| Clone Name | basd2f14 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AC137744.2| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone OSJNBa0074L11, complete sequence Length = 180703 Score = 117 bits (59), Expect = 1e-23 Identities = 135/160 (84%), Gaps = 1/160 (0%) Strand = Plus / Minus Query: 4 gggtattaacacactcctctcactggnggagacttatgctgacttcaccccagttaggat 63 |||||| ||||| || |||||||| | |||||| ||||||||| |||||||||||||||| Sbjct: 61908 gggtatcaacacgcttctctcactcgaggagacgtatgctgacatcaccccagttaggat 61849 Query: 64 ttctgacaattcggttacggcgttcgtgtcagttatgaggggttgtaacaaatatgngct 123 ||||||||||| || || || || || ||| ||||||||||||| ||| |||||| ||| Sbjct: 61848 ctctgacaattcagtgaccgcatttgtatcaattatgaggggttgcaac-aatatgtgct 61790 Query: 124 cgttttgcattgntcccttcactagaggcagggagaggtc 163 | ||||| || | ||| ||||||||||| ||||| ||||| Sbjct: 61789 ccttttgtatcgttcctttcactagaggtagggaaaggtc 61750
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 117 bits (59), Expect = 1e-23 Identities = 135/160 (84%), Gaps = 1/160 (0%) Strand = Plus / Minus Query: 4 gggtattaacacactcctctcactggnggagacttatgctgacttcaccccagttaggat 63 |||||| ||||| || |||||||| | |||||| ||||||||| |||||||||||||||| Sbjct: 21709855 gggtatcaacacgcttctctcactcgaggagacgtatgctgacatcaccccagttaggat 21709796 Query: 64 ttctgacaattcggttacggcgttcgtgtcagttatgaggggttgtaacaaatatgngct 123 ||||||||||| || || || || || ||| ||||||||||||| ||| |||||| ||| Sbjct: 21709795 ctctgacaattcagtgaccgcatttgtatcaattatgaggggttgcaac-aatatgtgct 21709737 Query: 124 cgttttgcattgntcccttcactagaggcagggagaggtc 163 | ||||| || | ||| ||||||||||| ||||| ||||| Sbjct: 21709736 ccttttgtatcgttcctttcactagaggtagggaaaggtc 21709697
>dbj|AK066319.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013067A17, full insert sequence Length = 2156 Score = 117 bits (59), Expect = 1e-23 Identities = 135/160 (84%), Gaps = 1/160 (0%) Strand = Plus / Plus Query: 4 gggtattaacacactcctctcactggnggagacttatgctgacttcaccccagttaggat 63 |||||| ||||| || |||||||| | |||||| ||||||||| |||||||||||||||| Sbjct: 685 gggtatcaacacgcttctctcactcgaggagacgtatgctgacatcaccccagttaggat 744 Query: 64 ttctgacaattcggttacggcgttcgtgtcagttatgaggggttgtaacaaatatgngct 123 ||||||||||| || || || || || ||| ||||||||||||| ||| |||||| ||| Sbjct: 745 ctctgacaattcagtgaccgcatttgtatcaattatgaggggttgcaac-aatatgtgct 803 Query: 124 cgttttgcattgntcccttcactagaggcagggagaggtc 163 | ||||| || | ||| ||||||||||| ||||| ||||| Sbjct: 804 ccttttgtatcgttcctttcactagaggtagggaaaggtc 843
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 117 bits (59), Expect = 1e-23 Identities = 135/160 (84%), Gaps = 1/160 (0%) Strand = Plus / Minus Query: 4 gggtattaacacactcctctcactggnggagacttatgctgacttcaccccagttaggat 63 |||||| ||||| || |||||||| | |||||| ||||||||| |||||||||||||||| Sbjct: 22020054 gggtatcaacacgcttctctcactcgaggagacgtatgctgacatcaccccagttaggat 22019995 Query: 64 ttctgacaattcggttacggcgttcgtgtcagttatgaggggttgtaacaaatatgngct 123 ||||||||||| || || || || || ||| ||||||||||||| ||| |||||| ||| Sbjct: 22019994 ctctgacaattcagtgaccgcatttgtatcaattatgaggggttgcaac-aatatgtgct 22019936 Query: 124 cgttttgcattgntcccttcactagaggcagggagaggtc 163 | ||||| || | ||| ||||||||||| ||||| ||||| Sbjct: 22019935 ccttttgtatcgttcctttcactagaggtagggaaaggtc 22019896
>dbj|AP006712.1| Lotus japonicus genomic DNA, chromosome 2, clone:LjT17E09, TM0627, complete sequence Length = 101220 Score = 54.0 bits (27), Expect = 1e-04 Identities = 59/69 (85%), Gaps = 1/69 (1%) Strand = Plus / Minus Query: 98 atgaggggttgtaacaaatatgngctcgttttgcattgntcccttcactagaggcaggga 157 ||||||||||| ||||| |||| |||| ||||| |||| || |||||||||||||| || Sbjct: 84981 atgaggggttgcaacaa-tatgtgctcattttgtattgtacctttcactagaggcagaga 84923 Query: 158 gaggtcacg 166 | ||||||| Sbjct: 84922 gcggtcacg 84914
>dbj|AB120535.2| Nicotiana tabacum NtCAPL mRNA, complete cds Length = 2160 Score = 48.1 bits (24), Expect = 0.009 Identities = 34/38 (89%) Strand = Plus / Plus Query: 114 aatatgngctcgttttgcattgntcccttcactagagg 151 |||||| |||| || ||||||| ||||||||||||||| Sbjct: 906 aatatgtgctcattctgcattgttcccttcactagagg 943
>gb|BT013845.1| Lycopersicon esculentum clone 132802F, mRNA sequence Length = 2181 Score = 40.1 bits (20), Expect = 2.2 Identities = 22/23 (95%) Strand = Plus / Plus Query: 129 tgcattgntcccttcactagagg 151 ||||||| ||||||||||||||| Sbjct: 921 tgcattgttcccttcactagagg 943
>emb|AL031717.11|HS361A3 Human DNA sequence from clone LA16c-361A3 on chromosome 16 Contains part of gene simliar to murine JNK/SAPK-associated protein-1, STSs, GSSs and CpG islands, complete sequence Length = 43288 Score = 40.1 bits (20), Expect = 2.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 151 gcagggagaggtcacggccc 170 |||||||||||||||||||| Sbjct: 40651 gcagggagaggtcacggccc 40632
>gb|AC012180.6| Homo sapiens chromosome 16 clone RP11-31I10, complete sequence Length = 69437 Score = 40.1 bits (20), Expect = 2.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 151 gcagggagaggtcacggccc 170 |||||||||||||||||||| Sbjct: 165 gcagggagaggtcacggccc 146
>gb|AE006639.1| Homo sapiens 16p13.3 sequence section 7 of 8 Length = 270150 Score = 40.1 bits (20), Expect = 2.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 151 gcagggagaggtcacggccc 170 |||||||||||||||||||| Sbjct: 154541 gcagggagaggtcacggccc 154522
>gb|AC159225.4| Mus musculus chromosome 1, clone RP24-306F17, complete sequence Length = 168805 Score = 38.2 bits (19), Expect = 8.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 56 gttaggatttctgacaatt 74 ||||||||||||||||||| Sbjct: 71500 gttaggatttctgacaatt 71482
>gb|AC112521.4| Mus musculus BAC clone RP23-186C6 from 9, complete sequence Length = 230334 Score = 38.2 bits (19), Expect = 8.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 147 agaggcagggagaggtcac 165 ||||||||||||||||||| Sbjct: 188392 agaggcagggagaggtcac 188374
>gb|AC102568.8| Mus musculus chromosome 1, clone RP23-224O10, complete sequence Length = 239053 Score = 38.2 bits (19), Expect = 8.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 56 gttaggatttctgacaatt 74 ||||||||||||||||||| Sbjct: 33405 gttaggatttctgacaatt 33423
>gb|AC073048.7| Homo sapiens BAC clone RP11-54E21 from 7, complete sequence Length = 166183 Score = 38.2 bits (19), Expect = 8.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 142 tcactagaggcagggagag 160 ||||||||||||||||||| Sbjct: 52923 tcactagaggcagggagag 52941
>ref|XM_845253.1| PREDICTED: Canis familiaris hypothetical protein LOC608278 (LOC608278), mRNA Length = 1179 Score = 38.2 bits (19), Expect = 8.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 151 gcagggagaggtcacggcc 169 ||||||||||||||||||| Sbjct: 844 gcagggagaggtcacggcc 862
>gb|AC159149.10| Mus musculus 10 BAC RP23-56F17 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 219585 Score = 38.2 bits (19), Expect = 8.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 89 gtgtcagttatgaggggtt 107 ||||||||||||||||||| Sbjct: 93459 gtgtcagttatgaggggtt 93441
>emb|AL356157.14| Human DNA sequence from clone RP11-733D4 on chromosome 10 Contains part of a novel gene, complete sequence Length = 198917 Score = 38.2 bits (19), Expect = 8.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 tagaggcagggagaggtca 164 ||||||||||||||||||| Sbjct: 164700 tagaggcagggagaggtca 164718
>emb|AL121581.41|HS1022E24 Human DNA sequence from clone RP5-1022E24 on chromosome 20 Contains the 3' end of the OPRL1 gene for opiate receptor-like 1 protein, the GPR8 gene encoding a G protein-coupled receptor, the KIAA0835 gene encoding a protein similar to the myelin transcription factor 1 (MYT1), a novel gene, 7 CpG islands, ESTs, STSs and GSSs, complete sequence Length = 179888 Score = 38.2 bits (19), Expect = 8.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 144 actagaggcagggagaggt 162 ||||||||||||||||||| Sbjct: 108454 actagaggcagggagaggt 108472
>gb|AC018517.7| Homo sapiens, clone RP11-115N12, complete sequence Length = 180917 Score = 38.2 bits (19), Expect = 8.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 45 acttcaccccagttaggat 63 ||||||||||||||||||| Sbjct: 78719 acttcaccccagttaggat 78701
>gb|AC155637.4| Mus musculus 10 BAC RP24-227O16 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 159189 Score = 38.2 bits (19), Expect = 8.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 89 gtgtcagttatgaggggtt 107 ||||||||||||||||||| Sbjct: 3925 gtgtcagttatgaggggtt 3943
>gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete sequence Length = 2648638 Score = 38.2 bits (19), Expect = 8.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 38 tatgctgacttcaccccag 56 ||||||||||||||||||| Sbjct: 2111252 tatgctgacttcaccccag 2111270
>pdb|486D|F Chain F, X-Ray Crystal Structures Of 70s Ribosome Functional Complexes Length = 85 Score = 38.2 bits (19), Expect = 8.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 44 gacttcaccccagttagga 62 ||||||||||||||||||| Sbjct: 84 gacttcaccccagttagga 66 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 948,116 Number of Sequences: 3902068 Number of extensions: 948116 Number of successful extensions: 87778 Number of sequences better than 10.0: 22 Number of HSP's better than 10.0 without gapping: 22 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 87673 Number of HSP's gapped (non-prelim): 100 length of query: 177 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 155 effective length of database: 17,147,199,772 effective search space: 2657815964660 effective search space used: 2657815964660 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)