ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name basd1o11
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|BT018814.1| Zea mays clone EL01N0531A02.d mRNA sequence 58 3e-05
2gb|AF215854.1|AF215854 Zea mays hexose transporter (pGlcT) mRNA,... 58 3e-05
3gb|AY112449.1| Zea mays CL1214_1 mRNA sequence 58 3e-05
4ref|XM_550032.1| Oryza sativa (japonica cultivar-group), mRNA 52 0.002
5dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 52 0.002
6dbj|AP003214.3| Oryza sativa (japonica cultivar-group) genomic D... 52 0.002
7dbj|AK065247.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.002
8emb|CR381641.12| Zebrafish DNA sequence from clone DKEY-189N10 i... 44 0.48
9gb|AC153602.6| Mus musculus 6 BAC RP23-374K11 (Roswell Park Canc... 42 1.9
10gb|AC167243.3| Mus musculus BAC clone RP24-144E2 from chromosome... 40 7.5
11gb|BC100141.1| Rattus norvegicus HLA-B-associated transcript 3, ... 40 7.5
12ref|NM_182844.1| Rattus norvegicus myosin VIIA and Rab interacti... 40 7.5
13gb|AC137848.31| Mus musculus chromosome 9, clone RP24-118I23, co... 40 7.5
14ref|NM_001033968.1| Rattus norvegicus HLA-B-associated transcrip... 40 7.5
15ref|NM_053609.2| Rattus norvegicus HLA-B-associated transcript 3... 40 7.5
16gb|AC102661.7| Mus musculus chromosome 3, clone RP23-114K16, com... 40 7.5
17ref|XM_420550.1| PREDICTED: Gallus gallus similar to protein tyr... 40 7.5
18gb|AC165242.6| Mus musculus chromosome 3, clone RP24-98F15, comp... 40 7.5
19ref|XM_001001862.1| PREDICTED: Mus musculus myosin VIIA and Rab ... 40 7.5
20ref|XM_001001869.1| PREDICTED: Mus musculus myosin VIIA and Rab ... 40 7.5
21emb|AJ508935.1|PFR508935 Propionibacterium freudenreichii subsp.... 40 7.5
22gb|AY294063.1| Pinus monticola putative NBS-LRR protein GI5033 (... 40 7.5
23gb|AY331984.1| Rattus norvegicus myosin VIIA and Rab interacting... 40 7.5
24emb|AL035687.13|HS142O9 Human DNA sequence from clone RP1-142O9 ... 40 7.5
25emb|BX883045.1| Rattus norvegicus chromosome 20, major histocomp... 40 7.5
26emb|AL606512.8| Mouse DNA sequence from clone RP23-155D19 on chr... 40 7.5
27gb|BC085713.1| Rattus norvegicus phosphate cytidylyltransferase ... 40 7.5
28gb|AY099470.1| Mus musculus exophilin 8 mRNA, complete cds 40 7.5
29gb|AF396688.1| Mus musculus rab effector MYRIP (Myrip) mRNA, com... 40 7.5
30dbj|AK148358.1| Mus musculus B16 F10Y cells cDNA, RIKEN full-len... 40 7.5
31dbj|AK038988.1| Mus musculus adult male hypothalamus cDNA, RIKEN... 40 7.5
32dbj|AK083225.1| Mus musculus adult male hippocampus cDNA, RIKEN ... 40 7.5
33gb|AY585926.1| Paxillus involutus strain ATCC 200175 CipC1 prote... 40 7.5
34gb|AC147283.3| Pan troglodytes BAC clone RP43-94K2 from chromoso... 40 7.5
35gb|AC083861.2|AC083861 Homo sapiens chromosome 7 clone RP11-164E... 40 7.5
36gb|AC007444.1|AC007444 Homo sapiens clone RP11-340F1 from 7p14-1... 40 7.5
37dbj|AB083782.1| Mus musculus slac2-c mRNA for Slp homologue lack... 40 7.5
38ref|NM_144557.2| Mus musculus myosin VIIA and Rab interacting pr... 40 7.5
39dbj|AB018791.1| Rattus norvegicus mRNA for BAT3, complete cds 40 7.5 
>gb|BT018814.1| Zea mays clone EL01N0531A02.d mRNA sequence
          Length = 2008

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                 
Query: 9    ctgtacatagccggcaatgtggtcgagaccaaggggcgatccctacaagagat 61
            ||||||||||| || |||||||||||| |||||||| |||||||  |||||||
Sbjct: 1668 ctgtacatagctgggaatgtggtcgagcccaaggggagatcccttgaagagat 1720
to top
>gb|AF215854.1|AF215854 Zea mays hexose transporter (pGlcT) mRNA, partial cds; nuclear gene
            for chloroplast product
          Length = 1874

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                     
Query: 9    ctgtacatagccggcaatgtggtcgagaccaaggggcgatc 49
            ||||||||||| || ||||||||||||||||||||| ||||
Sbjct: 1550 ctgtacatagctgggaatgtggtcgagaccaaggggagatc 1590
to top
>gb|AY112449.1| Zea mays CL1214_1 mRNA sequence
          Length = 1905

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                     
Query: 9    ctgtacatagccggcaatgtggtcgagaccaaggggcgatc 49
            ||||||||||| || ||||||||||||||||||||| ||||
Sbjct: 1550 ctgtacatagctgggaatgtggtcgagaccaaggggagatc 1590
to top
>ref|XM_550032.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1980

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 50/58 (86%)
 Strand = Plus / Plus

                                                                      
Query: 12   tacatagccggcaatgtggtcgagaccaaggggcgatccctacaagagatcgagcggg 69
            |||||||| || |||||||| |||||||||||||| || ||  ||||||| |||||||
Sbjct: 1552 tacatagctggaaatgtggttgagaccaaggggcgttctctggaagagattgagcggg 1609
to top
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
               sequence
          Length = 43261740

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 50/58 (86%)
 Strand = Plus / Plus

                                                                         
Query: 12      tacatagccggcaatgtggtcgagaccaaggggcgatccctacaagagatcgagcggg 69
               |||||||| || |||||||| |||||||||||||| || ||  ||||||| |||||||
Sbjct: 1847674 tacatagctggaaatgtggttgagaccaaggggcgttctctggaagagattgagcggg 1847731
to top
>dbj|AP003214.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:OSJNBa0083M16
          Length = 179428

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 50/58 (86%)
 Strand = Plus / Plus

                                                                       
Query: 12    tacatagccggcaatgtggtcgagaccaaggggcgatccctacaagagatcgagcggg 69
             |||||||| || |||||||| |||||||||||||| || ||  ||||||| |||||||
Sbjct: 89056 tacatagctggaaatgtggttgagaccaaggggcgttctctggaagagattgagcggg 89113
to top
>dbj|AK065247.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002J01, full
            insert sequence
          Length = 1982

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 50/58 (86%)
 Strand = Plus / Plus

                                                                      
Query: 12   tacatagccggcaatgtggtcgagaccaaggggcgatccctacaagagatcgagcggg 69
            |||||||| || |||||||| |||||||||||||| || ||  ||||||| |||||||
Sbjct: 1552 tacatagctggaaatgtggttgagaccaaggggcgttctctggaagagattgagcggg 1609
to top
>emb|CR381641.12| Zebrafish DNA sequence from clone DKEY-189N10 in linkage group 7,
             complete sequence
          Length = 168455

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 293   aatcaaagagctgctgtgttgt 314
             ||||||||||||||||||||||
Sbjct: 31053 aatcaaagagctgctgtgttgt 31032
to top
>gb|AC153602.6| Mus musculus 6 BAC RP23-374K11 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 194925

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 345    tgctagtccttggatgtcatc 365
              |||||||||||||||||||||
Sbjct: 127218 tgctagtccttggatgtcatc 127198
to top
>gb|AC167243.3| Mus musculus BAC clone RP24-144E2 from chromosome 9, complete sequence
          Length = 193364

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 242   gggtttgctgtgtctgccag 261
             ||||||||||||||||||||
Sbjct: 69247 gggtttgctgtgtctgccag 69228
to top
>gb|BC100141.1| Rattus norvegicus HLA-B-associated transcript 3, transcript variant
            1, mRNA (cDNA clone MGC:114288 IMAGE:7315623), complete
            cds
          Length = 3651

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 152  acctggggatgctgcctctg 171
            ||||||||||||||||||||
Sbjct: 1303 acctggggatgctgcctctg 1284
to top
>ref|NM_182844.1| Rattus norvegicus myosin VIIA and Rab interacting protein (Myrip),
           mRNA
          Length = 2571

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 242 gggtttgctgtgtctgccag 261
           ||||||||||||||||||||
Sbjct: 305 gggtttgctgtgtctgccag 324
to top
>gb|AC137848.31| Mus musculus chromosome 9, clone RP24-118I23, complete sequence
          Length = 190317

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 242    gggtttgctgtgtctgccag 261
              ||||||||||||||||||||
Sbjct: 101284 gggtttgctgtgtctgccag 101303
to top
>ref|NM_001033968.1| Rattus norvegicus HLA-B-associated transcript 3 (Bat3), transcript
            variant 1, mRNA
          Length = 3651

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 152  acctggggatgctgcctctg 171
            ||||||||||||||||||||
Sbjct: 1303 acctggggatgctgcctctg 1284
to top
>ref|NM_053609.2| Rattus norvegicus HLA-B-associated transcript 3 (Bat3), transcript
            variant 2, mRNA
          Length = 3659

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 152  acctggggatgctgcctctg 171
            ||||||||||||||||||||
Sbjct: 1461 acctggggatgctgcctctg 1442
to top
>gb|AC102661.7| Mus musculus chromosome 3, clone RP23-114K16, complete sequence
          Length = 176493

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 299  agagctgctgtgttgttgct 318
            ||||||||||||||||||||
Sbjct: 1000 agagctgctgtgttgttgct 981
to top
>ref|XM_420550.1| PREDICTED: Gallus gallus similar to protein tyrosine phosphatase,
            non-receptor type 13 isoform 2; protein tyrosine
            phosphatase, nonreceptor type 13; protein-tyrosine
            phosphatase PTPL1; protein tyrosine phosphatase 1E;
            Fas-associated phosphatase-1; protein-tyrosine
            phosphat... (LOC422591), mRNA
          Length = 9658

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 459  gtaatattcatcatctggaa 478
            ||||||||||||||||||||
Sbjct: 7536 gtaatattcatcatctggaa 7517
to top
>gb|AC165242.6| Mus musculus chromosome 3, clone RP24-98F15, complete sequence
          Length = 185876

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 299   agagctgctgtgttgttgct 318
             ||||||||||||||||||||
Sbjct: 53519 agagctgctgtgttgttgct 53538
to top
>ref|XM_001001862.1| PREDICTED: Mus musculus myosin VIIA and Rab interacting protein,
           transcript variant 1 (Myrip), mRNA
          Length = 3395

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 242 gggtttgctgtgtctgccag 261
           ||||||||||||||||||||
Sbjct: 466 gggtttgctgtgtctgccag 485
to top
>ref|XM_001001869.1| PREDICTED: Mus musculus myosin VIIA and Rab interacting protein,
           transcript variant 2 (Myrip), mRNA
          Length = 3421

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 242 gggtttgctgtgtctgccag 261
           ||||||||||||||||||||
Sbjct: 466 gggtttgctgtgtctgccag 485
to top
>emb|AJ508935.1|PFR508935 Propionibacterium freudenreichii subsp. shermanii eno1 gene for
           enolase 1
          Length = 1290

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 20  cggcaatgtggtcgagacca 39
           ||||||||||||||||||||
Sbjct: 204 cggcaatgtggtcgagacca 223
to top
>gb|AY294063.1| Pinus monticola putative NBS-LRR protein GI5033 (RGA) gene, partial
           cds
          Length = 516

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 278 ctcatcacatctcagaatca 297
           ||||||||||||||||||||
Sbjct: 319 ctcatcacatctcagaatca 338
to top
>gb|AY331984.1| Rattus norvegicus myosin VIIA and Rab interacting protein (Myrip)
           mRNA, complete cds
          Length = 2571

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 242 gggtttgctgtgtctgccag 261
           ||||||||||||||||||||
Sbjct: 305 gggtttgctgtgtctgccag 324
to top
>emb|AL035687.13|HS142O9 Human DNA sequence from clone RP1-142O9 on chromosome 6p11.1-12.3
             Contains a eukaryotic translation elongation factor 1
             alpha 1 (EEF1A1) pseudogene and a zinc finger (ZNF216)
             pseudogene, complete sequence
          Length = 131546

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 401   catcattaggaaataaaact 420
             ||||||||||||||||||||
Sbjct: 45519 catcattaggaaataaaact 45500
to top
>emb|BX883045.1| Rattus norvegicus chromosome 20, major histocompatibility complex,
              assembled from 40 BACs, strain Brown Norway (BN/ssNHsd),
              RT1n haplotype; segment 4/11
          Length = 346406

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 152    acctggggatgctgcctctg 171
              ||||||||||||||||||||
Sbjct: 339264 acctggggatgctgcctctg 339245
to top
>emb|AL606512.8| Mouse DNA sequence from clone RP23-155D19 on chromosome 11, complete
              sequence
          Length = 157494

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 465    ttcatcatctggaaatgctc 484
              ||||||||||||||||||||
Sbjct: 128838 ttcatcatctggaaatgctc 128819
to top
>gb|BC085713.1| Rattus norvegicus phosphate cytidylyltransferase 1, choline, alpha
            isoform, mRNA (cDNA clone MGC:93248 IMAGE:7127059),
            complete cds
          Length = 4343

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 312  tgttgcttctggaggtggac 331
            ||||||||||||||||||||
Sbjct: 2376 tgttgcttctggaggtggac 2357
to top
>gb|AY099470.1| Mus musculus exophilin 8 mRNA, complete cds
          Length = 2670

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 242 gggtttgctgtgtctgccag 261
           ||||||||||||||||||||
Sbjct: 341 gggtttgctgtgtctgccag 360
to top
>gb|AF396688.1| Mus musculus rab effector MYRIP (Myrip) mRNA, complete cds
          Length = 2632

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 242 gggtttgctgtgtctgccag 261
           ||||||||||||||||||||
Sbjct: 328 gggtttgctgtgtctgccag 347
to top
>dbj|AK148358.1| Mus musculus B16 F10Y cells cDNA, RIKEN full-length enriched
           library, clone:G370108P05 product:myosin VIIA and Rab
           interacting protein, full insert sequence
          Length = 3862

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 242 gggtttgctgtgtctgccag 261
           ||||||||||||||||||||
Sbjct: 584 gggtttgctgtgtctgccag 603
to top
>dbj|AK038988.1| Mus musculus adult male hypothalamus cDNA, RIKEN full-length
           enriched library, clone:A230081N12 product:hypothetical
           FYVE/PHD zinc finger structure containing protein, full
           insert sequence
          Length = 3512

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 242 gggtttgctgtgtctgccag 261
           ||||||||||||||||||||
Sbjct: 420 gggtttgctgtgtctgccag 439
to top
>dbj|AK083225.1| Mus musculus adult male hippocampus cDNA, RIKEN full-length
           enriched library, clone:C630029J04 product:hypothetical
           Cysteine-rich region containing protein, full insert
           sequence
          Length = 4763

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 242 gggtttgctgtgtctgccag 261
           ||||||||||||||||||||
Sbjct: 467 gggtttgctgtgtctgccag 486
to top
>gb|AY585926.1| Paxillus involutus strain ATCC 200175 CipC1 protein (cipC1) mRNA,
           complete cds
          Length = 435

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 28  tggtcgagaccaaggggcga 47
           ||||||||||||||||||||
Sbjct: 265 tggtcgagaccaaggggcga 284
to top
>gb|AC147283.3| Pan troglodytes BAC clone RP43-94K2 from chromosome 7, complete sequence
          Length = 171112

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 275    cttctcatcacatctcagaatcaa 298
              ||||||| ||||||||||||||||
Sbjct: 131716 cttctcaacacatctcagaatcaa 131739
to top
>gb|AC083861.2|AC083861 Homo sapiens chromosome 7 clone RP11-164E6, complete sequence
          Length = 147288

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 275   cttctcatcacatctcagaatcaa 298
             ||||||| ||||||||||||||||
Sbjct: 11543 cttctcaacacatctcagaatcaa 11520
to top
>gb|AC007444.1|AC007444 Homo sapiens clone RP11-340F1 from 7p14-15, complete sequence
          Length = 156940

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 275    cttctcatcacatctcagaatcaa 298
              ||||||| ||||||||||||||||
Sbjct: 116521 cttctcaacacatctcagaatcaa 116498
to top
>dbj|AB083782.1| Mus musculus slac2-c mRNA for Slp homologue lacking C2 domains-c,
           complete cds
          Length = 2571

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 242 gggtttgctgtgtctgccag 261
           ||||||||||||||||||||
Sbjct: 305 gggtttgctgtgtctgccag 324
to top
>ref|NM_144557.2| Mus musculus myosin VIIA and Rab interacting protein (Myrip), mRNA
          Length = 4763

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 242 gggtttgctgtgtctgccag 261
           ||||||||||||||||||||
Sbjct: 467 gggtttgctgtgtctgccag 486
to top
>dbj|AB018791.1| Rattus norvegicus mRNA for BAT3, complete cds
          Length = 3617

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 152  acctggggatgctgcctctg 171
            ||||||||||||||||||||
Sbjct: 1417 acctggggatgctgcctctg 1398


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,985,284
Number of Sequences: 3902068
Number of extensions: 3985284
Number of successful extensions: 70761
Number of sequences better than 10.0: 39
Number of HSP's better than 10.0 without gapping: 39
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 70677
Number of HSP's gapped (non-prelim): 84
length of query: 552
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 529
effective length of database: 17,143,297,704
effective search space: 9068804485416
effective search space used: 9068804485416
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top