ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name basd0b09
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|U43493.1|HVU43493 Hordeum vulgare ribulose-1,5-bisphosphate c... 48 7e-04
2emb|X00235.1|TARUB2 Wheat mRNA fragment for small subunit precur... 48 7e-04
3emb|X00234.1|TARUB1 Wheat mRNA fragment for small subunit precur... 48 7e-04
4emb|AJ131738.1|SCE131738 Secale cereale mRNA for hypothetical pr... 48 7e-04
5dbj|AB042066.1| Triticum aestivum rbcS gene for ribulose-1,5-bis... 48 7e-04
6dbj|AB042064.1| Triticum aestivum rbcS gene for ribulose-1,5-bis... 48 7e-04
7emb|X83095.1|ASRBCSSS A.squarrosa mRNA for ribulose-1,5-bisphosp... 42 0.043
8emb|AJ131737.1|SCE131737 Secale cereale mRNA for hypothetical pr... 42 0.043
9gb|M37328.1|WHTRUBIAA T.aestivum ribulose-1,5-bisphosphate carbo... 42 0.043
10dbj|AB020959.1| Secale cereale DNA for ribulose-1,5-bisphosphate... 42 0.043
11dbj|AB020958.1| Triticum aestivum DNA for ribulose-1,5-bisphosph... 42 0.043
12dbj|AB020955.1| Triticum timopheevii subsp. armeniacum DNA for r... 42 0.043
13dbj|AB020954.1| Triticum urartu DNA for ribulose-1,5-bisphosphat... 42 0.043
14dbj|AB020953.1| Aegilops squarrosa DNA for ribulose-1,5-bisphosp... 42 0.043
15dbj|AB020952.1| Aegilops searsii DNA for ribulose-1,5-bisphospha... 42 0.043
16dbj|AB020951.1| Aegilops bicornis DNA for ribulose-1,5-bisphosph... 42 0.043
17dbj|AB020950.1| Aegilops sharonensis DNA for ribulose-1,5-bispho... 42 0.043
18dbj|AB020949.1| Aegilops longissima DNA for ribulose-1,5-bisphos... 42 0.043
19dbj|AB020947.1| Aegilops speltoides DNA for ribulose-1,5-bisphos... 42 0.043
20dbj|AB020946.1| Aegilops speltoides DNA for ribulose-1,5-bisphos... 42 0.043
21dbj|AB020944.1| Agropyron intermedium DNA for ribulose-1,5-bisph... 42 0.043
22dbj|AB020943.1| Hordeum vulgare DNA for ribulose-1,5-bisphosphat... 42 0.043
23dbj|AB020941.1| Triticum aestivum DNA for ribulose-1,5-bisphosph... 42 0.043
24dbj|AB020940.1| Triticum turgidum subsp. dicoccoides DNA for rib... 42 0.043
25dbj|AB020936.1| Aegilops bicornis DNA for ribulose-1,5-bisphosph... 42 0.043
26dbj|AB020934.1| Aegilops longissima DNA for ribulose-1,5-bisphos... 42 0.043
27dbj|AB020933.1| Aegilops longissima DNA for ribulose-1,5-bisphos... 42 0.043
28dbj|AB020932.1| Aegilops longissima DNA for ribulose-1,5-bisphos... 42 0.043
29dbj|AB042069.1| Triticum aestivum rbcS gene for ribulose-1,5-bis... 42 0.043
30dbj|AB042067.1| Triticum aestivum rbcS gene for ribulose-1,5-bis... 42 0.043
31dbj|AB042065.1| Triticum aestivum rbcS gene for ribulose-1,5-bis... 42 0.043 
>gb|U43493.1|HVU43493 Hordeum vulgare ribulose-1,5-bisphosphate carboxylase small subunit
           mRNA, complete cds
          Length = 816

 Score = 48.1 bits (24), Expect = 7e-04
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 1   ctacctgatncgctncaagtgggtgccttg 30
           ||||||||| |||| |||||||||||||||
Sbjct: 254 ctacctgatccgctccaagtgggtgccttg 283
to top
>emb|X00235.1|TARUB2 Wheat mRNA fragment for small subunit precursor of RuBPCase (EC
           4.1.1.39 ribulosebisphosphate carboxylase) clones 234
           and 406
          Length = 743

 Score = 48.1 bits (24), Expect = 7e-04
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 1   ctacctgatncgctncaagtgggtgccttg 30
           ||||||||| |||| |||||||||||||||
Sbjct: 199 ctacctgatccgctccaagtgggtgccttg 228
to top
>emb|X00234.1|TARUB1 Wheat mRNA fragment for small subunit precursor of RuBPCase (EC
          4.1.1.39) (ribulosebisphosphate carboxylase, clone 512)
          Length = 611

 Score = 48.1 bits (24), Expect = 7e-04
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                        
Query: 1  ctacctgatncgctncaagtgggtgccttg 30
          ||||||||| |||| |||||||||||||||
Sbjct: 48 ctacctgatccgctccaagtgggtgccttg 77
to top
>emb|AJ131738.1|SCE131738 Secale cereale mRNA for hypothetical protein, clone 9
          Length = 875

 Score = 48.1 bits (24), Expect = 7e-04
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 1   ctacctgatncgctncaagtgggtgccttg 30
           ||||||||| |||| |||||||||||||||
Sbjct: 320 ctacctgatccgctccaagtgggtgccttg 349
to top
>dbj|AB042066.1| Triticum aestivum rbcS gene for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, complete cds,
           clone:p9-1
          Length = 739

 Score = 48.1 bits (24), Expect = 7e-04
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 1   ctacctgatncgctncaagtgggtgccttg 30
           ||||||||| |||| |||||||||||||||
Sbjct: 445 ctacctgatccgctccaagtgggtgccttg 474
to top
>dbj|AB042064.1| Triticum aestivum rbcS gene for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, complete cds,
           clone:p2-1
          Length = 653

 Score = 48.1 bits (24), Expect = 7e-04
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 1   ctacctgatncgctncaagtgggtgccttg 30
           ||||||||| |||| |||||||||||||||
Sbjct: 359 ctacctgatccgctccaagtgggtgccttg 388
to top
>emb|X83095.1|ASRBCSSS A.squarrosa mRNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase, small subunit
          Length = 837

 Score = 42.1 bits (21), Expect = 0.043
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 1   ctacctgatncgctncaagtgggtgcc 27
           ||||||||| |||| ||||||||||||
Sbjct: 280 ctacctgatccgctccaagtgggtgcc 306
to top
>emb|AJ131737.1|SCE131737 Secale cereale mRNA for hypothetical protein, clone 5
          Length = 845

 Score = 42.1 bits (21), Expect = 0.043
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 1   ctacctgatncgctncaagtgggtgcc 27
           ||||||||| |||| ||||||||||||
Sbjct: 301 ctacctgatccgctccaagtgggtgcc 327
to top
>gb|M37328.1|WHTRUBIAA T.aestivum ribulose-1,5-bisphosphate carboxylase/oxygenase (RUBISCO)
            gene, exons 1 and 2
          Length = 2205

 Score = 42.1 bits (21), Expect = 0.043
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                       
Query: 1    ctacctgatncgctncaagtgggtgcc 27
            ||||||||| |||| ||||||||||||
Sbjct: 1215 ctacctgatccgctccaagtgggtgcc 1241
to top
>dbj|AB020959.1| Secale cereale DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Sec-B
          Length = 789

 Score = 42.1 bits (21), Expect = 0.043
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 1   ctacctgatncgctncaagtgggtgcc 27
           ||||||||| |||| ||||||||||||
Sbjct: 511 ctacctgatccgctccaagtgggtgcc 537
to top
>dbj|AB020958.1| Triticum aestivum DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           CS-B2
          Length = 781

 Score = 42.1 bits (21), Expect = 0.043
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 1   ctacctgatncgctncaagtgggtgcc 27
           ||||||||| |||| ||||||||||||
Sbjct: 503 ctacctgatccgctccaagtgggtgcc 529
to top
>dbj|AB020955.1| Triticum timopheevii subsp. armeniacum DNA for
           ribulose-1,5-bisphosphate carboxylase/oxygenase small
           subunit, partial cds, clone Ara-B
          Length = 787

 Score = 42.1 bits (21), Expect = 0.043
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 1   ctacctgatncgctncaagtgggtgcc 27
           ||||||||| |||| ||||||||||||
Sbjct: 509 ctacctgatccgctccaagtgggtgcc 535
to top
>dbj|AB020954.1| Triticum urartu DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Ura-B
          Length = 787

 Score = 42.1 bits (21), Expect = 0.043
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 1   ctacctgatncgctncaagtgggtgcc 27
           ||||||||| |||| ||||||||||||
Sbjct: 509 ctacctgatccgctccaagtgggtgcc 535
to top
>dbj|AB020953.1| Aegilops squarrosa DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Squ-B
          Length = 781

 Score = 42.1 bits (21), Expect = 0.043
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 1   ctacctgatncgctncaagtgggtgcc 27
           ||||||||| |||| ||||||||||||
Sbjct: 503 ctacctgatccgctccaagtgggtgcc 529
to top
>dbj|AB020952.1| Aegilops searsii DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Sea-B
          Length = 728

 Score = 42.1 bits (21), Expect = 0.043
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 1   ctacctgatncgctncaagtgggtgcc 27
           ||||||||| |||| ||||||||||||
Sbjct: 450 ctacctgatccgctccaagtgggtgcc 476
to top
>dbj|AB020951.1| Aegilops bicornis DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Bic-B
          Length = 783

 Score = 42.1 bits (21), Expect = 0.043
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 1   ctacctgatncgctncaagtgggtgcc 27
           ||||||||| |||| ||||||||||||
Sbjct: 510 ctacctgatccgctccaagtgggtgcc 536
to top
>dbj|AB020950.1| Aegilops sharonensis DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Sha-B
          Length = 792

 Score = 42.1 bits (21), Expect = 0.043
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 1   ctacctgatncgctncaagtgggtgcc 27
           ||||||||| |||| ||||||||||||
Sbjct: 514 ctacctgatccgctccaagtgggtgcc 540
to top
>dbj|AB020949.1| Aegilops longissima DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Lon-B
          Length = 792

 Score = 42.1 bits (21), Expect = 0.043
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 1   ctacctgatncgctncaagtgggtgcc 27
           ||||||||| |||| ||||||||||||
Sbjct: 514 ctacctgatccgctccaagtgggtgcc 540
to top
>dbj|AB020947.1| Aegilops speltoides DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Spe2-B
          Length = 738

 Score = 42.1 bits (21), Expect = 0.043
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 1   ctacctgatncgctncaagtgggtgcc 27
           ||||||||| |||| ||||||||||||
Sbjct: 494 ctacctgatccgctccaagtgggtgcc 520
to top
>dbj|AB020946.1| Aegilops speltoides DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Spe1-B
          Length = 787

 Score = 42.1 bits (21), Expect = 0.043
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 1   ctacctgatncgctncaagtgggtgcc 27
           ||||||||| |||| ||||||||||||
Sbjct: 509 ctacctgatccgctccaagtgggtgcc 535
to top
>dbj|AB020944.1| Agropyron intermedium DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Agr-A
          Length = 604

 Score = 42.1 bits (21), Expect = 0.043
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 1   ctacctgatncgctncaagtgggtgcc 27
           ||||||||| |||| ||||||||||||
Sbjct: 326 ctacctgatccgctccaagtgggtgcc 352
to top
>dbj|AB020943.1| Hordeum vulgare DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Hor-A
          Length = 605

 Score = 42.1 bits (21), Expect = 0.043
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 1   ctacctgatncgctncaagtgggtgcc 27
           ||||||||| |||| ||||||||||||
Sbjct: 327 ctacctgatccgctccaagtgggtgcc 353
to top
>dbj|AB020941.1| Triticum aestivum DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           CS-A
          Length = 605

 Score = 42.1 bits (21), Expect = 0.043
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 1   ctacctgatncgctncaagtgggtgcc 27
           ||||||||| |||| ||||||||||||
Sbjct: 327 ctacctgatccgctccaagtgggtgcc 353
to top
>dbj|AB020940.1| Triticum turgidum subsp. dicoccoides DNA for
           ribulose-1,5-bisphosphate carboxylase/oxygenase small
           subunit, partial cds, clone Dic-A
          Length = 605

 Score = 42.1 bits (21), Expect = 0.043
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 1   ctacctgatncgctncaagtgggtgcc 27
           ||||||||| |||| ||||||||||||
Sbjct: 327 ctacctgatccgctccaagtgggtgcc 353
to top
>dbj|AB020936.1| Aegilops bicornis DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Bic-A
          Length = 605

 Score = 42.1 bits (21), Expect = 0.043
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 1   ctacctgatncgctncaagtgggtgcc 27
           ||||||||| |||| ||||||||||||
Sbjct: 327 ctacctgatccgctccaagtgggtgcc 353
to top
>dbj|AB020934.1| Aegilops longissima DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Lon-A3
          Length = 605

 Score = 42.1 bits (21), Expect = 0.043
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 1   ctacctgatncgctncaagtgggtgcc 27
           ||||||||| |||| ||||||||||||
Sbjct: 327 ctacctgatccgctccaagtgggtgcc 353
to top
>dbj|AB020933.1| Aegilops longissima DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Lon-A2
          Length = 605

 Score = 42.1 bits (21), Expect = 0.043
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 1   ctacctgatncgctncaagtgggtgcc 27
           ||||||||| |||| ||||||||||||
Sbjct: 327 ctacctgatccgctccaagtgggtgcc 353
to top
>dbj|AB020932.1| Aegilops longissima DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Lon-A1
          Length = 605

 Score = 42.1 bits (21), Expect = 0.043
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 1   ctacctgatncgctncaagtgggtgcc 27
           ||||||||| |||| ||||||||||||
Sbjct: 327 ctacctgatccgctccaagtgggtgcc 353
to top
>dbj|AB042069.1| Triticum aestivum rbcS gene for ribulose-1,5-bisphosphate
            carboxylase/oxygenase small subunit, complete cds,
            clone:6, subclone:16
          Length = 5980

 Score = 42.1 bits (21), Expect = 0.043
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                       
Query: 1    ctacctgatncgctncaagtgggtgcc 27
            ||||||||| |||| ||||||||||||
Sbjct: 5373 ctacctgatccgctccaagtgggtgcc 5399



 Score = 42.1 bits (21), Expect = 0.043
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 1   ctacctgatncgctncaagtgggtgcc 27
           ||||||||| |||| ||||||||||||
Sbjct: 969 ctacctgatccgctccaagtgggtgcc 995
to top
>dbj|AB042067.1| Triticum aestivum rbcS gene for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, complete cds,
           clone:p10-1
          Length = 629

 Score = 42.1 bits (21), Expect = 0.043
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 1   ctacctgatncgctncaagtgggtgcc 27
           ||||||||| |||| ||||||||||||
Sbjct: 335 ctacctgatccgctccaagtgggtgcc 361
to top
>dbj|AB042065.1| Triticum aestivum rbcS gene for ribulose-1,5-bisphosphate
           carboxylase/oxygenase Small subunit, complete cds,
           clone:p6-1
          Length = 638

 Score = 42.1 bits (21), Expect = 0.043
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 1   ctacctgatncgctncaagtgggtgcc 27
           ||||||||| |||| ||||||||||||
Sbjct: 344 ctacctgatccgctccaagtgggtgcc 370


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 32,976
Number of Sequences: 3902068
Number of extensions: 32976
Number of successful extensions: 6076
Number of sequences better than 10.0: 31
Number of HSP's better than 10.0 without gapping: 31
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 6044
Number of HSP's gapped (non-prelim): 32
length of query: 32
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 12
effective length of database: 17,155,003,908
effective search space: 205860046896
effective search space used: 205860046896
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)
to top