ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name basd2b13
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1emb|AJ635206.1| Triticum durum ssp. durum partial mRNA for putat... 90 6e-16
2gb|M37477.1|WHTRUBIAB T.aestivum ribulose-1,5-bisphosphate carbo... 90 6e-16
3gb|M37328.1|WHTRUBIAA T.aestivum ribulose-1,5-bisphosphate carbo... 90 6e-16
4dbj|AB020958.1| Triticum aestivum DNA for ribulose-1,5-bisphosph... 90 6e-16
5dbj|AB020955.1| Triticum timopheevii subsp. armeniacum DNA for r... 90 6e-16
6dbj|AB020954.1| Triticum urartu DNA for ribulose-1,5-bisphosphat... 90 6e-16
7dbj|AB020952.1| Aegilops searsii DNA for ribulose-1,5-bisphospha... 90 6e-16
8dbj|AB020950.1| Aegilops sharonensis DNA for ribulose-1,5-bispho... 90 6e-16
9dbj|AB020949.1| Aegilops longissima DNA for ribulose-1,5-bisphos... 90 6e-16
10dbj|AB020947.1| Aegilops speltoides DNA for ribulose-1,5-bisphos... 90 6e-16
11dbj|AB020946.1| Aegilops speltoides DNA for ribulose-1,5-bisphos... 90 6e-16
12dbj|AB020935.1| Aegilops sharonensis DNA for ribulose-1,5-bispho... 90 6e-16
13dbj|AB020934.1| Aegilops longissima DNA for ribulose-1,5-bisphos... 90 6e-16
14dbj|AB020933.1| Aegilops longissima DNA for ribulose-1,5-bisphos... 90 6e-16
15dbj|AB020932.1| Aegilops longissima DNA for ribulose-1,5-bisphos... 90 6e-16
16dbj|AB020928.1| Aegilops speltoides DNA for ribulose-1,5-bisphos... 90 6e-16
17emb|X00234.1|TARUB1 Wheat mRNA fragment for small subunit precur... 86 1e-14
18emb|AJ131738.1|SCE131738 Secale cereale mRNA for hypothetical pr... 86 1e-14
19dbj|AB020959.1| Secale cereale DNA for ribulose-1,5-bisphosphate... 82 2e-13
20dbj|AB020957.1| Triticum aestivum DNA for ribulose-1,5-bisphosph... 82 2e-13
21dbj|AB020956.1| Triticum turgidum subsp. dicoccoides DNA for rib... 82 2e-13
22dbj|AB020953.1| Aegilops squarrosa DNA for ribulose-1,5-bisphosp... 82 2e-13
23dbj|AB020951.1| Aegilops bicornis DNA for ribulose-1,5-bisphosph... 82 2e-13
24dbj|AB020948.1| Aegilops speltoides DNA for ribulose-1,5-bisphos... 82 2e-13
25dbj|AB020944.1| Agropyron intermedium DNA for ribulose-1,5-bisph... 82 2e-13
26dbj|AB020943.1| Hordeum vulgare DNA for ribulose-1,5-bisphosphat... 82 2e-13
27dbj|AB020938.1| Aegilops squarrosa DNA for ribulose-1,5-bisphosp... 82 2e-13
28dbj|AB020937.1| Aegilops searsii DNA for ribulose-1,5-bisphospha... 82 2e-13
29dbj|AB020936.1| Aegilops bicornis DNA for ribulose-1,5-bisphosph... 82 2e-13
30dbj|AB020931.1| Aegilops speltoides DNA for ribulose-1,5-bisphos... 82 2e-13
31dbj|AB020930.1| Aegilops speltoides DNA for ribulose-1,5-bisphos... 82 2e-13
32dbj|AB020929.1| Aegilops speltoides DNA for ribulose-1,5-bisphos... 82 2e-13
33dbj|AB020927.1| Aegilops speltoides DNA for ribulose-1,5-bisphos... 82 2e-13
34dbj|AB020926.1| Aegilops speltoides DNA for ribulose-1,5-bisphos... 82 2e-13
35dbj|AB042069.1| Triticum aestivum rbcS gene for ribulose-1,5-bis... 82 2e-13
36dbj|AB042068.1| Triticum aestivum rbcS gene for ribulose-1,5-bis... 82 2e-13
37dbj|AB042065.1| Triticum aestivum rbcS gene for ribulose-1,5-bis... 82 2e-13
38gb|U43493.1|HVU43493 Hordeum vulgare ribulose-1,5-bisphosphate c... 78 2e-12
39dbj|AB042064.1| Triticum aestivum rbcS gene for ribulose-1,5-bis... 78 2e-12
40dbj|AB020941.1| Triticum aestivum DNA for ribulose-1,5-bisphosph... 76 9e-12
41dbj|AB020940.1| Triticum turgidum subsp. dicoccoides DNA for rib... 76 9e-12
42dbj|AB042067.1| Triticum aestivum rbcS gene for ribulose-1,5-bis... 76 9e-12
43emb|AJ131737.1|SCE131737 Secale cereale mRNA for hypothetical pr... 74 4e-11
44dbj|AB020939.1| Triticum timopheevii subsp. armeniacum DNA for r... 74 4e-11
45dbj|AB042066.1| Triticum aestivum rbcS gene for ribulose-1,5-bis... 72 1e-10
46emb|X05982.1|LERBCS1 Tomato rbcS1 gene for ribulose 1,5-bisphosp... 70 6e-10
47gb|AF192778.1|AF192778 Avena sterilis subsp. ludoviciana ribulos... 70 6e-10
48gb|M15235.1|TOMRBCSD Tomato RuBP carboxylase small subunit LESS1... 70 6e-10
49gb|M13542.1|TOMRBCSA Tomato (L.esculentum) ribulose-1,5-bisphosp... 70 6e-10
50gb|AF097361.1|AF097361 Avena clauda ribulose-1,5-bisphosphate ca... 68 2e-09
51gb|AF493617.1| Acetabularia acetabulum ribulose-1,5-bisphosphate... 64 4e-08
52emb|X51814.1|AMRBCSM4 Acetabularia mediterranea mRNA for ribulos... 64 4e-08
53gb|L26605.1|SLARBCS Stellaria longipes ribulose-1,5-bisphosphate... 64 4e-08
54emb|X69763.1|STRBCS3 S.tuberosum rbcS3 gene for ribulose-(1,5)-b... 62 1e-07
55gb|AF202646.1|AF202646 Avena clauda clone ClG4 ribulose-1,5-bisp... 62 1e-07
56gb|AF192779.1|AF192779 Avena maroccana clone Ma4 ribulose-1,5-bi... 62 1e-07
57gb|AF192776.1|AF192776 Avena clauda clone Cl5 ribulose-1,5-bisph... 62 1e-07
58gb|AF192773.1|AF192773 Avena agadiriana ribulose-1,5-bisphosphat... 62 1e-07
59gb|AF097359.1|AF097359 Avena agadiriana ribulose-1,5-bisphosphat... 62 1e-07
60gb|AF104249.1|AF104249 Avena vaviloviana ribulose-1,5-bisphospha... 62 1e-07
61gb|L22155.1|RICCPRBCLA Oryza sativum mitochondrial ribulose bisp... 62 1e-07
62dbj|AB020942.1| Secale cereale DNA for ribulose-1,5-bisphosphate... 62 1e-07
63gb|AY267350.1| Flaveria bidentis ribulose-1,5-bisphosphate carbo... 60 6e-07
64gb|J01256.1|PEARBPC Pisum sativum ribulose-1,5-bisphosphate carb... 60 6e-07
65gb|AY273795.1| Citrus limon ribulose-1,5-bisphosphate carboxylas... 60 6e-07
66gb|M25613.1|PEARUBP2 Pisum sativum ribulose 1,5 bisphosphate car... 60 6e-07
67emb|X04334.1|PSRBCS3C Pea rbcS-3C gene for ribulose 1.5-bisphosp... 60 6e-07
68emb|X04333.1|PSRBCS3A Pea rbcS-3A gene for ribulose 1.5-bisphosp... 60 6e-07
69emb|X00806.1|PSRC01 Pea gene for rib-1,5-bisphospate carboxylase... 60 6e-07
70emb|X07515.1|OSRBCS Rice rbcS gene for ribulose 1,5-bisphosphate... 60 6e-07
71emb|X60000.1|PVRBCOS P.vulgaris rbcS mRNA for small subunit of r... 60 6e-07
72emb|X59999.1|PVRBCS P.vulgaris rbcS mRNA for small subunit of ri... 60 6e-07
73emb|X57022.1|PVSS15BCO P. vulgaris rbcS cDNA (with intronic sequ... 60 6e-07
74gb|AF192775.1|AF192775 Avena strigosa clone Str5 ribulose-1,5-bi... 60 6e-07
75gb|AF192774.1|AF192774 Avena strigosa clone Str3 ribulose-1,5-bi... 60 6e-07
76gb|AF101233.1|AF101233 Manihot esculenta clone U291 ribulose 1,5... 60 6e-07
77gb|AF101232.1|AF101232 Manihot esculenta clone U216 ribulose 1,5... 60 6e-07
78gb|AF101230.1|AF101230 Manihot esculenta clone R312 ribulose 1,5... 60 6e-07
79gb|AF162195.1|AF162195 Lactuca sativa ribulose-1,5-bisphosphate ... 60 6e-07
80gb|AF097360.1|AF097360 Avena strigosa ribulose-1,5-bisphosphate ... 60 6e-07
81gb|J01257.1|PEARUBPA Pea (P.sativum) ribulose 1,5-bisphosphate c... 60 6e-07
82gb|AY843526.1| Ammopiptanthus mongolicus ribulose-1,5-bisphospha... 58 2e-06
83gb|AY705444.1| Fagus sylvatica chloroplast ribulose-1,5-bisphosp... 56 9e-06
84emb|X02353.1|NTRUBSS Tobacco gene for ribulose 1,5-bisphosphate ... 56 9e-06
85emb|X01722.1|NSRUB1 Nicotiana silvestris mRNA for the small subu... 56 9e-06
86emb|AJ843975.1| Plantago major mRNA for Rubisco SSU (rbcs1a gene) 56 9e-06
87gb|AY220079.1| Nicotiana tabacum putative ribulose bisphosphate ... 56 9e-06
88emb|AJ538410.1|NTA538410 Nicotiana tabacum cDNA-AFLP-fragment BC... 56 9e-06
89emb|AJ538400.1|NTA538400 Nicotiana tabacum cDNA-AFLP-fragment BC... 56 9e-06
90emb|Y09214.1|ZMRUBSMSU Z.mays rubisco small subunit gene 56 9e-06
91gb|DQ286548.1| Pyrus pyrifolia ribulose-1,5-bisphosphate carboxy... 56 9e-06
92gb|J01308.1|TOBRBPC Nicotiana sylvestris ribulose-1,5-bisphospha... 56 9e-06
93gb|J03613.1|POTRBCS Potato (S.tuberosum) ribulose bisphosphate c... 56 9e-06
94gb|M16056.1|CUSSSU Cucumber SSU mRNA encoding ribulose bisphosph... 56 9e-06
95dbj|AB006080.1| Fagus crenata mRNA for small subunit of ribulose... 56 9e-06
96dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 54 3e-05
97dbj|AK121444.1| Oryza sativa (japonica cultivar-group) cDNA clon... 54 3e-05
98dbj|AK119219.1| Oryza sativa (japonica cultivar-group) cDNA clon... 54 3e-05
99gb|AF202648.1|AF202648 Avena maroccana ribulose-1,5-bisphosphate... 54 3e-05
100dbj|AK070556.1| Oryza sativa (japonica cultivar-group) cDNA clon... 54 3e-05
101gb|AF192780.1|AF192780 Avena maroccana clone Ma7 ribulose-1,5-bi... 54 3e-05
102dbj|AK061611.1| Oryza sativa (japonica cultivar-group) cDNA clon... 54 3e-05
103gb|AF104250.1|AF104250 Avena maroccana ribulose-1,5-bisphosphate... 54 3e-05
104gb|AF096617.1|AF096617 Avena sterilis subsp. ludoviciana ribulos... 54 3e-05
105gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 54 3e-05
106emb|AL731739.4|CNS08C7O Oryza sativa chromosome 12, . BAC OSJNBa... 54 3e-05
107gb|AF052305.1|AF052305 Oryza sativa ribulose 1,5-bisphosphate ca... 54 3e-05
108gb|AF017364.1|AF017364 Oryza sativa ribulose 1,5-bisphosphate ca... 54 3e-05
109dbj|AB020960.1| Bromus catharticus DNA for ribulose-1,5-bisphosp... 54 3e-05
110dbj|D00643.1|RICRUBPC1 Oryza sativa (japonica cultivar-group) mR... 54 3e-05
111gb|AY267351.1| Flaveria bidentis ribulose-1,5-bisphosphate carbo... 52 1e-04
112gb|BT013023.1| Lycopersicon esculentum clone 114270R, mRNA sequence 52 1e-04
113emb|V00458.1|GMRUBP Glycine max gene encoding ribulose-1,5-bisph... 52 1e-04
114dbj|AB236868.1| Panax ginseng mRNA for ribulose-1,5-bisphosphate... 52 1e-04
115gb|AF044400.1|AF044400 Flaveria palmeri ribulose-1,5-bisphosphat... 52 1e-04
116gb|AF044399.1|AF044399 Flaveria palmeri ribulose-1,5-bisphosphat... 52 1e-04
117gb|AF044398.1|AF044398 Flaveria palmeri ribulose-1,5-bisphosphat... 52 1e-04
118gb|AF044396.1|AF044396 Flaveria ramosissima ribulose-1,5-bisphos... 52 1e-04
119gb|AF044395.1|AF044395 Flaveria ramosissima ribulose-1,5-bisphos... 52 1e-04
120gb|AF312228.1|AF312228 Citrus reticulata ribulose-1,5-bisphospha... 52 1e-04
121gb|AF303941.1|AF303941 Glycine max ribulose-1,5-bisphosphate car... 52 1e-04
122gb|AF303940.1|AF303940 Glycine max ribulose-1,5-bisphosphate car... 52 1e-04
123gb|AF303939.1|AF303939 Glycine max ribulose-1,5-bisphosphate car... 52 1e-04
124gb|U39567.1|GMU39567 Glycine max ribulose-1,5-bisphosphate carbo... 52 1e-04
125emb|X05983.1|LERBCS2 Tomato rbcS2 gene for ribulose 1,5-bisphosp... 52 1e-04
126emb|X13711.1|NPRBCS8B Nicotiana plumbaginifolia rbcS-8B gene for... 52 1e-04
127emb|AJ428877.1|ROB428877 Rumex obtusifolius mRNA for putative ri... 52 1e-04
128gb|AF162210.1|AF162210 Lactuca sativa ribulose-1,5-bisphosphate ... 52 1e-04
129gb|AF202645.1|AF202645 Avena clauda clone ClG2 ribulose-1,5-bisp... 52 1e-04
130gb|AF101231.1|AF101231 Manihot esculenta clone R33 ribulose 1,5-... 52 1e-04
131gb|AF101228.1|AF101228 Manihot esculenta clone R214 ribulose 1,5... 52 1e-04
132emb|X84730.1|ASRBCS Artificial rbcS gene sequence 52 1e-04
133gb|U29939.1|FPU29939 Flaveria pringlei ribulose-1,5-bisphosphate... 52 1e-04
134gb|U29938.1|FPU29938 Flaveria pringlei ribulose-1,5-bisphosphate... 52 1e-04
135gb|U29937.1|FPU29937 Flaveria pringlei ribulose-1,5-bisphosphate... 52 1e-04
136gb|U29936.1|FPU29936 Flaveria pringlei ribulose-1,5-bisphosphate... 52 1e-04
137gb|U29935.1|FPU29935 Flaveria pringlei ribulose-1,5-bisphosphate... 52 1e-04
138gb|U29934.1|FPU29934 Flaveria pringlei ribulose-1,5-bisphosphate... 52 1e-04
139gb|M16888.1|SIPRUBPCS White campion ribulose bisphosphate carbox... 52 1e-04
140gb|M96583.1|MNHRUBISCO Manihot esculenta ribulose 1,5-bisphospha... 52 1e-04
141gb|U39858.1|GTU39858 Glycine tabacina ribulose 1,5-bisphosphate ... 52 1e-04
142gb|M15236.1|TOMRBCSE Tomato RuBP carboxylase small subunit LESS5... 52 1e-04
143gb|M13543.1|TOMRBCSB Tomato (L.esculentum) ribulose-1,5-bisphosp... 52 1e-04
144gb|M36685.1|TOBRBCS8B N.plumbaginifolia ribulose bisphosphate ca... 52 1e-04
145gb|M16889.1|SOYRUBPA Soybean ribulose 1,5-bisphosphate carboxyla... 52 1e-04
146gb|M95930.1|MNHRBCSA Manihot esculenta (clone rubssr37) ribulose... 52 1e-04
147dbj|AB020945.1| Avena sativa DNA for ribulose-1,5-bisphosphate c... 52 1e-04
148emb|X92858.1|BPRBCS B.pendula rbcS gene 50 5e-04
149gb|AF039014.1|AF039014 Fritillaria agrestis clone TA8 ribulose 1... 50 5e-04
150gb|AF039011.1|AF039011 Fritillaria agrestis clone TA22 ribulose ... 50 5e-04
151gb|AF039008.1|AF039008 Fritillaria agrestis clone TA15 ribulose ... 50 5e-04
152emb|Y07779.1|BPRBCSSU Betula pendula mRNA for ribulose-1,5-bisph... 50 5e-04
153gb|AF008214.1|AF008214 Musa acuminata ribulose-1,5-bisphosphate ... 50 5e-04
154dbj|AP006376.1| Lotus japonicus genomic DNA, chromosome 1, clone... 50 5e-04
155dbj|D00572.1|PYPRBCO Pyrus pyrifolia var. culta mRNA for RuBisCO... 48 0.002
156emb|Y00322.1|ZMRBCS Maize rbcS gene for ribulose-1,5-bisphosphat... 48 0.002
157emb|Z28636.1|ACRUBIS Acetabularia cliftonii gene for ribulose-1,... 48 0.002
158emb|X05985.1|LERBCS3B Tomato rbcS3B gene for ribulose 1,5-bispho... 48 0.002
159emb|X03821.1|PERBCS11 Petunia x hybrida rbcS gene (ssu11A) for r... 48 0.002
160emb|X65494.1|MSCARB Malus (unidentified species of crab apple) m... 48 0.002
161emb|X06535.1|ZMRUBSSU Maize mRNA for ribulose-1,5-bisphosphate c... 48 0.002
162gb|AF192777.1|AF192777 Avena clauda clone Cl9 ribulose-1,5-bisph... 48 0.002
163gb|AY103730.1| Zea mays PCO095823 mRNA sequence 48 0.002
164gb|AF039007.1|AF039007 Fritillaria agrestis clone TA10 rbcS pseu... 48 0.002
165gb|AF039006.1|AF039006 Fritillaria agrestis clone TA17 rbcS pseu... 48 0.002
166gb|AF039005.1|AF039005 Fritillaria agrestis clone TA13 rbcS pseu... 48 0.002
167gb|U39856.1|GSU39856 Glycine soja ribulose 1,5-bisphosphate carb... 48 0.002
168gb|L24497.1|PYPRBCS Pyrus malus X domestica ribulose-1,5-bisphos... 48 0.002
169dbj|D00170.1|MZEPCSSU Zea mays mRNA for ribulose 1,5-bisphosphat... 48 0.002
170dbj|D14001.1|LAURBCS Lettuce mRNA for riburose-1,5-bisphosphate ... 48 0.002
171dbj|D11112.1|TOMRBCO Tomato ribulose 1,5-bisphosphate carboxylas... 48 0.002
172dbj|AB026685.1| Physcomitrella patens mRNA for ribulose 1,5-bisp... 48 0.002
173gb|AY163904.1| Chrysanthemum x morifolium ribulose-1,5-bisphosph... 46 0.008
174emb|X00137.1|LGRUBP Lemna gibba ribulose 1.5-bisphospate carboxy... 46 0.008
175emb|X17234.1|LGRBCS4B Lemna gibba rbcS gene SSU40B for small sub... 46 0.008
176emb|X17233.1|LGRBCS4A Lemna gibba rbcS gene SSU40A for small sub... 46 0.008
177emb|X17231.1|LGRBCS5B Lemna gibba rbcS gene SSU5B for small subu... 46 0.008
178emb|X17230.1|LGRBCS5A Lemna gibba rbcS gene SSU5A for small subu... 46 0.008
179emb|X17235.1|LGRBCS1 Lemna gibba rbcS mRNA SSU1 for small subuni... 46 0.008
180emb|X83095.1|ASRBCSSS A.squarrosa mRNA for ribulose-1,5-bisphosp... 46 0.008
181dbj|AK099574.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.008
182gb|AF202647.1|AF202647 Avena agadiriana ribulose-1,5-bisphosphat... 46 0.008
183emb|BX119951.3|CNS09S4U Oryza sativa chromosome 12, . BAC OJ1523... 46 0.008
184emb|X79152.1|EGRBCS1 E.gracilis rbcS 1 gene exons 1 to 19 46 0.008
185dbj|AU066498.1| Chlamydomonas sp. HS-5 mRNA for ribulose-bisphos... 46 0.008
186ref|NM_123203.2| Arabidopsis thaliana ribulose-bisphosphate carb... 44 0.034
187gb|AY693395.1| Lolium perenne ribulose-1,5-bisphosphate carboxyl... 44 0.034
188gb|AY093288.1| Arabidopsis thaliana ribulose bisphosphate carbox... 44 0.034
189gb|L76557.1|SPIRBCS Spinacia oleracea chloroplast ribulose 1,5-b... 44 0.034
190gb|AY062543.1| Arabidopsis thaliana ribulose bisphosphate carbox... 44 0.034
191gb|AY062458.1| Arabidopsis thaliana ribulose bisphosphate carbox... 44 0.034
192gb|AY062437.1| Arabidopsis thaliana ribulose bisphosphate carbox... 44 0.034
193gb|AY059939.1| Arabidopsis thaliana ribulose bisphosphate carbox... 44 0.034
194gb|DQ336280.1| Vitis pseudoreticulata ribulose-1,5-bisphophate c... 44 0.034
195emb|BX841713.1|CNS09YLJ Arabidopsis thaliana Full-length cDNA Co... 44 0.034
196gb|BT003356.1| Arabidopsis thaliana ribulose bisphosphate carbox... 44 0.034
197gb|BT002554.1| Arabidopsis thaliana ribulose bisphosphate carbox... 44 0.034
198gb|AF139469.2|AF139469 Vigna radiata ribulose-1,5-bisphosphate c... 44 0.034
199dbj|AB005248.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 44 0.034
200emb|AJ131050.1|CAR131050 Cicer arietinum mRNA for ribulose 1,5-b... 44 0.034
201emb|Y00431.1|HARBCS Sunflower rbcS gene for RuBP carboxylase sma... 44 0.034
202emb|X51809.1|ACRBCSC4 Acetabularia cliftonii mRNA for ribulose 1... 44 0.034
203emb|X97600.1|SORBCS2 S.oleracea mRNA for ribulose-1,5-bisphospha... 44 0.034
204emb|X03820.1|PERBCS08 Petunia x hybrida rbcS gene (ssu8) for rib... 44 0.034
205emb|X05079.1|HARUBISC Sunflower mRNA for ribulose 1,5-bisphospha... 44 0.034
206emb|X54091.1|GHRBCS G.hirsutum rbcS gene for ribulose-1,5-bispho... 44 0.034
207emb|X69759.1|STRBCS1 S.tuberosum rbcS1 gene for ribulose-(1,5)-b... 44 0.034
208emb|X57267.1|BORBCSB2 B.oerstedii mRNA for ribulose bisphosphate... 44 0.034
209gb|AF173667.1|AF173667 Beta vulgaris clone RUB109UNI ribulose bi... 44 0.034
210gb|AF200303.1|AF200303 Avena clauda ribulose-1,5-bisphosphate ca... 44 0.034
211gb|BT002094.1| Arabidopsis thaliana ribulose bisphosphate carbox... 44 0.034
212gb|U29933.1|FPU29933 Flaveria pringlei ribulose-1,5-bisphosphate... 44 0.034
213gb|U39857.1|GTU39857 Glycine tomentella ribulose 1,5-bisphosphat... 44 0.034
214emb|X14564.1|ATATSGS A.thaliana ats1B, ats2B and ats3B gene for ... 44 0.034
215gb|M29642.1|PETRBCB Petunia ribulose 1,5-bisphosphate carboxylas... 44 0.034
216gb|M29641.1|PETRBCA Petunia ribulose 1,5-bisphosphate carboxylas... 44 0.034
217gb|M60274.1|HEVRBSS Hevea brasiliensis ribulose-1,5-bisphosphate... 44 0.034
218gb|CP000117.1| Anabaena variabilis ATCC 29413 chromosome, comple... 42 0.13
219gb|AY267674.1| Bigelowiella natans ribulose-1,5-bisphosphate car... 42 0.13
220gb|AY142543.1| Arabidopsis thaliana clone RAFL04-14-I04 (R09825)... 42 0.13
221gb|AY048671.1| Sequoia sempervirens ribulose-1,5-bisphosphate ca... 42 0.13
222dbj|BA000019.2| Nostoc sp. PCC 7120 DNA, complete genome 42 0.13
223gb|L02522.1|ANARBCLSC Anabaena sp. strain PCC 7120 ribulose 1,5-... 42 0.13
224emb|X51813.1|AMRBCSM3 Acetabularia mediterranea mRNA for ribulos... 42 0.13
225emb|X51812.1|AMRBCSM2 Acetabularia mediterranea partial mRNA for... 42 0.13
226emb|X51811.1|AMRBCSM1 Acetabularia mediterranea mRNA for ribulos... 42 0.13
227gb|M86717.1|SCFBCS1A Saccharum hybrid cultivar H32-8560 ribulose... 42 0.13
228gb|AF039015.1|AF039015 Fritillaria agrestis clone TA1 ribulose 1... 42 0.13
229gb|AF039013.1|AF039013 Fritillaria agrestis clone TA26 ribulose ... 42 0.13
230gb|AF039010.1|AF039010 Fritillaria agrestis clone TA24 ribulose ... 42 0.13
231gb|AF039009.1|AF039009 Fritillaria agrestis clone TA23 ribulose ... 42 0.13
232gb|AF031543.1|AF031543 Fritillaria agrestis ribulose 1,5 bisphos... 42 0.13
233gb|AF024574.1|AF024574 Fritillaria agrestis ribulose 1,5 bisphos... 42 0.13
234gb|AF024572.1|AF024572 Fritillaria agrestis ribulose 1,5 bisphos... 42 0.13
235gb|U05590.1|ASU05590 Anabaena sp. ribulose 1,5-bisphosphate carb... 42 0.13
236gb|J01540.1|ANARUBP Anabaena sp. (clone pAN600) rbcL & rbcS gene... 42 0.13
237gb|L02521.1|ANARBCLSB Anabaena sp. ribulose 1,5-bisphosphate car... 42 0.13
238gb|L02520.1|ANARBCLSA Anabaena sp. ribulose 1,5-bisphosphate car... 42 0.13
239ref|NM_123204.3| Arabidopsis thaliana ribulose-bisphosphate carb... 40 0.52
240ref|NM_123202.2| Arabidopsis thaliana ribulose-bisphosphate carb... 40 0.52
241ref|NM_001036904.1| Arabidopsis thaliana ribulose-bisphosphate c... 40 0.52
242ref|NM_202369.1| Arabidopsis thaliana ribulose-bisphosphate carb... 40 0.52
243ref|NM_105379.2| Arabidopsis thaliana ribulose-bisphosphate carb... 40 0.52
244gb|AC007152.9| Arabidopsis thaliana chromosome I BAC F1O19 genom... 40 0.52
245gb|AC147741.11| Medicago truncatula clone mth2-17b23, complete s... 40 0.52
246gb|AY445627.1| Oryza sativa (japonica cultivar-group) ribulose-1... 40 0.52
247gb|AY143814.1| Arabidopsis thaliana At5g38430/F1O19.10 mRNA, com... 40 0.52
248gb|BT000721.1| Arabidopsis thaliana clone RAFL04-15-J15 (R09791)... 40 0.52
249emb|AJ786661.1| Limonium gibertii mRNA for ribulose 1,5 bisphosp... 40 0.52
250emb|AJ786660.1| Limonium gibertii partial mRNA for ribulose 1,5 ... 40 0.52
251gb|BT000362.1| Arabidopsis thaliana ribulose bisphosphate carbox... 40 0.52
252gb|AY051025.1| Arabidopsis thaliana putative RuBisCO small 3b su... 40 0.52
253gb|AF360124.1| Arabidopsis thaliana putative ribulose bisphospha... 40 0.52
254emb|X13611.1|ATRBCSA Arabidopsis thaliana ats1A gene for ribulos... 40 0.52
255emb|X16435.1|SARUBISC Mustard Rubisco mRNA for the small subunit... 40 0.52
256emb|X61097.1|BNRBCS B.napus rbcS gene for the small subunit of r... 40 0.52
257gb|AY098970.1| Arabidopsis thaliana At5g38410/F1O19.10 mRNA, com... 40 0.52
258gb|AY097366.1| Arabidopsis thaliana At1g67090/F1O19.10 mRNA, com... 40 0.52
259gb|AY093388.1| Arabidopsis thaliana ribulose bisphosphate carbox... 40 0.52
260gb|AY093380.1| Arabidopsis thaliana ribulose bisphosphate carbox... 40 0.52
261dbj|AB240146.1| Chlorella pyrenoidosa rbcS mRNA for RuBisCO smal... 40 0.52
262gb|AF462822.1|AF462822 Arabidopsis thaliana At5g38410/F1O19.10 m... 40 0.52
263gb|AY065026.1| Arabidopsis thaliana AT5g53140/MFH8_8 mRNA, compl... 40 0.52
264gb|AY064686.1| Arabidopsis thaliana ribulose bisphosphate carbox... 40 0.52
265gb|AY065101.1| Arabidopsis thaliana ribulose bisphosphate carbox... 40 0.52
266gb|AY062711.1| Arabidopsis thaliana ribulose bisphosphate carbox... 40 0.52
267gb|AY062612.1| Arabidopsis thaliana ribulose bisphosphate carbox... 40 0.52
268gb|AY059940.1| Arabidopsis thaliana ribulose bisphosphate carbox... 40 0.52
269gb|AY058831.1| Arabidopsis thaliana At1g67090/F1O19.10 mRNA, com... 40 0.52
270gb|AY054188.1| Arabidopsis thaliana At1g67090/F1O19.10 mRNA, com... 40 0.52
271gb|AY054581.1| Arabidopsis thaliana ribulose bisphosphate carbox... 40 0.52
272gb|AY054552.1| Arabidopsis thaliana ribulose bisphosphate carbox... 40 0.52
273gb|AF410314.1|AF410314 Arabidopsis thaliana F1O19.10/F1O19.10 mR... 40 0.52
274gb|AF410291.1|AF410291 Arabidopsis thaliana F1O19.10/F1O19.10 mR... 40 0.52
275gb|AF410283.1|AF410283 Arabidopsis thaliana F1O19.10/F1O19.10 mR... 40 0.52
276gb|AY050459.1| Arabidopsis thaliana AT4g36870/C7A10_490 mRNA, co... 40 0.52
277gb|AC004146.1|AC004146 Arabidopsis thaliana chromosome I BAC F5A... 40 0.52
278gb|AF325004.2|AF325004 Arabidopsis thaliana At1g67090 (At1g67090... 40 0.52
279gb|AF372874.1|AF372874 Arabidopsis thaliana F1O19.10/F1O19.10 mR... 40 0.52
280emb|BX814212.1|CNS0ADS1 Arabidopsis thaliana Full-length cDNA Co... 40 0.52
281emb|BX818334.1|CNS0ACND Arabidopsis thaliana Full-length cDNA Co... 40 0.52
282emb|BX818366.1|CNS0ACKZ Arabidopsis thaliana Full-length cDNA Co... 40 0.52
283emb|BX817617.1|CNS0ACFY Arabidopsis thaliana Full-length cDNA Co... 40 0.52
284emb|BX830542.1|CNS0A26B Arabidopsis thaliana Full-length cDNA Co... 40 0.52
285emb|BX833384.1|CNS0A1LA Arabidopsis thaliana Full-length cDNA Co... 40 0.52
286emb|BX830381.1|CNS0A1HW Arabidopsis thaliana Full-length cDNA Co... 40 0.52
287emb|BX830099.1|CNS0A1FH Arabidopsis thaliana Full-length cDNA Co... 40 0.52
288emb|BX832776.1|CNS0A0L8 Arabidopsis thaliana Full-length cDNA Co... 40 0.52
289emb|BX831203.1|CNS0A0SX Arabidopsis thaliana Full-length cDNA Co... 40 0.52
290emb|BX833789.1|CNS0A0DD Arabidopsis thaliana Full-length cDNA Co... 40 0.52
291emb|BX833660.1|CNS0A0FN Arabidopsis thaliana Full-length cDNA Co... 40 0.52
292emb|BX833317.1|CNS0A0CV Arabidopsis thaliana Full-length cDNA Co... 40 0.52
293emb|BX832874.1|CNS0A0CD Arabidopsis thaliana Full-length cDNA Co... 40 0.52
294gb|AF325011.1|AF325011 Arabidopsis thaliana 000C10C11 mRNA, comp... 40 0.52
295gb|BT005730.1| Arabidopsis thaliana clone RAFL15-16-B15 (R20676) 40 0.52
296emb|X51808.1|ACRBCSC3 Acetabularia cliftonii mRNA for ribulose 1... 40 0.52
297emb|AJ419827.1|CAR419827 Coffea arabica rbcs1 gene for rubisco s... 40 0.52
298emb|X07367.1|BNRBCSSU B.napus mRNA for ribulose 1,5-bisphosphate... 40 0.52
299emb|X55937.1|BNRBCSF1 Brassica napus rbcSF1 gene for ribulose-1,... 40 0.52
300dbj|AK068555.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 0.52
301gb|BT002076.1| Arabidopsis thaliana ribulose bisphosphate carbox... 40 0.52
302gb|DQ300277.1| Coffea arabica cultivar Rume Sudan plastid ribulo... 40 0.52
303gb|DQ300276.1| Coffea arabica cultivar Colombia plastid ribulose... 40 0.52
304gb|DQ300275.1| Coffea arabica cultivar SL-28 plastid ribulose-1,... 40 0.52
305gb|DQ300274.1| Coffea arabica cultivar Kent plastid ribulose-1,5... 40 0.52
306gb|DQ300273.1| Coffea arabica cultivar F-502 plastid ribulose-1,... 40 0.52
307gb|DQ300272.1| Coffea arabica cultivar Tipica plastid ribulose-1... 40 0.52
308gb|DQ300271.1| Coffea arabica cultivar Bourbon plastid ribulose-... 40 0.52
309gb|DQ300270.1| Coffea arabica cultivar Mundo novo plastid ribulo... 40 0.52
310gb|DQ300269.1| Coffea arabica cultivar Ethiopia 167 plastid ribu... 40 0.52
311gb|DQ300268.1| Coffea arabica cultivar Ethiopia 87 plastid ribul... 40 0.52
312gb|DQ300267.1| Coffea arabica cultivar Alghe plastid ribulose-1,... 40 0.52
313gb|DQ300266.1| Coffea arabica cultivar Dilla plastid ribulose-1,... 40 0.52
314gb|AF017363.1|AF017363 Oryza sativa ribulose 1,5-bisphosphate ca... 40 0.52
315emb|X96847.1|MSRBCSK1A M.sativa Rbcsk-1A gene 40 0.52
316gb|DQ242646.1| Brassica napus chloroplast ribulose-1,5-bisphosph... 40 0.52
317dbj|D00644.1|RICRUBPC2 Oryza sativa (japonica cultivar-group) mR... 40 0.52
318gb|AY531637.1| Solemya velum gill symbiont ribulose-1,5-bisphosp... 38 2.1
319emb|AJ843972.1| Plantago major mRNA for Rubisco SSU (rbcs1 gene) 38 2.1
320emb|X66617.1|EGRBCS5 Euglena gracilis partial rbcS gene for ribu... 38 2.1
321gb|U80810.1|CSU80810 Chloromonas sp. ANT3 ribulose-1,5-bisphosph... 38 2.1
322emb|X17546.1|EGRBCS Euglena gracilis rbcS mRNA for the small sub... 38 2.1
323emb|AL772238.7| Mouse DNA sequence from clone RP23-344G15 on chr... 38 2.1
324gb|AY530156.1| Dunaliella tertiolecta ribulose-1,5-bisphosphate ... 36 8.2
325gb|AY530155.1| Dunaliella tertiolecta ribulose-1,5-bisphosphate ... 36 8.2
326gb|AC124339.9| Mus musculus chromosome 7, clone RP24-238P16, com... 36 8.2
327gb|AC110716.6| Homo sapiens 3 BAC RP11-442N1 (Roswell Park Cance... 36 8.2
328gb|AC131740.3| Mus musculus BAC clone RP23-85D12 from chromosome... 36 8.2
329ref|XM_756227.1| Ustilago maydis 521 hypothetical protein (UM051... 36 8.2
330gb|AC159873.11| Medicago truncatula clone mth2-46p15, complete s... 36 8.2
331gb|AC125475.11| Medicago truncatula clone mth2-5j2, complete seq... 36 8.2
332ref|XM_970273.1| PREDICTED: Tribolium castaneum similar to CG157... 36 8.2
333gb|AC163292.2| Mus musculus BAC clone RP23-241P22 from chromosom... 36 8.2
334gb|AC008494.8| Homo sapiens chromosome 5 clone CTC-428G20, compl... 36 8.2
335gb|AC154320.2| Mus musculus BAC clone RP23-308E16 from chromosom... 36 8.2
336gb|AC008585.4|AC008585 Homo sapiens chromosome 5 clone CTC-568C6... 36 8.2
337emb|X51810.1|ACRBCSC5 Acetabularia cliftonii mRNA for ribulose 1... 36 8.2
338emb|Z28640.1|ACRBPCX Acetabularia cliftonii gene for ribulose-1-... 36 8.2
339emb|X13974.1|CMRBPC Chlamydomonas moewusii rbcS mRNA for ribulos... 36 8.2
340emb|X75334.1|BNRBCSSW B.napus (Semundo winterraps) rbcS gene 36 8.2
341emb|AL928871.5| Mouse DNA sequence from clone RP23-350F2 on chro... 36 8.2
342gb|AC091981.4| Homo sapiens chromosome 5 clone RP11-549L3, compl... 36 8.2
343gb|M38318.1|CIPRBCS4 Mesembryanthemum crystallinum ribulose-1,5-... 36 8.2
344gb|M38317.1|CIPRBCS3 Mesembryanthemum crystallinum ribulose-1,5-... 36 8.2
345gb|M38316.1|CIPRBCS2 Mesembryanthemum crystallinum ribulose-1,5-... 36 8.2
346gb|M31640.1|CIPRBC Ice plant ribulose-1-5-bisphosphate carboxyla... 36 8.2
347gb|L10213.1|CIP6RSS Mesembryanthemum crystallinum (clone: rbcs-6... 36 8.2
348gb|L10215.1|CIP345RSS Mesembryanthemum crystallinum (clones: rbc... 36 8.2
349gb|L10214.1|CIP2RSS Mesembryanthemum crystallinum (clone: rbcs-2... 36 8.2
350gb|L10212.1|CIP1RSS Mesembryanthemum crystallinum (clone: rbcs-1... 36 8.2 
>emb|AJ635206.1| Triticum durum ssp. durum partial mRNA for putative rubisco small
           subunit (rbcS gene)
          Length = 518

 Score = 89.7 bits (45), Expect = 6e-16
 Identities = 53/56 (94%)
 Strand = Plus / Plus

                                                                   
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           |||||||||||||||||||||| |||||||| |||||||||| |||||||||||||
Sbjct: 322 gatactggacaatgtggaagctgcctatgttcgggtgcaccgacgccacacaggtg 377
to top
>gb|M37477.1|WHTRUBIAB T.aestivum ribulose-1,5-bisphosphate carboxylase/oxygenase
           (RUBISCO) gene, complete cds
          Length = 779

 Score = 89.7 bits (45), Expect = 6e-16
 Identities = 53/56 (94%)
 Strand = Plus / Plus

                                                                   
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           |||||||||||||||||||||| |||||||| |||||||||| |||||||||||||
Sbjct: 389 gatactggacaatgtggaagctgcctatgttcgggtgcaccgacgccacacaggtg 444
to top
>gb|M37328.1|WHTRUBIAA T.aestivum ribulose-1,5-bisphosphate carboxylase/oxygenase (RUBISCO)
            gene, exons 1 and 2
          Length = 2205

 Score = 89.7 bits (45), Expect = 6e-16
 Identities = 53/56 (94%)
 Strand = Plus / Plus

                                                                    
Query: 1    gatactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
            |||||||||||||||||||||| |||||||| |||||||||| |||||||||||||
Sbjct: 1313 gatactggacaatgtggaagctgcctatgttcgggtgcaccgacgccacacaggtg 1368
to top
>dbj|AB020958.1| Triticum aestivum DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           CS-B2
          Length = 781

 Score = 89.7 bits (45), Expect = 6e-16
 Identities = 53/56 (94%)
 Strand = Plus / Plus

                                                                   
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           |||||||||||||||||||||| || |||||||||||||||| |||||||||||||
Sbjct: 601 gatactggacaatgtggaagctgcccatgtttgggtgcaccgacgccacacaggtg 656
to top
>dbj|AB020955.1| Triticum timopheevii subsp. armeniacum DNA for
           ribulose-1,5-bisphosphate carboxylase/oxygenase small
           subunit, partial cds, clone Ara-B
          Length = 787

 Score = 89.7 bits (45), Expect = 6e-16
 Identities = 53/56 (94%)
 Strand = Plus / Plus

                                                                   
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           |||||||||||||||||||||| |||||||| |||||||||| |||||||||||||
Sbjct: 607 gatactggacaatgtggaagctgcctatgttcgggtgcaccgacgccacacaggtg 662
to top
>dbj|AB020954.1| Triticum urartu DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Ura-B
          Length = 787

 Score = 89.7 bits (45), Expect = 6e-16
 Identities = 53/56 (94%)
 Strand = Plus / Plus

                                                                   
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           |||||||||||||||||||||| |||||||| |||||||||| |||||||||||||
Sbjct: 607 gatactggacaatgtggaagctgcctatgttcgggtgcaccgacgccacacaggtg 662
to top
>dbj|AB020952.1| Aegilops searsii DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Sea-B
          Length = 728

 Score = 89.7 bits (45), Expect = 6e-16
 Identities = 53/56 (94%)
 Strand = Plus / Plus

                                                                   
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           |||||||||||||||||||||| |||||||| |||||||||| |||||||||||||
Sbjct: 548 gatactggacaatgtggaagctgcctatgttcgggtgcaccgacgccacacaggtg 603
to top
>dbj|AB020950.1| Aegilops sharonensis DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Sha-B
          Length = 792

 Score = 89.7 bits (45), Expect = 6e-16
 Identities = 53/56 (94%)
 Strand = Plus / Plus

                                                                   
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           |||||||||||||||||||||| |||||||| |||||||||| |||||||||||||
Sbjct: 612 gatactggacaatgtggaagctgcctatgttcgggtgcaccgacgccacacaggtg 667
to top
>dbj|AB020949.1| Aegilops longissima DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Lon-B
          Length = 792

 Score = 89.7 bits (45), Expect = 6e-16
 Identities = 53/56 (94%)
 Strand = Plus / Plus

                                                                   
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           |||||||||||||||||||||| |||||||| |||||||||| |||||||||||||
Sbjct: 612 gatactggacaatgtggaagctgcctatgttcgggtgcaccgacgccacacaggtg 667
to top
>dbj|AB020947.1| Aegilops speltoides DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Spe2-B
          Length = 738

 Score = 89.7 bits (45), Expect = 6e-16
 Identities = 53/56 (94%)
 Strand = Plus / Plus

                                                                   
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           |||||||||||||||||||||| |||||||| |||||||||| |||||||||||||
Sbjct: 592 gatactggacaatgtggaagctgcctatgttcgggtgcaccgacgccacacaggtg 647
to top
>dbj|AB020946.1| Aegilops speltoides DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Spe1-B
          Length = 787

 Score = 89.7 bits (45), Expect = 6e-16
 Identities = 53/56 (94%)
 Strand = Plus / Plus

                                                                   
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           |||||||||||||||||||||| |||||||| |||||||||| |||||||||||||
Sbjct: 607 gatactggacaatgtggaagctgcctatgttcgggtgcaccgacgccacacaggtg 662
to top
>dbj|AB020935.1| Aegilops sharonensis DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Sha-A
          Length = 605

 Score = 89.7 bits (45), Expect = 6e-16
 Identities = 53/56 (94%)
 Strand = Plus / Plus

                                                                   
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           |||||||||||||||||||||| |||||||| |||||||||| |||||||||||||
Sbjct: 425 gatactggacaatgtggaagctgcctatgttcgggtgcaccgacgccacacaggtg 480
to top
>dbj|AB020934.1| Aegilops longissima DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Lon-A3
          Length = 605

 Score = 89.7 bits (45), Expect = 6e-16
 Identities = 53/56 (94%)
 Strand = Plus / Plus

                                                                   
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           ||||||||||||||||||||||||||||||| |||||||||| |||||| ||||||
Sbjct: 425 gatactggacaatgtggaagctacctatgttcgggtgcaccgacgccacgcaggtg 480
to top
>dbj|AB020933.1| Aegilops longissima DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Lon-A2
          Length = 605

 Score = 89.7 bits (45), Expect = 6e-16
 Identities = 53/56 (94%)
 Strand = Plus / Plus

                                                                   
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           ||||||||||||||||||||||||||||||| |||||||||| |||||| ||||||
Sbjct: 425 gatactggacaatgtggaagctacctatgttcgggtgcaccgacgccacgcaggtg 480
to top
>dbj|AB020932.1| Aegilops longissima DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Lon-A1
          Length = 605

 Score = 89.7 bits (45), Expect = 6e-16
 Identities = 53/56 (94%)
 Strand = Plus / Plus

                                                                   
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           ||||||||||||||||||||||||||||||| |||||||||| |||||| ||||||
Sbjct: 425 gatactggacaatgtggaagctacctatgttcgggtgcaccgacgccacgcaggtg 480
to top
>dbj|AB020928.1| Aegilops speltoides DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Spe2-A
          Length = 604

 Score = 89.7 bits (45), Expect = 6e-16
 Identities = 53/56 (94%)
 Strand = Plus / Plus

                                                                   
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           |||||||||||||||||||||| |||||||| |||||||||| |||||||||||||
Sbjct: 424 gatactggacaatgtggaagctccctatgttcgggtgcaccgacgccacacaggtg 479
to top
>emb|X00234.1|TARUB1 Wheat mRNA fragment for small subunit precursor of RuBPCase (EC
           4.1.1.39) (ribulosebisphosphate carboxylase, clone 512)
          Length = 611

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 51/54 (94%)
 Strand = Plus / Plus

                                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           |||||||||||||||||||| |||||||| |||||||||| |||||||||||||
Sbjct: 148 tactggacaatgtggaagctgcctatgttcgggtgcaccgacgccacacaggtg 201
to top
>emb|AJ131738.1|SCE131738 Secale cereale mRNA for hypothetical protein, clone 9
          Length = 875

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 51/54 (94%)
 Strand = Plus / Plus

                                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           |||||||||||||||||||| |||||||| |||||||||| |||||||||||||
Sbjct: 420 tactggacaatgtggaagctgcctatgttcgggtgcaccgacgccacacaggtg 473
to top
>dbj|AB020959.1| Secale cereale DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Sec-B
          Length = 789

 Score = 81.8 bits (41), Expect = 2e-13
 Identities = 52/56 (92%)
 Strand = Plus / Plus

                                                                   
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           |||||||||||||||||||||| |||||||| |||||||||| |||||| ||||||
Sbjct: 609 gatactggacaatgtggaagctgcctatgttcgggtgcaccgacgccactcaggtg 664
to top
>dbj|AB020957.1| Triticum aestivum DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           CS-B1
          Length = 787

 Score = 81.8 bits (41), Expect = 2e-13
 Identities = 52/56 (92%)
 Strand = Plus / Plus

                                                                   
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           |||||||||||||||||||||| |||||||| |||||||| | |||||||||||||
Sbjct: 607 gatactggacaatgtggaagctgcctatgttcgggtgcactgacgccacacaggtg 662
to top
>dbj|AB020956.1| Triticum turgidum subsp. dicoccoides DNA for
           ribulose-1,5-bisphosphate carboxylase/oxygenase small
           subunit, partial cds, clone Dic-B
          Length = 787

 Score = 81.8 bits (41), Expect = 2e-13
 Identities = 52/56 (92%)
 Strand = Plus / Plus

                                                                   
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           |||||||||||||||||||||| |||||||| |||||||| | |||||||||||||
Sbjct: 607 gatactggacaatgtggaagctgcctatgttcgggtgcactgacgccacacaggtg 662
to top
>dbj|AB020953.1| Aegilops squarrosa DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Squ-B
          Length = 781

 Score = 81.8 bits (41), Expect = 2e-13
 Identities = 52/56 (92%)
 Strand = Plus / Plus

                                                                   
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           |||||||||||||||||||||| || ||||| |||||||||| |||||||||||||
Sbjct: 601 gatactggacaatgtggaagctgcccatgttcgggtgcaccgacgccacacaggtg 656
to top
>dbj|AB020951.1| Aegilops bicornis DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Bic-B
          Length = 783

 Score = 81.8 bits (41), Expect = 2e-13
 Identities = 52/56 (92%)
 Strand = Plus / Plus

                                                                   
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           |||||||||||||||||||||| |||||||| || ||||||| |||||||||||||
Sbjct: 608 gatactggacaatgtggaagctgcctatgttcggttgcaccgacgccacacaggtg 663
to top
>dbj|AB020948.1| Aegilops speltoides DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Spe3-B
          Length = 772

 Score = 81.8 bits (41), Expect = 2e-13
 Identities = 52/56 (92%)
 Strand = Plus / Plus

                                                                   
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           |||||||||||||||||||||| |||||||| |||||||||| |||||| ||||||
Sbjct: 592 gatactggacaatgtggaagctgcctatgttcgggtgcaccgacgccacgcaggtg 647
to top
>dbj|AB020944.1| Agropyron intermedium DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Agr-A
          Length = 604

 Score = 81.8 bits (41), Expect = 2e-13
 Identities = 52/56 (92%)
 Strand = Plus / Plus

                                                                   
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           |||||||||||||||||||||| |||||||| |||||||||| |||||| ||||||
Sbjct: 424 gatactggacaatgtggaagctgcctatgttcgggtgcaccgacgccacgcaggtg 479
to top
>dbj|AB020943.1| Hordeum vulgare DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Hor-A
          Length = 605

 Score = 81.8 bits (41), Expect = 2e-13
 Identities = 52/56 (92%)
 Strand = Plus / Plus

                                                                   
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           |||||||||||||||||||||| |||||||| || ||||||| |||||||||||||
Sbjct: 425 gatactggacaatgtggaagctgcctatgttcggatgcaccgacgccacacaggtg 480
to top
>dbj|AB020938.1| Aegilops squarrosa DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Squ-A
          Length = 607

 Score = 81.8 bits (41), Expect = 2e-13
 Identities = 52/56 (92%)
 Strand = Plus / Plus

                                                                   
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           |||||||||||||||||||||| |||||||| |||||||||| |||||| ||||||
Sbjct: 427 gatactggacaatgtggaagctgcctatgttcgggtgcaccgacgccacgcaggtg 482
to top
>dbj|AB020937.1| Aegilops searsii DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Sea-A
          Length = 611

 Score = 81.8 bits (41), Expect = 2e-13
 Identities = 52/56 (92%)
 Strand = Plus / Plus

                                                                   
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           |||||||||||||||||||||| |||||||| |||||||||| |||||| ||||||
Sbjct: 431 gatactggacaatgtggaagctgcctatgttcgggtgcaccgacgccacgcaggtg 486
to top
>dbj|AB020936.1| Aegilops bicornis DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Bic-A
          Length = 605

 Score = 81.8 bits (41), Expect = 2e-13
 Identities = 52/56 (92%)
 Strand = Plus / Plus

                                                                   
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           |||||||||||||||||||||| |||||||| |||||||||| |||||| ||||||
Sbjct: 425 gatactggacaatgtggaagctgcctatgttcgggtgcaccgacgccacgcaggtg 480
to top
>dbj|AB020931.1| Aegilops speltoides DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Spe3-A3
          Length = 604

 Score = 81.8 bits (41), Expect = 2e-13
 Identities = 52/56 (92%)
 Strand = Plus / Plus

                                                                   
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           |||||||||||||||||||||| |||||||| |||||||||| |||||| ||||||
Sbjct: 424 gatactggacaatgtggaagctgcctatgttcgggtgcaccgacgccacgcaggtg 479
to top
>dbj|AB020930.1| Aegilops speltoides DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Spe3-A2
          Length = 604

 Score = 81.8 bits (41), Expect = 2e-13
 Identities = 52/56 (92%)
 Strand = Plus / Plus

                                                                   
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           |||||||||||||||||||||| |||||||| |||||||||| |||||| ||||||
Sbjct: 424 gatactggacaatgtggaagctgcctatgttcgggtgcaccgacgccacgcaggtg 479
to top
>dbj|AB020929.1| Aegilops speltoides DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Spe3-A1
          Length = 604

 Score = 81.8 bits (41), Expect = 2e-13
 Identities = 52/56 (92%)
 Strand = Plus / Plus

                                                                   
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           |||||||||||||||||||||| |||||||| |||||||||| |||||| ||||||
Sbjct: 424 gatactggacaatgtggaagctgcctatgttcgggtgcaccgacgccacgcaggtg 479
to top
>dbj|AB020927.1| Aegilops speltoides DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Spe1-A1
          Length = 604

 Score = 81.8 bits (41), Expect = 2e-13
 Identities = 52/56 (92%)
 Strand = Plus / Plus

                                                                   
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           |||||||||||||||||||||| |||||||| |||||||||| |||||| ||||||
Sbjct: 424 gatactggacaatgtggaagctgcctatgttcgggtgcaccgacgccacgcaggtg 479
to top
>dbj|AB020926.1| Aegilops speltoides DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds
          Length = 604

 Score = 81.8 bits (41), Expect = 2e-13
 Identities = 52/56 (92%)
 Strand = Plus / Plus

                                                                   
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           |||||||||||||||||||||| |||||||| |||||||||| |||||| ||||||
Sbjct: 424 gatactggacaatgtggaagctgcctatgttcgggtgcaccgacgccacgcaggtg 479
to top
>dbj|AB042069.1| Triticum aestivum rbcS gene for ribulose-1,5-bisphosphate
            carboxylase/oxygenase small subunit, complete cds,
            clone:6, subclone:16
          Length = 5980

 Score = 81.8 bits (41), Expect = 2e-13
 Identities = 52/56 (92%)
 Strand = Plus / Plus

                                                                    
Query: 1    gatactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
            |||||||||||||||||||||| |||||||| |||||||||| |||||| ||||||
Sbjct: 1067 gatactggacaatgtggaagctgcctatgttcgggtgcaccgacgccacgcaggtg 1122



 Score = 60.0 bits (30), Expect = 6e-07
 Identities = 33/34 (97%)
 Strand = Plus / Plus

                                              
Query: 9    acaatgtggaagctacctatgtttgggtgcaccg 42
            |||||||||||||||||||| |||||||||||||
Sbjct: 4136 acaatgtggaagctacctatctttgggtgcaccg 4169



 Score = 58.0 bits (29), Expect = 2e-06
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                    
Query: 1    gatactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
            ||||| |||||| ||||||| | |||||||| |||||||| | |||||||||||||
Sbjct: 5471 gataccggacaaagtggaagttgcctatgttcgggtgcactgacgccacacaggtg 5526
to top
>dbj|AB042068.1| Triticum aestivum rbcS gene for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, complete cds,
           clone:p13-1
          Length = 985

 Score = 81.8 bits (41), Expect = 2e-13
 Identities = 52/56 (92%)
 Strand = Plus / Plus

                                                                   
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           |||||||||||||||||||||| |||||||| |||||||||| ||| |||||||||
Sbjct: 789 gatactggacaatgtggaagctgcctatgttcgggtgcaccgacgctacacaggtg 844
to top
>dbj|AB042065.1| Triticum aestivum rbcS gene for ribulose-1,5-bisphosphate
           carboxylase/oxygenase Small subunit, complete cds,
           clone:p6-1
          Length = 638

 Score = 81.8 bits (41), Expect = 2e-13
 Identities = 52/56 (92%)
 Strand = Plus / Plus

                                                                   
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           |||||||||||||||||||||| |||||||| |||||||||| |||||| ||||||
Sbjct: 442 gatactggacaatgtggaagctgcctatgttcgggtgcaccgacgccacgcaggtg 497
to top
>gb|U43493.1|HVU43493 Hordeum vulgare ribulose-1,5-bisphosphate carboxylase small subunit
           mRNA, complete cds
          Length = 816

 Score = 77.8 bits (39), Expect = 2e-12
 Identities = 50/54 (92%)
 Strand = Plus / Plus

                                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           |||||||||||||||||||| |||||||| || ||||||| |||||||||||||
Sbjct: 354 tactggacaatgtggaagctgcctatgttcggatgcaccgacgccacacaggtg 407
to top
>dbj|AB042064.1| Triticum aestivum rbcS gene for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, complete cds,
           clone:p2-1
          Length = 653

 Score = 77.8 bits (39), Expect = 2e-12
 Identities = 50/54 (92%)
 Strand = Plus / Plus

                                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           |||||||||||||||||||| |||||||| |||||||||| |||||| ||||||
Sbjct: 459 tactggacaatgtggaagctgcctatgttcgggtgcaccgacgccacgcaggtg 512
to top
>dbj|AB020941.1| Triticum aestivum DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           CS-A
          Length = 605

 Score = 75.8 bits (38), Expect = 9e-12
 Identities = 46/49 (93%)
 Strand = Plus / Plus

                                                            
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcaccgncgccac 49
           |||||||||||||||||||||| |||||||| |||||||||| ||||||
Sbjct: 425 gatactggacaatgtggaagctgcctatgttcgggtgcaccgacgccac 473
to top
>dbj|AB020940.1| Triticum turgidum subsp. dicoccoides DNA for
           ribulose-1,5-bisphosphate carboxylase/oxygenase small
           subunit, partial cds, clone Dic-A
          Length = 605

 Score = 75.8 bits (38), Expect = 9e-12
 Identities = 46/49 (93%)
 Strand = Plus / Plus

                                                            
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcaccgncgccac 49
           |||||||||||||||||||||| |||||||| |||||||||| ||||||
Sbjct: 425 gatactggacaatgtggaagctgcctatgttcgggtgcaccgacgccac 473
to top
>dbj|AB042067.1| Triticum aestivum rbcS gene for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, complete cds,
           clone:p10-1
          Length = 629

 Score = 75.8 bits (38), Expect = 9e-12
 Identities = 46/49 (93%)
 Strand = Plus / Plus

                                                            
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcaccgncgccac 49
           |||||||||||||||||||||| |||||||| |||||||||| ||||||
Sbjct: 433 gatactggacaatgtggaagctgcctatgttcgggtgcaccgacgccac 481
to top
>emb|AJ131737.1|SCE131737 Secale cereale mRNA for hypothetical protein, clone 5
          Length = 845

 Score = 73.8 bits (37), Expect = 4e-11
 Identities = 51/56 (91%)
 Strand = Plus / Plus

                                                                   
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           |||||||||||||||||||| | |||||||| |||||||||| |||||| ||||||
Sbjct: 399 gatactggacaatgtggaagttgcctatgttcgggtgcaccgacgccacgcaggtg 454
to top
>dbj|AB020939.1| Triticum timopheevii subsp. armeniacum DNA for
           ribulose-1,5-bisphosphate carboxylase/oxygenase small
           subunit, partial cds, clone Ara-A
          Length = 604

 Score = 73.8 bits (37), Expect = 4e-11
 Identities = 51/56 (91%)
 Strand = Plus / Plus

                                                                   
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           |||||||||| ||||||||||| |||||||| |||||||||| |||||| ||||||
Sbjct: 424 gatactggactatgtggaagctgcctatgttcgggtgcaccgacgccacgcaggtg 479
to top
>dbj|AB042066.1| Triticum aestivum rbcS gene for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, complete cds,
           clone:p9-1
          Length = 739

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 6   tggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           ||||||||||||||||| |||||||| |||||||| | |||||||||||||
Sbjct: 548 tggacaatgtggaagctgcctatgttcgggtgcactgacgccacacaggtg 598
to top
>emb|X05982.1|LERBCS1 Tomato rbcS1 gene for ribulose 1,5-bisphosphate carboxylase/
           oxygenase small subunit
          Length = 1454

 Score = 69.9 bits (35), Expect = 6e-10
 Identities = 52/58 (89%)
 Strand = Plus / Plus

                                                                     
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtgtt 58
           |||||||||| ||||||||| ||||||||||||||||||| |  || |||||||||||
Sbjct: 895 gatactggaccatgtggaagttacctatgtttgggtgcactgatgcaacacaggtgtt 952
to top
>gb|AF192778.1|AF192778 Avena sterilis subsp. ludoviciana ribulose-1,5-bisphosphate
           carboxylase small subunit (rbcS) mRNA, nuclear gene
           encoding chloroplast protein, partial cds
          Length = 504

 Score = 69.9 bits (35), Expect = 6e-10
 Identities = 49/54 (90%)
 Strand = Plus / Plus

                                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           |||||||||||||||||||| || ||||| |||||||||| |||| ||||||||
Sbjct: 319 tactggacaatgtggaagctgcccatgttcgggtgcaccgacgcctcacaggtg 372
to top
>gb|M15235.1|TOMRBCSD Tomato RuBP carboxylase small subunit LESS17 mRNA
          Length = 778

 Score = 69.9 bits (35), Expect = 6e-10
 Identities = 52/58 (89%)
 Strand = Plus / Plus

                                                                     
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtgtt 58
           |||||||||| ||||||||| ||||||||||||||||||| |  || |||||||||||
Sbjct: 441 gatactggaccatgtggaagttacctatgtttgggtgcactgatgcaacacaggtgtt 498
to top
>gb|M13542.1|TOMRBCSA Tomato (L.esculentum) ribulose-1,5-bisphosphate
           carboxylase/oxygenase (RBCS) small subunit gene, clone
           Rbcs-1
          Length = 1032

 Score = 69.9 bits (35), Expect = 6e-10
 Identities = 52/58 (89%)
 Strand = Plus / Plus

                                                                     
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtgtt 58
           |||||||||| ||||||||| ||||||||||||||||||| |  || |||||||||||
Sbjct: 684 gatactggaccatgtggaagttacctatgtttgggtgcactgatgcaacacaggtgtt 741
to top
>gb|AF097361.1|AF097361 Avena clauda ribulose-1,5-bisphosphate carboxylase small subunit
           (rbcS) mRNA, nuclear gene encoding chloroplast protein,
           partial cds
          Length = 504

 Score = 67.9 bits (34), Expect = 2e-09
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggt 55
           |||||||||||||||||||| || ||||| |||||||||| |||| |||||||
Sbjct: 319 tactggacaatgtggaagctgcccatgttcgggtgcaccgacgcctcacaggt 371
to top
>gb|AF493617.1| Acetabularia acetabulum ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit (rbcS) mRNA, partial
           cds; chloroplast gene for chloroplast product
          Length = 411

 Score = 63.9 bits (32), Expect = 4e-08
 Identities = 38/40 (95%)
 Strand = Plus / Plus

                                                   
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcac 40
           |||| ||||||||||||||||||||||||||||| |||||
Sbjct: 172 gatattggacaatgtggaagctacctatgtttggatgcac 211
to top
>emb|X51814.1|AMRBCSM4 Acetabularia mediterranea mRNA for ribulose 1,5-bisphosphate
           carboxylase/oxygenase, small subunit (rbcS gene), clone
           M4
          Length = 741

 Score = 63.9 bits (32), Expect = 4e-08
 Identities = 38/40 (95%)
 Strand = Plus / Plus

                                                   
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcac 40
           |||| ||||||||||||||||||||||||||||| |||||
Sbjct: 381 gatattggacaatgtggaagctacctatgtttggatgcac 420
to top
>gb|L26605.1|SLARBCS Stellaria longipes ribulose-1,5-bisphosphate carboxylase/oxygenase
           (rbcS) mRNA, complete cds
          Length = 723

 Score = 63.9 bits (32), Expect = 4e-08
 Identities = 38/40 (95%)
 Strand = Plus / Plus

                                                   
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcac 40
           |||||||||| ||||||||||| |||||||||||||||||
Sbjct: 397 gatactggaccatgtggaagctgcctatgtttgggtgcac 436
to top
>emb|X69763.1|STRBCS3 S.tuberosum rbcS3 gene for ribulose-(1,5)-bisphosphate
           carboxylase/oxygenase small subunit
          Length = 1598

 Score = 61.9 bits (31), Expect = 1e-07
 Identities = 51/58 (87%)
 Strand = Plus / Plus

                                                                     
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtgtt 58
           |||||||||| ||||||||| | ||||||||||||||||| | ||| || ||||||||
Sbjct: 928 gatactggaccatgtggaagttgcctatgtttgggtgcactgacgcaacccaggtgtt 985
to top
>gb|AF202646.1|AF202646 Avena clauda clone ClG4 ribulose-1,5-bisphosphate carboxylase small
           subunit (rbcS) gene, partial cds
          Length = 586

 Score = 61.9 bits (31), Expect = 1e-07
 Identities = 48/54 (88%)
 Strand = Plus / Plus

                                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           |||||||||||||||||| | || ||||| |||||||||| |||| ||||||||
Sbjct: 401 tactggacaatgtggaagttgcccatgttcgggtgcaccgacgcctcacaggtg 454
to top
>gb|AF192779.1|AF192779 Avena maroccana clone Ma4 ribulose-1,5-bisphosphate carboxylase
           small subunit (rbcS) mRNA, nuclear gene encoding
           chloroplast protein, partial cds
          Length = 504

 Score = 61.9 bits (31), Expect = 1e-07
 Identities = 48/54 (88%)
 Strand = Plus / Plus

                                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           |||||||||||||||||||| || ||||| || ||||||| |||| ||||||||
Sbjct: 319 tactggacaatgtggaagctgcccatgttcggctgcaccgacgcctcacaggtg 372
to top
>gb|AF192776.1|AF192776 Avena clauda clone Cl5 ribulose-1,5-bisphosphate carboxylase small
           subunit (rbcS) mRNA, nuclear gene encoding chloroplast
           protein, partial cds
          Length = 504

 Score = 61.9 bits (31), Expect = 1e-07
 Identities = 48/54 (88%)
 Strand = Plus / Plus

                                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           |||||||||||||||||||| || ||||| || ||||||| |||| ||||||||
Sbjct: 319 tactggacaatgtggaagctgcccatgttcggctgcaccgacgcctcacaggtg 372
to top
>gb|AF192773.1|AF192773 Avena agadiriana ribulose-1,5-bisphosphate carboxylase small
           subunit (rbcS) mRNA, nuclear gene encoding chloroplast
           protein, partial cds
          Length = 504

 Score = 61.9 bits (31), Expect = 1e-07
 Identities = 48/54 (88%)
 Strand = Plus / Plus

                                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           |||||||||||||||||||| || ||||| || ||||||| |||| ||||||||
Sbjct: 319 tactggacaatgtggaagctgcccatgttcggctgcaccgacgcctcacaggtg 372
to top
>gb|AF097359.1|AF097359 Avena agadiriana ribulose-1,5-bisphosphate carboxylase small
           subunit (rbcS) mRNA, nuclear gene encoding chloroplast
           protein, partial cds
          Length = 504

 Score = 61.9 bits (31), Expect = 1e-07
 Identities = 48/54 (88%)
 Strand = Plus / Plus

                                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           |||||||||||||||||||| || ||||| || ||||||| |||| ||||||||
Sbjct: 319 tactggacaatgtggaagctgcccatgttcggctgcaccgacgcctcacaggtg 372
to top
>gb|AF104249.1|AF104249 Avena vaviloviana ribulose-1,5-bisphosphate carboxylase small
           subunit (rbcS) mRNA, nuclear gene encoding chloroplast
           protein, partial cds
          Length = 504

 Score = 61.9 bits (31), Expect = 1e-07
 Identities = 48/54 (88%)
 Strand = Plus / Plus

                                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           |||||||||||||||||||| || ||||| || ||||||| |||| ||||||||
Sbjct: 319 tactggacaatgtggaagctgcccatgttcggctgcaccgacgcctcacaggtg 372
to top
>gb|L22155.1|RICCPRBCLA Oryza sativum mitochondrial ribulose bisphosphate
           carboxylase/oxygenase (rbcS) mRNA, complete cds
          Length = 808

 Score = 61.9 bits (31), Expect = 1e-07
 Identities = 48/54 (88%)
 Strand = Plus / Plus

                                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           |||||||| ||||||||||| || ||||| |||||||||| |||||| ||||||
Sbjct: 368 tactggaccatgtggaagctgcccatgttcgggtgcaccgacgccacccaggtg 421
to top
>dbj|AB020942.1| Secale cereale DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Sec-A
          Length = 591

 Score = 61.9 bits (31), Expect = 1e-07
 Identities = 48/54 (88%)
 Strand = Plus / Plus

                                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           |||||||||||||||||||| |||||||| || ||||| | |||||| ||||||
Sbjct: 413 tactggacaatgtggaagctgcctatgttcggctgcacggacgccactcaggtg 466
to top
>gb|AY267350.1| Flaveria bidentis ribulose-1,5-bisphosphate carboxylase/oxygenase
           small subunit (RbcS1) mRNA, complete cds
          Length = 735

 Score = 60.0 bits (30), Expect = 6e-07
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                     
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcaccg 42
           |||||||||||||||||||| | ||||||||||| |||||||
Sbjct: 373 gatactggacaatgtggaagttgcctatgtttggatgcaccg 414
to top
>gb|J01256.1|PEARBPC Pisum sativum ribulose-1,5-bisphosphate carboxylase small subunit
           precursor mRNA, partial cds
          Length = 669

 Score = 60.0 bits (30), Expect = 6e-07
 Identities = 33/34 (97%)
 Strand = Plus / Plus

                                             
Query: 1   gatactggacaatgtggaagctacctatgtttgg 34
           |||||||||||||||||||||| |||||||||||
Sbjct: 233 gatactggacaatgtggaagcttcctatgtttgg 266
to top
>gb|AY273795.1| Citrus limon ribulose-1,5-bisphosphate carboxylase/oxygenase small
           subunit mRNA, partial cds; nuclear gene for chloroplast
           product
          Length = 357

 Score = 60.0 bits (30), Expect = 6e-07
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcac 40
           |||||||||||||||||||| || ||||||||||||||
Sbjct: 214 tactggacaatgtggaagctgcccatgtttgggtgcac 251
to top
>gb|M25613.1|PEARUBP2 Pisum sativum ribulose 1,5 bisphosphate carboxylase (RuBP) mRNA,
           partial cds
          Length = 674

 Score = 60.0 bits (30), Expect = 6e-07
 Identities = 33/34 (97%)
 Strand = Plus / Plus

                                             
Query: 1   gatactggacaatgtggaagctacctatgtttgg 34
           |||||||||||||||||||||| |||||||||||
Sbjct: 242 gatactggacaatgtggaagcttcctatgtttgg 275
to top
>emb|X04334.1|PSRBCS3C Pea rbcS-3C gene for ribulose 1.5-bisphosphate carboxylase (RBC)
           small subunit
          Length = 1381

 Score = 60.0 bits (30), Expect = 6e-07
 Identities = 33/34 (97%)
 Strand = Plus / Plus

                                             
Query: 1   gatactggacaatgtggaagctacctatgtttgg 34
           |||||||||||||||||||||| |||||||||||
Sbjct: 862 gatactggacaatgtggaagcttcctatgtttgg 895
to top
>emb|X04333.1|PSRBCS3A Pea rbcS-3A gene for ribulose 1.5-bisphosphate carboxylase (RBC)
            small subunit
          Length = 2061

 Score = 60.0 bits (30), Expect = 6e-07
 Identities = 33/34 (97%)
 Strand = Plus / Plus

                                              
Query: 1    gatactggacaatgtggaagctacctatgtttgg 34
            |||||||||||||||||||||| |||||||||||
Sbjct: 1354 gatactggacaatgtggaagcttcctatgtttgg 1387
to top
>emb|X00806.1|PSRC01 Pea gene for rib-1,5-bisphospate carboxylase (rbcS) small subunit (EC
            4.1.1.39)
          Length = 2351

 Score = 60.0 bits (30), Expect = 6e-07
 Identities = 33/34 (97%)
 Strand = Plus / Plus

                                              
Query: 1    gatactggacaatgtggaagctacctatgtttgg 34
            |||||||||||||||||||||| |||||||||||
Sbjct: 1615 gatactggacaatgtggaagcttcctatgtttgg 1648
to top
>emb|X07515.1|OSRBCS Rice rbcS gene for ribulose 1,5-bisphosphate carboxylase/oxygenase
           small subunit (EC 4.1.1.39)
          Length = 1110

 Score = 60.0 bits (30), Expect = 6e-07
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggt 55
           |||||||| ||||||||||| || ||||| |||||||||| |||||| |||||
Sbjct: 680 tactggaccatgtggaagctgcccatgttcgggtgcaccgacgccacccaggt 732
to top
>emb|X60000.1|PVRBCOS P.vulgaris rbcS mRNA for small subunit of ribulose bisphosphate
           carboxylase/oxygenase (clone pPvSS191)
          Length = 849

 Score = 60.0 bits (30), Expect = 6e-07
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcac 40
           |||||||| ||||||||||| |||||||||||||||||
Sbjct: 405 tactggacgatgtggaagctgcctatgtttgggtgcac 442
to top
>emb|X59999.1|PVRBCS P.vulgaris rbcS mRNA for small subunit of ribulose bisphosphate
           carboxylase/oxygenase (clone pPvSS965)
          Length = 591

 Score = 60.0 bits (30), Expect = 6e-07
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcac 40
           |||||||| ||||||||||| |||||||||||||||||
Sbjct: 233 tactggacgatgtggaagctgcctatgtttgggtgcac 270
to top
>emb|X57022.1|PVSS15BCO P. vulgaris rbcS cDNA (with intronic sequences) for small subunit
           of ribulose 1,5-bisphosphate carboxylase/oxygenase
          Length = 1071

 Score = 60.0 bits (30), Expect = 6e-07
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcac 40
           |||||||| ||||||||||| |||||||||||||||||
Sbjct: 614 tactggacgatgtggaagctgcctatgtttgggtgcac 651
to top
>gb|AF192775.1|AF192775 Avena strigosa clone Str5 ribulose-1,5-bisphosphate carboxylase
           small subunit (rbcS) mRNA, nuclear gene encoding
           chloroplast protein, partial cds
          Length = 504

 Score = 60.0 bits (30), Expect = 6e-07
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggt 55
           |||||||||||||||||||| || ||||| || ||||||| |||| |||||||
Sbjct: 319 tactggacaatgtggaagctgcccatgttcggctgcaccgacgcctcacaggt 371
to top
>gb|AF192774.1|AF192774 Avena strigosa clone Str3 ribulose-1,5-bisphosphate carboxylase
           small subunit (rbcS) mRNA, nuclear gene encoding
           chloroplast protein, partial cds
          Length = 504

 Score = 60.0 bits (30), Expect = 6e-07
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggt 55
           |||||||||||||||||||| || ||||| || ||||||| |||| |||||||
Sbjct: 319 tactggacaatgtggaagctgcccatgttcggctgcaccgacgcctcacaggt 371
to top
>gb|AF101233.1|AF101233 Manihot esculenta clone U291 ribulose 1,5-bisphosphate carboxylase
           small chain precursor, mRNA, complete cds; chloroplast
           gene for chloroplast product
          Length = 780

 Score = 60.0 bits (30), Expect = 6e-07
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcac 40
           |||||||||||||||||||| || ||||||||||||||
Sbjct: 373 tactggacaatgtggaagctgccaatgtttgggtgcac 410
to top
>gb|AF101232.1|AF101232 Manihot esculenta clone U216 ribulose 1,5-bisphosphate carboxylase
           small chain precursor, mRNA, complete cds; chloroplast
           gene for chloroplast product
          Length = 793

 Score = 60.0 bits (30), Expect = 6e-07
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcac 40
           |||||||||||||||||||| || ||||||||||||||
Sbjct: 414 tactggacaatgtggaagctgccaatgtttgggtgcac 451
to top
>gb|AF101230.1|AF101230 Manihot esculenta clone R312 ribulose 1,5-bisphosphate carboxylase
           small chain precursor, mRNA, complete cds; chloroplast
           gene for chloroplast product
          Length = 811

 Score = 60.0 bits (30), Expect = 6e-07
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcac 40
           |||||||||||||||||||| || ||||||||||||||
Sbjct: 373 tactggacaatgtggaagctgccaatgtttgggtgcac 410
to top
>gb|AF162195.1|AF162195 Lactuca sativa ribulose-1,5-bisphosphate carboxylase/oxygenase
           small subunit precursor, mRNA, complete cds
          Length = 956

 Score = 60.0 bits (30), Expect = 6e-07
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcac 40
           |||||||||||||||||| | |||||||||||||||||
Sbjct: 900 tactggacaatgtggaagttgcctatgtttgggtgcac 937



 Score = 48.1 bits (24), Expect = 0.002
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                   
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcac 40
           |||||||||||||||||||| | |||||||| || |||||
Sbjct: 410 gatactggacaatgtggaagttgcctatgttcggatgcac 449
to top
>gb|AF097360.1|AF097360 Avena strigosa ribulose-1,5-bisphosphate carboxylase small subunit
           (rbcS) mRNA, nuclear gene encoding chloroplast protein,
           partial cds
          Length = 504

 Score = 60.0 bits (30), Expect = 6e-07
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggt 55
           |||||||||||||||||||| || ||||| || ||||||| |||| |||||||
Sbjct: 319 tactggacaatgtggaagctgcccatgttcggctgcaccgacgcctcacaggt 371
to top
>gb|J01257.1|PEARUBPA Pea (P.sativum) ribulose 1,5-bisphosphate carboxylase small subunit
           mRNA, clone pSS15
          Length = 619

 Score = 60.0 bits (30), Expect = 6e-07
 Identities = 33/34 (97%)
 Strand = Plus / Plus

                                             
Query: 1   gatactggacaatgtggaagctacctatgtttgg 34
           |||||||||||||||||||||| |||||||||||
Sbjct: 293 gatactggacaatgtggaagcttcctatgtttgg 326
to top
>gb|AY843526.1| Ammopiptanthus mongolicus ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit mRNA, complete cds;
           chloroplast
          Length = 824

 Score = 58.0 bits (29), Expect = 2e-06
 Identities = 35/37 (94%)
 Strand = Plus / Plus

                                                
Query: 3   tactggacaatgtggaagctacctatgtttgggtgca 39
           |||||||| ||||||||||| ||||||||||||||||
Sbjct: 393 tactggaccatgtggaagctgcctatgtttgggtgca 429
to top
>gb|AY705444.1| Fagus sylvatica chloroplast ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit (rbcS) mRNA,
           complete cds; nuclear gene for chloroplast product
          Length = 562

 Score = 56.0 bits (28), Expect = 9e-06
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 12  atgtggaagctacctatgtttgggtgcaccgncgccacacaggtgtt 58
           ||||||||||| || |||||||| |||||||  ||||||||||||||
Sbjct: 383 atgtggaagctgcccatgtttggatgcaccgatgccacacaggtgtt 429
to top
>emb|X02353.1|NTRUBSS Tobacco gene for ribulose 1,5-bisphosphate carboxylase small subunit
          Length = 2362

 Score = 56.0 bits (28), Expect = 9e-06
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                    
Query: 1    gatactggacaatgtggaagctacctatgtttgggtgcac 40
            |||||||||| |||||||||||||||||||| || |||||
Sbjct: 1806 gatactggaccatgtggaagctacctatgttcggatgcac 1845
to top
>emb|X01722.1|NSRUB1 Nicotiana silvestris mRNA for the small subunit of ribulose
           bisphosphate carboxylase
          Length = 796

 Score = 56.0 bits (28), Expect = 9e-06
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                   
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcac 40
           |||||||||| |||||||||||||||||||| || |||||
Sbjct: 425 gatactggaccatgtggaagctacctatgttcggatgcac 464
to top
>emb|AJ843975.1| Plantago major mRNA for Rubisco SSU (rbcs1a gene)
          Length = 761

 Score = 56.0 bits (28), Expect = 9e-06
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                   
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcaccg 42
           ||||||||||||||||||||||| ||||| || |||||||
Sbjct: 394 tactggacaatgtggaagctacccatgttcggatgcaccg 433
to top
>gb|AY220079.1| Nicotiana tabacum putative ribulose bisphosphate carboxylase small
           subunit protein precursor, mRNA, complete cds; nuclear
           gene for chloroplast product
          Length = 806

 Score = 56.0 bits (28), Expect = 9e-06
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                   
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcac 40
           |||||||||| ||||||||||| || ||||||||||||||
Sbjct: 425 gatactggaccatgtggaagctgcccatgtttgggtgcac 464
to top
>emb|AJ538410.1|NTA538410 Nicotiana tabacum cDNA-AFLP-fragment BC1-M32-023
          Length = 221

 Score = 56.0 bits (28), Expect = 9e-06
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                  
Query: 1  gatactggacaatgtggaagctacctatgtttgggtgcac 40
          |||||||||| ||||||||||| || ||||||||||||||
Sbjct: 89 gatactggaccatgtggaagctgcccatgtttgggtgcac 50
to top
>emb|AJ538400.1|NTA538400 Nicotiana tabacum cDNA-AFLP-fragment BC1-M23-013
          Length = 263

 Score = 56.0 bits (28), Expect = 9e-06
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                  
Query: 1  gatactggacaatgtggaagctacctatgtttgggtgcac 40
          |||||||||| |||||||||||||||||||| || |||||
Sbjct: 90 gatactggaccatgtggaagctacctatgttcggatgcac 51
to top
>emb|Y09214.1|ZMRUBSMSU Z.mays rubisco small subunit gene
          Length = 1274

 Score = 56.0 bits (28), Expect = 9e-06
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtgt 57
           |||||||| ||||||||||| || ||||| || ||||||| |||||| |||||||
Sbjct: 647 tactggaccatgtggaagctgcccatgttcggctgcaccgacgccacgcaggtgt 701
to top
>gb|DQ286548.1| Pyrus pyrifolia ribulose-1,5-bisphosphate carboxylase small
           subunit-like gene, complete sequence; plastid
          Length = 549

 Score = 56.0 bits (28), Expect = 9e-06
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                   
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcaccg 42
           |||||||||||||||||||| || |||||||| |||||||
Sbjct: 369 tactggacaatgtggaagcttcccatgtttggatgcaccg 408
to top
>gb|J01308.1|TOBRBPC Nicotiana sylvestris ribulose-1,5-bisphosphate carboxylase small
           subunit mRNA
          Length = 453

 Score = 56.0 bits (28), Expect = 9e-06
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                   
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcac 40
           |||||||||| |||||||||||||||||||| || |||||
Sbjct: 83  gatactggaccatgtggaagctacctatgttcggatgcac 122
to top
>gb|J03613.1|POTRBCS Potato (S.tuberosum) ribulose bisphosphate carboxylase (rbcS) mRNA,
           complete cds
          Length = 546

 Score = 56.0 bits (28), Expect = 9e-06
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                   
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcac 40
           |||||||||| ||||||||| | |||||||||||||||||
Sbjct: 368 gatactggaccatgtggaagttgcctatgtttgggtgcac 407
to top
>gb|M16056.1|CUSSSU Cucumber SSU mRNA encoding ribulose bisphosphate
           carboxylase/oxygenase, complete cds
          Length = 812

 Score = 56.0 bits (28), Expect = 9e-06
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                   
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcaccg 42
           |||||||| ||||||||||| ||||||||||| |||||||
Sbjct: 402 tactggaccatgtggaagctccctatgtttggctgcaccg 441
to top
>dbj|AB006080.1| Fagus crenata mRNA for small subunit of ribulose-1,5-bisphosphate
           carboxylase/oxygenase, complete cds
          Length = 789

 Score = 56.0 bits (28), Expect = 9e-06
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 12  atgtggaagctacctatgtttgggtgcaccgncgccacacaggtgtt 58
           ||||||||||| || |||||||| |||||||  ||||||||||||||
Sbjct: 419 atgtggaagctgcccatgtttggatgcaccgatgccacacaggtgtt 465
to top
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 54.0 bits (27), Expect = 3e-05
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                      
Query: 3        tactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
                |||||||| ||||||||||| || ||||| |||||||| | |||||| ||||||
Sbjct: 10079964 tactggaccatgtggaagctgcccatgttcgggtgcactgacgccacccaggtg 10079911



 Score = 46.1 bits (23), Expect = 0.008
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                      
Query: 3        tactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
                |||||||| ||||||||||| |||||||| || ||||| |  ||||| ||||||
Sbjct: 11276780 tactggaccatgtggaagctgcctatgttcggatgcactgatgccacccaggtg 11276833



 Score = 40.1 bits (20), Expect = 0.52
 Identities = 43/51 (84%)
 Strand = Plus / Plus

                                                                   
Query: 6        tggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
                ||||| ||||||||||| || ||||| || |||||||  ||||| ||||||
Sbjct: 11262120 tggaccatgtggaagctgcccatgttcggctgcaccgatgccacccaggtg 11262170
to top
>dbj|AK121444.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023141B14, full
           insert sequence
          Length = 984

 Score = 54.0 bits (27), Expect = 3e-05
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           |||||||| ||||||||||| || ||||| |||||||| | |||||| ||||||
Sbjct: 544 tactggaccatgtggaagctgcccatgttcgggtgcactgacgccacccaggtg 597
to top
>dbj|AK119219.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-046-F11, full
           insert sequence
          Length = 828

 Score = 54.0 bits (27), Expect = 3e-05
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           |||||||| ||||||||||| || ||||| |||||||| | |||||| ||||||
Sbjct: 390 tactggaccatgtggaagctgcccatgttcgggtgcactgacgccacccaggtg 443
to top
>gb|AF202648.1|AF202648 Avena maroccana ribulose-1,5-bisphosphate carboxylase small subunit
           (rbcS) gene, partial cds
          Length = 620

 Score = 54.0 bits (27), Expect = 3e-05
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           |||||||||||||||||||| || ||||| || ||||| | |||| ||||||||
Sbjct: 435 tactggacaatgtggaagctgcccatgttcggctgcactgacgcctcacaggtg 488
to top
>dbj|AK070556.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023062J10, full
           insert sequence
          Length = 2409

 Score = 54.0 bits (27), Expect = 3e-05
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           |||||||| ||||||||||| || ||||| |||||||| | |||||| ||||||
Sbjct: 391 tactggaccatgtggaagctgcccatgttcgggtgcactgacgccacccaggtg 444
to top
>gb|AF192780.1|AF192780 Avena maroccana clone Ma7 ribulose-1,5-bisphosphate carboxylase
           small subunit (rbcS) mRNA, nuclear gene encoding
           chloroplast protein, partial cds
          Length = 504

 Score = 54.0 bits (27), Expect = 3e-05
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           |||||||||||||||||||| || ||||| || ||||| | |||| ||||||||
Sbjct: 319 tactggacaatgtggaagctgcccatgttcggctgcactgacgcctcacaggtg 372
to top
>dbj|AK061611.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-032-F07, full
           insert sequence
          Length = 830

 Score = 54.0 bits (27), Expect = 3e-05
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           |||||||| ||||||||||| || ||||| |||||||| | |||||| ||||||
Sbjct: 393 tactggaccatgtggaagctgcccatgttcgggtgcactgacgccacccaggtg 446
to top
>gb|AF104250.1|AF104250 Avena maroccana ribulose-1,5-bisphosphate carboxylase small subunit
           (rbcS) mRNA, nuclear gene encoding chloroplast protein,
           partial cds
          Length = 504

 Score = 54.0 bits (27), Expect = 3e-05
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           |||||||||||||||||||| || ||||| || ||||| | |||| ||||||||
Sbjct: 319 tactggacaatgtggaagctgcccatgttcggctgcactgacgcctcacaggtg 372
to top
>gb|AF096617.1|AF096617 Avena sterilis subsp. ludoviciana ribulose-1,5-bisphosphate
           carboxylase small subunit (rbcS) mRNA, partial cds
          Length = 504

 Score = 54.0 bits (27), Expect = 3e-05
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           |||||||||||||||||||| || ||||| || ||||||| |||| | ||||||
Sbjct: 319 tactggacaatgtggaagctccccatgttcggatgcaccgacgcctcccaggtg 372
to top
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 54.0 bits (27), Expect = 3e-05
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                      
Query: 3        tactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
                |||||||| ||||||||||| || ||||| |||||||| | |||||| ||||||
Sbjct: 10079849 tactggaccatgtggaagctgcccatgttcgggtgcactgacgccacccaggtg 10079796



 Score = 46.1 bits (23), Expect = 0.008
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                      
Query: 3        tactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
                |||||||| ||||||||||| |||||||| || ||||| |  ||||| ||||||
Sbjct: 11276451 tactggaccatgtggaagctgcctatgttcggatgcactgatgccacccaggtg 11276504



 Score = 40.1 bits (20), Expect = 0.52
 Identities = 43/51 (84%)
 Strand = Plus / Plus

                                                                   
Query: 6        tggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
                ||||| ||||||||||| || ||||| || |||||||  ||||| ||||||
Sbjct: 11261791 tggaccatgtggaagctgcccatgttcggctgcaccgatgccacccaggtg 11261841
to top
>emb|AL731739.4|CNS08C7O Oryza sativa chromosome 12, . BAC OSJNBa0056I18 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 145890

 Score = 54.0 bits (27), Expect = 3e-05
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                   
Query: 3     tactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
             |||||||| ||||||||||| || ||||| |||||||| | |||||| ||||||
Sbjct: 82657 tactggaccatgtggaagctgcccatgttcgggtgcactgacgccacccaggtg 82710
to top
>gb|AF052305.1|AF052305 Oryza sativa ribulose 1,5-bisphosphate carboxylase small subunit
           mRNA, complete cds
          Length = 835

 Score = 54.0 bits (27), Expect = 3e-05
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           |||||||| ||||||||||| || ||||| |||||||| | |||||| ||||||
Sbjct: 379 tactggaccatgtggaagctgcccatgttcgggtgcactgacgccacccaggtg 432
to top
>gb|AF017364.1|AF017364 Oryza sativa ribulose 1,5-bisphosphate carboxylase small subunit
           mRNA, complete cds
          Length = 854

 Score = 54.0 bits (27), Expect = 3e-05
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           |||||||| ||||||||||| || ||||| |||||||| | |||||| ||||||
Sbjct: 416 tactggaccatgtggaagctgcccatgttcgggtgcactgacgccacccaggtg 469
to top
>dbj|AB020960.1| Bromus catharticus DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Bro-B
          Length = 784

 Score = 54.0 bits (27), Expect = 3e-05
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           |||||||||||||||||| | |||||||| || |||||||  ||| ||||||||
Sbjct: 606 tactggacaatgtggaagttgcctatgttcggatgcaccgatgcctcacaggtg 659
to top
>dbj|D00643.1|RICRUBPC1 Oryza sativa (japonica cultivar-group) mRNA for the small subunit
           of ribulose-1,5-bisphosphate carboxylase, complete cds,
           clone pOSSS1139
          Length = 830

 Score = 54.0 bits (27), Expect = 3e-05
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           |||||||| ||||||||||| || ||||| |||||||| | |||||| ||||||
Sbjct: 388 tactggaccatgtggaagctgcccatgttcgggtgcactgacgccacccaggtg 441
to top
>gb|AY267351.1| Flaveria bidentis ribulose-1,5-bisphosphate carboxylase/oxygenase
           small subunit (RbcS2) mRNA, complete cds
          Length = 787

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcaccg 42
           |||||||||||||||||||| | |||||||| || |||||||
Sbjct: 397 gatactggacaatgtggaagttgcctatgttcggatgcaccg 438
to top
>gb|BT013023.1| Lycopersicon esculentum clone 114270R, mRNA sequence
          Length = 1097

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcac 40
           |||||||| ||||||||| | |||||||||||||||||
Sbjct: 728 tactggaccatgtggaagttgcctatgtttgggtgcac 765
to top
>emb|V00458.1|GMRUBP Glycine max gene encoding ribulose-1,5-bisphosphate carboxylase small
            subunit
          Length = 1601

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                  
Query: 3    tactggacaatgtggaagctacctatgtttgggtgcac 40
            |||||||| ||||||||||| ||||||||||| |||||
Sbjct: 1129 tactggaccatgtggaagctgcctatgtttggctgcac 1166
to top
>dbj|AB236868.1| Panax ginseng mRNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, complete cds
          Length = 790

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcac 40
           |||||||||||||||||||| || |||||||| |||||
Sbjct: 410 tactggacaatgtggaagctgcccatgtttggatgcac 447
to top
>gb|AF044400.1|AF044400 Flaveria palmeri ribulose-1,5-bisphosphate carboxylase small
           subunit P2A (rbcS-P2A) mRNA, nuclear gene encoding
           chloroplast protein, partial cds
          Length = 534

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcaccg 42
           |||||||||||||||||||| | |||||||| || |||||||
Sbjct: 218 gatactggacaatgtggaagttgcctatgttcggatgcaccg 259
to top
>gb|AF044399.1|AF044399 Flaveria palmeri ribulose-1,5-bisphosphate carboxylase small
           subunit P1B (rbcS-P1B) mRNA, nuclear gene encoding
           chloroplast protein, partial cds
          Length = 629

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcaccg 42
           |||||||||||||||||||| | |||||||| || |||||||
Sbjct: 218 gatactggacaatgtggaagttgcctatgttcggatgcaccg 259
to top
>gb|AF044398.1|AF044398 Flaveria palmeri ribulose-1,5-bisphosphate carboxylase small
           subunit P1A (rbcS-P1A) mRNA, nuclear gene encoding
           chloroplast protein, partial cds
          Length = 608

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcaccg 42
           |||||||||||||||||||| | |||||||| || |||||||
Sbjct: 218 gatactggacaatgtggaagttgcctatgttcggatgcaccg 259
to top
>gb|AF044396.1|AF044396 Flaveria ramosissima ribulose-1,5-bisphosphate carboxylase small
           subunit R2 (rbcS-R2) mRNA, nuclear gene encoding
           chloroplast protein, partial cds
          Length = 574

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcaccg 42
           |||||||||||||||||||| | |||||||| || |||||||
Sbjct: 218 gatactggacaatgtggaagttgcctatgttcggatgcaccg 259
to top
>gb|AF044395.1|AF044395 Flaveria ramosissima ribulose-1,5-bisphosphate carboxylase small
           subunit R1 (rbcS-R1) mRNA, nuclear gene encoding
           chloroplast protein, partial cds
          Length = 525

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcac 40
           |||||||| ||||||||| | |||||||||||||||||
Sbjct: 220 tactggactatgtggaagttgcctatgtttgggtgcac 257
to top
>gb|AF312228.1|AF312228 Citrus reticulata ribulose-1,5-bisphosphate carboxylase/oxygenase
           small subunit precursor, gene, partial cds, nuclear gene
           for chloroplast product
          Length = 353

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcac 40
           |||||||||||||||||||| || |||| |||||||||
Sbjct: 199 tactggacaatgtggaagctgcccatgtatgggtgcac 236
to top
>gb|AF303941.1|AF303941 Glycine max ribulose-1,5-bisphosphate carboxylase small subunit
           rbcS3 mRNA, complete cds
          Length = 772

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcac 40
           |||||||| ||||||||||| ||||||||||| |||||
Sbjct: 395 tactggaccatgtggaagctgcctatgtttggttgcac 432
to top
>gb|AF303940.1|AF303940 Glycine max ribulose-1,5-bisphosphate carboxylase small subunit
           rbcS2 mRNA, complete cds
          Length = 830

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcac 40
           |||||||| ||||||||||| ||||||||||| |||||
Sbjct: 395 tactggaccatgtggaagctgcctatgtttggttgcac 432
to top
>gb|AF303939.1|AF303939 Glycine max ribulose-1,5-bisphosphate carboxylase small subunit
           rbcS1 mRNA, complete cds
          Length = 750

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcac 40
           |||||||| ||||||||||| ||||||||||| |||||
Sbjct: 395 tactggaccatgtggaagctgcctatgtttggttgcac 432
to top
>gb|U39567.1|GMU39567 Glycine max ribulose-1,5-bisphosphate carboxylase small subunit
           mRNA, complete cds
          Length = 765

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcac 40
           |||||||| ||||||||||| ||||||||||| |||||
Sbjct: 392 tactggaccatgtggaagctgcctatgtttggttgcac 429
to top
>emb|X05983.1|LERBCS2 Tomato rbcS2 gene for ribulose 1,5-bisphosphate carboxylase/oxygenase
            small subunit
          Length = 2776

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                  
Query: 3    tactggacaatgtggaagctacctatgtttgggtgcac 40
            |||||||| ||||||||| | |||||||||||||||||
Sbjct: 2319 tactggaccatgtggaagttgcctatgtttgggtgcac 2356
to top
>emb|X13711.1|NPRBCS8B Nicotiana plumbaginifolia rbcS-8B gene for ribulose bisphosphate
            carboxylase small subunit
          Length = 2293

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                  
Query: 3    tactggacaatgtggaagctacctatgtttgggtgcac 40
            |||||||| |||||||||||||||||||| || |||||
Sbjct: 1816 tactggaccatgtggaagctacctatgttcggatgcac 1853
to top
>emb|AJ428877.1|ROB428877 Rumex obtusifolius mRNA for putative ribulose 1,5 biphosphate
           carboxylase small subunit percursor (rbcs gene)
          Length = 686

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggt 55
           |||||||| ||||||||||| || ||||| |||||||| | |||||| |||||
Sbjct: 418 tactggaccatgtggaagctgcccatgttcgggtgcactgacgccacccaggt 470
to top
>gb|AF162210.1|AF162210 Lactuca sativa ribulose-1,5-bisphosphate carboxylase/oxygenase
           small subunit mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 835

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcac 40
           |||||||||||||||||| | |||||||| ||||||||
Sbjct: 437 tactggacaatgtggaagttgcctatgttcgggtgcac 474
to top
>gb|AF202645.1|AF202645 Avena clauda clone ClG2 ribulose-1,5-bisphosphate carboxylase small
           subunit (rbcS) gene, partial cds
          Length = 600

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcaccgncgcc 47
           |||||||||||||||||||| || ||||| || ||||||| ||||
Sbjct: 415 tactggacaatgtggaagctgcccatgttcggctgcaccgacgcc 459
to top
>gb|AF101231.1|AF101231 Manihot esculenta clone R33 ribulose 1,5-bisphosphate carboxylase
           small chain precursor, mRNA, complete cds; chloroplast
           gene for chloroplast product
          Length = 824

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcac 40
           |||||||| ||||||||||| || ||||||||||||||
Sbjct: 386 tactggaccatgtggaagctgcccatgtttgggtgcac 423
to top
>gb|AF101228.1|AF101228 Manihot esculenta clone R214 ribulose 1,5-bisphosphate carboxylase
           small chain precursor, mRNA, complete cds; chloroplast
           gene for chloroplast product
          Length = 780

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcac 40
           |||||||| ||||||||||| || ||||||||||||||
Sbjct: 368 tactggaccatgtggaagctgcccatgtttgggtgcac 405
to top
>emb|X84730.1|ASRBCS Artificial rbcS gene sequence
          Length = 420

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggt 55
           |||||||| ||||||||||| || |||||||| ||||||| ||| || |||||
Sbjct: 218 tactggactatgtggaagcttccaatgtttggttgcaccgacgctacccaggt 270
to top
>gb|U29939.1|FPU29939 Flaveria pringlei ribulose-1,5-bisphosphate carboxylase/oxygenase
           small subunit protein (rbcS7) mRNA, complete cds
          Length = 743

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcaccg 42
           |||||||||||||||||||| | |||||||| || |||||||
Sbjct: 377 gatactggacaatgtggaagttgcctatgttcggatgcaccg 418
to top
>gb|U29938.1|FPU29938 Flaveria pringlei ribulose-1,5-bisphosphate carboxylase/oxygenase
           small subunit protein (rbcS6) mRNA, complete cds
          Length = 724

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcaccg 42
           |||||||||||||||||||| | |||||||| || |||||||
Sbjct: 362 gatactggacaatgtggaagttgcctatgttcggatgcaccg 403
to top
>gb|U29937.1|FPU29937 Flaveria pringlei ribulose-1,5-bisphosphate carboxylase/oxygenase
           small subunit protein (rbcS5) mRNA, complete cds
          Length = 731

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcaccg 42
           |||||||||||||||||||| | |||||||| || |||||||
Sbjct: 365 gatactggacaatgtggaagttgcctatgttcggatgcaccg 406
to top
>gb|U29936.1|FPU29936 Flaveria pringlei ribulose-1,5-bisphosphate carboxylase/oxygenase
           small subunit protein (rbcS4) mRNA, complete cds
          Length = 753

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcaccg 42
           |||||||||||||||||||| | |||||||| || |||||||
Sbjct: 394 gatactggacaatgtggaagttgcctatgttcggatgcaccg 435
to top
>gb|U29935.1|FPU29935 Flaveria pringlei ribulose-1,5-bisphosphate carboxylase/oxygenase
           small subunit protein (rbcS3) mRNA, complete cds
          Length = 746

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcaccg 42
           |||||||||||||||||||| | |||||||| || |||||||
Sbjct: 379 gatactggacaatgtggaagttgcctatgttcggatgcaccg 420
to top
>gb|U29934.1|FPU29934 Flaveria pringlei ribulose-1,5-bisphosphate carboxylase/oxygenase
           small subunit protein (rbcS2) mRNA, complete cds
          Length = 763

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcaccg 42
           |||||||||||||||||||| | |||||||| || |||||||
Sbjct: 391 gatactggacaatgtggaagttgcctatgttcggatgcaccg 432
to top
>gb|M16888.1|SIPRUBPCS White campion ribulose bisphosphate carboxylase small subunit
           (RuBPC) mRNA, complete cds
          Length = 692

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcac 40
           ||||||||||||||||||||||| ||||| || |||||
Sbjct: 365 tactggacaatgtggaagctacccatgttcggatgcac 402
to top
>gb|M96583.1|MNHRUBISCO Manihot esculenta ribulose 1,5-bisphosphate carboxylase mRNA,
           complete cds
          Length = 1093

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcac 40
           |||||||| ||||||||||| || ||||||||||||||
Sbjct: 639 tactggaccatgtggaagctgcccatgtttgggtgcac 676
to top
>gb|U39858.1|GTU39858 Glycine tabacina ribulose 1,5-bisphosphate carboxylase/oxygenase
           small subunit precursor (rbcS) gene, nuclear gene
           encoding chloroplast protein, complete cds
          Length = 1084

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcac 40
           |||||||| ||||||||||| ||||||||||| |||||
Sbjct: 907 tactggaccatgtggaagctgcctatgtttggctgcac 944
to top
>gb|M15236.1|TOMRBCSE Tomato RuBP carboxylase small subunit LESS5 mRNA
          Length = 742

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcac 40
           |||||||| ||||||||| | |||||||||||||||||
Sbjct: 394 tactggaccatgtggaagttgcctatgtttgggtgcac 431
to top
>gb|M13543.1|TOMRBCSB Tomato (L.esculentum) ribulose-1,5-bisphosphate
           carboxylase/oxygenase (RBCS) small subunit mRNA, clone
           Rbcs-2A
          Length = 599

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcac 40
           |||||||| ||||||||| | |||||||||||||||||
Sbjct: 381 tactggaccatgtggaagttgcctatgtttgggtgcac 418
to top
>gb|M36685.1|TOBRBCS8B N.plumbaginifolia ribulose bisphosphate carboxylase (rbcS-8B) gene,
            complete cds
          Length = 2293

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                  
Query: 3    tactggacaatgtggaagctacctatgtttgggtgcac 40
            |||||||| |||||||||||||||||||| || |||||
Sbjct: 1816 tactggaccatgtggaagctacctatgttcggatgcac 1853
to top
>gb|M16889.1|SOYRUBPA Soybean ribulose 1,5-bisphosphate carboxylase small subunit (SRS4)
            gene, complete cds
          Length = 2185

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                  
Query: 3    tactggacaatgtggaagctacctatgtttgggtgcac 40
            |||||||| ||||||||||| ||||||||||| |||||
Sbjct: 1563 tactggaccatgtggaagctgcctatgtttggttgcac 1600
to top
>gb|M95930.1|MNHRBCSA Manihot esculenta (clone rubssr37) ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit EC 4.1.1.39 (rbc S)
           mRNA sequence
          Length = 1162

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcac 40
           |||||||| ||||||||||| || ||||||||||||||
Sbjct: 639 tactggaccatgtggaagctgcccatgtttgggtgcac 676
to top
>dbj|AB020945.1| Avena sativa DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Ave-A
          Length = 590

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcaccgncgcc 47
           |||||||||||||||||||| || ||||| || ||||||| ||||
Sbjct: 412 tactggacaatgtggaagctgcccatgttcggctgcaccgacgcc 456
to top
>emb|X92858.1|BPRBCS B.pendula rbcS gene
          Length = 651

 Score = 50.1 bits (25), Expect = 5e-04
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                
Query: 3   tactggacaatgtggaagctacctatgtttgggtgca 39
           |||||||| ||||||||||| || |||||||||||||
Sbjct: 526 tactggaccatgtggaagctgcccatgtttgggtgca 562
to top
>gb|AF039014.1|AF039014 Fritillaria agrestis clone TA8 ribulose 1,5 bisphosphate
           carboxylase small subunit (rbcS) gene, partial cds
          Length = 592

 Score = 50.1 bits (25), Expect = 5e-04
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                
Query: 1   gatactggacaatgtggaagctacctatgtttgggtg 37
           |||||||||||||||||||||| || ||||| |||||
Sbjct: 503 gatactggacaatgtggaagctgcccatgttcgggtg 539
to top
>gb|AF039011.1|AF039011 Fritillaria agrestis clone TA22 ribulose 1,5 bisphosphate
           carboxylase small subunit (rbcS) gene, partial cds
          Length = 591

 Score = 50.1 bits (25), Expect = 5e-04
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                
Query: 1   gatactggacaatgtggaagctacctatgtttgggtg 37
           |||||||||||||||||||||| || ||||| |||||
Sbjct: 502 gatactggacaatgtggaagctgcccatgttcgggtg 538
to top
>gb|AF039008.1|AF039008 Fritillaria agrestis clone TA15 ribulose 1,5 bisphosphate
           carboxylase small subunit (rbcS) gene, partial cds
          Length = 592

 Score = 50.1 bits (25), Expect = 5e-04
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                
Query: 1   gatactggacaatgtggaagctacctatgtttgggtg 37
           |||||||||||||||||||||| || ||||| |||||
Sbjct: 503 gatactggacaatgtggaagctgcccatgttcgggtg 539
to top
>emb|Y07779.1|BPRBCSSU Betula pendula mRNA for ribulose-1,5-bisphosphate carboxylase (rbcS
           gene)
          Length = 803

 Score = 50.1 bits (25), Expect = 5e-04
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                
Query: 3   tactggacaatgtggaagctacctatgtttgggtgca 39
           |||||||| ||||||||||| || |||||||||||||
Sbjct: 403 tactggaccatgtggaagctgcccatgtttgggtgca 439
to top
>gb|AF008214.1|AF008214 Musa acuminata ribulose-1,5-bisphosphate carboxylase small subunit
           (rbcS1) mRNA, complete cds
          Length = 853

 Score = 50.1 bits (25), Expect = 5e-04
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcaccgncgc 46
           |||||||| ||||||||||| || ||||| |||||||||| |||
Sbjct: 435 tactggaccatgtggaagctgcccatgttcgggtgcaccgacgc 478
to top
>dbj|AP006376.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT23D08, TM0220,
             complete sequence
          Length = 70687

 Score = 50.1 bits (25), Expect = 5e-04
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                  
Query: 3     tactggacaatgtggaagctacctatgtttgggtgca 39
             |||||||| ||||||||||| || |||||||||||||
Sbjct: 69448 tactggaccatgtggaagctccccatgtttgggtgca 69484



 Score = 42.1 bits (21), Expect = 0.13
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                  
Query: 3     tactggacaatgtggaagctacctatgtttgggtgca 39
             |||||||| ||||||||||| || |||||||| ||||
Sbjct: 64443 tactggaccatgtggaagctccccatgtttggatgca 64479
to top
>dbj|D00572.1|PYPRBCO Pyrus pyrifolia var. culta mRNA for RuBisCO small subunit, complete
           cds
          Length = 844

 Score = 48.1 bits (24), Expect = 0.002
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                   
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcaccg 42
           |||||||||||||||||||| || ||||| || |||||||
Sbjct: 421 tactggacaatgtggaagctgcccatgttcggatgcaccg 460
to top
>emb|Y00322.1|ZMRBCS Maize rbcS gene for ribulose-1,5-bisphosphate carboxylase/oxygenase
            small subunit (EC 4.1.1.39)
          Length = 1648

 Score = 48.1 bits (24), Expect = 0.002
 Identities = 47/55 (85%)
 Strand = Plus / Plus

                                                                   
Query: 3    tactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtgt 57
            |||||||| ||||||||||| || ||||| || |||| || |||||| |||||||
Sbjct: 984  tactggaccatgtggaagctgcccatgttcggctgcaacgacgccacccaggtgt 1038
to top
>emb|Z28636.1|ACRUBIS Acetabularia cliftonii gene for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, clone plACrbcS1
          Length = 2230

 Score = 48.1 bits (24), Expect = 0.002
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                   
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcaccg 42
           |||||||| |||||||||||||| ||||| || |||||||
Sbjct: 870 tactggaccatgtggaagctacccatgttcggctgcaccg 909
to top
>emb|X05985.1|LERBCS3B Tomato rbcS3B gene for ribulose 1,5-bisphosphate
           carboxylase/oxygenase small subunit
          Length = 1054

 Score = 48.1 bits (24), Expect = 0.002
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                   
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcac 40
           |||||||||| ||||||||| | || ||||||||||||||
Sbjct: 819 gatactggaccatgtggaagttgcccatgtttgggtgcac 858
to top
>emb|X03821.1|PERBCS11 Petunia x hybrida rbcS gene (ssu11A) for ribulose 1,5-bisphosphate
            carboxylase small subunit
          Length = 1314

 Score = 48.1 bits (24), Expect = 0.002
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                    
Query: 3    tactggacaatgtggaagctacctatgtttgggtgcaccg 42
            |||||||| ||||||||||| || ||||| ||||||||||
Sbjct: 1012 tactggaccatgtggaagctgcccatgttcgggtgcaccg 1051
to top
>emb|X65494.1|MSCARB Malus (unidentified species of crab apple) mRNA for
           rubisco-1,5-bisphosphate carboxylase
          Length = 853

 Score = 48.1 bits (24), Expect = 0.002
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                   
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcaccg 42
           |||||||||||||||||||| || ||||| || |||||||
Sbjct: 425 tactggacaatgtggaagctgcccatgttcggatgcaccg 464
to top
>emb|X06535.1|ZMRUBSSU Maize mRNA for ribulose-1,5-bisphosphate carboxylase small subunit
           (RuBPC; EC 4.1.1.39)
          Length = 830

 Score = 48.1 bits (24), Expect = 0.002
 Identities = 47/55 (85%)
 Strand = Plus / Plus

                                                                  
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtgt 57
           |||||||| ||||||||||| || ||||| || |||| || |||||| |||||||
Sbjct: 399 tactggaccatgtggaagctgcccatgttcggctgcaacgacgccacccaggtgt 453
to top
>gb|AF192777.1|AF192777 Avena clauda clone Cl9 ribulose-1,5-bisphosphate carboxylase small
           subunit (rbcS) mRNA, nuclear gene encoding chloroplast
           protein, partial cds
          Length = 504

 Score = 48.1 bits (24), Expect = 0.002
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                   
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcaccg 42
           |||||||||||||||||||| || ||||| || |||||||
Sbjct: 319 tactggacaatgtggaagctgcccatgttcggctgcaccg 358
to top
>gb|AY103730.1| Zea mays PCO095823 mRNA sequence
          Length = 1172

 Score = 48.1 bits (24), Expect = 0.002
 Identities = 47/55 (85%)
 Strand = Plus / Plus

                                                                  
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtgt 57
           |||||||| ||||||||||| || ||||| || |||| || |||||| |||||||
Sbjct: 519 tactggaccatgtggaagctgcccatgttcggctgcaacgacgccacccaggtgt 573
to top
>gb|AF039007.1|AF039007 Fritillaria agrestis clone TA10 rbcS pseudogene, partial sequence
          Length = 584

 Score = 48.1 bits (24), Expect = 0.002
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 3   tactggacaatgtggaagctacctatgtttgg 34
           |||||||||||||||||||| || ||||||||
Sbjct: 497 tactggacaatgtggaagctgcccatgtttgg 528
to top
>gb|AF039006.1|AF039006 Fritillaria agrestis clone TA17 rbcS pseudogene, partial sequence
          Length = 584

 Score = 48.1 bits (24), Expect = 0.002
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 3   tactggacaatgtggaagctacctatgtttgg 34
           |||||||||||||||||||| || ||||||||
Sbjct: 497 tactggacaatgtggaagctgcccatgtttgg 528
to top
>gb|AF039005.1|AF039005 Fritillaria agrestis clone TA13 rbcS pseudogene, partial sequence
          Length = 584

 Score = 48.1 bits (24), Expect = 0.002
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 3   tactggacaatgtggaagctacctatgtttgg 34
           |||||||||||||||||||| || ||||||||
Sbjct: 497 tactggacaatgtggaagctgcccatgtttgg 528
to top
>gb|U39856.1|GSU39856 Glycine soja ribulose 1,5-bisphosphate carboxylase small subunit
           precursor (rbcS) gene, nuclear gene encoding chloroplast
           protein, complete cds
          Length = 1089

 Score = 48.1 bits (24), Expect = 0.002
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 5   ctggacaatgtggaagctacctatgtttgggtgcac 40
           |||||| ||||||||||| ||||||||||| |||||
Sbjct: 914 ctggaccatgtggaagctgcctatgtttggttgcac 949
to top
>gb|L24497.1|PYPRBCS Pyrus malus X domestica ribulose-1,5-bisphosphate carboxylase small
           subunit (rbcS) mRNA, complete cds
          Length = 813

 Score = 48.1 bits (24), Expect = 0.002
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                   
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcaccg 42
           |||||||||||||||||||| || ||||| || |||||||
Sbjct: 389 tactggacaatgtggaagctgcccatgttcggatgcaccg 428
to top
>dbj|D00170.1|MZEPCSSU Zea mays mRNA for ribulose 1,5-bisphosphate carboxylase small
           subunit, complete cds
          Length = 830

 Score = 48.1 bits (24), Expect = 0.002
 Identities = 47/55 (85%)
 Strand = Plus / Plus

                                                                  
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtgt 57
           |||||||| ||||||||||| || ||||| || |||| || |||||| |||||||
Sbjct: 399 tactggaccatgtggaagctgcccatgttcggctgcaacgacgccacccaggtgt 453
to top
>dbj|D14001.1|LAURBCS Lettuce mRNA for riburose-1,5-bisphosphate carboxylase/oxygenase
           small subunit, complete cds
          Length = 758

 Score = 48.1 bits (24), Expect = 0.002
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                   
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcac 40
           |||||||||||||||||||| | |||||||| || |||||
Sbjct: 402 gatactggacaatgtggaagttgcctatgttcggatgcac 441
to top
>dbj|D11112.1|TOMRBCO Tomato ribulose 1,5-bisphosphate carboxylase/oxygenase small subunit
            gene, complete cds
          Length = 4124

 Score = 48.1 bits (24), Expect = 0.002
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                    
Query: 1    gatactggacaatgtggaagctacctatgtttgggtgcac 40
            |||||||||| ||||||||| | || ||||||||||||||
Sbjct: 3889 gatactggaccatgtggaagttgcccatgtttgggtgcac 3928
to top
>dbj|AB026685.1| Physcomitrella patens mRNA for ribulose 1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds
          Length = 818

 Score = 48.1 bits (24), Expect = 0.002
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                   
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcaccg 42
           |||||||| ||||||||||| || ||||| ||||||||||
Sbjct: 477 tactggaccatgtggaagctgcccatgttcgggtgcaccg 516
to top
>gb|AY163904.1| Chrysanthemum x morifolium ribulose-1,5-bisphosphate carboxylase
            small subunit gene, complete cds; nuclear gene for
            chloroplast product
          Length = 2662

 Score = 46.1 bits (23), Expect = 0.008
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                   
Query: 1    gatactggacaatgtggaagctacctatgtttgggtgca 39
            |||||||||||||||||||| | || ||||| |||||||
Sbjct: 1540 gatactggacaatgtggaagttgcccatgttcgggtgca 1578
to top
>emb|X00137.1|LGRUBP Lemna gibba ribulose 1.5-bisphospate carboxylase small subunit
           (cDNA clone pLg ssu1)
          Length = 776

 Score = 46.1 bits (23), Expect = 0.008
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                         
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcaccgncgcca 48
           |||||||| ||||||||||| || ||||| || ||||||| |||||
Sbjct: 367 tactggacgatgtggaagctgcccatgttcggctgcaccgacgcca 412
to top
>emb|X17234.1|LGRBCS4B Lemna gibba rbcS gene SSU40B for small subunit of ribulose
           bisphosphate carboxylase (EC 4.1.1.39)
          Length = 791

 Score = 46.1 bits (23), Expect = 0.008
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                         
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcaccgncgcca 48
           |||||||| ||||||||||| || ||||| || ||||||| |||||
Sbjct: 446 tactggacgatgtggaagctgcccatgttcggctgcaccgacgcca 491
to top
>emb|X17233.1|LGRBCS4A Lemna gibba rbcS gene SSU40A for small subunit of ribulose
           bisphosphate carboxylase (EC 4.1.1.39)
          Length = 791

 Score = 46.1 bits (23), Expect = 0.008
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                         
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcaccgncgcca 48
           |||||||| ||||||||||| || ||||| || ||||||| |||||
Sbjct: 444 tactggacgatgtggaagctgcccatgttcggctgcaccgacgcca 489
to top
>emb|X17231.1|LGRBCS5B Lemna gibba rbcS gene SSU5B for small subunit of ribulose
           bisphosphate carboxylase (EC 4.1.1.39)
          Length = 800

 Score = 46.1 bits (23), Expect = 0.008
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                         
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcaccgncgcca 48
           |||||||| ||||||||||| || ||||| || ||||||| |||||
Sbjct: 465 tactggacgatgtggaagctgcccatgttcggctgcaccgacgcca 510
to top
>emb|X17230.1|LGRBCS5A Lemna gibba rbcS gene SSU5A for small subunit of ribulose
           bisphosphate carboxylase (EC 4.1.1.39)
          Length = 858

 Score = 46.1 bits (23), Expect = 0.008
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                         
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcaccgncgcca 48
           |||||||| ||||||||||| || ||||| || ||||||| |||||
Sbjct: 441 tactggacgatgtggaagctgcccatgttcggctgcaccgacgcca 486
to top
>emb|X17235.1|LGRBCS1 Lemna gibba rbcS mRNA SSU1 for small subunit of ribulose
           bisphosphate carboxylase (EC 4.1.1.39)
          Length = 764

 Score = 46.1 bits (23), Expect = 0.008
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                         
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcaccgncgcca 48
           |||||||| ||||||||||| || ||||| || ||||||| |||||
Sbjct: 352 tactggacgatgtggaagctgcccatgttcggctgcaccgacgcca 397
to top
>emb|X83095.1|ASRBCSSS A.squarrosa mRNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase, small subunit
          Length = 837

 Score = 46.1 bits (23), Expect = 0.008
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           ||||||||||||||||| || |||||||| || ||| ||| | |||| ||||||
Sbjct: 380 tactggacaatgtggaaactccctatgttcggatgccccgcccccacccaggtg 433
to top
>dbj|AK099574.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013036G21, full
           insert sequence
          Length = 947

 Score = 46.1 bits (23), Expect = 0.008
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           |||||||| ||||||||||| |||||||| || ||||| |  ||||| ||||||
Sbjct: 402 tactggaccatgtggaagctgcctatgttcggatgcactgatgccacccaggtg 455
to top
>gb|AF202647.1|AF202647 Avena agadiriana ribulose-1,5-bisphosphate carboxylase small
           subunit (rbcS) gene, partial cds
          Length = 593

 Score = 46.1 bits (23), Expect = 0.008
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           |||||||||||||||||||| || ||||| || ||||| |  ||| ||||||||
Sbjct: 408 tactggacaatgtggaagctgcccatgttcggctgcactgatgcctcacaggtg 461
to top
>emb|BX119951.3|CNS09S4U Oryza sativa chromosome 12, . BAC OJ1523_A01 of library Monsanto from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 127267

 Score = 46.1 bits (23), Expect = 0.008
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                   
Query: 3     tactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
             |||||||| ||||||||||| |||||||| || ||||| |  ||||| ||||||
Sbjct: 95274 tactggaccatgtggaagctgcctatgttcggatgcactgatgccacccaggtg 95221



 Score = 40.1 bits (20), Expect = 0.52
 Identities = 43/51 (84%)
 Strand = Plus / Minus

                                                                 
Query: 6      tggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
              ||||| ||||||||||| || ||||| || |||||||  ||||| ||||||
Sbjct: 109934 tggaccatgtggaagctgcccatgttcggctgcaccgatgccacccaggtg 109884
to top
>emb|X79152.1|EGRBCS1 E.gracilis rbcS 1 gene exons 1 to 19
          Length = 4446

 Score = 46.1 bits (23), Expect = 0.008
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                          
Query: 3    tactggacaatgtggaagctacctatgtttgggtgcaccgncgcca 48
            |||||||| ||||||||||| || |||||||| ||||| | |||||
Sbjct: 2908 tactggaccatgtggaagctgcccatgtttggctgcacggacgcca 2953



 Score = 38.2 bits (19), Expect = 2.1
 Identities = 39/46 (84%)
 Strand = Plus / Plus

                                                          
Query: 3    tactggacaatgtggaagctacctatgtttgggtgcaccgncgcca 48
            |||||||| ||||||||||| || ||||| || ||||| | |||||
Sbjct: 3772 tactggaccatgtggaagctgcccatgttcggctgcacggacgcca 3817



 Score = 38.2 bits (19), Expect = 2.1
 Identities = 39/46 (84%)
 Strand = Plus / Plus

                                                          
Query: 3    tactggacaatgtggaagctacctatgtttgggtgcaccgncgcca 48
            |||||||| ||||||||||| || ||||| || ||||| | |||||
Sbjct: 3340 tactggaccatgtggaagctgcccatgttcggctgcacggacgcca 3385



 Score = 38.2 bits (19), Expect = 2.1
 Identities = 39/46 (84%)
 Strand = Plus / Plus

                                                          
Query: 3    tactggacaatgtggaagctacctatgtttgggtgcaccgncgcca 48
            |||||||| ||||||||||| || ||||| || ||||| | |||||
Sbjct: 2476 tactggaccatgtggaagctgcccatgttcggctgcacggacgcca 2521



 Score = 38.2 bits (19), Expect = 2.1
 Identities = 39/46 (84%)
 Strand = Plus / Plus

                                                          
Query: 3    tactggacaatgtggaagctacctatgtttgggtgcaccgncgcca 48
            |||||||| ||||||||||| || ||||| || ||||| | |||||
Sbjct: 2044 tactggaccatgtggaagctgcccatgttcggctgcacggacgcca 2089



 Score = 38.2 bits (19), Expect = 2.1
 Identities = 39/46 (84%)
 Strand = Plus / Plus

                                                          
Query: 3    tactggacaatgtggaagctacctatgtttgggtgcaccgncgcca 48
            |||||||| ||||||||||| || ||||| || ||||| | |||||
Sbjct: 1612 tactggaccatgtggaagctgcccatgttcggctgcacggacgcca 1657



 Score = 38.2 bits (19), Expect = 2.1
 Identities = 39/46 (84%)
 Strand = Plus / Plus

                                                          
Query: 3    tactggacaatgtggaagctacctatgtttgggtgcaccgncgcca 48
            |||||||| ||||||||||| || ||||| || ||||| | |||||
Sbjct: 1180 tactggaccatgtggaagctgcccatgttcggctgcacggacgcca 1225



 Score = 38.2 bits (19), Expect = 2.1
 Identities = 39/46 (84%)
 Strand = Plus / Plus

                                                         
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcaccgncgcca 48
           |||||||| ||||||||||| || ||||| || ||||| | |||||
Sbjct: 748 tactggaccatgtggaagctgcccatgttcggctgcacggacgcca 793
to top
>dbj|AU066498.1| Chlamydomonas sp. HS-5 mRNA for ribulose-bisphosphate carboxylase
           small chain precursor, NaCl inducible, complete cds,
           clone:NaEX96-11
          Length = 587

 Score = 46.1 bits (23), Expect = 0.008
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           |||||||| ||||||||||| || |||||||| ||||| | |||| | ||||||
Sbjct: 291 tactggacgatgtggaagctgcccatgtttggctgcactgacgccgcccaggtg 344
to top
>ref|NM_123203.2| Arabidopsis thaliana ribulose-bisphosphate carboxylase AT5G38420
           mRNA, complete cds
          Length = 837

 Score = 44.1 bits (22), Expect = 0.034
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 1   gatactggacaatgtggaagct 22
           ||||||||||||||||||||||
Sbjct: 410 gatactggacaatgtggaagct 431
to top
>gb|AY693395.1| Lolium perenne ribulose-1,5-bisphosphate carboxylase small subunit
           (rbcS) mRNA, partial cds
          Length = 195

 Score = 44.1 bits (22), Expect = 0.034
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcac 40
           |||||||||||||||||||| || ||||| || |||||
Sbjct: 151 tactggacaatgtggaagctgcccatgttcggctgcac 188
to top
>gb|AY093288.1| Arabidopsis thaliana ribulose bisphosphate carboxylase small chain
           2b precursor (RuBisCO small subunit 2b) (At5g38420)
           mRNA, complete cds
          Length = 586

 Score = 44.1 bits (22), Expect = 0.034
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 1   gatactggacaatgtggaagct 22
           ||||||||||||||||||||||
Sbjct: 359 gatactggacaatgtggaagct 380
to top
>gb|L76557.1|SPIRBCS Spinacia oleracea chloroplast ribulose 1,5-bisphosphate carboxylase
           small subunit mRNA, complete cds
          Length = 756

 Score = 44.1 bits (22), Expect = 0.034
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcac 40
           |||||||||||||||||| | || ||||| ||||||||
Sbjct: 398 tactggacaatgtggaagttgcccatgttcgggtgcac 435
to top
>gb|AY062543.1| Arabidopsis thaliana ribulose bisphosphate carboxylase small chain
           2b precursor (RuBisCO small subunit 2b) (At5g38420;
           MXI10.14) mRNA, complete cds
          Length = 721

 Score = 44.1 bits (22), Expect = 0.034
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 1   gatactggacaatgtggaagct 22
           ||||||||||||||||||||||
Sbjct: 406 gatactggacaatgtggaagct 427
to top
>gb|AY062458.1| Arabidopsis thaliana ribulose bisphosphate carboxylase small chain
           2b precursor (RuBisCO small subunit 2b) (At5g38420;
           MXI10.14) mRNA, complete cds
          Length = 720

 Score = 44.1 bits (22), Expect = 0.034
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 1   gatactggacaatgtggaagct 22
           ||||||||||||||||||||||
Sbjct: 406 gatactggacaatgtggaagct 427
to top
>gb|AY062437.1| Arabidopsis thaliana ribulose bisphosphate carboxylase small chain
           2b precursor (RuBisCO small subunit 2b) (At5g38420;
           MXI10.14) mRNA, complete cds
          Length = 728

 Score = 44.1 bits (22), Expect = 0.034
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 1   gatactggacaatgtggaagct 22
           ||||||||||||||||||||||
Sbjct: 410 gatactggacaatgtggaagct 431
to top
>gb|AY059939.1| Arabidopsis thaliana ribulose bisphosphate carboxylase small chain
           2b precursor (RuBisCO small subunit 2b) (At5g38420;
           MXI10.14) mRNA, complete cds
          Length = 758

 Score = 44.1 bits (22), Expect = 0.034
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 1   gatactggacaatgtggaagct 22
           ||||||||||||||||||||||
Sbjct: 406 gatactggacaatgtggaagct 427
to top
>gb|DQ336280.1| Vitis pseudoreticulata ribulose-1,5-bisphophate
           carboxylase/oxygenase small subunit mRNA, complete cds
          Length = 543

 Score = 44.1 bits (22), Expect = 0.034
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcac 40
           |||||||| ||||||||||| || ||||| ||||||||
Sbjct: 373 tactggaccatgtggaagctgcccatgttcgggtgcac 410
to top
>emb|BX841713.1|CNS09YLJ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL40ZH10 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 752

 Score = 44.1 bits (22), Expect = 0.034
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 1   gatactggacaatgtggaagct 22
           ||||||||||||||||||||||
Sbjct: 398 gatactggacaatgtggaagct 419
to top
>gb|BT003356.1| Arabidopsis thaliana ribulose bisphosphate carboxylase small chain
           2b precursor (RuBisCO small subunit 2b) (At5g38420)
           mRNA, complete cds
          Length = 587

 Score = 44.1 bits (22), Expect = 0.034
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 1   gatactggacaatgtggaagct 22
           ||||||||||||||||||||||
Sbjct: 359 gatactggacaatgtggaagct 380
to top
>gb|BT002554.1| Arabidopsis thaliana ribulose bisphosphate carboxylase small chain
           2b precursor (RuBisCO small subunit 2b) (At5g38420)
           mRNA, complete cds
          Length = 586

 Score = 44.1 bits (22), Expect = 0.034
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 1   gatactggacaatgtggaagct 22
           ||||||||||||||||||||||
Sbjct: 359 gatactggacaatgtggaagct 380
to top
>gb|AF139469.2|AF139469 Vigna radiata ribulose-1,5-bisphosphate carboxylase small subunit
           (rbcS) mRNA, complete cds; nuclear gene for chloroplast
           product
          Length = 782

 Score = 44.1 bits (22), Expect = 0.034
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcac 40
           |||||||| ||||||||||| ||||||| ||| |||||
Sbjct: 416 tactggaccatgtggaagctgcctatgtatggctgcac 453
to top
>dbj|AB005248.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MXI10
          Length = 83646

 Score = 44.1 bits (22), Expect = 0.034
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 1     gatactggacaatgtggaagct 22
             ||||||||||||||||||||||
Sbjct: 54522 gatactggacaatgtggaagct 54501



 Score = 40.1 bits (20), Expect = 0.52
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 3     tactggacaatgtggaagct 22
             ||||||||||||||||||||
Sbjct: 57667 tactggacaatgtggaagct 57648



 Score = 40.1 bits (20), Expect = 0.52
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 3     tactggacaatgtggaagct 22
             ||||||||||||||||||||
Sbjct: 50818 tactggacaatgtggaagct 50799
to top
>emb|AJ131050.1|CAR131050 Cicer arietinum mRNA for ribulose 1,5-bisphosphate carboxylase
           small subunit
          Length = 729

 Score = 44.1 bits (22), Expect = 0.034
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcac 40
           |||||||||||||||||||| ||  ||||||| |||||
Sbjct: 375 tactggacaatgtggaagcttccattgtttggttgcac 412
to top
>emb|Y00431.1|HARBCS Sunflower rbcS gene for RuBP carboxylase small subunit (EC 4.1.1.39)
            (RuBP carboxylase=ribulose 1.5-bisphosphate
            carboxylase/oxygenase)
          Length = 1400

 Score = 44.1 bits (22), Expect = 0.034
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                      
Query: 1    gatactggacaatgtggaagctacctatgtttgggtgcaccg 42
            |||||||||||||||||||  | |||||||| || |||||||
Sbjct: 1124 gatactggacaatgtggaaattgcctatgttcggttgcaccg 1165
to top
>emb|X51809.1|ACRBCSC4 Acetabularia cliftonii mRNA for ribulose 1,5-bisphosphate
           carboxylase/oxygenase, small subunit (rbcS gene), clone
           C4
          Length = 793

 Score = 44.1 bits (22), Expect = 0.034
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                     
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcaccg 42
           |||| ||||| ||||||||  | |||||||||||||||||||
Sbjct: 381 gatattggactatgtggaaattgcctatgtttgggtgcaccg 422
to top
>emb|X97600.1|SORBCS2 S.oleracea mRNA for ribulose-1,5-bisphosphate carboxylase
          Length = 751

 Score = 44.1 bits (22), Expect = 0.034
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcac 40
           |||||||||||||||||| | || ||||| ||||||||
Sbjct: 396 tactggacaatgtggaagttgcccatgttcgggtgcac 433
to top
>emb|X03820.1|PERBCS08 Petunia x hybrida rbcS gene (ssu8) for ribulose 1,5-bisphosphate
            carboxylase small subunit
          Length = 2242

 Score = 44.1 bits (22), Expect = 0.034
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                  
Query: 3    tactggacaatgtggaagctacctatgtttgggtgcac 40
            |||||||| ||||||||| | || ||||||||||||||
Sbjct: 1721 tactggaccatgtggaagttgcccatgtttgggtgcac 1758
to top
>emb|X05079.1|HARUBISC Sunflower mRNA for ribulose 1,5-bisphosphate carboxylase RuBisCO
           SSU (E.C. 4.1.1.39)
          Length = 674

 Score = 44.1 bits (22), Expect = 0.034
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                     
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcaccg 42
           |||||||||||||||||||  | |||||||| || |||||||
Sbjct: 380 gatactggacaatgtggaaattgcctatgttcggttgcaccg 421
to top
>emb|X54091.1|GHRBCS G.hirsutum rbcS gene for ribulose-1,5-bisphosphate carboxylase, small
            subunit
          Length = 1594

 Score = 44.1 bits (22), Expect = 0.034
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                  
Query: 3    tactggacaatgtggaagctacctatgtttgggtgcac 40
            |||||||| |||||||| || || ||||||||||||||
Sbjct: 1086 tactggaccatgtggaaactgcccatgtttgggtgcac 1123
to top
>emb|X69759.1|STRBCS1 S.tuberosum rbcS1 gene for ribulose-(1,5)-bisphosphate
            carboxylase/oxygenase small subunit
          Length = 3323

 Score = 44.1 bits (22), Expect = 0.034
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                  
Query: 3    tactggacaatgtggaagctacctatgtttgggtgcac 40
            |||||||| ||||||||| | || ||||||||||||||
Sbjct: 2594 tactggaccatgtggaagttgcccatgtttgggtgcac 2631
to top
>emb|X57267.1|BORBCSB2 B.oerstedii mRNA for ribulose bisphosphate carboxylase small
           subunit, clone B2
          Length = 524

 Score = 44.1 bits (22), Expect = 0.034
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 1   gatactggacaatgtggaagctacctatgtttgg 34
           |||||||||| ||||||||| | |||||||||||
Sbjct: 83  gatactggaccatgtggaagttgcctatgtttgg 116
to top
>gb|AF173667.1|AF173667 Beta vulgaris clone RUB109UNI ribulose bisphosphate carboxylase,
           small subunit (RbcS) gene, partial sequence
          Length = 767

 Score = 44.1 bits (22), Expect = 0.034
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcac 40
           |||||||| ||||||||| | || ||||||||||||||
Sbjct: 164 tactggactatgtggaagttgcccatgtttgggtgcac 127
to top
>gb|AF200303.1|AF200303 Avena clauda ribulose-1,5-bisphosphate carboxylase small subunit
           (rbcS) gene, nuclear gene encoding chloroplast protein,
           partial cds
          Length = 594

 Score = 44.1 bits (22), Expect = 0.034
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggt 55
           |||||||||||||||||| | || ||||| || ||||| | |||| |||||||
Sbjct: 409 tactggacaatgtggaagttgcccatgttcggctgcacagacgcctcacaggt 461
to top
>gb|BT002094.1| Arabidopsis thaliana ribulose bisphosphate carboxylase small chain
           2b precursor (RuBisCO small subunit 2b) (At5g38420)
           mRNA, complete cds
          Length = 586

 Score = 44.1 bits (22), Expect = 0.034
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 1   gatactggacaatgtggaagct 22
           ||||||||||||||||||||||
Sbjct: 359 gatactggacaatgtggaagct 380
to top
>gb|U29933.1|FPU29933 Flaveria pringlei ribulose-1,5-bisphosphate carboxylase/oxygenase
           small subunit protein (rbcS1) mRNA, complete cds
          Length = 743

 Score = 44.1 bits (22), Expect = 0.034
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                     
Query: 1   gatactggacaatgtggaagctacctatgtttgggtgcaccg 42
           |||||||||||||||||||  | |||||||| || |||||||
Sbjct: 376 gatactggacaatgtggaaattgcctatgttcggatgcaccg 417
to top
>gb|U39857.1|GTU39857 Glycine tomentella ribulose 1,5-bisphosphate carboxylase/oxygenase
           small subunit precursor (rbcS) gene, nuclear gene
           encoding chloroplast protein, complete cds
          Length = 1069

 Score = 44.1 bits (22), Expect = 0.034
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcac 40
           |||||||| ||||||||||| ||| ||||||| |||||
Sbjct: 892 tactggaccatgtggaagctgcctgtgtttggctgcac 929
to top
>emb|X14564.1|ATATSGS A.thaliana ats1B, ats2B and ats3B gene for ribulose-1,5-biphosphate
            carboxylase small subunit (rbcS) (EC 4.1.1.39)
          Length = 9647

 Score = 44.1 bits (22), Expect = 0.034
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 1    gatactggacaatgtggaagct 22
            ||||||||||||||||||||||
Sbjct: 5361 gatactggacaatgtggaagct 5382



 Score = 40.1 bits (20), Expect = 0.52
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 3    tactggacaatgtggaagct 22
            ||||||||||||||||||||
Sbjct: 9062 tactggacaatgtggaagct 9081



 Score = 40.1 bits (20), Expect = 0.52
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 3    tactggacaatgtggaagct 22
            ||||||||||||||||||||
Sbjct: 2215 tactggacaatgtggaagct 2234
to top
>gb|M29642.1|PETRBCB Petunia ribulose 1,5-bisphosphate carboxylase small subunit mRNA
          (clone pSSU 51), partial cds
          Length = 212

 Score = 44.1 bits (22), Expect = 0.034
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                
Query: 3  tactggacaatgtggaagctacctatgtttgggtgcac 40
          |||||||| ||||||||||| || ||||| ||||||||
Sbjct: 31 tactggaccatgtggaagctgcccatgttcgggtgcac 68
to top
>gb|M29641.1|PETRBCA Petunia ribulose 1,5-bisphosphate carboxylase small subunit mRNA
           (clone pSSU 117), partial cds
          Length = 318

 Score = 44.1 bits (22), Expect = 0.034
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcac 40
           |||||||||||||||||| | || |||||||| |||||
Sbjct: 163 tactggacaatgtggaagttgcccatgtttggttgcac 200
to top
>gb|M60274.1|HEVRBSS Hevea brasiliensis ribulose-1,5-bisphosphate carboxylase small
           subunit (RbsS) mRNA, complete cds
          Length = 797

 Score = 44.1 bits (22), Expect = 0.034
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 3   tactggacaatgtggaagctacctatgtttgggtgcac 40
           |||||||| ||||||||||| || |||||||| |||||
Sbjct: 399 tactggaccatgtggaagctgcccatgtttggttgcac 436
to top
>gb|CP000117.1| Anabaena variabilis ATCC 29413 chromosome, complete sequence
          Length = 6365727

 Score = 42.1 bits (21), Expect = 0.13
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                            
Query: 3       tactggacaatgtggaagctacctatgtt 31
               ||||||||| |||||||||||||| ||||
Sbjct: 4856766 tactggacactgtggaagctacctttgtt 4856738
to top
>gb|AY267674.1| Bigelowiella natans ribulose-1,5-bisphosphate carboxylase/oxygenase
           small subunit 1 mRNA, complete cds; nuclear gene for
           plastid product
          Length = 986

 Score = 42.1 bits (21), Expect = 0.13
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 3   tactggacaatgtggaagctacctatgtt 31
           |||||||| ||||||||||| ||||||||
Sbjct: 393 tactggaccatgtggaagcttcctatgtt 421
to top
>gb|AY142543.1| Arabidopsis thaliana clone RAFL04-14-I04 (R09825) mRNA sequence
          Length = 2116

 Score = 42.1 bits (21), Expect = 0.13
 Identities = 47/56 (83%)
 Strand = Plus / Plus

                                                                    
Query: 3    tactggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtgtt 58
            |||||||||||||||||||| ||  |||| || ||||||| | || | ||||||||
Sbjct: 1766 tactggacaatgtggaagcttccattgttcggatgcaccgactccgctcaggtgtt 1821
to top
>gb|AY048671.1| Sequoia sempervirens ribulose-1,5-bisphosphate carboxylase small
           subunit mRNA, partial cds; nuclear gene for chloroplast
           product
          Length = 279

 Score = 42.1 bits (21), Expect = 0.13
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 11  aatgtggaagctacctatgtttgggtgca 39
           ||||||||||||||| |||||||| ||||
Sbjct: 123 aatgtggaagctacccatgtttggatgca 151
to top
>dbj|BA000019.2| Nostoc sp. PCC 7120 DNA, complete genome
          Length = 6413771

 Score = 42.1 bits (21), Expect = 0.13
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                            
Query: 6       tggacaatgtggaagctacctatgtttgg 34
               |||||| |||||||||||||| |||||||
Sbjct: 1788106 tggacactgtggaagctacctttgtttgg 1788134
to top
>gb|L02522.1|ANARBCLSC Anabaena sp. strain PCC 7120 ribulose 1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL), rbcX, and
            ribulose 1,5-bisphosphate carboxylase/oxygenase small
            subunit (rbcS) genes, complete cds
          Length = 2695

 Score = 42.1 bits (21), Expect = 0.13
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 6    tggacaatgtggaagctacctatgtttgg 34
            |||||| |||||||||||||| |||||||
Sbjct: 2235 tggacactgtggaagctacctttgtttgg 2263
to top
>emb|X51813.1|AMRBCSM3 Acetabularia mediterranea mRNA for ribulose 1,5-bisphosphate
           carboxylase/oxygenase, small subunit (rbcS gene), clone
           M3
          Length = 890

 Score = 42.1 bits (21), Expect = 0.13
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                
Query: 6   tggacaatgtggaagctacctatgtttgggtgcaccg 42
           ||||| ||||||||| | ||||||||||| |||||||
Sbjct: 417 tggacgatgtggaagttgcctatgtttggatgcaccg 453
to top
>emb|X51812.1|AMRBCSM2 Acetabularia mediterranea partial mRNA for ribulose
           1,5-bisphosphate carboxylase/oxygenase, small subunit
           (rbcS gene), clone M2
          Length = 797

 Score = 42.1 bits (21), Expect = 0.13
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                
Query: 6   tggacaatgtggaagctacctatgtttgggtgcaccg 42
           ||||| ||||||||| | ||||||||||| |||||||
Sbjct: 318 tggacgatgtggaagttgcctatgtttggatgcaccg 354
to top
>emb|X51811.1|AMRBCSM1 Acetabularia mediterranea mRNA for ribulose 1,5-bisphosphate
           carboxylase/oxygenase, small subunit (rbcS gene), clone
           M1
          Length = 833

 Score = 42.1 bits (21), Expect = 0.13
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                
Query: 6   tggacaatgtggaagctacctatgtttgggtgcaccg 42
           ||||| ||||||||| | ||||||||||| |||||||
Sbjct: 397 tggacgatgtggaagttgcctatgtttggatgcaccg 433
to top
>gb|M86717.1|SCFBCS1A Saccharum hybrid cultivar H32-8560 ribulose 1,5-bisphosphate
            carboxylase/oxygenase small subunit gene, complete cds
          Length = 2328

 Score = 42.1 bits (21), Expect = 0.13
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                        
Query: 3    tactggacaatgtggaagctacctatgtttgggtgcaccgncgc 46
            |||||||| ||||||||||| || ||||| || ||||||| |||
Sbjct: 1597 tactggaccatgtggaagctgcccatgttcggctgcaccgacgc 1640
to top
>gb|AF039015.1|AF039015 Fritillaria agrestis clone TA1 ribulose 1,5 bisphosphate
           carboxylase small subunit (rbcS) gene, partial cds
          Length = 595

 Score = 42.1 bits (21), Expect = 0.13
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 3   tactggacaatgtggaagctacctatgtt 31
           |||||||||||||||||||| || |||||
Sbjct: 508 tactggacaatgtggaagctgcccatgtt 536
to top
>gb|AF039013.1|AF039013 Fritillaria agrestis clone TA26 ribulose 1,5 bisphosphate
           carboxylase small subunit (rbcS) gene, partial cds
          Length = 595

 Score = 42.1 bits (21), Expect = 0.13
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 3   tactggacaatgtggaagctacctatgtt 31
           |||||||||||||||||||| || |||||
Sbjct: 508 tactggacaatgtggaagctgcccatgtt 536
to top
>gb|AF039010.1|AF039010 Fritillaria agrestis clone TA24 ribulose 1,5 bisphosphate
           carboxylase small subunit (rbcS) gene, partial cds
          Length = 595

 Score = 42.1 bits (21), Expect = 0.13
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 3   tactggacaatgtggaagctacctatgtt 31
           |||||||||||||||||||| || |||||
Sbjct: 508 tactggacaatgtggaagctgcccatgtt 536
to top
>gb|AF039009.1|AF039009 Fritillaria agrestis clone TA23 ribulose 1,5 bisphosphate
           carboxylase small subunit (rbcS) gene, partial cds
          Length = 595

 Score = 42.1 bits (21), Expect = 0.13
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 3   tactggacaatgtggaagctacctatgtt 31
           |||||||||||||||||||| || |||||
Sbjct: 508 tactggacaatgtggaagctgcccatgtt 536
to top
>gb|AF031543.1|AF031543 Fritillaria agrestis ribulose 1,5 bisphosphate carboxylase small
           subunit type IV (rbcS4) mRNA, complete cds
          Length = 732

 Score = 42.1 bits (21), Expect = 0.13
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 3   tactggacaatgtggaagctacctatgtt 31
           |||||||||||||||||||| || |||||
Sbjct: 383 tactggacaatgtggaagctgccgatgtt 411
to top
>gb|AF024574.1|AF024574 Fritillaria agrestis ribulose 1,5 bisphosphate carboxylase, small
           subunit type III (rbcS3) mRNA, nuclear gene encoding
           chloroplast protein, complete cds
          Length = 798

 Score = 42.1 bits (21), Expect = 0.13
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 3   tactggacaatgtggaagctacctatgtt 31
           |||||||||||||||||||| || |||||
Sbjct: 388 tactggacaatgtggaagctgcccatgtt 416
to top
>gb|AF024572.1|AF024572 Fritillaria agrestis ribulose 1,5 bisphosphate carboxylase, small
           subunit type I (rbcS1) mRNA, nuclear gene encoding
           chloroplast protein, complete cds
          Length = 713

 Score = 42.1 bits (21), Expect = 0.13
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 3   tactggacaatgtggaagctacctatgtt 31
           |||||||||||||||||||| || |||||
Sbjct: 382 tactggacaatgtggaagctgccgatgtt 410
to top
>gb|U05590.1|ASU05590 Anabaena sp. ribulose 1,5-bisphosphate carboxylase/oxygenase  small
           subunit (rbcS) gene and rbcX gene, complete cds
          Length = 2469

 Score = 42.1 bits (21), Expect = 0.13
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 3   tactggacaatgtggaagctacctatgtt 31
           |||||||||||||||||||| ||| ||||
Sbjct: 702 tactggacaatgtggaagctgcctttgtt 730
to top
>gb|J01540.1|ANARUBP Anabaena sp. (clone pAN600) rbcL & rbcS genes encoding both
            ribulose-1,5-bisphosphate carboxylase subunits, complete
            cds
          Length = 3429

 Score = 42.1 bits (21), Expect = 0.13
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 6    tggacaatgtggaagctacctatgtttgg 34
            |||||| |||||||||||||| |||||||
Sbjct: 2856 tggacactgtggaagctacctttgtttgg 2884
to top
>gb|L02521.1|ANARBCLSB Anabaena sp. ribulose 1,5-bisphosphate carboxylase/oxygenase large
           subunit (rbcL) gene, complete cds; ribulose
           1,5-bisphosphate carboxylase/oxygenase small subunit
           (rbcS) gene, complete cds
          Length = 2285

 Score = 42.1 bits (21), Expect = 0.13
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 6   tggacaatgtggaagctacctatgtttgg 34
           |||||| |||||||||||||| |||||||
Sbjct: 260 tggacactgtggaagctacctttgtttgg 288
to top
>gb|L02520.1|ANARBCLSA Anabaena sp. ribulose 1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; ribulose
            1,5-bisphosphate carboxylase/oxygenase small subunit
            (rbcS) gene, complete cds
          Length = 2169

 Score = 42.1 bits (21), Expect = 0.13
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 6    tggacaatgtggaagctacctatgtttgg 34
            |||||| |||||||||||||| |||||||
Sbjct: 1709 tggacactgtggaagctacctttgtttgg 1737
to top
>ref|NM_123204.3| Arabidopsis thaliana ribulose-bisphosphate carboxylase AT5G38430
           mRNA, complete cds
          Length = 808

 Score = 40.1 bits (20), Expect = 0.52
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 3   tactggacaatgtggaagct 22
           ||||||||||||||||||||
Sbjct: 390 tactggacaatgtggaagct 409
to top
>ref|NM_123202.2| Arabidopsis thaliana ribulose-bisphosphate carboxylase AT5G38410
           transcript variant AT5G38410.1 mRNA, complete cds
          Length = 925

 Score = 40.1 bits (20), Expect = 0.52
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 3   tactggacaatgtggaagct 22
           ||||||||||||||||||||
Sbjct: 412 tactggacaatgtggaagct 431
to top
>ref|NM_001036904.1| Arabidopsis thaliana ribulose-bisphosphate carboxylase AT5G38410
           transcript variant AT5G38410.2 mRNA, complete cds
          Length = 963

 Score = 40.1 bits (20), Expect = 0.52
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 3   tactggacaatgtggaagct 22
           ||||||||||||||||||||
Sbjct: 450 tactggacaatgtggaagct 469
to top
>ref|NM_202369.1| Arabidopsis thaliana ribulose-bisphosphate carboxylase AT1G67090
           transcript variant AT1G67090.2 mRNA, complete cds
          Length = 871

 Score = 40.1 bits (20), Expect = 0.52
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 3   tactggacaatgtggaagct 22
           ||||||||||||||||||||
Sbjct: 382 tactggacaatgtggaagct 401
to top
>ref|NM_105379.2| Arabidopsis thaliana ribulose-bisphosphate carboxylase AT1G67090
           transcript variant AT1G67090.1 mRNA, complete cds
          Length = 878

 Score = 40.1 bits (20), Expect = 0.52
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 3   tactggacaatgtggaagct 22
           ||||||||||||||||||||
Sbjct: 389 tactggacaatgtggaagct 408
to top
>gb|AC007152.9| Arabidopsis thaliana chromosome I BAC F1O19 genomic sequence, complete
             sequence
          Length = 90387

 Score = 40.1 bits (20), Expect = 0.52
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 3     tactggacaatgtggaagct 22
             ||||||||||||||||||||
Sbjct: 78350 tactggacaatgtggaagct 78331
to top
>gb|AC147741.11| Medicago truncatula clone mth2-17b23, complete sequence
          Length = 110572

 Score = 40.1 bits (20), Expect = 0.52
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 3     tactggacaatgtggaagctacctatgtttgg 34
             |||||||||||||||||| | ||| |||||||
Sbjct: 30883 tactggacaatgtggaagttgcctttgtttgg 30914



 Score = 36.2 bits (18), Expect = 8.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 3     tactggacaatgtggaag 20
             ||||||||||||||||||
Sbjct: 27805 tactggacaatgtggaag 27822
to top
>gb|AY445627.1| Oryza sativa (japonica cultivar-group) ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit mRNA, complete cds;
           chloroplast
          Length = 860

 Score = 40.1 bits (20), Expect = 0.52
 Identities = 43/51 (84%)
 Strand = Plus / Plus

                                                              
Query: 6   tggacaatgtggaagctacctatgtttgggtgcaccgncgccacacaggtg 56
           ||||| ||||||||||| || ||||| || |||||||  ||||| ||||||
Sbjct: 388 tggaccatgtggaagctgcccatgttcggctgcaccgatgccacccaggtg 438
to top
>gb|AY143814.1| Arabidopsis thaliana At5g38430/F1O19.10 mRNA, complete cds
          Length = 546

 Score = 40.1 bits (20), Expect = 0.52
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 3   tactggacaatgtggaagct 22
           ||||||||||||||||||||
Sbjct: 361 tactggacaatgtggaagct 380
to top
>gb|BT000721.1| Arabidopsis thaliana clone RAFL04-15-J15 (R09791) putative ribulose
           bisphosphate carboxylase small chain 3b precursor
           (RuBisCO small subunit 3b) (At5g38410) mRNA, complete
           cds
          Length = 772

 Score = 40.1 bits (20), Expect = 0.52
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 3   tactggacaatgtggaagct 22
           ||||||||||||||||||||
Sbjct: 413 tactggacaatgtggaagct 432
to top
>emb|AJ786661.1| Limonium gibertii mRNA for ribulose 1,5 bisphosphate
           carboxylase/oxygenase small subunit (rbcS2 gene)
          Length = 465

 Score = 40.1 bits (20), Expect = 0.52
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 3   tactggacaatgtggaagct 22
           ||||||||||||||||||||
Sbjct: 292 tactggacaatgtggaagct 311
to top
>emb|AJ786660.1| Limonium gibertii partial mRNA for ribulose 1,5 bisphosphate
           carboxylase/oxygenase small subunit (rbcS1 gene)
          Length = 459

 Score = 40.1 bits (20), Expect = 0.52
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 3   tactggacaatgtggaagct 22
           ||||||||||||||||||||
Sbjct: 292 tactggacaatgtggaagct 311


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 261,498
Number of Sequences: 3902068
Number of extensions: 261498
Number of successful extensions: 15043
Number of sequences better than 10.0: 351
Number of HSP's better than 10.0 without gapping: 351
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 14652
Number of HSP's gapped (non-prelim): 391
length of query: 58
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 37
effective length of database: 17,151,101,840
effective search space: 634590768080
effective search space used: 634590768080
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)
to top