

                                                                  
Query: 450  catggacatcccgcctcctcgcggtcctctctggatcctgggagacgtcttcat 503
            |||||||||||| || ||| |||| || |||||||||||||| |||||||||||
Sbjct: 1180 catggacatccccccgcctggcgggccgctctggatcctgggcgacgtcttcat 1233



to top

>emb|AM048627.1| Canis familiaris mRNA for cathepsin D (ctsd gene)
          Length = 1524

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 48/54 (88%)
 Strand = Plus / Plus

                                                                  
Query: 450  catggacatcccgcctcctcgcggtcctctctggatcctgggagacgtcttcat 503
            |||||||||||| || ||| |||| ||||||||||||||||| || ||||||||
Sbjct: 1179 catggacatccccccacctggcgggcctctctggatcctgggtgatgtcttcat 1232



to top

>dbj|AB055312.1| Bos taurus cat-D mRNA for cathepsin D, partial cds
          Length = 1578

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 48/54 (88%)
 Strand = Plus / Plus

                                                                  
Query: 450  catggacatcccgcctcctcgcggtcctctctggatcctgggagacgtcttcat 503
            |||||||||||| || ||| |||| || |||||||||||||| |||||||||||
Sbjct: 1039 catggacatccccccgcctggcgggccgctctggatcctgggcgacgtcttcat 1092



to top

>ref|NM_101062.2| Arabidopsis thaliana aspartic-type endopeptidase/ pepsin A AT1G11910
            mRNA, complete cds
          Length = 1898

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 116/145 (80%)
 Strand = Plus / Plus

                                                                        
Query: 385  ccagaagagtatatcctgaaggttggtgaaggagctgctgcccagtgcatcagtggattc 444
            |||||||||||| | ||||| |||||||| ||| |||  || |||||||||||||| || 
Sbjct: 1388 ccagaagagtatgttctgaaagttggtgagggacctgtggcacagtgcatcagtggtttt 1447

                                                                        
Query: 445  acagccatggacatcccgcctcctcgcggtcctctctggatcctgggagacgtcttcatg 504
            |  ||  | ||| |  | || ||||| || |||||||||||| ||||||| || ||||||
Sbjct: 1448 attgctcttgacgttgctccacctcgtggacctctctggatcttgggagatgtgttcatg 1507

                                     
Query: 505  ggcccgtaccacaccgtctttgact 529
            |||   ||||||||||| |||||||
Sbjct: 1508 ggcaaataccacaccgtatttgact 1532



 Score = 40.1 bits (20), Expect = 7.5
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 193  tgtgagatggctgttgtatggatgcaga 220
            ||||||||||||||||| ||||| ||||
Sbjct: 1196 tgtgagatggctgttgtgtggatccaga 1223



to top

>gb|AY063974.1| Arabidopsis thaliana putative aspartic proteinase (At1g11910) mRNA,
            complete cds
          Length = 1830

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 116/145 (80%)
 Strand = Plus / Plus

                                                                        
Query: 385  ccagaagagtatatcctgaaggttggtgaaggagctgctgcccagtgcatcagtggattc 444
            |||||||||||| | ||||| |||||||| ||| |||  || |||||||||||||| || 
Sbjct: 1388 ccagaagagtatgttctgaaagttggtgagggacctgtggcacagtgcatcagtggtttt 1447

                                                                        
Query: 445  acagccatggacatcccgcctcctcgcggtcctctctggatcctgggagacgtcttcatg 504
            |  ||  | ||| |  | || ||||| || |||||||||||| ||||||| || ||||||
Sbjct: 1448 attgctcttgacgttgctccacctcgtggacctctctggatcttgggagatgtgttcatg 1507

                                     
Query: 505  ggcccgtaccacaccgtctttgact 529
            |||   ||||||||||| |||||||
Sbjct: 1508 ggcaaataccacaccgtatttgact 1532



 Score = 40.1 bits (20), Expect = 7.5
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 193  tgtgagatggctgttgtatggatgcaga 220
            ||||||||||||||||| ||||| ||||
Sbjct: 1196 tgtgagatggctgttgtgtggatccaga 1223



to top

>gb|AY056403.1| Arabidopsis thaliana At1g11910/F12F1_24 mRNA, complete cds
          Length = 1820

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 116/145 (80%)
 Strand = Plus / Plus

                                                                        
Query: 385  ccagaagagtatatcctgaaggttggtgaaggagctgctgcccagtgcatcagtggattc 444
            |||||||||||| | ||||| |||||||| ||| |||  || |||||||||||||| || 
Sbjct: 1388 ccagaagagtatgttctgaaagttggtgagggacctgtggcacagtgcatcagtggtttt 1447

                                                                        
Query: 445  acagccatggacatcccgcctcctcgcggtcctctctggatcctgggagacgtcttcatg 504
            |  ||  | ||| |  | || ||||| || |||||||||||| ||||||| || ||||||
Sbjct: 1448 attgctcttgacgttgctccacctcgtggacctctctggatcttgggagatgtgttcatg 1507

                                     
Query: 505  ggcccgtaccacaccgtctttgact 529
            |||   ||||||||||| |||||||
Sbjct: 1508 ggcaaataccacaccgtatttgact 1532



 Score = 40.1 bits (20), Expect = 7.5
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 193  tgtgagatggctgttgtatggatgcaga 220
            ||||||||||||||||| ||||| ||||
Sbjct: 1196 tgtgagatggctgttgtgtggatccaga 1223



to top

>gb|AY056387.1| Arabidopsis thaliana At1g11910/F12F1_24 mRNA, complete cds
          Length = 1874

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 116/145 (80%)
 Strand = Plus / Plus

                                                                        
Query: 385  ccagaagagtatatcctgaaggttggtgaaggagctgctgcccagtgcatcagtggattc 444
            |||||||||||| | ||||| |||||||| ||| |||  || |||||||||||||| || 
Sbjct: 1388 ccagaagagtatgttctgaaagttggtgagggacctgtggcacagtgcatcagtggtttt 1447

                                                                        
Query: 445  acagccatggacatcccgcctcctcgcggtcctctctggatcctgggagacgtcttcatg 504
            |  ||  | ||| |  | || ||||| || |||||||||||| ||||||| || ||||||
Sbjct: 1448 attgctcttgacgttgctccacctcgtggacctctctggatcttgggagatgtgttcatg 1507

                                     
Query: 505  ggcccgtaccacaccgtctttgact 529
            |||   ||||||||||| |||||||
Sbjct: 1508 ggcaaataccacaccgtatttgact 1532



 Score = 40.1 bits (20), Expect = 7.5
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 193  tgtgagatggctgttgtatggatgcaga 220
            ||||||||||||||||| ||||| ||||
Sbjct: 1196 tgtgagatggctgttgtgtggatccaga 1223



to top

>dbj|AK221098.1| Arabidopsis thaliana mRNA for putative aspartic proteinase,
           complete cds, clone: RAFL22-84-P18
          Length = 721

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 116/145 (80%)
 Strand = Plus / Plus

                                                                       
Query: 385 ccagaagagtatatcctgaaggttggtgaaggagctgctgcccagtgcatcagtggattc 444
           |||||||||||| | ||||| |||||||| ||| |||  || |||||||||||||| || 
Sbjct: 284 ccagaagagtatgttctgaaagttggtgagggacctgtggcacagtgcatcagtggtttt 343

                                                                       
Query: 445 acagccatggacatcccgcctcctcgcggtcctctctggatcctgggagacgtcttcatg 504
           |  ||  | ||| |  | || ||||| || |||||||||||| ||||||| || ||||||
Sbjct: 344 attgctcttgacgttgctccacctcgtggacctctctggatcttgggagatgtgttcatg 403

                                    
Query: 505 ggcccgtaccacaccgtctttgact 529
           |||   ||||||||||| |||||||
Sbjct: 404 ggcaaataccacaccgtatttgact 428



 Score = 40.1 bits (20), Expect = 7.5
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 193 tgtgagatggctgttgtatggatgcaga 220
           ||||||||||||||||| ||||| ||||
Sbjct: 92  tgtgagatggctgttgtgtggatccaga 119



to top

>dbj|AK221202.1| Arabidopsis thaliana mRNA for putative aspartic proteinase,
           complete cds, clone: RAFL23-06-J05
          Length = 1039

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 116/145 (80%)
 Strand = Plus / Plus

                                                                       
Query: 385 ccagaagagtatatcctgaaggttggtgaaggagctgctgcccagtgcatcagtggattc 444
           |||||||||||| | ||||| |||||||| ||| |||  || |||||||||||||| || 
Sbjct: 512 ccagaagagtatgttctgaaagttggtgagggacctgtggcacagtgcatcagtggtttt 571

                                                                       
Query: 445 acagccatggacatcccgcctcctcgcggtcctctctggatcctgggagacgtcttcatg 504
           |  ||  | ||| |  | || ||||| || |||||||||||| ||||||| || ||||||
Sbjct: 572 attgctcttgacgttgctccacctcgtggacctctctggatcttgggagatgtgttcatg 631

                                    
Query: 505 ggcccgtaccacaccgtctttgact 529
           |||   ||||||||||| |||||||
Sbjct: 632 ggcaaataccacaccgtatttgact 656



 Score = 40.1 bits (20), Expect = 7.5
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 193 tgtgagatggctgttgtatggatgcaga 220
           ||||||||||||||||| ||||| ||||
Sbjct: 320 tgtgagatggctgttgtgtggatccaga 347



to top

>gb|AY088657.1| Arabidopsis thaliana clone 8972 mRNA, complete sequence
          Length = 1814

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 116/145 (80%)
 Strand = Plus / Plus

                                                                        
Query: 385  ccagaagagtatatcctgaaggttggtgaaggagctgctgcccagtgcatcagtggattc 444
            |||||||||||| | ||||| |||||||| ||| |||  || |||||||||||||| || 
Sbjct: 1388 ccagaagagtatgttctgaaagttggtgagggacctgtggcacagtgcatcagtggtttt 1447

                                                                        
Query: 445  acagccatggacatcccgcctcctcgcggtcctctctggatcctgggagacgtcttcatg 504
            |  ||  | ||| |  | || ||||| || |||||||||||| ||||||| || ||||||
Sbjct: 1448 attgctcttgacgttgctccacctcgtggacctctctggatcttgggagatgtgttcatg 1507

                                     
Query: 505  ggcccgtaccacaccgtctttgact 529
            |||   ||||||||||| |||||||
Sbjct: 1508 ggcaaataccacaccgtatttgact 1532



 Score = 40.1 bits (20), Expect = 7.5
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 193  tgtgagatggctgttgtatggatgcaga 220
            ||||||||||||||||| ||||| ||||
Sbjct: 1196 tgtgagatggctgttgtgtggatccaga 1223



to top

>gb|BT001980.1| Arabidopsis thaliana clone U11602 putative aspartic proteinase
            (At1g11910) mRNA, complete cds
          Length = 1552

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 116/145 (80%)
 Strand = Plus / Plus

                                                                        
Query: 385  ccagaagagtatatcctgaaggttggtgaaggagctgctgcccagtgcatcagtggattc 444
            |||||||||||| | ||||| |||||||| ||| |||  || |||||||||||||| || 
Sbjct: 1339 ccagaagagtatgttctgaaagttggtgagggacctgtggcacagtgcatcagtggtttt 1398

                                                                        
Query: 445  acagccatggacatcccgcctcctcgcggtcctctctggatcctgggagacgtcttcatg 504
            |  ||  | ||| |  | || ||||| || |||||||||||| ||||||| || ||||||
Sbjct: 1399 attgctcttgacgttgctccacctcgtggacctctctggatcttgggagatgtgttcatg 1458

                                     
Query: 505  ggcccgtaccacaccgtctttgact 529
            |||   ||||||||||| |||||||
Sbjct: 1459 ggcaaataccacaccgtatttgact 1483



 Score = 40.1 bits (20), Expect = 7.5
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 193  tgtgagatggctgttgtatggatgcaga 220
            ||||||||||||||||| ||||| ||||
Sbjct: 1147 tgtgagatggctgttgtgtggatccaga 1174



to top

>gb|U51036.1|ATU51036 Arabidopsis thaliana aspartic proteinase mRNA, partial cds
          Length = 1722

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 116/145 (80%)
 Strand = Plus / Plus

                                                                        
Query: 385  ccagaagagtatatcctgaaggttggtgaaggagctgctgcccagtgcatcagtggattc 444
            |||||||||||| | ||||| |||||||| ||| |||  || |||||||||||||| || 
Sbjct: 1280 ccagaagagtatgttctgaaagttggtgagggacctgtggcacagtgcatcagtggtttt 1339

                                                                        
Query: 445  acagccatggacatcccgcctcctcgcggtcctctctggatcctgggagacgtcttcatg 504
            |  ||  | ||| |  | || ||||| || |||||||||||| ||||||| || ||||||
Sbjct: 1340 attgctcttgacgttgctccacctcgtggacctctctggatcttgggagatgtgttcatg 1399

                                     
Query: 505  ggcccgtaccacaccgtctttgact 529
            |||   ||||||||||| |||||||
Sbjct: 1400 ggcaaataccacaccgtatttgact 1424



 Score = 40.1 bits (20), Expect = 7.5
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 193  tgtgagatggctgttgtatggatgcaga 220
            ||||||||||||||||| ||||| ||||
Sbjct: 1088 tgtgagatggctgttgtgtggatccaga 1115



to top

>gb|AY672651.1| Solanum tuberosum Asp mRNA, complete cds
          Length = 1680

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                 
Query: 466  cctcgcggtcctctctggatcctgggagacgtcttcatgggcccgtaccacac 518
            |||||||||||||| ||||| || ||||| || |||||||| |||||||||||
Sbjct: 1391 cctcgcggtcctctttggattcttggagatgtattcatggggccgtaccacac 1443



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                     
Query: 184  tgcagtgcctgtgagatggctgttgtatggatgcagaacca 224
            |||| ||||||||||||||| ||||| |||||||| |||||
Sbjct: 1109 tgcactgcctgtgagatggcagttgtttggatgcaaaacca 1149



to top

>gb|DQ241852.1| Solanum tuberosum clone 188C11 aspartic protease precursor-like mRNA,
            complete cds
          Length = 1764

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                        
Query: 466  cctcgcggtcctctctggatcctgggagacgtcttcatgggcccgtaccacaccgtcttt 525
            |||||||||||||| ||||| || ||||| || |||||||| ||||| ||||| || |||
Sbjct: 1444 cctcgcggtcctctttggattcttggagatgtattcatggggccgtatcacactgtgttt 1503

                 
Query: 526  gacta 530
            |||||
Sbjct: 1504 gacta 1508



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                     
Query: 184  tgcagtgcctgtgagatggctgttgtatggatgcagaacca 224
            |||| ||||||||||||||| ||||| |||||||| |||||
Sbjct: 1162 tgcactgcctgtgagatggcagttgtttggatgcaaaacca 1202



to top

>emb|CR662614.2|CNS0FA8S Tetraodon nigroviridis full-length cDNA
          Length = 629

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 481 tggatcctgggagacgtcttcatgggcccgtaccacaccgtctt 524
           ||||||||||||||||||||||| || | |||| ||||||||||
Sbjct: 201 tggatcctgggagacgtcttcatcggtcagtactacaccgtctt 244



to top

>emb|CR660862.2|CNS0F8W4 Tetraodon nigroviridis full-length cDNA
          Length = 626

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 481 tggatcctgggagacgtcttcatgggcccgtaccacaccgtctt 524
           ||||||||||||||||||||||| || | |||| ||||||||||
Sbjct: 202 tggatcctgggagacgtcttcatcggtcagtactacaccgtctt 245



to top

>emb|X88774.1|BORNAPAP B.oleracea mRNA for putative aspartic protease (partial)
          Length = 431

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 466 cctcgcggtcctctctggatcctgggagacgtcttcatgggcccgtaccacaccgtcttt 525
           ||||| || |||||||||||||| ||||| || |||||||||   ||||||||||| |||
Sbjct: 175 cctcgtggacctctctggatccttggagatgtgttcatgggcaaataccacaccgtgttt 234

               
Query: 526 gact 529
           ||||
Sbjct: 235 gact 238



to top

>dbj|AB091762.1| Glycine max soyAP4 mRNA for aspartic proteinase 4, partial cds
          Length = 664

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 61  aaaaagatctgctcccaggttggtctgtgcacctttgatgggactcgtggtgttag 116
           |||||||||||||| ||  ||||  |||| |||||||||||||||| |||||||||
Sbjct: 5   aaaaagatctgctcacaaattggattgtgtacctttgatgggactcatggtgttag 60



 Score = 48.1 bits (24), Expect = 0.031
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 463 cctcctcgcggtcctctctggatcctgggagacgtcttcatggg 506
           |||||||| || ||||| |||||||| ||||| |||||||||||
Sbjct: 407 cctcctcgtggccctctatggatccttggagatgtcttcatggg 450



 Score = 48.1 bits (24), Expect = 0.031
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 193 tgtgagatggctgttgtatggatgcagaacca 224
           ||||||||||||||| | ||||||||||||||
Sbjct: 137 tgtgagatggctgttatttggatgcagaacca 168



to top

>gb|AF082029.1|AF082029 Hemerocallis hybrid cultivar senescence-associated protein 4 (SA4)
            mRNA, complete cds
          Length = 1970

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 89/108 (82%), Gaps = 1/108 (0%)
 Strand = Plus / Plus

                                                                        
Query: 352  ttcaccattggtggcaagaagtttgcgctgaaaccagaagagtatatcctgaaggttggt 411
            ||||| |||||||||||| ||||||  || | | ||||  ||||| |  |||||||||||
Sbjct: 1395 ttcactattggtggcaagcagtttgaccttacagcagagcagtatgttttgaaggttggt 1454

                                                            
Query: 412  gaaggagctgctgcccagtgcatc-agtggattcacagccatggacat 458
            |||||| |||| || ||||| ||| ||||||||||| ||| |||||||
Sbjct: 1455 gaaggacctgcagctcagtgtatcaagtggattcactgccttggacat 1502



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                  
Query: 181  atgtgcagtgcctgtgagatggctgttgtatggatgca 218
            ||||||||||| ||||||||||| ||||| ||||||||
Sbjct: 1224 atgtgcagtgcttgtgagatggcagttgtgtggatgca 1261



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                           
Query: 80   ttggtctgtgcacctttgatgggactcgtgg 110
            |||||||||| || |||||||||||||||||
Sbjct: 1129 ttggtctgtgtacttttgatgggactcgtgg 1159



to top

>gb|AY389666.1| Hyacinthus orientalis aspartic proteinase mRNA, partial cds
          Length = 585

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 81/99 (81%)
 Strand = Plus / Plus

                                                                       
Query: 406 gttggtgaaggagctgctgcccagtgcatcagtggattcacagccatggacatcccgcct 465
           ||||| || |||||||| || || |||||||| |||||||| ||| ||||  | ||||| 
Sbjct: 266 gttggggagggagctgcagcacaatgcatcagcggattcacggccttggatgtaccgcca 325

                                                  
Query: 466 cctcgcggtcctctctggatcctgggagacgtcttcatg 504
           || || ||||||||||||||  |||| || |||||||||
Sbjct: 326 ccgcggggtcctctctggattttgggtgatgtcttcatg 364



to top

>emb|X77260.1|BOASPR B. oleracea L. gene for aspartic protease (partial)
          Length = 1121

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 475 cctctctggatcctgggagacgtcttcatgggcccgtaccacaccgtctttgact 529
           |||||||||||| ||||||| || |||||||||   ||||||||||| |||||||
Sbjct: 787 cctctctggatcttgggagatgtattcatgggcaaataccacaccgtgtttgact 841



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 391 gagtatatcctgaaggttggtgaaggagctgctgcccagtgcatcagtgg 440
           |||||| | |||||||||||||| || ||||| || ||||||||||||||
Sbjct: 703 gagtatgttctgaaggttggtgagggcgctgcagcacagtgcatcagtgg 752



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 67  atctgctcccaggttggtctgtgcacctttgatgg 101
           |||||||||||| ||||||||||||| || |||||
Sbjct: 379 atctgctcccagattggtctgtgcactttcgatgg 413



to top

>dbj|AB045891.1| Nepenthes alata NaAP1 mRNA for aspartic proteinase 1, complete cds
          Length = 1802

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 111/139 (79%)
 Strand = Plus / Plus

                                                                        
Query: 392  agtatatcctgaaggttggtgaaggagctgctgcccagtgcatcagtggattcacagcca 451
            ||||||||||  | ||||| ||||||| |||  | || |||||||| || ||||||||| 
Sbjct: 1458 agtatatccttcaagttggcgaaggagttgcaactcaatgcatcagcggcttcacagcct 1517

                                                                        
Query: 452  tggacatcccgcctcctcgcggtcctctctggatcctgggagacgtcttcatgggcccgt 511
            | ||| |  | |||||||  || |||||||||||| |||||||| | |||||||| | ||
Sbjct: 1518 tagacgtggcccctcctcttggacctctctggatcttgggagacattttcatgggtcagt 1577

                               
Query: 512  accacaccgtctttgacta 530
            | ||||| || ||||||||
Sbjct: 1578 atcacactgtgtttgacta 1596



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 47/55 (85%)
 Strand = Plus / Plus

                                                                   
Query: 47   cagagacacagcccaaaaagatctgctcccaggttggtctgtgcacctttgatgg 101
            ||||||| || || |||||||||||||| ||| ||||| | || |||||||||||
Sbjct: 1113 cagagactcaaccaaaaaagatctgctcgcagattggtttatgtacctttgatgg 1167



 Score = 44.1 bits (22), Expect = 0.48
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 193  tgtgagatggctgttgtatggatgca 218
            ||||||||| ||||||||||||||||
Sbjct: 1259 tgtgagatgactgttgtatggatgca 1284



to top

>gb|AF156788.1| Pleuronectes americanus pepsinogen A form IIb precursor (pep2b) mRNA,
            complete cds
          Length = 1280

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                      
Query: 478  ctctggatcctgggagacgtcttcat 503
            ||||||||||||||||||||||||||
Sbjct: 1074 ctctggatcctgggagacgtcttcat 1099



to top

>dbj|AB120129.1| Paralichthys olivaceus pep mRNA for pepsinogen, complete cds
          Length = 1307

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                      
Query: 478  ctctggatcctgggagacgtcttcat 503
            ||||||||||||||||||||||||||
Sbjct: 1079 ctctggatcctgggagacgtcttcat 1104



to top

>emb|X81984.1|CCCYPRSN C.cardunculus mRNA for cyprosin
          Length = 1757

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 73/89 (82%)
 Strand = Plus / Plus

                                                                        
Query: 430  tgcatcagtggattcacagccatggacatcccgcctcctcgcggtcctctctggatcctg 489
            ||||||||||||||||| || |||||  |  | |||||||| || ||||| |||||| ||
Sbjct: 1443 tgcatcagtggattcactgctatggatgtggcccctcctcgtggacctctatggatcttg 1502

                                         
Query: 490  ggagacgtcttcatgggcccgtaccacac 518
            ||||| || || |||||||  ||||||||
Sbjct: 1503 ggagatgtttttatgggccgataccacac 1531



to top

>gb|AY103665.1| Zea mays PCO108960 mRNA sequence
          Length = 1413

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                        
Query: 472  ggtcctctctggatcctgggagacgtcttcatgggcccgtaccacaccgtctttgactac 531
            |||||||||||||| || || ||||||||||||||  | |||||||| || || |||| |
Sbjct: 1028 ggtcctctctggattcttggggacgtcttcatgggagcttaccacacggtgttcgacttc 1087

                 
Query: 532  ggcaa 536
            |||||
Sbjct: 1088 ggcaa 1092



 Score = 40.1 bits (20), Expect = 7.5
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 235 aacaagacccaggatctcatactagattacgttaaccagctgtg 278
           ||||||||| |||| ||||||||  | |||| ||||||||||||
Sbjct: 791 aacaagaccaaggagctcatactgcagtacgctaaccagctgtg 834



to top

>dbj|AB025359.2| Helianthus annuus mRNA for aspartic proteinase, complete cds
          Length = 1722

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                 
Query: 192  ctgtgagatggctgttgtatggatgcagaaccaactt 228
            |||||||||||||||||| |||||||| | |||||||
Sbjct: 1171 ctgtgagatggctgttgtttggatgcaaagccaactt 1207



to top

>gb|AY826351.2| Fagopyrum esculentum aspartic proteinase 9 mRNA, complete cds
          Length = 1900

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                    
Query: 463  cctcctcgcggtcctctctggatcctgggagacgtcttcatgggcccgtaccacac 518
            ||||| || ||||||||||||||  |||| ||| |||||||||| | |||||||||
Sbjct: 1554 cctccacgtggtcctctctggatattgggcgacatcttcatgggtcagtaccacac 1609



to top

>emb|X69193.1|VCCYNA V.cardunculus mRNA for cynarase
          Length = 1603

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 54/64 (84%)
 Strand = Plus / Plus

                                                                        
Query: 392  agtatatcctgaaggttggtgaaggagctgctgcccagtgcatcagtggattcacagcca 451
            ||||| ||||||| ||||| ||||||||  | || || ||||| ||||||||||| ||||
Sbjct: 1252 agtatgtcctgaaagttggggaaggagcaacagcacaatgcataagtggattcaccgcca 1311

                
Query: 452  tgga 455
            ||||
Sbjct: 1312 tgga 1315



to top

>gb|AC169788.4| Medicago truncatula clone mth2-28c18, complete sequence
          Length = 122876

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                              
Query: 193    tgtgagatggctgttgtatggatgcagaacca 224
              ||||||||||| ||||| ||||||||||||||
Sbjct: 120302 tgtgagatggcagttgtttggatgcagaacca 120271



 Score = 44.1 bits (22), Expect = 0.48
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                            
Query: 482    ggatcctgggagacgtcttcatgggcccgtaccacaccgtctttga 527
              ||||||| |||||  ||||||||||||  |||||||| ||||||||
Sbjct: 115488 ggatccttggagatatcttcatgggccgttaccacacagtctttga 115443



to top

>gb|AC134967.20| Medicago truncatula clone mth2-26b8, complete sequence
          Length = 133030

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                            
Query: 193  tgtgagatggctgttgtatggatgcagaacca 224
            ||||||||||| ||||| ||||||||||||||
Sbjct: 1404 tgtgagatggcagttgtttggatgcagaacca 1435



 Score = 44.1 bits (22), Expect = 0.48
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                          
Query: 482  ggatcctgggagacgtcttcatgggcccgtaccacaccgtctttga 527
            ||||||| |||||  ||||||||||||  |||||||| ||||||||
Sbjct: 6218 ggatccttggagatatcttcatgggccgttaccacacagtctttga 6263



to top

>dbj|AB069959.1| Glycine max soyAP1 mRNA for aspartic proteinase 1, complete cds
          Length = 1719

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                            
Query: 193  tgtgagatggctgttgtatggatgcagaacca 224
            ||||||||||| ||||| ||||||||||||||
Sbjct: 1171 tgtgagatggcggttgtttggatgcagaacca 1202



 Score = 40.1 bits (20), Expect = 7.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 475  cctctctggatcctgggagacgtcttcatggg 506
            |||||||||||||| || || |||||||||||
Sbjct: 1453 cctctctggatccttggtgatgtcttcatggg 1484



to top

>emb|AJ550951.1|TBE550951 Trematomus bernacchii mRNA for pepsin A3
          Length = 1298

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 481  tggatcctgggagacgtcttcat 503
            |||||||||||||||||||||||
Sbjct: 1076 tggatcctgggagacgtcttcat 1098



to top

>emb|AJ131678.1|CDR131678 Camelus dromedarius mRNA for pepsin
          Length = 1221

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                           
Query: 478  ctctggatcctgggagacgtcttcatgggcccgtaccacaccgtctt 524
            |||||||||||||| |||||||||||  ||| ||||  |||||||||
Sbjct: 1109 ctctggatcctgggtgacgtcttcatccgccagtacttcaccgtctt 1155



to top

>dbj|AB089792.1| Oryctolagus cuniculus mRNA for pepsinogen III, complete cds
          Length = 1364

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                           
Query: 478  ctctggatcctgggagacgtcttcatgggcccgtaccacaccgtctt 524
            |||||||||||||| |||||||||||  ||| ||||  |||||||||
Sbjct: 1099 ctctggatcctgggtgacgtcttcatccgccagtacttcaccgtctt 1145



to top

>dbj|AB089791.1| Oryctolagus cuniculus mRNA for pepsinogen II-4, complete cds
          Length = 1268

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                           
Query: 478  ctctggatcctgggagacgtcttcatgggcccgtaccacaccgtctt 524
            |||||||||||||| |||||||||||  ||| ||||  |||||||||
Sbjct: 1109 ctctggatcctgggtgacgtcttcatccgccagtacttcaccgtctt 1155



to top

>dbj|AB089790.1| Oryctolagus cuniculus mRNA for pepsinogen II-1, complete cds
          Length = 1454

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                           
Query: 478  ctctggatcctgggagacgtcttcatgggcccgtaccacaccgtctt 524
            |||||||||||||| |||||||||||  ||| ||||  |||||||||
Sbjct: 1200 ctctggatcctgggtgacgtcttcatccgccagtacttcaccgtctt 1246



to top

>gb|M59237.1|RABPEPIII Rabbit pepsinogen III mRNA, complete cds
          Length = 1371

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                           
Query: 478  ctctggatcctgggagacgtcttcatgggcccgtaccacaccgtctt 524
            |||||||||||||| |||||||||||  ||| ||||  |||||||||
Sbjct: 1104 ctctggatcctgggtgacgtcttcatccgccagtacttcaccgtctt 1150



to top

>gb|M59235.1|RABPEPII23 Rabbit pepsinogen 11-2/3 mRNA, complete cds
          Length = 1266

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                           
Query: 478  ctctggatcctgggagacgtcttcatgggcccgtaccacaccgtctt 524
            |||||||||||||| |||||||||||  ||| ||||  |||||||||
Sbjct: 1107 ctctggatcctgggtgacgtcttcatccgccagtacttcaccgtctt 1153



to top

>dbj|AB047245.1| Rhinolophus ferrumequinum pgnA mRNA for pepsinogen A, complete cds
          Length = 1161

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                               
Query: 478  ctctggatcctgggagacgtcttcatgggcccgtaccacaccgtctttgac 528
            |||||||||||||| |||||||||||  | | ||||  |||||||||||||
Sbjct: 1072 ctctggatcctgggcgacgtcttcattcgtcagtacttcaccgtctttgac 1122



to top

>dbj|AB047244.1| Sorex unguiculatus pgnA mRNA for pepsinogen A, complete cds
          Length = 1381

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                           
Query: 478  ctctggatcctgggagacgtcttcatgggcccgtaccacaccgtctt 524
            |||||||||||||| |||||||||||  ||| ||||  |||||||||
Sbjct: 1097 ctctggatcctgggcgacgtcttcatccgccagtacttcaccgtctt 1143



to top

>ref|XM_475576.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1491

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                  
Query: 469  cgcggtcctctctggatcctgggagacgtcttcatggg 506
            ||||||||||| ||||| || ||||| |||||||||||
Sbjct: 1393 cgcggtcctctttggattcttggagatgtcttcatggg 1430



 Score = 40.1 bits (20), Expect = 7.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 193  tgtgagatggctgttgtatggatgcagaacca 224
            ||||||||||||||||| |||||  |||||||
Sbjct: 1117 tgtgagatggctgttgtgtggatagagaacca 1148



to top

>gb|BT018637.1| Zea mays clone EL01N0504C03.d mRNA sequence
          Length = 1568

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 460  ccgcctcctcgcggtcctctctggat 485
            ||||||||||| ||||||||||||||
Sbjct: 1173 ccgcctcctcgtggtcctctctggat 1198



to top

>ref|XM_545694.2| PREDICTED: Canis familiaris similar to cathepsin E isoform a
            preproprotein (LOC488577), mRNA
          Length = 1287

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                              
Query: 454  gacatcccgcctcctcgcggtcctctctggatcctgggagacgtcttcat 503
            ||||||| ||||||   ||| ||||||||||||||||| || ||||||||
Sbjct: 1171 gacatccagcctccagccgggcctctctggatcctgggcgatgtcttcat 1220



to top

>gb|AC161241.18| Medicago truncatula clone mth2-193c3, complete sequence
          Length = 125129

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 341   ctgacattgagttcaccattgg 362
             ||||||||||||||||||||||
Sbjct: 96033 ctgacattgagttcaccattgg 96054



to top

>emb|AL450337.24| Human DNA sequence from clone RP11-51B10 on chromosome 10 Contains the 5'
              end of the PARD3 gene for par-3 partitioning defective 3
              homolog (C.elegans), a novel gene, a pseudogene similar to
              part of synovial sarcoma translocation, chromosome 18
              protein (SS18), a peroxiredoxin 2 (PRDX2) pseudogene and a
              CpG island, complete sequence
          Length = 173987

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 430    tgcatcagtggattcacagccatgga 455
              |||||||||||||||||| |||||||
Sbjct: 124237 tgcatcagtggattcacatccatgga 124262



to top

>emb|AJ579366.1|CRE579366 Chlamydomonas reinhardtii mRNA for aspartic proteinase (chlapsin
            gene)
          Length = 2443

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                  
Query: 481  tggatcctgggagacgtcttcatgggcccgtaccacaccgtctttgactacggc 534
            ||||||||||||||| | ||| ||||| | || |||||||| || |||||||||
Sbjct: 1794 tggatcctgggagacatattcctgggcgcctatcacaccgtgttcgactacggc 1847



to top

>emb|AJ550949.2|TBE550949 Trematomus bernacchii mRNA for pepsin A1
          Length = 1270

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 478  ctctggatcctgggagacgtcttcat 503
            ||||||||||||||||| ||||||||
Sbjct: 1041 ctctggatcctgggagatgtcttcat 1066



to top

>emb|AJ550950.1|TBE550950 Trematomus bernacchii partial mRNA for pepsin A2
          Length = 1259

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 478  ctctggatcctgggagacgtcttcat 503
            ||||||||||||||||| ||||||||
Sbjct: 1034 ctctggatcctgggagatgtcttcat 1059



to top

>ref|NM_205054.1| Gallus gallus pepsinogen (LOC395926), mRNA
          Length = 1276

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 478  ctctggatcctgggagacgtcttcat 503
            ||||||||| ||||||||||||||||
Sbjct: 1079 ctctggatcttgggagacgtcttcat 1104



to top

>gb|AF164143.1|AF164143 Ovis aries cathepsin D (CTSD) mRNA, partial cds
          Length = 1095

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                  
Query: 450  catggacatcccgcctcctcgcggtcctctctggatcctgggagacgtcttcat 503
            |||||||||||| || ||  |||| || |||||||||||||| ||||| |||||
Sbjct: 1035 catggacatccccccgcccggcgggccgctctggatcctgggcgacgtgttcat 1088



to top

>dbj|AK065206.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002F13, full
            insert sequence
          Length = 1900

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                  
Query: 469  cgcggtcctctctggatcctgggagacgtcttcatggg 506
            ||||||||||| ||||| || ||||| |||||||||||
Sbjct: 1545 cgcggtcctctttggattcttggagatgtcttcatggg 1582



 Score = 40.1 bits (20), Expect = 7.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 193  tgtgagatggctgttgtatggatgcagaacca 224
            ||||||||||||||||| |||||  |||||||
Sbjct: 1269 tgtgagatggctgttgtgtggatagagaacca 1300



to top

>gb|AY103982.1| Zea mays PCO140262 mRNA sequence
          Length = 1929

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 460  ccgcctcctcgcggtcctctctggat 485
            ||||||||||| ||||||||||||||
Sbjct: 1548 ccgcctcctcgtggtcctctctggat 1573



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 193  tgtgagatggctgttgtatggatgcagaa 221
            ||||||||||||||||| ||||| |||||
Sbjct: 1281 tgtgagatggctgttgtctggatacagaa 1309



to top

>dbj|D12777.1|RICASPPRO Oryza sativa (japonica cultivar-group) mRNA for aspartic proteinase,
            complete cds
          Length = 1774

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                  
Query: 469  cgcggtcctctctggatcctgggagacgtcttcatggg 506
            ||||||||||| ||||| || ||||| |||||||||||
Sbjct: 1474 cgcggtcctctttggattcttggagatgtcttcatggg 1511



 Score = 40.1 bits (20), Expect = 7.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 193  tgtgagatggctgttgtatggatgcagaacca 224
            ||||||||||||||||| |||||  |||||||
Sbjct: 1198 tgtgagatggctgttgtgtggatagagaacca 1229



to top

>dbj|D00215.1|CHKPSN Gallus gallus mRNA for pepsinogen, complete cds
          Length = 1276

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 478  ctctggatcctgggagacgtcttcat 503
            ||||||||| ||||||||||||||||
Sbjct: 1079 ctctggatcttgggagacgtcttcat 1104



to top

>dbj|AB045893.1| Nepenthes alata NaAP3 mRNA for aspartic proteinase 3, complete cds
          Length = 1753

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                              
Query: 67   atctgctcccaggttggtctgtgcacctttgatgggactcgtggtgttag 116
            |||||||||||  ||||  |||||||||| ||||| ||||| ||||||||
Sbjct: 1029 atctgctcccaaattggattgtgcaccttcgatggcactcgcggtgttag 1078



to top

>dbj|AB028888.1| Oryza sativa RAP mRNA for aspartic proteinase, partial cds
          Length = 492

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 469 cgcggtcctctctggatcctgggagacgtcttcatggg 506
           ||||||||||| ||||| || ||||| |||||||||||
Sbjct: 181 cgcggtcctctttggattcttggagatgtcttcatggg 218



to top

>dbj|AB047243.1| Suncus murinus pgnA mRNA for pepsinogen A, complete cds
          Length = 1362

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 478  ctctggatcctgggagacgtcttcat 503
            |||||||||||||| |||||||||||
Sbjct: 1144 ctctggatcctgggtgacgtcttcat 1169



to top

>ref|NM_116684.3| Arabidopsis thaliana aspartic-type endopeptidase/ pepsin A AT4G04460
            mRNA, complete cds
          Length = 1712

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                 
Query: 466  cctcgcggtcctctctggatcctgggagacgtcttcatgggcccgtaccacac 518
            ||||| || |||||||||||| |||| ||  |||||||||| || ||||||||
Sbjct: 1483 cctcgtggacctctctggatcttgggtgatatcttcatgggaccataccacac 1535



to top

>ref|XM_657624.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN5112.2), mRNA
          Length = 2349

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 459  cccgcctcctcgcggtcctct 479
            |||||||||||||||||||||
Sbjct: 2267 cccgcctcctcgcggtcctct 2247



to top

>emb|AL365502.57| Human DNA sequence from clone RP11-48C7 on chromosome 9q34.2-34.3
             Contains the gene for nasal embryonic luteinizing
             hormone-releasing hormone factor (DKFZP586J1624), a novel
             gene (FLJ31318), the MRPL41 gene for mitochondrial
             ribosomal protein L41 (RPML27, MRP-L270), a novel gene
             (LOC9271), the gene for melanin-concentrating hormone
             receptor 1 interacting zinc-finger protein (ZMYND17)
             (MIZIP), a novel gene (MGC40555), a novel protein and
             eleven CpG islands, complete sequence
          Length = 174995

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 485   tcctgggagacgtcttcatgg 505
             |||||||||||||||||||||
Sbjct: 15805 tcctgggagacgtcttcatgg 15785



to top

>emb|AL118509.9|HSJ770C23 Human DNA sequence from clone RP4-770C23 on chromosome 20 Contains part
             of the C20orf23 gene for a novel protein similar to KIF1
             type and other kinesin-like proteins, complete sequence
          Length = 81487

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 235   aacaagacccaggatctcata 255
             |||||||||||||||||||||
Sbjct: 13755 aacaagacccaggatctcata 13775



to top

>emb|AJ009838.1|PSI9838 Podarcis sicula mRNA for ovarian Cathepsin D
          Length = 1442

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 475  cctctctggatcctgggagacgtcttcat 503
            ||||| |||||||||||||| ||||||||
Sbjct: 1240 cctctttggatcctgggagatgtcttcat 1268



to top

>emb|AL832856.1|HSM804167 Homo sapiens mRNA; cDNA DKFZp667P1625 (from clone DKFZp667P1625)
          Length = 5327

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 485  tcctgggagacgtcttcatgg 505
            |||||||||||||||||||||
Sbjct: 4315 tcctgggagacgtcttcatgg 4335



to top

>dbj|AK221179.1| Arabidopsis thaliana mRNA for putative aspartic protease, complete
           cds, clone: RAFL22-98-B11
          Length = 536

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 466 cctcgcggtcctctctggatcctgggagacgtcttcatgggcccgtaccacac 518
           ||||| || |||||||||||| |||| ||  |||||||||| || ||||||||
Sbjct: 303 cctcgtggacctctctggatcttgggtgatatcttcatgggaccataccacac 355



to top

>gb|AF372974.1|AF372974 Arabidopsis thaliana AT4g04460/T26N6_7 mRNA, complete cds
          Length = 1677

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                 
Query: 466  cctcgcggtcctctctggatcctgggagacgtcttcatgggcccgtaccacac 518
            ||||| || |||||||||||| |||| ||  |||||||||| || ||||||||
Sbjct: 1467 cctcgtggacctctctggatcttgggtgatatcttcatgggaccataccacac 1519



to top

>emb|BX827174.1|CNS0A2UE Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS1ZB10 of Adult vegetative tissue of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 1688

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                 
Query: 466  cctcgcggtcctctctggatcctgggagacgtcttcatgggcccgtaccacac 518
            ||||| || |||||||||||| |||| ||  |||||||||| || ||||||||
Sbjct: 1483 cctcgtggacctctctggatcttgggtgatatcttcatgggaccataccacac 1535



to top

>emb|BX829292.1|CNS0A2OQ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTSIL89ZE03 of Silique of strain col-0 of Arabidopsis
            thaliana (thale cress)
          Length = 1593

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                 
Query: 466  cctcgcggtcctctctggatcctgggagacgtcttcatgggcccgtaccacac 518
            ||||| || |||||||||||| |||| ||  |||||||||| || ||||||||
Sbjct: 1434 cctcgtggacctctctggatcttgggtgatatcttcatgggaccataccacac 1486



to top

>dbj|AK024443.1| Homo sapiens mRNA for FLJ00033 protein, partial cds
          Length = 4150

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 485  tcctgggagacgtcttcatgg 505
            |||||||||||||||||||||
Sbjct: 3156 tcctgggagacgtcttcatgg 3176



to top

>gb|AY961419.1| Phytophthora infestans clone PB005D3 aspartic protease mRNA, complete
            cds
          Length = 1312

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                             
Query: 481  tggatcctgggagacgtcttcatgggcccgtaccacaccgtctttgact 529
            ||||||||||| |||||||||||| ||  | || |||| ||||||||||
Sbjct: 1103 tggatcctgggcgacgtcttcatgcgcaagcactacacagtctttgact 1151



to top

>gb|AE016877.1| Bacillus cereus ATCC 14579, complete genome
          Length = 5411809

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 222     ccaacttgcacagaacaagac 242
               |||||||||||||||||||||
Sbjct: 2791045 ccaacttgcacagaacaagac 2791025



to top

>gb|AF036319.1|AF036319 Sparus aurata cathepsin D mRNA, complete cds
          Length = 1837

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 66/81 (81%)
 Strand = Plus / Plus

                                                                        
Query: 448  gccatggacatcccgcctcctcgcggtcctctctggatcctgggagacgtcttcatgggc 507
            |||||||||||||| ||||||   || || || |||||||||||||| || ||||| || 
Sbjct: 1156 gccatggacatccctcctcctgcaggccccctgtggatcctgggagatgtattcatcggg 1215

                                 
Query: 508  ccgtaccacaccgtctttgac 528
              |||| |||| |||||||||
Sbjct: 1216 aagtactacactgtctttgac 1236



to top

>dbj|AB021787.1| Pyrus pyrifolia PPFRU11 mRNA for aspartic endopeptidase, partial
           cds
          Length = 1028

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 51/61 (83%)
 Strand = Plus / Plus

                                                                       
Query: 53  cacagcccaaaaagatctgctcccaggttggtctgtgcacctttgatgggactcgtggtg 112
           |||| ||| ||||||||||||| ||  ||||| | || || |||||||| ||||||||||
Sbjct: 308 cacaaccccaaaagatctgctctcaaattggtttctgtacttttgatggaactcgtggtg 367

            
Query: 113 t 113
           |
Sbjct: 368 t 368



to top

>gb|AC005105.3| Homo sapiens BAC clone CTA-491N20 from 7, complete sequence
          Length = 177206

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 416    gagctgctgcccagtgcatc 435
              ||||||||||||||||||||
Sbjct: 119896 gagctgctgcccagtgcatc 119877



to top

>emb|CT009567.9| Mouse DNA sequence from clone RP23-50H13 on chromosome 16, complete
            sequence
          Length = 213704

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 214  atgcagaaccaacttgcaca 233
            ||||||||||||||||||||
Sbjct: 6886 atgcagaaccaacttgcaca 6905



to top

>gb|AC161500.4| Mus musculus chromosome 7, clone RP23-145H5, complete sequence
          Length = 223833

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 45     agcagagacacagcccaaaaagat 68
              |||||||||| |||||||||||||
Sbjct: 109418 agcagagacagagcccaaaaagat 109441



to top

>emb|AL359641.10| Human DNA sequence from clone RP11-402K9 on chromosome Xq21.32-22.2
              Contains a novel pseudogene and a laminin receptor 1
              (ribosomal protein SA,67kDa) (LAMR1) pseudogene, complete
              sequence
          Length = 175132

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 144    tgaacctgtgaaatcaaatg 163
              ||||||||||||||||||||
Sbjct: 129083 tgaacctgtgaaatcaaatg 129064



to top

>emb|AL110503.2|HSJ1100I6 Human DNA sequence from clone RP5-1100I6 on chromosome 20 Contains a
             novel gene, a novel gene (FLJ33581) and a CpG island,
             complete sequence
          Length = 161525

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 200   tggctgttgtatggatgcag 219
             ||||||||||||||||||||
Sbjct: 24270 tggctgttgtatggatgcag 24289



to top

>gb|AC092211.7| Oryza sativa chromosome 10  P0031G09 genomic sequence, complete
             sequence
          Length = 17072

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 430   tgcatcagtggattcacagc 449
             ||||||||||||||||||||
Sbjct: 12136 tgcatcagtggattcacagc 12155



to top

>gb|AC091953.3| Homo sapiens chromosome 5 clone RP11-417J1, complete sequence
          Length = 172738

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 180    catgtgcagtgcctgtgagatggc 203
              ||||||||||||||||||| ||||
Sbjct: 163525 catgtgcagtgcctgtgaggtggc 163502



to top

>gb|AC110785.2| Homo sapiens BAC clone RP11-455I7 from 4, complete sequence
          Length = 100987

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 144   tgaacctgtgaaatcaaatg 163
             ||||||||||||||||||||
Sbjct: 34098 tgaacctgtgaaatcaaatg 34079



to top

>gb|AC027328.4| Homo sapiens chromosome 5 clone CTD-2136J7, complete sequence
          Length = 88303

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 180   catgtgcagtgcctgtgagatggc 203
             ||||||||||||||||||| ||||
Sbjct: 83949 catgtgcagtgcctgtgaggtggc 83972



to top

>gb|AF259982.1|AF259982 Ipomoea batatas putative aspartic protease mRNA, complete cds
          Length = 1565

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 193  tgtgagatggctgttgtatggatgcagaacca 224
            ||||||||||||||| | ||| ||||||||||
Sbjct: 1181 tgtgagatggctgttatttggttgcagaacca 1212



to top

>ref|XM_397192.2| PREDICTED: Apis mellifera similar to ENSANGP00000010721 (LOC413753),
            mRNA
          Length = 6921

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 7    tttctcaatatggacaacag 26
            ||||||||||||||||||||
Sbjct: 4514 tttctcaatatggacaacag 4533



to top

>dbj|AB080684.1| Xenopus laevis CE1 mRNA for cathepsin E1, complete cd
          Length = 1604

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 475  cctctctggatcctgggaga 494
            ||||||||||||||||||||
Sbjct: 1105 cctctctggatcctgggaga 1124



to top

>dbj|AB179551.1| Takifugu rubripes NTS mRNA for nothepsin, complete cds
          Length = 1245

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                            
Query: 481  tggatcctgggagacgtcttcatgggcccgtaccacaccgtctttgac 528
            ||||||||||||||||| ||| ||  || |||| ||| ||||||||||
Sbjct: 1144 tggatcctgggagacgtgttcctgacccagtactacagcgtctttgac 1191



to top

>dbj|AB179548.1| Takifugu rubripes CTSD1 mRNA for cathepsin D1, complete cds
          Length = 1191

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                        
Query: 481  tggatcctgggagacgtcttcatgggcccgtaccacaccgtctt 524
            |||||||| ||||||||||| || || | |||| ||||||||||
Sbjct: 1105 tggatccttggagacgtctttattggtcagtactacaccgtctt 1148



to top

>gb|AC002087.1|HSAC002087 Human BAC clone GS1-113D4 from 5p15.2, complete sequence
          Length = 154028

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 180    catgtgcagtgcctgtgagatggc 203
              ||||||||||||||||||| ||||
Sbjct: 141260 catgtgcagtgcctgtgaggtggc 141237



to top

>gb|AC138272.11| Mus musculus chromosome 7, clone RP23-91H13, complete sequence
          Length = 234237

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 45     agcagagacacagcccaaaaagat 68
              |||||||||| |||||||||||||
Sbjct: 191552 agcagagacagagcccaaaaagat 191529



to top

>gb|AC002131.1|F12F1 Arabidopsis thaliana chromosome 1 BAC F12F1 sequence, complete sequence
          Length = 123386

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                             
Query: 482   ggatcctgggagacgtcttcatgggcccgtaccacaccgtctttgact 529
             ||||| ||||||| || |||||||||   ||||||||||| |||||||
Sbjct: 97421 ggatcttgggagatgtgttcatgggcaaataccacaccgtatttgact 97468



 Score = 40.1 bits (20), Expect = 7.5
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 193   tgtgagatggctgttgtatggatgcaga 220
             ||||||||||||||||| ||||| ||||
Sbjct: 96859 tgtgagatggctgttgtgtggatccaga 96886



to top

>gb|U55032.1|BNU55032 Brassica napus aspartic protease gene, complete cds
          Length = 5381

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                            
Query: 482  ggatcctgggagacgtcttcatgggcccgtaccacaccgtctttgact 529
            ||||||| ||||| || |||||||||   ||||||||||| |||||||
Sbjct: 4766 ggatccttggagatgtgttcatgggcaaataccacaccgtgtttgact 4813



 Score = 40.1 bits (20), Expect = 7.5
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                                
Query: 50   agacacagcccaaaaagatctgctcccaggttggtctgtgcacctttgatgg 101
            |||| ||||| || || |||||||| ||| ||||||||||||| || |||||
Sbjct: 3950 agacccagccgaagaaaatctgctcgcagattggtctgtgcactttcgatgg 4001



to top

>gb|AC093490.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1127_B08,
             complete sequence
          Length = 112268

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 193   tgtgagatggctgttgtatggatgcagaacca 224
             ||||||||||||||||| |||||  |||||||
Sbjct: 84227 tgtgagatggctgttgtgtggatagagaacca 84258


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,156,412
Number of Sequences: 3902068
Number of extensions: 4156412
Number of successful extensions: 85997
Number of sequences better than 10.0: 163
Number of HSP's better than 10.0 without gapping: 162
Number of HSP's successfully gapped in prelim test: 2
Number of HSP's that attempted gapping in prelim test: 85589
Number of HSP's gapped (non-prelim): 394
length of query: 556
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 533
effective length of database: 17,143,297,704
effective search space: 9137377676232
effective search space used: 9137377676232
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top