ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name basd2a18
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|XM_469455.1| Oryza sativa (japonica cultivar-group), mRNA 353 5e-94
2dbj|AK065804.1| Oryza sativa (japonica cultivar-group) cDNA clon... 353 5e-94
3gb|AC091775.10| Oryza sativa chromosome 3 BAC OSJNBa0004G17 geno... 256 8e-65
4gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 256 8e-65
5dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 256 8e-65
6gb|AF466646.1| Zea mays putative transposase (Z195D10.1) gene, p... 228 2e-56
7gb|AC009660.15| Homo sapiens chromosome 15, clone RP11-424J10, c... 46 0.15
8gb|AC166653.5| Mus musculus BAC clone RP24-84J23 from chromosome... 44 0.59
9gb|AC166822.3| Mus musculus BAC clone RP24-117F20 from chromosom... 44 0.59
10gb|AC158165.1| Mus musculus BAC clone RP23-462M21 from chromosom... 44 0.59
11gb|AC101931.8| Mus musculus chromosome 1, clone RP24-63O23, comp... 44 0.59
12ref|NM_128656.2| Arabidopsis thaliana oxysterol binding AT2G3102... 42 2.3
13gb|AC121298.10| Mus musculus chromosome 5, clone RP23-377E6, com... 42 2.3
14gb|AC151759.1| Ornithorhynchus anatinus chromosome UNK clone OAB... 42 2.3
15gb|AC168268.2| Mus musculus BAC clone RP23-339K12 from chromosom... 42 2.3
16gb|AC160993.5| Mus musculus BAC clone RP23-159D11 from chromosom... 42 2.3
17gb|AC151667.1| Pan troglodytes chromosome X clone RP43-007H19 ma... 42 2.3
18gb|AC120413.20| Mus musculus chromosome 5, clone RP24-458L16, co... 42 2.3
19gb|AC145689.4| Pan troglodytes BAC clone CH251-184I22 from X, co... 42 2.3
20emb|CR388131.10| Zebrafish DNA sequence from clone DKEY-114G9 in... 42 2.3
21gb|AC125313.2| Mus musculus BAC clone RP24-353A16 from 5, comple... 42 2.3
22gb|AC125343.2| Mus musculus BAC clone RP24-537A5 from 5, complet... 42 2.3
23gb|AC155955.2| Xenopus tropicalis clone CH216-151P9, complete se... 42 2.3
24gb|AC148217.15| Medicago truncatula clone mth2-20c19, complete s... 42 2.3
25gb|AC087871.9| Genomic sequence for Mus musculus, clone RP23-334... 42 2.3
26gb|AC007846.12| Homo sapiens chromosome 17, clone CTC-803F22, co... 42 2.3
27gb|AC004669.3| Arabidopsis thaliana chromosome 2 clone F7F1 map ... 42 2.3
28gb|AC154497.2| Mus musculus BAC clone RP24-112C15 from chromosom... 42 2.3
29gb|AC068718.6| Homo sapiens BAC clone RP11-123G24 from 2, comple... 42 2.3
30gb|U82671.5| Homo sapiens chromosome X multiple clones map q28, ... 42 2.3
31gb|AC117622.10| Mus musculus chromosome 5, clone RP23-114L5, com... 42 2.3
32emb|AL928988.14| Mouse DNA sequence from clone RP23-402M7 on chr... 42 2.3
33emb|BX005220.7| Zebrafish DNA sequence from clone DKEY-82D4 in l... 42 2.3
34gb|BC072570.1| Mus musculus cDNA clone IMAGE:5719559 42 2.3
35emb|CT010467.6| Mouse DNA sequence from clone RP23-81C12 on chro... 42 2.3
36gb|AC165972.4| Mus musculus BAC clone RP23-87D12 from chromosome... 40 9.2
37gb|CP000141.1| Carboxydothermus hydrogenoformans Z-2901, complet... 40 9.2
38gb|AC150653.5| Bos taurus BAC CH240-226L9 (Children's Hospital ... 40 9.2
39gb|AC150694.2| Bos taurus BAC CH240-144A17 (Children's Hospital... 40 9.2
40gb|AC090900.3| Drosophila melanogaster clone BACR30C07, complete... 40 9.2
41gb|AC127361.4| Mus musculus BAC clone RP23-125M8 from chromosome... 40 9.2
42gb|AC154605.2| Mus musculus BAC clone RP23-348G3 from chromosome... 40 9.2
43gb|AC004002.1| Homo sapiens BAC clone CTA-356F9 from 7, complete... 40 9.2
44gb|BC056062.1| Xenopus laevis chronic myelogenous leukemia tumor... 40 9.2
45gb|AC145864.2| Pan troglodytes BAC clone RP43-6L18 from 7, compl... 40 9.2
46gb|AC091302.5| Oryza sativa chromosome 3 BAC OSJNBb0015I21 genom... 40 9.2
47gb|AC146588.14| Medicago truncatula clone mth2-145c3, complete s... 40 9.2
48emb|AL583806.7| Human DNA sequence from clone RP11-10F17 on chro... 40 9.2
49gb|AC164578.5| Mus musculus BAC RP23-15E20 (Roswell Park Cancer... 40 9.2
50emb|AL161571.2|ATCHRIV67 Arabidopsis thaliana DNA chromosome 4, ... 40 9.2
51emb|AL035602.1|ATT29A15 Arabidopsis thaliana DNA chromosome 4, B... 40 9.2
52gb|AC108709.3| Homo sapiens 3 BAC RP11-81P15 (Roswell Park Cance... 40 9.2
53gb|AC101690.7| Mus musculus chromosome 7, clone RP23-218E6, comp... 40 9.2
54gb|AC009930.7| Homo sapiens chromosome 8, clone RP11-114O8, comp... 40 9.2
55gb|AC084823.11| Mus Musculus Strain C57BL6/J chromosome 8 BAC, R... 40 9.2
56gb|AC037426.12| Oryza sativa chromosome 10 BAC OSJNBb0014I11 gen... 40 9.2
57gb|AC023577.6| Homo sapiens chromosome 18, clone RP11-645D5, com... 40 9.2
58dbj|AK163197.1| Mus musculus 7 days neonate cerebellum cDNA, RIK... 40 9.2
59emb|CR338865.2| Gallus gallus finished cDNA, clone ChEST1020f23 40 9.2
60dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 40 9.2
61dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 40 9.2
62gb|AC100735.15| Mus musculus chromosome 7, clone RP24-331F7, com... 40 9.2
63gb|AC084319.5|AC084319 Oryza sativa chromosome 3 BAC OSJNBa0004B... 40 9.2
64gb|AC129918.10| Homo sapiens chromosome 8, clone CTD-2132E17, co... 40 9.2
65gb|AC104946.4| Homo sapiens chromosome 8, clone RP11-946L20, com... 40 9.2
66dbj|AP004131.3| Oryza sativa (japonica cultivar-group) genomic D... 40 9.2
67gb|AE003812.4| Drosophila melanogaster chromosome 2R, section 38... 40 9.2
68emb|AL162252.17| Human DNA sequence from clone RP11-55J24 on chr... 40 9.2
69gb|AE015451.1| Pseudomonas putida KT2440 complete genome 40 9.2
70gb|AC159275.6| Mus musculus BAC clone RP23-367C13 from chromosom... 40 9.2
71gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 40 9.2
72gb|AC004306.1|AC004306 Drosophila melanogaster DNA sequence (P1 ... 40 9.2
73gb|M79353.1|HIVENVMA7 Human immunodeficiency virus type 1 (clone... 40 9.2
74emb|AL603837.8| Mouse DNA sequence from clone RP23-254F2 on chro... 40 9.2
75gb|AC164983.2| Mus musculus BAC clone RP23-16J24 from chromosome... 40 9.2
76emb|AL731811.24| Mouse DNA sequence from clone RP23-60A1 on chro... 40 9.2 
>ref|XM_469455.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2735

 Score =  353 bits (178), Expect = 5e-94
 Identities = 251/274 (91%), Gaps = 1/274 (0%)
 Strand = Plus / Plus

                                                                        
Query: 24   tgcctagagaatggtgaatatgaaagagcaaatgctgagaagttgaggcttgagcaaaga 83
            ||||||||||||||||| ||||||||||||||||||||||||||||||||||| || |||
Sbjct: 2194 tgcctagagaatggtgagtatgaaagagcaaatgctgagaagttgaggcttgaacagaga 2253

                                                                        
Query: 84   caacggcaggcacgaaagatgcaggagagtgggtggaaacctcggtggtttgcgaaggat 143
            ||||| |||||||| |||||||||||||| ||||||||||||||||||||||| || |||
Sbjct: 2254 caacgacaggcacggaagatgcaggagagcgggtggaaacctcggtggtttgcaaaagat 2313

                                                                        
Query: 144  aaaggtagcgacacataccgctacctcggtggttactgggaatccagagaaaagagcagc 203
            |||| || |||||||||||||||||| ||||||||||||||||||||||||||| |||||
Sbjct: 2314 aaagctaccgacacataccgctaccttggtggttactgggaatccagagaaaagggcagc 2373

                                                                        
Query: 204  tgggaaggctgccctgacattttcggacaacttccaaacgatctaatgataactgactag 263
            ||||||||||| || || || ||||||||| |||| |||||| | |||||||||||||||
Sbjct: 2374 tgggaaggctgtccagatatcttcggacaagttcctaacgatttgatgataactgactag 2433

                                              
Query: 264  g-ttcaagtaggttacaggtcttctggttctctg 296
            | ||  ||||||||||||||||||||||||||||
Sbjct: 2434 gctttgagtaggttacaggtcttctggttctctg 2467



 Score = 44.1 bits (22), Expect = 0.59
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                          
Query: 324  tttttagtggtttatactagagcaattaaa 353
            ||||||| |||||||| |||||||||||||
Sbjct: 2504 tttttagcggtttatattagagcaattaaa 2533
to top
>dbj|AK065804.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013037L05, full
            insert sequence
          Length = 2353

 Score =  353 bits (178), Expect = 5e-94
 Identities = 251/274 (91%), Gaps = 1/274 (0%)
 Strand = Plus / Plus

                                                                        
Query: 24   tgcctagagaatggtgaatatgaaagagcaaatgctgagaagttgaggcttgagcaaaga 83
            ||||||||||||||||| ||||||||||||||||||||||||||||||||||| || |||
Sbjct: 1812 tgcctagagaatggtgagtatgaaagagcaaatgctgagaagttgaggcttgaacagaga 1871

                                                                        
Query: 84   caacggcaggcacgaaagatgcaggagagtgggtggaaacctcggtggtttgcgaaggat 143
            ||||| |||||||| |||||||||||||| ||||||||||||||||||||||| || |||
Sbjct: 1872 caacgacaggcacggaagatgcaggagagcgggtggaaacctcggtggtttgcaaaagat 1931

                                                                        
Query: 144  aaaggtagcgacacataccgctacctcggtggttactgggaatccagagaaaagagcagc 203
            |||| || |||||||||||||||||| ||||||||||||||||||||||||||| |||||
Sbjct: 1932 aaagctaccgacacataccgctaccttggtggttactgggaatccagagaaaagggcagc 1991

                                                                        
Query: 204  tgggaaggctgccctgacattttcggacaacttccaaacgatctaatgataactgactag 263
            ||||||||||| || || || ||||||||| |||| |||||| | |||||||||||||||
Sbjct: 1992 tgggaaggctgtccagatatcttcggacaagttcctaacgatttgatgataactgactag 2051

                                              
Query: 264  g-ttcaagtaggttacaggtcttctggttctctg 296
            | ||  ||||||||||||||||||||||||||||
Sbjct: 2052 gctttgagtaggttacaggtcttctggttctctg 2085
to top
>gb|AC091775.10| Oryza sativa chromosome 3 BAC OSJNBa0004G17 genomic sequence, complete
              sequence
          Length = 139074

 Score =  256 bits (129), Expect = 8e-65
 Identities = 190/209 (90%), Gaps = 1/209 (0%)
 Strand = Plus / Minus

                                                                          
Query: 89     gcaggcacgaaagatgcaggagagtgggtggaaacctcggtggtttgcgaaggataaagg 148
              ||||||||| |||||||||||||| ||||||||||||||||||||||| || ||||||| 
Sbjct: 109344 gcaggcacggaagatgcaggagagcgggtggaaacctcggtggtttgcaaaagataaagc 109285

                                                                          
Query: 149    tagcgacacataccgctacctcggtggttactgggaatccagagaaaagagcagctggga 208
              || |||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||
Sbjct: 109284 taccgacacataccgctaccttggtggttactgggaatccagagaaaagggcagctggga 109225

                                                                          
Query: 209    aggctgccctgacattttcggacaacttccaaacgatctaatgataactgactagg-ttc 267
              |||||| || || || ||||||||| |||| |||||| | |||||||||||||||| || 
Sbjct: 109224 aggctgtccagatatcttcggacaagttcctaacgatttgatgataactgactaggcttt 109165

                                           
Query: 268    aagtaggttacaggtcttctggttctctg 296
               ||||||||||||||||||||||||||||
Sbjct: 109164 gagtaggttacaggtcttctggttctctg 109136



 Score =  107 bits (54), Expect = 5e-20
 Identities = 66/70 (94%)
 Strand = Plus / Minus

                                                                          
Query: 24     tgcctagagaatggtgaatatgaaagagcaaatgctgagaagttgaggcttgagcaaaga 83
              ||||||||||||||||| ||||||||||||||||||||||||||||||||||| || |||
Sbjct: 109940 tgcctagagaatggtgagtatgaaagagcaaatgctgagaagttgaggcttgaacagaga 109881

                        
Query: 84     caacggcagg 93
              ||||| ||||
Sbjct: 109880 caacgacagg 109871



 Score = 44.1 bits (22), Expect = 0.59
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 324    tttttagtggtttatactagagcaattaaa 353
              ||||||| |||||||| |||||||||||||
Sbjct: 109099 tttttagcggtttatattagagcaattaaa 109070
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  256 bits (129), Expect = 8e-65
 Identities = 190/209 (90%), Gaps = 1/209 (0%)
 Strand = Plus / Plus

                                                                            
Query: 89       gcaggcacgaaagatgcaggagagtgggtggaaacctcggtggtttgcgaaggataaagg 148
                ||||||||| |||||||||||||| ||||||||||||||||||||||| || ||||||| 
Sbjct: 28043763 gcaggcacggaagatgcaggagagcgggtggaaacctcggtggtttgcaaaagataaagc 28043822

                                                                            
Query: 149      tagcgacacataccgctacctcggtggttactgggaatccagagaaaagagcagctggga 208
                || |||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||
Sbjct: 28043823 taccgacacataccgctaccttggtggttactgggaatccagagaaaagggcagctggga 28043882

                                                                            
Query: 209      aggctgccctgacattttcggacaacttccaaacgatctaatgataactgactagg-ttc 267
                |||||| || || || ||||||||| |||| |||||| | |||||||||||||||| || 
Sbjct: 28043883 aggctgtccagatatcttcggacaagttcctaacgatttgatgataactgactaggcttt 28043942

                                             
Query: 268      aagtaggttacaggtcttctggttctctg 296
                 ||||||||||||||||||||||||||||
Sbjct: 28043943 gagtaggttacaggtcttctggttctctg 28043971



 Score =  107 bits (54), Expect = 5e-20
 Identities = 66/70 (94%)
 Strand = Plus / Plus

                                                                            
Query: 24       tgcctagagaatggtgaatatgaaagagcaaatgctgagaagttgaggcttgagcaaaga 83
                ||||||||||||||||| ||||||||||||||||||||||||||||||||||| || |||
Sbjct: 28043167 tgcctagagaatggtgagtatgaaagagcaaatgctgagaagttgaggcttgaacagaga 28043226

                          
Query: 84       caacggcagg 93
                ||||| ||||
Sbjct: 28043227 caacgacagg 28043236



 Score = 44.1 bits (22), Expect = 0.59
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                              
Query: 324      tttttagtggtttatactagagcaattaaa 353
                ||||||| |||||||| |||||||||||||
Sbjct: 28044008 tttttagcggtttatattagagcaattaaa 28044037



 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 393      tacattgtttttccgtacat 412
                ||||||||||||||||||||
Sbjct: 20494444 tacattgtttttccgtacat 20494425
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  256 bits (129), Expect = 8e-65
 Identities = 190/209 (90%), Gaps = 1/209 (0%)
 Strand = Plus / Plus

                                                                            
Query: 89       gcaggcacgaaagatgcaggagagtgggtggaaacctcggtggtttgcgaaggataaagg 148
                ||||||||| |||||||||||||| ||||||||||||||||||||||| || ||||||| 
Sbjct: 28135087 gcaggcacggaagatgcaggagagcgggtggaaacctcggtggtttgcaaaagataaagc 28135146

                                                                            
Query: 149      tagcgacacataccgctacctcggtggttactgggaatccagagaaaagagcagctggga 208
                || |||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||
Sbjct: 28135147 taccgacacataccgctaccttggtggttactgggaatccagagaaaagggcagctggga 28135206

                                                                            
Query: 209      aggctgccctgacattttcggacaacttccaaacgatctaatgataactgactagg-ttc 267
                |||||| || || || ||||||||| |||| |||||| | |||||||||||||||| || 
Sbjct: 28135207 aggctgtccagatatcttcggacaagttcctaacgatttgatgataactgactaggcttt 28135266

                                             
Query: 268      aagtaggttacaggtcttctggttctctg 296
                 ||||||||||||||||||||||||||||
Sbjct: 28135267 gagtaggttacaggtcttctggttctctg 28135295



 Score =  107 bits (54), Expect = 5e-20
 Identities = 66/70 (94%)
 Strand = Plus / Plus

                                                                            
Query: 24       tgcctagagaatggtgaatatgaaagagcaaatgctgagaagttgaggcttgagcaaaga 83
                ||||||||||||||||| ||||||||||||||||||||||||||||||||||| || |||
Sbjct: 28134491 tgcctagagaatggtgagtatgaaagagcaaatgctgagaagttgaggcttgaacagaga 28134550

                          
Query: 84       caacggcagg 93
                ||||| ||||
Sbjct: 28134551 caacgacagg 28134560



 Score = 44.1 bits (22), Expect = 0.59
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                              
Query: 324      tttttagtggtttatactagagcaattaaa 353
                ||||||| |||||||| |||||||||||||
Sbjct: 28135332 tttttagcggtttatattagagcaattaaa 28135361



 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 393      tacattgtttttccgtacat 412
                ||||||||||||||||||||
Sbjct: 20487473 tacattgtttttccgtacat 20487454
to top
>gb|AF466646.1| Zea mays putative transposase (Z195D10.1) gene, partial cds;
             glycyl-tRNA synthetase (Z195D10.2), ornithine
             carbamoyltransferase (Z195D10.3), putative gag protein
             (Z195D10.5), putative SET-domain transcriptional regulator
             (Z195D10.7), putative oxysterol-binding protein
             (Z195D10.8), putative polyprotein (Z195D10.9), putative
             oxysterol-binding protein (Z195D10.10), putative gag-pol
             polyprotein (Z195D10.11), putative
             phosphatidylinositol-4-phosphate-5-kinase (Z195D10.12),
             hypothetical protein (Z195D10.15), putative gag-pol
             polyprotein (Z195D10.16), putative polyprotein
             (Z195D10.17), putative retrotransposon protein
             (Z195D10.18), and prpol (Z195D10.19) genes, complete cds;
             and putative teosinte branched2 (Z195D10.20) gene, partial
             cds
          Length = 141939

 Score =  228 bits (115), Expect = 2e-56
 Identities = 184/207 (88%)
 Strand = Plus / Plus

                                                                         
Query: 89    gcaggcacgaaagatgcaggagagtgggtggaaacctcggtggtttgcgaaggataaagg 148
             ||||||||||||||||||||| || || ||||| |||||||||||||| |||||||||| 
Sbjct: 63659 gcaggcacgaaagatgcaggatagcggatggaagcctcggtggtttgcaaaggataaagc 63718

                                                                         
Query: 149   tagcgacacataccgctacctcggtggttactgggaatccagagaaaagagcagctggga 208
             ||  ||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 63719 tactgacacataccgttacctcggtgggtactgggaatccagagaaaagagcagctggga 63778

                                                                         
Query: 209   aggctgccctgacattttcggacaacttccaaacgatctaatgataactgactaggttca 268
             ||||||||| ||||| ||||| |||   || |||||||| |||||| |||||||||||  
Sbjct: 63779 aggctgccccgacatcttcgggcaagaccctaacgatctgatgatagctgactaggtttg 63838

                                        
Query: 269   agtaggttacaggtcttctggttctct 295
             ||||||||| ||||||| |||||||||
Sbjct: 63839 agtaggttataggtcttttggttctct 63865



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                         
Query: 30    gagaatggtgaatatgaaagagcaaatgctgagaagttgaggcttgagcaaagacaacgg 89
             ||||| |||||||||||||| |||||||||||||||||||||||||| || | ||| |||
Sbjct: 60875 gagaaaggtgaatatgaaagggcaaatgctgagaagttgaggcttgaacagaaacagcgg 60934

                 
Query: 90    cagg 93
             ||||
Sbjct: 60935 cagg 60938
to top
>gb|AC009660.15| Homo sapiens chromosome 15, clone RP11-424J10, complete sequence
          Length = 214166

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 58    ctgagaagttgaggcttgagcaaagac 84
             |||||||| ||||||||||||||||||
Sbjct: 19032 ctgagaaggtgaggcttgagcaaagac 19058
to top
>gb|AC166653.5| Mus musculus BAC clone RP24-84J23 from chromosome 14, complete sequence
          Length = 223142

 Score = 44.1 bits (22), Expect = 0.59
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 290   ttctctgttcttcttttggaat 311
             ||||||||||||||||||||||
Sbjct: 67536 ttctctgttcttcttttggaat 67515
to top
>gb|AC166822.3| Mus musculus BAC clone RP24-117F20 from chromosome 14, complete sequence
          Length = 186860

 Score = 44.1 bits (22), Expect = 0.59
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 290    ttctctgttcttcttttggaat 311
              ||||||||||||||||||||||
Sbjct: 160238 ttctctgttcttcttttggaat 160217
to top
>gb|AC158165.1| Mus musculus BAC clone RP23-462M21 from chromosome 6, complete sequence
          Length = 179032

 Score = 44.1 bits (22), Expect = 0.59
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 290    ttctctgttcttcttttggaat 311
              ||||||||||||||||||||||
Sbjct: 121735 ttctctgttcttcttttggaat 121756
to top
>gb|AC101931.8| Mus musculus chromosome 1, clone RP24-63O23, complete sequence
          Length = 209705

 Score = 44.1 bits (22), Expect = 0.59
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 290   ttctctgttcttcttttggaat 311
             ||||||||||||||||||||||
Sbjct: 63071 ttctctgttcttcttttggaat 63050
to top
>ref|NM_128656.2| Arabidopsis thaliana oxysterol binding AT2G31020 mRNA, complete cds
          Length = 2422

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                        
Query: 60   gagaagttgaggcttgagcaaagacaacggcaggcacgaaagatgcaggagagtgggtgg 119
            |||||||||||| | || ||||||||| | |||||  || ||||||| ||||| || |||
Sbjct: 2089 gagaagttgaggttggaacaaagacaaagacaggcgagagagatgcaagagagaggttgg 2148

                 
Query: 120  aaacc 124
            |||||
Sbjct: 2149 aaacc 2153
to top
>gb|AC121298.10| Mus musculus chromosome 5, clone RP23-377E6, complete sequence
          Length = 194045

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 55    atgctgagaagttgaggcttg 75
             |||||||||||||||||||||
Sbjct: 13268 atgctgagaagttgaggcttg 13248
to top
>gb|AC151759.1| Ornithorhynchus anatinus chromosome UNK clone OABb-454P24, complete
              sequence
          Length = 147999

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 72     cttgagcaaagacaacggcag 92
              |||||||||||||||||||||
Sbjct: 147874 cttgagcaaagacaacggcag 147854
to top
>gb|AC168268.2| Mus musculus BAC clone RP23-339K12 from chromosome 17, complete
             sequence
          Length = 184085

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 29    agagaatggtgaatatgaaagagcaaatg 57
             |||||||||||| | ||||||||||||||
Sbjct: 83395 agagaatggtgagtttgaaagagcaaatg 83423
to top
>gb|AC160993.5| Mus musculus BAC clone RP23-159D11 from chromosome 16, complete sequence
          Length = 187536

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 299    cttcttttggaatctgttggttcca 323
              ||||||||||| |||||||||||||
Sbjct: 149614 cttcttttggactctgttggttcca 149638
to top
>gb|AC151667.1| Pan troglodytes chromosome X clone RP43-007H19 map human ortholog q28,
             complete sequence
          Length = 200796

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 179   ctgggaatccagagaaaagag 199
             |||||||||||||||||||||
Sbjct: 50762 ctgggaatccagagaaaagag 50742
to top
>gb|AC120413.20| Mus musculus chromosome 5, clone RP24-458L16, complete sequence
          Length = 163011

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 55    atgctgagaagttgaggcttg 75
             |||||||||||||||||||||
Sbjct: 76287 atgctgagaagttgaggcttg 76307
to top
>gb|AC145689.4| Pan troglodytes BAC clone CH251-184I22 from X, complete sequence
          Length = 181915

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 179    ctgggaatccagagaaaagag 199
              |||||||||||||||||||||
Sbjct: 165550 ctgggaatccagagaaaagag 165530
to top
>emb|CR388131.10| Zebrafish DNA sequence from clone DKEY-114G9 in linkage group 1, complete
              sequence
          Length = 169443

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 185    atccagagaaaagagcagctg 205
              |||||||||||||||||||||
Sbjct: 161186 atccagagaaaagagcagctg 161206
to top
>gb|AC125313.2| Mus musculus BAC clone RP24-353A16 from 5, complete sequence
          Length = 152433

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 55     atgctgagaagttgaggcttg 75
              |||||||||||||||||||||
Sbjct: 146602 atgctgagaagttgaggcttg 146622
to top
>gb|AC125343.2| Mus musculus BAC clone RP24-537A5 from 5, complete sequence
          Length = 131476

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 55    atgctgagaagttgaggcttg 75
             |||||||||||||||||||||
Sbjct: 90446 atgctgagaagttgaggcttg 90426
to top
>gb|AC155955.2| Xenopus tropicalis clone CH216-151P9, complete sequence
          Length = 166977

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 508   catttgtgtatatctgaatat 528
             |||||||||||||||||||||
Sbjct: 39909 catttgtgtatatctgaatat 39889
to top
>gb|AC148217.15| Medicago truncatula clone mth2-20c19, complete sequence
          Length = 113210

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 40    aatatgaaagagcaaatgctg 60
             |||||||||||||||||||||
Sbjct: 46126 aatatgaaagagcaaatgctg 46146
to top
>gb|AC087871.9| Genomic sequence for Mus musculus, clone RP23-334N23, complete sequence
          Length = 117000

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 324   tttttagtggtttatactaga 344
             |||||||||||||||||||||
Sbjct: 50396 tttttagtggtttatactaga 50376
to top
>gb|AC007846.12| Homo sapiens chromosome 17, clone CTC-803F22, complete sequence
          Length = 160034

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 297   ttcttcttttggaatctgttg 317
             |||||||||||||||||||||
Sbjct: 81347 ttcttcttttggaatctgttg 81367
to top
>gb|AC004669.3| Arabidopsis thaliana chromosome 2 clone F7F1 map m283, complete
             sequence
          Length = 89779

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                         
Query: 60    gagaagttgaggcttgagcaaagacaacggcaggcacgaaagatgcaggagagtgggtgg 119
             |||||||||||| | || ||||||||| | |||||  || ||||||| ||||| || |||
Sbjct: 78946 gagaagttgaggttggaacaaagacaaagacaggcgagagagatgcaagagagaggttgg 79005

                  
Query: 120   aaacc 124
             |||||
Sbjct: 79006 aaacc 79010
to top
>gb|AC154497.2| Mus musculus BAC clone RP24-112C15 from chromosome 17, complete
             sequence
          Length = 176161

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 29    agagaatggtgaatatgaaagagcaaatg 57
             |||||||||||| | ||||||||||||||
Sbjct: 35283 agagaatggtgagtttgaaagagcaaatg 35311
to top
>gb|AC068718.6| Homo sapiens BAC clone RP11-123G24 from 2, complete sequence
          Length = 161955

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 546   gccaaagaatagtaaagcatg 566
             |||||||||||||||||||||
Sbjct: 48684 gccaaagaatagtaaagcatg 48704
to top
>gb|U82671.5| Homo sapiens chromosome X multiple clones map q28, complete sequence
          Length = 324604

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 179    ctgggaatccagagaaaagag 199
              |||||||||||||||||||||
Sbjct: 160960 ctgggaatccagagaaaagag 160940
to top
>gb|AC117622.10| Mus musculus chromosome 5, clone RP23-114L5, complete sequence
          Length = 185368

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 55     atgctgagaagttgaggcttg 75
              |||||||||||||||||||||
Sbjct: 147087 atgctgagaagttgaggcttg 147067
to top
>emb|AL928988.14| Mouse DNA sequence from clone RP23-402M7 on chromosome 2, complete
             sequence
          Length = 121977

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 55    atgctgagaagttgaggcttg 75
             |||||||||||||||||||||
Sbjct: 50786 atgctgagaagttgaggcttg 50766
to top
>emb|BX005220.7| Zebrafish DNA sequence from clone DKEY-82D4 in linkage group 1, complete
              sequence
          Length = 170985

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 185    atccagagaaaagagcagctg 205
              |||||||||||||||||||||
Sbjct: 156647 atccagagaaaagagcagctg 156667
to top
>gb|BC072570.1| Mus musculus cDNA clone IMAGE:5719559
          Length = 4255

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 55   atgctgagaagttgaggcttg 75
            |||||||||||||||||||||
Sbjct: 1129 atgctgagaagttgaggcttg 1149
to top
>emb|CT010467.6| Mouse DNA sequence from clone RP23-81C12 on chromosome 17, complete
            sequence
          Length = 216559

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 29   agagaatggtgaatatgaaagagcaaatg 57
            |||||||||||| | ||||||||||||||
Sbjct: 9878 agagaatggtgagtttgaaagagcaaatg 9850
to top
>gb|AC165972.4| Mus musculus BAC clone RP23-87D12 from chromosome 17, complete sequence
          Length = 199737

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 512   tgtgtatatctgaatatgta 531
             ||||||||||||||||||||
Sbjct: 27768 tgtgtatatctgaatatgta 27749
to top
>gb|CP000141.1| Carboxydothermus hydrogenoformans Z-2901, complete genome
          Length = 2401520

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 636    ttttgcccttgaaaaattaa 655
              ||||||||||||||||||||
Sbjct: 123088 ttttgcccttgaaaaattaa 123069
to top
>gb|AC150653.5| Bos taurus  BAC CH240-226L9 (Children's Hospital Oakland Research
             Institute Bovine BAC Library (male)) complete sequence
          Length = 158246

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 499   tatataggccatttgtgtat 518
             ||||||||||||||||||||
Sbjct: 54706 tatataggccatttgtgtat 54687
to top
>gb|AC150694.2| Bos taurus  BAC CH240-144A17 (Children's Hospital Oakland Research
             Institute Bovine BAC Library (male)) complete sequence
          Length = 163920

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 499   tatataggccatttgtgtat 518
             ||||||||||||||||||||
Sbjct: 15451 tatataggccatttgtgtat 15470
to top
>gb|AC090900.3| Drosophila melanogaster clone BACR30C07, complete sequence
          Length = 186286

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 379   gctgccctttcagatacattgtttttcc 406
             |||||||  |||||||||||||||||||
Sbjct: 55276 gctgcccaatcagatacattgtttttcc 55303
to top
>gb|AC127361.4| Mus musculus BAC clone RP23-125M8 from chromosome 17, complete sequence
          Length = 201331

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 292    ctctgttcttcttttggaat 311
              ||||||||||||||||||||
Sbjct: 155762 ctctgttcttcttttggaat 155743
to top
>gb|AC154605.2| Mus musculus BAC clone RP23-348G3 from chromosome 16, complete sequence
          Length = 191050

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 292   ctctgttcttcttttggaat 311
             ||||||||||||||||||||
Sbjct: 68576 ctctgttcttcttttggaat 68557
to top
>gb|AC004002.1| Homo sapiens BAC clone CTA-356F9 from 7, complete sequence
          Length = 112314

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 633    tcattttgcccttgaaaaat 652
              ||||||||||||||||||||
Sbjct: 105054 tcattttgcccttgaaaaat 105035
to top
>gb|BC056062.1| Xenopus laevis chronic myelogenous leukemia tumor antigen 66, mRNA
           (cDNA clone MGC:69032 IMAGE:4964693), complete cds
          Length = 2026

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 29  agagaatggtgaatatgaaa 48
           ||||||||||||||||||||
Sbjct: 733 agagaatggtgaatatgaaa 752
to top
>gb|AC145864.2| Pan troglodytes BAC clone RP43-6L18 from 7, complete sequence
          Length = 206128

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 633   tcattttgcccttgaaaaat 652
             ||||||||||||||||||||
Sbjct: 88235 tcattttgcccttgaaaaat 88216
to top
>gb|AC091302.5| Oryza sativa chromosome 3 BAC OSJNBb0015I21 genomic sequence,
            complete sequence
          Length = 101073

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 393  tacattgtttttccgtacat 412
            ||||||||||||||||||||
Sbjct: 8509 tacattgtttttccgtacat 8490
to top
>gb|AC146588.14| Medicago truncatula clone mth2-145c3, complete sequence
          Length = 116965

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 41     atatgaaagagcaaatgctg 60
              ||||||||||||||||||||
Sbjct: 107340 atatgaaagagcaaatgctg 107321
to top
>emb|AL583806.7| Human DNA sequence from clone RP11-10F17 on chromosome 6 Contains the
             C6orf58 gene and the 5' end of a novel gene, complete
             sequence
          Length = 114100

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 29    agagaatggtgaatatgaaa 48
             ||||||||||||||||||||
Sbjct: 37538 agagaatggtgaatatgaaa 37519
to top
>gb|AC164578.5| Mus musculus  BAC RP23-15E20 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 225564

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 297    ttcttcttttggaatctgtt 316
              ||||||||||||||||||||
Sbjct: 166608 ttcttcttttggaatctgtt 166627
to top
>emb|AL161571.2|ATCHRIV67 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 67
          Length = 200001

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 596    atatctcttatcaatctatggcat 619
              ||||||||||||| ||||||||||
Sbjct: 105507 atatctcttatcagtctatggcat 105530
to top
>emb|AL035602.1|ATT29A15 Arabidopsis thaliana DNA chromosome 4, BAC clone T29A15 (ESSA project)
          Length = 95679

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 596   atatctcttatcaatctatggcat 619
             ||||||||||||| ||||||||||
Sbjct: 44797 atatctcttatcagtctatggcat 44820
to top
>gb|AC108709.3| Homo sapiens 3 BAC RP11-81P15 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 179223

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 643   cttgaaaaattaatttaaac 662
             ||||||||||||||||||||
Sbjct: 48647 cttgaaaaattaatttaaac 48666
to top
>gb|AC101690.7| Mus musculus chromosome 7, clone RP23-218E6, complete sequence
          Length = 229964

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 107   ggagagtgggtggaaacctc 126
             ||||||||||||||||||||
Sbjct: 12287 ggagagtgggtggaaacctc 12268
to top
>gb|AC009930.7| Homo sapiens chromosome 8, clone RP11-114O8, complete sequence
          Length = 165662

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 292   ctctgttcttcttttggaat 311
             ||||||||||||||||||||
Sbjct: 83023 ctctgttcttcttttggaat 83042
to top
>gb|AC084823.11| Mus Musculus Strain C57BL6/J chromosome 8 BAC, RP23-290L7, Complete
              Sequence, complete sequence
          Length = 212133

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 196    agagcagctgggaaggctgc 215
              ||||||||||||||||||||
Sbjct: 182756 agagcagctgggaaggctgc 182775
to top
>gb|AC037426.12| Oryza sativa chromosome 10 BAC OSJNBb0014I11 genomic sequence, complete
             sequence
          Length = 135510

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 90    caggcacgaaagatgcaggagagtgggtggaa 121
             |||||| | ||||||||||||||||| |||||
Sbjct: 99266 caggcaaggaagatgcaggagagtggttggaa 99235
to top
>gb|AC023577.6| Homo sapiens chromosome 18, clone RP11-645D5, complete sequence
          Length = 166503

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 550   aagaatagtaaagcatgcat 569
             ||||||||||||||||||||
Sbjct: 76345 aagaatagtaaagcatgcat 76326
to top
>dbj|AK163197.1| Mus musculus 7 days neonate cerebellum cDNA, RIKEN full-length
            enriched library, clone:A730084F04
            product:unclassifiable, full insert sequence
          Length = 2337

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 47   aagagcaaatgctgagaagt 66
            ||||||||||||||||||||
Sbjct: 2252 aagagcaaatgctgagaagt 2271
to top
>emb|CR338865.2| Gallus gallus finished cDNA, clone ChEST1020f23
          Length = 893

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 497 gttatataggccatttgtgt 516
           ||||||||||||||||||||
Sbjct: 300 gttatataggccatttgtgt 281
to top
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                                
Query: 90       caggcacgaaagatgcaggagagtgggtggaa 121
                |||||| | ||||||||||||||||| |||||
Sbjct: 21235093 caggcaaggaagatgcaggagagtggttggaa 21235124
to top
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 393      tacattgtttttccgtacat 412
                ||||||||||||||||||||
Sbjct: 15942869 tacattgtttttccgtacat 15942888
to top
>gb|AC100735.15| Mus musculus chromosome 7, clone RP24-331F7, complete sequence
          Length = 179974

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 107    ggagagtgggtggaaacctc 126
              ||||||||||||||||||||
Sbjct: 173486 ggagagtgggtggaaacctc 173467
to top
>gb|AC084319.5|AC084319 Oryza sativa chromosome 3 BAC OSJNBa0004B24 genomic sequence, complete
              sequence
          Length = 152883

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 393    tacattgtttttccgtacat 412
              ||||||||||||||||||||
Sbjct: 138744 tacattgtttttccgtacat 138725
to top
>gb|AC129918.10| Homo sapiens chromosome 8, clone CTD-2132E17, complete sequence
          Length = 142854

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 626    tgcagtttcattttgcccttgaaa 649
              ||||||||||||||||||| ||||
Sbjct: 104394 tgcagtttcattttgccctggaaa 104371
to top
>gb|AC104946.4| Homo sapiens chromosome 8, clone RP11-946L20, complete sequence
          Length = 200292

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 292  ctctgttcttcttttggaat 311
            ||||||||||||||||||||
Sbjct: 4767 ctctgttcttcttttggaat 4786
to top
>dbj|AP004131.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1057_F01
          Length = 120026

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 393   tacattgtttttccgtacat 412
             ||||||||||||||||||||
Sbjct: 86544 tacattgtttttccgtacat 86563
to top
>gb|AE003812.4| Drosophila melanogaster chromosome 2R, section 38 of 73 of the complete
              sequence
          Length = 255772

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 379    gctgccctttcagatacattgtttttcc 406
              |||||||  |||||||||||||||||||
Sbjct: 180133 gctgcccaatcagatacattgtttttcc 180160
to top
>emb|AL162252.17| Human DNA sequence from clone RP11-55J24 on chromosome 9, complete
              sequence
          Length = 176845

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 642    ccttgaaaaattaatttaaa 661
              ||||||||||||||||||||
Sbjct: 146108 ccttgaaaaattaatttaaa 146089
to top
>gb|AE015451.1| Pseudomonas putida KT2440 complete genome
          Length = 6181863

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 309     aatctgttggttccattttt 328
               ||||||||||||||||||||
Sbjct: 5976033 aatctgttggttccattttt 5976052
to top
>gb|AC159275.6| Mus musculus BAC clone RP23-367C13 from chromosome 8, complete sequence
          Length = 195034

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 292    ctctgttcttcttttggaat 311
              ||||||||||||||||||||
Sbjct: 103637 ctctgttcttcttttggaat 103656
to top
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                                
Query: 90       caggcacgaaagatgcaggagagtgggtggaa 121
                |||||| | ||||||||||||||||| |||||
Sbjct: 21246357 caggcaaggaagatgcaggagagtggttggaa 21246388
to top
>gb|AC004306.1|AC004306 Drosophila melanogaster DNA sequence (P1 DS01386 (D198)), complete
             sequence
          Length = 61849

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 379   gctgccctttcagatacattgtttttcc 406
             |||||||  |||||||||||||||||||
Sbjct: 15750 gctgcccaatcagatacattgtttttcc 15777
to top
>gb|M79353.1|HIVENVMA7 Human immunodeficiency virus type 1 (clone MA7) glycoprotein 120
           (env) gene, 5' end
          Length = 1566

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 35  tggtgaatatgaaagagcaa 54
           ||||||||||||||||||||
Sbjct: 499 tggtgaatatgaaagagcaa 480
to top
>emb|AL603837.8| Mouse DNA sequence from clone RP23-254F2 on chromosome 15, complete
              sequence
          Length = 202904

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 196    agagcagctgggaaggctgc 215
              ||||||||||||||||||||
Sbjct: 194103 agagcagctgggaaggctgc 194122
to top
>gb|AC164983.2| Mus musculus BAC clone RP23-16J24 from chromosome 17, complete sequence
          Length = 224370

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 512   tgtgtatatctgaatatgta 531
             ||||||||||||||||||||
Sbjct: 95860 tgtgtatatctgaatatgta 95841
to top
>emb|AL731811.24| Mouse DNA sequence from clone RP23-60A1 on chromosome X, complete
              sequence
          Length = 167102

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 47     aagagcaaatgctgagaagt 66
              ||||||||||||||||||||
Sbjct: 148019 aagagcaaatgctgagaagt 148000


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,345,515
Number of Sequences: 3902068
Number of extensions: 6345515
Number of successful extensions: 135830
Number of sequences better than 10.0: 76
Number of HSP's better than 10.0 without gapping: 78
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 135393
Number of HSP's gapped (non-prelim): 432
length of query: 672
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 649
effective length of database: 17,143,297,704
effective search space: 11126000209896
effective search space used: 11126000209896
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top