>gb|AC165162.4| Mus musculus BAC clone RP23-173L24 from chromosome 3, complete sequence
          Length = 211699

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 6      ccacactgataacagttaat 25
              ||||||||||||||||||||
Sbjct: 129679 ccacactgataacagttaat 129660

>gb|AC120000.17| Mus musculus chromosome 3, clone RP24-133F9, complete sequence
          Length = 149389

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 6     ccacactgataacagttaat 25
             ||||||||||||||||||||
Sbjct: 10865 ccacactgataacagttaat 10884

>emb|Z98946.15|HS376D21 Human DNA sequence from clone RP3-376D21 on chromosome Xq11.1-12
             Contains the MSN gene for Moesin and a CpG island,
             complete sequence
          Length = 149671

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 77    tacacatacaggttctaca 95
             |||||||||||||||||||
Sbjct: 60711 tacacatacaggttctaca 60729

>gb|AC090605.7| Homo sapiens chromosome 15, clone RP11-261P5, complete sequence
          Length = 166870

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 26     agcctctggaaagcatatt 44
              |||||||||||||||||||
Sbjct: 156463 agcctctggaaagcatatt 156445

>gb|AC105123.4| Homo sapiens chromosome 15, clone RP11-94B17, complete sequence
          Length = 134569

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 26    agcctctggaaagcatatt 44
             |||||||||||||||||||
Sbjct: 34068 agcctctggaaagcatatt 34050

>gb|AC068601.8|AC068601 Homo sapiens BAC clone RP11-1067I16 from Y, complete sequence
          Length = 75756

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 5     gccacactgataacagtta 23
             |||||||||||||||||||
Sbjct: 46235 gccacactgataacagtta 46253

>gb|AC007562.4|AC007562 Homo sapiens BAC clone RP11-497C14 from Y, complete sequence
          Length = 137077

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 5      gccacactgataacagtta 23
              |||||||||||||||||||
Sbjct: 129794 gccacactgataacagtta 129776

>ref|NG_004755.1| Homo sapiens chromosome Y palindromes P1, P2, P3 and inverted repeat IR2
               (P1-P2-P3-IR2@) on chromosome Y
          Length = 4538292

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 5       gccacactgataacagtta 23
               |||||||||||||||||||
Sbjct: 3829714 gccacactgataacagtta 3829696



 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 5       gccacactgataacagtta 23
               |||||||||||||||||||
Sbjct: 2218648 gccacactgataacagtta 2218666


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 640,388
Number of Sequences: 3902068
Number of extensions: 640388
Number of successful extensions: 42497
Number of sequences better than 10.0: 8
Number of HSP's better than 10.0 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 42464
Number of HSP's gapped (non-prelim): 33
length of query: 108
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 87
effective length of database: 17,151,101,840
effective search space: 1492145860080
effective search space used: 1492145860080
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)