ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name basd2b07
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1emb|BX842644.1| Mycoplasma mycoides subsp. mycoides SC genomic D... 46 0.11
2emb|CR382296.26| Zebrafish DNA sequence from clone DKEY-121H17 i... 46 0.11
3gb|AC110567.10| Mus musculus chromosome 5, clone RP23-304I24, co... 44 0.45
4gb|AC142271.3| Mus musculus chromosome 5 clone RP24-69A21, compl... 44 0.45
5gb|AC098736.4| Mus musculus BAC clone RP23-122B3 from 1, complet... 44 0.45
6gb|AC146789.30| Medicago truncatula clone mth2-71h24, complete s... 44 0.45
7emb|AL672230.6| Mouse DNA sequence from clone RP23-56L5 on chrom... 44 0.45
8gb|AC122246.5| Mus musculus BAC clone RP23-152K13 from 1, comple... 42 1.8
9emb|Z97336.1|ATFCA1 Arabidopsis thaliana DNA chromosome 4, ESSA ... 42 1.8
10emb|AL161554.2|ATCHRIV54 Arabidopsis thaliana DNA chromosome 4, ... 42 1.8
11emb|AL161538.2|ATCHRIV38 Arabidopsis thaliana DNA chromosome 4, ... 42 1.8
12emb|AL161471.2|ATCHRIV1 Arabidopsis thaliana DNA chromosome 4, c... 42 1.8
13emb|AL031187.1|ATT6K22 Arabidopsis thaliana DNA chromosome 4, BA... 42 1.8
14emb|BX640481.14| Zebrafish DNA sequence from clone DKEY-3H23 in ... 42 1.8
15gb|AC093703.1| Caenorhabditis elegans cosmid Y20F4, complete seq... 42 1.8
16gb|AC093608.3| Homo sapiens BAC clone RP11-700C8 from 4, complet... 42 1.8
17gb|AF195115.1|F5I10 Arabidopsis thaliana BAC F5I10 42 1.8
18emb|Z81483.2|CEC43D7 Caenorhabditis elegans Cosmid C43D7, comple... 42 1.8
19gb|AF013293.1|IG005I10 Arabidopsis thaliana BAC IG005I10 42 1.8
20emb|AL935335.5| Zebrafish DNA sequence from clone CH211-244M22, ... 42 1.8
21emb|AL672001.7| Mouse DNA sequence from clone RP23-248F16 on chr... 42 1.8
22gb|AC170810.2| Mus musculus BAC clone RP23-273L20 from chromosom... 42 1.8
23gb|AC166344.4| Mus musculus BAC clone RP24-63B17 from chromosome... 42 1.8
24gb|AC092956.5| Homo sapiens 3 BAC RP11-648O5 (Roswell Park Cance... 42 1.8
25gb|AC102004.7| Mus musculus chromosome 15, clone RP24-489M6, com... 40 7.1
26ref|NM_179048.1| Arabidopsis thaliana unknown protein AT4G14342 ... 40 7.1
27ref|XM_640675.1| Dictyostelium discoideum hypothetical protein (... 40 7.1
28gb|AY170464.1| Takifugu rubripes C16orf8-like protein, hemoglobi... 40 7.1
29gb|AC151473.3| Mus musculus BAC clone RP24-492O15 from chromosom... 40 7.1
30gb|AF106591.3| Caenorhabditis elegans cosmid T01A4, complete seq... 40 7.1
31gb|AC146448.4| Pan troglodytes BAC clone RP43-5H14 from 7, compl... 40 7.1
32gb|AE017244.1| Mycoplasma hyopneumoniae 7448, complete genome 40 7.1
33gb|AC146539.2| Gasterosteus aculeatus clone CH213-129C17, comple... 40 7.1
34emb|Z67995.1|CEM153 Caenorhabditis elegans Cosmid M153, complete... 40 7.1
35emb|Z48245.1|CET27D1 Caenorhabditis elegans Cosmid T27D1, comple... 40 7.1
36ref|XM_646619.1| Entamoeba histolytica HM-1:IMSS Rho guanine nuc... 40 7.1
37gb|AC146690.1| Gasterosteus aculeatus clone CH213-156J22, comple... 40 7.1
38gb|CP000053.1| Rickettsia felis URRWXCal2, complete genome 40 7.1
39gb|AC147007.17| Medicago truncatula clone mth2-26c3, complete se... 40 7.1
40emb|AL162402.19| Human DNA sequence from clone RP5-1054K23 on ch... 40 7.1
41emb|AL138827.16| Human DNA sequence from clone RP11-156F23 on ch... 40 7.1
42emb|AL137021.15| Human DNA sequence from clone RP11-202A15 on ch... 40 7.1
43gb|AC134043.1| Homo sapiens chromosome 5 clone RP11-175K6, compl... 40 7.1
44emb|AL137000.6| Human DNA sequence from clone RP11-203I16 on chr... 40 7.1
45emb|AL034411.6|HS808P6 Human DNA sequence from clone RP4-808P6 o... 40 7.1
46emb|X71020.1|NTNPGDNA N.tabacum Npg1 gene for polygalacturonase 40 7.1
47emb|AJ307315.2|CTH307315 Clostridium thermocellum ORF1, celC gen... 40 7.1
48emb|AL732566.5| Mouse DNA sequence from clone RP24-357P21 on chr... 40 7.1
49emb|BX537102.13| Zebrafish DNA sequence from clone DKEY-276L17 i... 40 7.1
50gb|AF483209.1| Solanum tuberosum putative trehalose synthase (St... 40 7.1
51gb|AC068506.10| Homo sapiens chromosome 18, clone RP11-96A15, co... 40 7.1
52gb|AC139854.21| Medicago truncatula clone mth2-16e16, complete s... 40 7.1
53gb|AC011376.5| Homo sapiens chromosome 5 clone CTB-11I22, comple... 40 7.1
54gb|AC009222.4| Homo sapiens chromosome 17, clone RP11-429O1, com... 40 7.1
55gb|AC087714.6| Homo sapiens chromosome 17, clone RP11-167A1, com... 40 7.1
56gb|AC093119.2| Homo sapiens chromosome 1 clone RP5-916A15, compl... 40 7.1
57gb|AC093427.2| Homo sapiens chromosome 1 clone RP5-1080K5, compl... 40 7.1
58gb|AC099027.1| Drosophila melanogaster, chromosome 2R, region 53... 40 7.1
59gb|DQ363750.1| Bacillus thuringiensis plasmid pBMB67, complete s... 40 7.1
60dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 40 7.1
61emb|AL606992.3|OSJN00116 Oryza sativa genomic DNA, chromosome 4,... 40 7.1
62gb|U63571.1|OTU63571 Oxytricha trifallax B micronuclear telomere... 40 7.1
63gb|AC009180.9|AC009180 Homo sapiens chromosome 7 clone RP11-209G... 40 7.1
64gb|AC084598.1|CBRG42J05 Caenorhabditis briggsae cosmid G42J05, c... 40 7.1
65gb|AC009277.4|AC009277 Homo sapiens chromosome 18, clone RP11-48... 40 7.1
66gb|CP000252.1| Syntrophus aciditrophicus SB, complete genome 40 7.1
67gb|AC155850.6| Mus musculus 6 BAC RP24-545D3 (Roswell Park Cance... 40 7.1
68gb|AC153831.4| Mus musculus 6 BAC RP23-291M9 (Roswell Park Cance... 40 7.1
69emb|BX663609.29| Zebrafish DNA sequence from clone DKEY-182H7 in... 40 7.1
70gb|AE003807.3| Drosophila melanogaster chromosome 2R, section 43... 40 7.1
71gb|AY449458.1| Oikopleura dioica clone BACOIKO002 4xj18, complet... 40 7.1
72gb|AE017332.1| Mycoplasma hyopneumoniae 232, complete genome 40 7.1
73gb|AC005147.1|AC005147 Drosophila melanogaster DNA sequence (P1s... 40 7.1
74gb|AE017126.1| Prochlorococcus marinus subsp. marinus str. CCMP1... 40 7.1
75gb|AE000512.1| Thermotoga maritima MSB8, complete genome 40 7.1
76emb|AL033514.1|CEY75B8A Caenorhabditis elegans YAC Y75B8A, compl... 40 7.1
77emb|BX001002.4| Zebrafish DNA sequence from clone CH211-51G4 in ... 40 7.1
78gb|AC139573.4| Mus musculus BAC clone RP23-472H13 from 16, compl... 40 7.1
79emb|CT025674.13| Mouse DNA sequence from clone RP24-364I17 on ch... 40 7.1
80gb|AC145211.3| Mus musculus BAC clone RP23-419G4 from 8, complet... 40 7.1
81emb|CT009749.1| Medicago truncatula chromosome 5 clone mth2-46e3... 40 7.1
82emb|Z67737.1|CET01H10 Caenorhabditis elegans Cosmid T01H10, comp... 40 7.1
83dbj|AP006632.1| Lotus japonicus genomic DNA, chromosome 2, clone... 40 7.1
84dbj|D00945.1|CLOC307 Clostridium thermocellum gene for endogluca... 40 7.1
85emb|AL603826.18| Mouse DNA sequence from clone RP23-206P11 on ch... 40 7.1 
>emb|BX842644.1| Mycoplasma mycoides subsp. mycoides SC genomic DNA, complete sequence;
              segment 3/4
          Length = 349402

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 497    attcatcaaaattttcaatttct 519
              |||||||||||||||||||||||
Sbjct: 252292 attcatcaaaattttcaatttct 252314
to top
>emb|CR382296.26| Zebrafish DNA sequence from clone DKEY-121H17 in linkage group 21,
             complete sequence
          Length = 137360

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 384   gcaatttttgttttcagaaaatt 406
             |||||||||||||||||||||||
Sbjct: 92927 gcaatttttgttttcagaaaatt 92905
to top
>gb|AC110567.10| Mus musculus chromosome 5, clone RP23-304I24, complete sequence
          Length = 188137

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 495    agattcatcaaaattttcaatt 516
              ||||||||||||||||||||||
Sbjct: 171870 agattcatcaaaattttcaatt 171891
to top
>gb|AC142271.3| Mus musculus chromosome 5 clone RP24-69A21, complete sequence
          Length = 179941

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 495    agattcatcaaaattttcaatt 516
              ||||||||||||||||||||||
Sbjct: 151523 agattcatcaaaattttcaatt 151502
to top
>gb|AC098736.4| Mus musculus BAC clone RP23-122B3 from 1, complete sequence
          Length = 211208

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 407    ctgaaaattgcacataacatta 428
              ||||||||||||||||||||||
Sbjct: 200568 ctgaaaattgcacataacatta 200589
to top
>gb|AC146789.30| Medicago truncatula clone mth2-71h24, complete sequence
          Length = 127922

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 243   aatggcaaaatctgaaaatttt 264
             ||||||||||||||||||||||
Sbjct: 49816 aatggcaaaatctgaaaatttt 49837



 Score = 44.1 bits (22), Expect = 0.45
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 243   aatggcaaaatctgaaaatttt 264
             ||||||||||||||||||||||
Sbjct: 32391 aatggcaaaatctgaaaatttt 32412
to top
>emb|AL672230.6| Mouse DNA sequence from clone RP23-56L5 on chromosome X, complete
              sequence
          Length = 226781

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 496    gattcatcaaaattttcaattt 517
              ||||||||||||||||||||||
Sbjct: 178144 gattcatcaaaattttcaattt 178165
to top
>gb|AC122246.5| Mus musculus BAC clone RP23-152K13 from 1, complete sequence
          Length = 203739

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 396    ttcagaaaattctgaaaattgcaca 420
              |||| ||||||||||||||||||||
Sbjct: 109786 ttcacaaaattctgaaaattgcaca 109762
to top
>emb|Z97336.1|ATFCA1 Arabidopsis thaliana DNA chromosome 4, ESSA I FCA contig fragment No. 1
          Length = 206606

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 497   attcatcaaaattttcaattt 517
             |||||||||||||||||||||
Sbjct: 11571 attcatcaaaattttcaattt 11551
to top
>emb|AL161554.2|ATCHRIV54 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 54
          Length = 198715

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 497    attcatcaaaattttcaattt 517
              |||||||||||||||||||||
Sbjct: 171948 attcatcaaaattttcaattt 171968
to top
>emb|AL161538.2|ATCHRIV38 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 38
          Length = 198944

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 497    attcatcaaaattttcaattt 517
              |||||||||||||||||||||
Sbjct: 151011 attcatcaaaattttcaattt 150991
to top
>emb|AL161471.2|ATCHRIV1 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 1
          Length = 197119

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 386    aatttttgttttcagaaaatt 406
              |||||||||||||||||||||
Sbjct: 191190 aatttttgttttcagaaaatt 191210
to top
>emb|AL031187.1|ATT6K22 Arabidopsis thaliana DNA chromosome 4, BAC clone T6K22 (ESSAII project)
          Length = 89219

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 497   attcatcaaaattttcaattt 517
             |||||||||||||||||||||
Sbjct: 28671 attcatcaaaattttcaattt 28691
to top
>emb|BX640481.14| Zebrafish DNA sequence from clone DKEY-3H23 in linkage group 10,
             complete sequence
          Length = 111244

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 297   atggaaatttttcaccatattttgg 321
             |||||||||||||| ||||||||||
Sbjct: 51368 atggaaatttttcatcatattttgg 51344
to top
>gb|AC093703.1| Caenorhabditis elegans cosmid Y20F4, complete sequence
          Length = 58521

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 346   aaatttcaattttctgcaatt 366
             |||||||||||||||||||||
Sbjct: 26905 aaatttcaattttctgcaatt 26885
to top
>gb|AC093608.3| Homo sapiens BAC clone RP11-700C8 from 4, complete sequence
          Length = 162015

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 500    catcaaaattttcaatttcta 520
              |||||||||||||||||||||
Sbjct: 153908 catcaaaattttcaatttcta 153888
to top
>gb|AF195115.1|F5I10 Arabidopsis thaliana BAC F5I10
          Length = 111906

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 386   aatttttgttttcagaaaatt 406
             |||||||||||||||||||||
Sbjct: 91709 aatttttgttttcagaaaatt 91729
to top
>emb|Z81483.2|CEC43D7 Caenorhabditis elegans Cosmid C43D7, complete sequence
          Length = 34981

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 397   tcagaaaattctgaaaattgc 417
             |||||||||||||||||||||
Sbjct: 22641 tcagaaaattctgaaaattgc 22661
to top
>gb|AF013293.1|IG005I10 Arabidopsis thaliana BAC IG005I10
          Length = 111906

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 386   aatttttgttttcagaaaatt 406
             |||||||||||||||||||||
Sbjct: 20198 aatttttgttttcagaaaatt 20178
to top
>emb|AL935335.5| Zebrafish DNA sequence from clone CH211-244M22, complete sequence
          Length = 197549

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 495   agattcatcaaaattttcaatttctacaa 523
             |||||||||| ||||||||||||| ||||
Sbjct: 51087 agattcatcataattttcaatttccacaa 51059
to top
>emb|AL672001.7| Mouse DNA sequence from clone RP23-248F16 on chromosome X, complete
             sequence
          Length = 191279

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 395   tttcagaaaattctgaaaatt 415
             |||||||||||||||||||||
Sbjct: 19901 tttcagaaaattctgaaaatt 19881
to top
>gb|AC170810.2| Mus musculus BAC clone RP23-273L20 from chromosome 14, complete
             sequence
          Length = 193636

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 341   catcaaaatttcaattttctg 361
             |||||||||||||||||||||
Sbjct: 41561 catcaaaatttcaattttctg 41581
to top
>gb|AC166344.4| Mus musculus BAC clone RP24-63B17 from chromosome 14, complete sequence
          Length = 224882

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 341    catcaaaatttcaattttctg 361
              |||||||||||||||||||||
Sbjct: 215583 catcaaaatttcaattttctg 215603
to top
>gb|AC092956.5| Homo sapiens 3 BAC RP11-648O5 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 194510

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 37    cttttaggttatgcttgcttt 57
             |||||||||||||||||||||
Sbjct: 18287 cttttaggttatgcttgcttt 18307
to top
>gb|AC102004.7| Mus musculus chromosome 15, clone RP24-489M6, complete sequence
          Length = 164810

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 392   tgttttcagaaaattctgaa 411
             ||||||||||||||||||||
Sbjct: 88686 tgttttcagaaaattctgaa 88667
to top
>ref|NM_179048.1| Arabidopsis thaliana unknown protein AT4G14342 mRNA, complete cds
          Length = 578

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 497 attcatcaaaattttcaatt 516
           ||||||||||||||||||||
Sbjct: 559 attcatcaaaattttcaatt 578
to top
>ref|XM_640675.1| Dictyostelium discoideum hypothetical protein (DDB0202739), partial
            mRNA
          Length = 2679

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 338  attcatcaaaatttcaattt 357
            ||||||||||||||||||||
Sbjct: 2488 attcatcaaaatttcaattt 2507
to top
>gb|AY170464.1| Takifugu rubripes C16orf8-like protein, hemoglobin alpha 3 subunit
             (HBA3), hemoglobin beta subunit (HBB), hemoglobin alpha 4
             subunit (HBA4), and leucine carboxyl methyltransferase
             (LCMT) genes, complete cds
          Length = 35210

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 289   ggactaacatggaaatttttcacc 312
             |||||| |||||||||||||||||
Sbjct: 11500 ggactaccatggaaatttttcacc 11477
to top
>gb|AC151473.3| Mus musculus BAC clone RP24-492O15 from chromosome 17, complete sequence
          Length = 128797

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 385    caatttttgttttcagaaaa 404
              ||||||||||||||||||||
Sbjct: 127747 caatttttgttttcagaaaa 127766
to top
>gb|AF106591.3| Caenorhabditis elegans cosmid T01A4, complete sequence
          Length = 44436

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 344   caaaatttcaattttctgcaattt 367
             ||||||||||||||| ||||||||
Sbjct: 14733 caaaatttcaattttttgcaattt 14710
to top
>gb|AC146448.4| Pan troglodytes BAC clone RP43-5H14 from 7, complete sequence
          Length = 203611

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 349    tttcaattttctgcaatttt 368
              ||||||||||||||||||||
Sbjct: 185350 tttcaattttctgcaatttt 185331
to top
>gb|AE017244.1| Mycoplasma hyopneumoniae 7448, complete genome
          Length = 920079

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 502   tcaaaattttcaatttctac 521
             ||||||||||||||||||||
Sbjct: 28613 tcaaaattttcaatttctac 28632
to top
>gb|AC146539.2| Gasterosteus aculeatus clone CH213-129C17, complete sequence
          Length = 202686

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 160    tcaaaaccagccgaaccacc 179
              ||||||||||||||||||||
Sbjct: 163215 tcaaaaccagccgaaccacc 163196
to top
>emb|Z67995.1|CEM153 Caenorhabditis elegans Cosmid M153, complete sequence
          Length = 16986

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 387 atttttgttttcagaaaatt 406
           ||||||||||||||||||||
Sbjct: 83  atttttgttttcagaaaatt 64
to top
>emb|Z48245.1|CET27D1 Caenorhabditis elegans Cosmid T27D1, complete sequence
          Length = 22559

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 398   cagaaaattctgaaaattgc 417
             ||||||||||||||||||||
Sbjct: 12507 cagaaaattctgaaaattgc 12488
to top
>ref|XM_646619.1| Entamoeba histolytica HM-1:IMSS Rho guanine nucleotide exchange
           factor (151.t00015) partial mRNA
          Length = 1374

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 458 aaaattttgaacatatcttt 477
           ||||||||||||||||||||
Sbjct: 103 aaaattttgaacatatcttt 84
to top
>gb|AC146690.1| Gasterosteus aculeatus clone CH213-156J22, complete sequence
          Length = 166930

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 160    tcaaaaccagccgaaccacc 179
              ||||||||||||||||||||
Sbjct: 134160 tcaaaaccagccgaaccacc 134141
to top
>gb|CP000053.1| Rickettsia felis URRWXCal2, complete genome
          Length = 1485148

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 498    ttcatcaaaattttcaattt 517
              ||||||||||||||||||||
Sbjct: 458640 ttcatcaaaattttcaattt 458621
to top
>gb|AC147007.17| Medicago truncatula clone mth2-26c3, complete sequence
          Length = 122770

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 338    attcatcaaaatttcaattt 357
              ||||||||||||||||||||
Sbjct: 107248 attcatcaaaatttcaattt 107267
to top
>emb|AL162402.19| Human DNA sequence from clone RP5-1054K23 on chromosome 1p13.3-21.1,
             complete sequence
          Length = 80743

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 300   gaaatttttcaccatatttt 319
             ||||||||||||||||||||
Sbjct: 80055 gaaatttttcaccatatttt 80036
to top
>emb|AL138827.16| Human DNA sequence from clone RP11-156F23 on chromosome 6 Contains the
             CGA gene for glycoprotein hormones, alpha polypeptide and
             a 60S ribosomal protein L21 (RPL21) pseudogene, complete
             sequence
          Length = 80844

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 505   aaattttcaatttctacaat 524
             ||||||||||||||||||||
Sbjct: 69470 aaattttcaatttctacaat 69451
to top
>emb|AL137021.15| Human DNA sequence from clone RP11-202A15 on chromosome 9q31.1-32,
             complete sequence
          Length = 80658

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 333   gagagattcatcaaaatttcaatt 356
             |||||||| |||||||||||||||
Sbjct: 22036 gagagattgatcaaaatttcaatt 22059
to top
>gb|AC134043.1| Homo sapiens chromosome 5 clone RP11-175K6, complete sequence
          Length = 154098

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 392   tgttttcagaaaattctgaaaatt 415
             ||||||||||||| ||||||||||
Sbjct: 18387 tgttttcagaaaaatctgaaaatt 18410
to top
>emb|AL137000.6| Human DNA sequence from clone RP11-203I16 on chromosome 13 Contains the
             gene for KIAA0970 protein,  the COX7CP1 cytochrome c
             oxidase subunit VIIc pseudogene 1, a novel pseudogene, the
             GPR38 gene for G protein-coupled receptor 38 and a CpG
             island, complete sequence
          Length = 163284

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 395   tttcagaaaattctgaaaat 414
             ||||||||||||||||||||
Sbjct: 56166 tttcagaaaattctgaaaat 56147
to top
>emb|AL034411.6|HS808P6 Human DNA sequence from clone RP4-808P6 on chromosome Xq24 Contains the
             SLC6A14 gene for solute carrier family 6 (neurotransmitter
             transporter) member 14, complete sequence
          Length = 99271

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 174   accaccccctcctggtttta 193
             ||||||||||||||||||||
Sbjct: 58830 accaccccctcctggtttta 58849
to top
>emb|X71020.1|NTNPGDNA N.tabacum Npg1 gene for polygalacturonase
          Length = 5061

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 348  atttcaattttctgcaattttggg 371
            ||||||||||||| ||||||||||
Sbjct: 4421 atttcaattttcttcaattttggg 4398
to top
>emb|AJ307315.2|CTH307315 Clostridium thermocellum ORF1, celC gene, ORF3, licA gene and ORF5
            (partial)
          Length = 9760

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 339  ttcatcaaaatttcaatttt 358
            ||||||||||||||||||||
Sbjct: 2124 ttcatcaaaatttcaatttt 2105
to top
>emb|AL732566.5| Mouse DNA sequence from clone RP24-357P21 on chromosome 4, complete
             sequence
          Length = 109027

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 396   ttcagaaaattctgaaaatt 415
             ||||||||||||||||||||
Sbjct: 73890 ttcagaaaattctgaaaatt 73871
to top
>emb|BX537102.13| Zebrafish DNA sequence from clone DKEY-276L17 in linkage group 14,
             complete sequence
          Length = 239944

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 47    atgcttgctttattacctatattg 70
             |||||||||||||| |||||||||
Sbjct: 47661 atgcttgctttatttcctatattg 47638
to top
>gb|AF483209.1| Solanum tuberosum putative trehalose synthase (StTS1) gene, exons 1
            through 4 and complete cds
          Length = 8590

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 347  aatttcaattttctgcaatt 366
            ||||||||||||||||||||
Sbjct: 1945 aatttcaattttctgcaatt 1926
to top
>gb|AC068506.10| Homo sapiens chromosome 18, clone RP11-96A15, complete sequence
          Length = 175885

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 388   tttttgttttcagaaaattc 407
             ||||||||||||||||||||
Sbjct: 38643 tttttgttttcagaaaattc 38624
to top
>gb|AC139854.21| Medicago truncatula clone mth2-16e16, complete sequence
          Length = 117864

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 338  attcatcaaaatttcaattt 357
            ||||||||||||||||||||
Sbjct: 9331 attcatcaaaatttcaattt 9350
to top
>gb|AC011376.5| Homo sapiens chromosome 5 clone CTB-11I22, complete sequence
          Length = 132768

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 392   tgttttcagaaaattctgaaaatt 415
             ||||||||||||| ||||||||||
Sbjct: 85557 tgttttcagaaaaatctgaaaatt 85534
to top
>gb|AC009222.4| Homo sapiens chromosome 17, clone RP11-429O1, complete sequence
          Length = 184304

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 45     ttatgcttgctttattacctatat 68
              |||||||||||||||||| |||||
Sbjct: 167175 ttatgcttgctttattacatatat 167152
to top
>gb|AC087714.6| Homo sapiens chromosome 17, clone RP11-167A1, complete sequence
          Length = 163377

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 45     ttatgcttgctttattacctatat 68
              |||||||||||||||||| |||||
Sbjct: 158644 ttatgcttgctttattacatatat 158667
to top
>gb|AC093119.2| Homo sapiens chromosome 1 clone RP5-916A15, complete sequence
          Length = 124603

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 300  gaaatttttcaccatatttt 319
            ||||||||||||||||||||
Sbjct: 1312 gaaatttttcaccatatttt 1293
to top
>gb|AC093427.2| Homo sapiens chromosome 1 clone RP5-1080K5, complete sequence
          Length = 131877

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 390   tttgttttcagaaaattctg 409
             ||||||||||||||||||||
Sbjct: 70279 tttgttttcagaaaattctg 70298
to top
>gb|AC099027.1| Drosophila melanogaster, chromosome 2R, region 53C-53D, BAC clone
              BACR06I15, complete sequence
          Length = 185425

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 349    tttcaattttctgcaatttt 368
              ||||||||||||||||||||
Sbjct: 124196 tttcaattttctgcaatttt 124177
to top
>gb|DQ363750.1| Bacillus thuringiensis plasmid pBMB67, complete sequence
          Length = 67159

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 65   atattgaagatggttttatt 84
            ||||||||||||||||||||
Sbjct: 5922 atattgaagatggttttatt 5941
to top
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4,
              complete sequence
          Length = 35498469

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 347    aatttcaattttctgcaattttgg 370
              |||||||||||||||||| |||||
Sbjct: 903324 aatttcaattttctgcaagtttgg 903301
to top
>emb|AL606992.3|OSJN00116 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0073L13,
              complete sequence
          Length = 143386

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 347    aatttcaattttctgcaattttgg 370
              |||||||||||||||||| |||||
Sbjct: 123985 aatttcaattttctgcaagtttgg 123962
to top
>gb|U63571.1|OTU63571 Oxytricha trifallax B micronuclear telomere-binding protein beta
           subunit gene, partial cds
          Length = 1573

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 243 aatggcaaaatctgaaaattttca 266
           ||||||||||| ||||||||||||
Sbjct: 879 aatggcaaaatatgaaaattttca 856
to top
>gb|AC009180.9|AC009180 Homo sapiens chromosome 7 clone RP11-209G24, complete sequence
          Length = 163384

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 349   tttcaattttctgcaatttt 368
             ||||||||||||||||||||
Sbjct: 90486 tttcaattttctgcaatttt 90505
to top
>gb|AC084598.1|CBRG42J05 Caenorhabditis briggsae cosmid G42J05, complete sequence
          Length = 40229

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 345  aaaatttcaattttctgcaatttt 368
            ||||||||| ||||||||||||||
Sbjct: 1843 aaaatttcatttttctgcaatttt 1820
to top
>gb|AC009277.4|AC009277 Homo sapiens chromosome 18, clone RP11-481E24, complete sequence
          Length = 160401

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 388    tttttgttttcagaaaattc 407
              ||||||||||||||||||||
Sbjct: 124732 tttttgttttcagaaaattc 124713
to top
>gb|CP000252.1| Syntrophus aciditrophicus SB, complete genome
          Length = 3179300

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 387     atttttgttttcagaaaatt 406
               ||||||||||||||||||||
Sbjct: 2214752 atttttgttttcagaaaatt 2214733
to top
>gb|AC155850.6| Mus musculus 6 BAC RP24-545D3 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 195675

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 389    ttttgttttcagaaaattct 408
              ||||||||||||||||||||
Sbjct: 134549 ttttgttttcagaaaattct 134568
to top
>gb|AC153831.4| Mus musculus 6 BAC RP23-291M9 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 202080

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 389    ttttgttttcagaaaattct 408
              ||||||||||||||||||||
Sbjct: 194646 ttttgttttcagaaaattct 194665
to top
>emb|BX663609.29| Zebrafish DNA sequence from clone DKEY-182H7 in linkage group 7, complete
              sequence
          Length = 248960

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 344    caaaatttcaattttctgcaattt 367
              |||||||||||||| |||||||||
Sbjct: 178663 caaaatttcaatttgctgcaattt 178686
to top
>gb|AE003807.3| Drosophila melanogaster chromosome 2R, section 43 of 73 of the complete
              sequence
          Length = 258223

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 349    tttcaattttctgcaatttt 368
              ||||||||||||||||||||
Sbjct: 244618 tttcaattttctgcaatttt 244637
to top
>gb|AY449458.1| Oikopleura dioica clone BACOIKO002 4xj18, complete sequence
          Length = 188193

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 247   gcaaaatctgaaaattttca 266
             ||||||||||||||||||||
Sbjct: 55173 gcaaaatctgaaaattttca 55154
to top
>gb|AE017332.1| Mycoplasma hyopneumoniae 232, complete genome
          Length = 892758

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 502   tcaaaattttcaatttctac 521
             ||||||||||||||||||||
Sbjct: 29797 tcaaaattttcaatttctac 29816
to top
>gb|AC005147.1|AC005147 Drosophila melanogaster DNA sequence (P1s DS02829 (D189) and DS00090
             (D235)), complete sequence
          Length = 90065

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 349   tttcaattttctgcaatttt 368
             ||||||||||||||||||||
Sbjct: 79958 tttcaattttctgcaatttt 79939
to top
>gb|AE017126.1| Prochlorococcus marinus subsp. marinus str. CCMP1375 complete genome
          Length = 1751080

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 236     tagaaggaatggcaaaatctgaaa 259
               |||||| |||||||||||||||||
Sbjct: 1340865 tagaagaaatggcaaaatctgaaa 1340888
to top
>gb|AE000512.1| Thermotoga maritima MSB8, complete genome
          Length = 1860725

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 401     aaaattctgaaaattgcaca 420
               ||||||||||||||||||||
Sbjct: 1222889 aaaattctgaaaattgcaca 1222870
to top
>emb|AL033514.1|CEY75B8A Caenorhabditis elegans YAC Y75B8A, complete sequence
          Length = 298406

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 345    aaaatttcaattttctgcaatttt 368
              ||||||||||||||| ||||||||
Sbjct: 173088 aaaatttcaattttcggcaatttt 173065
to top
>emb|BX001002.4| Zebrafish DNA sequence from clone CH211-51G4 in linkage group 14,
              complete sequence
          Length = 177858

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 47     atgcttgctttattacctatattg 70
              |||||||||||||| |||||||||
Sbjct: 103496 atgcttgctttatttcctatattg 103519
to top
>gb|AC139573.4| Mus musculus BAC clone RP23-472H13 from 16, complete sequence
          Length = 189632

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 145    attcaaccccaaacttcaaa 164
              ||||||||||||||||||||
Sbjct: 153742 attcaaccccaaacttcaaa 153761
to top
>emb|CT025674.13| Mouse DNA sequence from clone RP24-364I17 on chromosome 13, complete
            sequence
          Length = 117646

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 228  tcagcaggtagaaggaatgg 247
            ||||||||||||||||||||
Sbjct: 9502 tcagcaggtagaaggaatgg 9521
to top
>gb|AC145211.3| Mus musculus BAC clone RP23-419G4 from 8, complete sequence
          Length = 191166

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 458    aaaattttgaacatatcttt 477
              ||||||||||||||||||||
Sbjct: 108644 aaaattttgaacatatcttt 108663
to top
>emb|CT009749.1| Medicago truncatula chromosome 5 clone mth2-46e3, COMPLETE SEQUENCE
          Length = 138861

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 387   atttttgttttcagaaaatt 406
             ||||||||||||||||||||
Sbjct: 33404 atttttgttttcagaaaatt 33385
to top
>emb|Z67737.1|CET01H10 Caenorhabditis elegans Cosmid T01H10, complete sequence
          Length = 30864

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 387   atttttgttttcagaaaatt 406
             ||||||||||||||||||||
Sbjct: 30847 atttttgttttcagaaaatt 30828
to top
>dbj|AP006632.1| Lotus japonicus genomic DNA, chromosome 2, clone:LjT16I03, TM0056,
             complete sequence
          Length = 102883

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 392   tgttttcagaaaattctgaaaatt 415
             |||||| |||||||||||||||||
Sbjct: 16878 tgttttaagaaaattctgaaaatt 16901
to top
>dbj|D00945.1|CLOC307 Clostridium thermocellum gene for endoglucanase, complete cds
          Length = 1499

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 339 ttcatcaaaatttcaatttt 358
           ||||||||||||||||||||
Sbjct: 191 ttcatcaaaatttcaatttt 172
to top
>emb|AL603826.18| Mouse DNA sequence from clone RP23-206P11 on chromosome 11, complete
             sequence
          Length = 145299

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 237   agaaggaatggcaaaatctgaaaatttt 264
             ||||||||||||||||  ||||||||||
Sbjct: 78354 agaaggaatggcaaaaggtgaaaatttt 78381


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,563,728
Number of Sequences: 3902068
Number of extensions: 6563728
Number of successful extensions: 150239
Number of sequences better than 10.0: 85
Number of HSP's better than 10.0 without gapping: 85
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 149703
Number of HSP's gapped (non-prelim): 536
length of query: 524
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 501
effective length of database: 17,143,297,704
effective search space: 8588792149704
effective search space used: 8588792149704
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top