ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd26c13
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1emb|X68654.1|HVCW21 H.vulgare Cw-21 mRNA 375 e-101
2emb|Z66529.1|HVGLTP4X9 H.vulgare Ltp4.2 gene 319 2e-84
3gb|U63993.1|HVU63993 Hordeum vulgare lipid transfer protein (blt... 319 2e-84
4emb|Z66528.1|HVGLTP4X3 H.vulgare ltp4.3 gene 315 3e-83
5emb|Z37115.1|HVLTPPB H.vulgare (clone pKG285) mRNA for lipid tra... 307 8e-81
6gb|U18127.1|HVU18127 Hordeum vulgare phospholipid transfer prote... 256 2e-65
7emb|AJ852555.1| Triticum aestivum ltp9.2c gene for type 1 non sp... 208 5e-51
8emb|AJ784903.1| Triticum turgidum subsp. durum partial mRNA for ... 200 1e-48
9emb|AJ784901.1| Triticum aestivum mRNA for type 1 non-specific l... 184 7e-44
10emb|AJ852556.1| Triticum aestivum ltp9.2d gene for type 1 non sp... 184 7e-44
11gb|DQ465676.1| Triticum aestivum clone Lt10F9 non-specific lipid... 176 2e-41
12gb|DQ465678.1| Triticum aestivum clone Lt10E10 non-specific lipi... 176 2e-41
13gb|DQ465679.1| Triticum aestivum clone Lt19C10 non-specific lipi... 176 2e-41
14emb|X68656.1|HVCW19 H.vulgare Cw-19 mRNA 119 4e-24
15gb|AY566607.1| Triticum aestivum lipid transfer protein (LPT1) g... 105 6e-20
16gb|AF302788.1|AF302788 Triticum aestivum lipid transfer protein ... 105 6e-20
17gb|AY796184.1| Triticum aestivum lipid transfer protein (LTP1) m... 103 2e-19
18gb|DQ465677.1| Triticum aestivum clone Lt10B6 non-specific lipid... 103 2e-19
19gb|AC135561.3| Oryza sativa (japonica cultivar-group) chromosome... 96 5e-17
20dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 96 5e-17
21dbj|AK071260.1| Oryza sativa (japonica cultivar-group) cDNA clon... 96 5e-17
22dbj|AK061288.1| Oryza sativa (japonica cultivar-group) cDNA clon... 96 5e-17
23gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 96 5e-17
24dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 92 8e-16
25emb|Y08691.1|OSLPI O.sativa mRNA for lipid transfer protein 92 8e-16
26emb|X83435.1|OSLTPA15 O.sativa mRNA for lipid transfer protein, a15 92 8e-16
27dbj|AK059808.1| Oryza sativa (japonica cultivar-group) cDNA clon... 92 8e-16
28gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 92 8e-16
29emb|BX000511.2|CNS08CE1 Oryza sativa chromosome 12, . BAC OJ1136... 92 8e-16
30gb|U77295.1|OSU77295 Oryza sativa lipid transfer protein (LTP) m... 92 8e-16
31gb|AY335485.1| Oryza sativa (japonica cultivar-group) lipid tran... 84 2e-13
32gb|AF334185.1|AF334185 Triticum aestivum lipid transfer protein ... 84 2e-13
33dbj|AK070414.1| Oryza sativa (japonica cultivar-group) cDNA clon... 84 2e-13
34dbj|AK058805.1| Oryza sativa (japonica cultivar-group) cDNA clon... 84 2e-13
35emb|AJ852557.1| Triticum aestivum ltp9.5b gene for type 1 non sp... 84 2e-13
36emb|BX000512.1|CNS08CE2 Oryza sativa chromosome 11, . BAC OSJNBa... 84 2e-13
37gb|AY754742.1| Triticum aestivum lipid transfer protein (LTP2) m... 82 8e-13
38emb|X56547.1|HSBLT4 H. vulgare BLT4 mRNA 76 5e-11
39dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 76 5e-11
40dbj|AP004134.3| Oryza sativa (japonica cultivar-group) genomic D... 76 5e-11
41gb|AF017361.1|AF017361 Oryza sativa lipid transfer protein LPT I... 76 5e-11
42gb|AF017360.1|AF017360 Oryza sativa lipid transfer protein LPT I... 76 5e-11
43emb|X71669.1|SVTLP1R S.vulgare ltp1 mRNA 72 8e-10
44emb|X71667.1|SVLTP1 S.vulgare ltp1 gene 72 8e-10
45emb|Z37114.1|HVLTPPA H.vulgare (clone pKG2316) mRNA for lipid tr... 70 3e-09
46gb|AY327042.1| Oryza sativa (japonica cultivar-group) lipid tran... 68 1e-08
47emb|Z23271.1|OSLPTPRA O.sativa lipid transfer protein gene, comp... 68 1e-08
48emb|X83434.1|OSLTPB1 O.sativa mRNA for lipid transfer protein, b1 68 1e-08
49dbj|AK104981.1| Oryza sativa (japonica cultivar-group) cDNA clon... 68 1e-08
50dbj|AK102455.1| Oryza sativa (japonica cultivar-group) cDNA clon... 68 1e-08
51dbj|AK073466.1| Oryza sativa (japonica cultivar-group) cDNA clon... 68 1e-08
52dbj|AK063683.1| Oryza sativa (japonica cultivar-group) cDNA clon... 68 1e-08
53dbj|AK059819.1| Oryza sativa (japonica cultivar-group) cDNA clon... 68 1e-08
54dbj|AK058896.1| Oryza sativa (japonica cultivar-group) cDNA clon... 68 1e-08
55gb|AF017359.1|AF017359 Oryza sativa lipid transfer protein LPT I... 68 1e-08
56gb|AF017358.1|AF017358 Oryza sativa lipid transfer protein mRNA,... 66 5e-08
57gb|BT018347.1| Zea mays clone EL01T0403E02.c mRNA sequence 64 2e-07
58emb|X71668.1|SVLTP2 S.vulgare ltp2 gene 64 2e-07
59dbj|AK107447.1| Oryza sativa (japonica cultivar-group) cDNA clon... 64 2e-07
60gb|U66105.1|ZMU66105 Zea mays phospholipid transfer protein mRNA... 64 2e-07
61gb|DQ147213.1| Zea diploperennis isolate d7B phospholipid transf... 64 2e-07
62gb|DQ147210.1| Zea diploperennis isolate d4 phospholipid transfe... 64 2e-07
63gb|DQ147209.1| Zea diploperennis isolate d4a phospholipid transf... 64 2e-07
64gb|DQ147205.1| Zea mays subsp. parviglumis isolate p15 phospholi... 64 2e-07
65gb|DQ147204.1| Zea mays subsp. parviglumis isolate p13 phospholi... 64 2e-07
66gb|DQ147203.1| Zea mays subsp. parviglumis isolate p12 phospholi... 64 2e-07
67gb|DQ147202.1| Zea mays subsp. parviglumis isolate p11 phospholi... 64 2e-07
68gb|DQ147201.1| Zea mays subsp. parviglumis isolate p11a phosphol... 64 2e-07
69gb|DQ147199.1| Zea mays subsp. parviglumis isolate p8 phospholip... 64 2e-07
70gb|DQ147198.1| Zea mays subsp. parviglumis isolate p6 phospholip... 64 2e-07
71gb|DQ147197.1| Zea mays subsp. parviglumis isolate p5 phospholip... 64 2e-07
72gb|DQ147196.1| Zea mays subsp. parviglumis isolate p4 phospholip... 64 2e-07
73gb|DQ147194.1| Zea mays subsp. parviglumis isolate p2 phospholip... 64 2e-07
74gb|DQ147193.1| Zea mays subsp. parviglumis isolate p1 phospholip... 64 2e-07
75gb|DQ147192.1| Zea diploperennis isolate d8L phospholipid transf... 64 2e-07
76gb|DQ147191.1| Zea diploperennis isolate d7 phospholipid transfe... 64 2e-07
77gb|DQ147190.1| Zea diploperennis isolate d5b phospholipid transf... 64 2e-07
78gb|DQ147189.1| Zea diploperennis isolate d5 phospholipid transfe... 64 2e-07
79gb|DQ147188.1| Zea diploperennis isolate d6 phospholipid transfe... 64 2e-07
80gb|DQ147187.1| Zea diploperennis isolate d4 phospholipid transfe... 64 2e-07
81gb|DQ147186.1| Zea diploperennis isolate d3b phospholipid transf... 64 2e-07
82gb|DQ147185.1| Zea diploperennis isolate d3a phospholipid transf... 64 2e-07
83gb|DQ147184.1| Zea diploperennis isolate d2 phospholipid transfe... 64 2e-07
84gb|DQ147183.1| Zea diploperennis isolate d1b phospholipid transf... 64 2e-07
85gb|DQ147182.1| Zea diploperennis isolate d1a phospholipid transf... 64 2e-07
86gb|DQ147181.1| Zea mays subsp. parviglumis isolate p15 phospholi... 64 2e-07
87gb|DQ147180.1| Zea mays subsp. parviglumis isolate p14 phospholi... 64 2e-07
88gb|DQ147179.1| Zea mays subsp. parviglumis isolate p13 phospholi... 64 2e-07
89gb|DQ147178.1| Zea mays subsp. parviglumis isolate p12G phosphol... 64 2e-07
90gb|DQ147177.1| Zea mays subsp. parviglumis isolate p11 phospholi... 64 2e-07
91gb|DQ147176.1| Zea mays subsp. parviglumis isolate p9 phospholip... 64 2e-07
92gb|DQ147175.1| Zea mays subsp. parviglumis isolate p8 phospholip... 64 2e-07
93gb|DQ147174.1| Zea mays subsp. parviglumis isolate p6U phospholi... 64 2e-07
94gb|DQ147173.1| Zea mays subsp. parviglumis isolate p6L phospholi... 64 2e-07
95gb|DQ147171.1| Zea mays subsp. parviglumis isolate p4 phospholip... 64 2e-07
96gb|DQ147170.1| Zea mays subsp. parviglumis isolate p3 phospholip... 64 2e-07
97gb|DQ147169.1| Zea mays subsp. parviglumis isolate p2 phospholip... 64 2e-07
98gb|M57249.1|MZEPLTPA Maize phospholipid transfer protein mRNA, 3... 64 2e-07
99gb|J04176.1|MZEPLTP Maize phospholipid transfer protein mRNA, co... 64 2e-07
100emb|X68655.1|HVCW18 H.vulgare Cw-18 mRNA 62 7e-07
101gb|AF051369.1|AF051369 Oryza sativa lipid transfer protein mRNA,... 60 3e-06
102dbj|D10955.1|RIC323PTP Oryza sativa mRNA for phospholipid trasfe... 56 5e-05
103gb|AY662492.1| Hordeum vulgare subsp. vulgare non-specific lipid... 56 5e-05
104gb|DQ147207.1| Zea diploperennis isolate d2 phospholipid transfe... 56 5e-05
105gb|DQ147200.1| Zea mays subsp. parviglumis isolate p9 phospholip... 56 5e-05
106gb|DQ147195.1| Zea mays subsp. parviglumis isolate p3 phospholip... 56 5e-05
107gb|DQ147172.1| Zea mays subsp. parviglumis isolate p5_U phosphol... 56 5e-05
108gb|DQ147168.1| Zea mays subsp. parviglumis isolate p1 phospholip... 56 5e-05
109gb|U31766.1|OSU31766 Oryza sativa lipid transfer protein precurs... 52 7e-04
110gb|AY789644.1| Triticum aestivum lipid transfer protein 4 (LTP4)... 50 0.003
111gb|AY057932.1| Bromus inermis nonspecific lipid transfer protein... 44 0.17
112dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 42 0.69
113dbj|AP005383.3| Oryza sativa (japonica cultivar-group) genomic D... 42 0.69
114dbj|AP004694.3| Oryza sativa (japonica cultivar-group) genomic D... 42 0.69 
>emb|X68654.1|HVCW21 H.vulgare Cw-21 mRNA
          Length = 705

 Score =  375 bits (189), Expect = e-101
 Identities = 208/215 (96%), Gaps = 1/215 (0%)
 Strand = Plus / Minus

                                                                       
Query: 1   gggctataggcagcaagtggttgatcagcgaatcttagagcantcgacggaagcgctgat 60
           |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 431 gggctataggcagcaagtggttgatcagcgaatcttagagcagtcgacggaagcgctgat 372

                                                                       
Query: 61  ggcgtaggggacgctgacgccgcacatggaggggatgccggctgnccttgncagcgttta 120
           |||||||||||||||||||||||||||||||||||||||||| | ||||| |||||||||
Sbjct: 371 ggcgtaggggacgctgacgccgcacatggaggggatgccggc-ggccttgccagcgttta 313

                                                                       
Query: 121 gcccaccancagcgctcttgatgcacttgcacgccgcttgtttgtcagcggtgctctggg 180
           |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 312 gcccaccagcagcgctcttgatgcacttgcacgccgcttgtttgtcagcggtgctctggg 253

                                              
Query: 181 cagcgccggccagtctnttgacgccgctgcancag 215
           |||||||||||||||| |||||||||||||| |||
Sbjct: 252 cagcgccggccagtctcttgacgccgctgcagcag 218
to top
>emb|Z66529.1|HVGLTP4X9 H.vulgare Ltp4.2 gene
          Length = 1567

 Score =  319 bits (161), Expect = 2e-84
 Identities = 201/215 (93%), Gaps = 1/215 (0%)
 Strand = Plus / Minus

                                                                        
Query: 1    gggctataggcagcaagtggttgatcagcgaatcttagagcantcgacggaagcgctgat 60
            |||||||||||||||||||||||||||||||||||||||||| || |||||||| |||||
Sbjct: 1036 gggctataggcagcaagtggttgatcagcgaatcttagagcagtccacggaagcactgat 977

                                                                        
Query: 61   ggcgtaggggacgctgacgccgcacatggaggggatgccggctgnccttgncagcgttta 120
            |||||||||||||||||||||||||||||||||||| ||||| | ||||| |||||||||
Sbjct: 976  ggcgtaggggacgctgacgccgcacatggaggggattccggc-ggccttgccagcgttta 918

                                                                        
Query: 121  gcccaccancagcgctcttgatgcacttgcacgccgcttgtttgtcagcggtgctctggg 180
            |||||||  ||||||||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 917  gcccacccgcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctggg 858

                                               
Query: 181  cagcgccggccagtctnttgacgccgctgcancag 215
            | |||||||||||||| ||||| |||||||| |||
Sbjct: 857  ctgcgccggccagtctcttgacaccgctgcagcag 823
to top
>gb|U63993.1|HVU63993 Hordeum vulgare lipid transfer protein (blt4.9) gene, complete cds
          Length = 3238

 Score =  319 bits (161), Expect = 2e-84
 Identities = 201/215 (93%), Gaps = 1/215 (0%)
 Strand = Plus / Minus

                                                                        
Query: 1    gggctataggcagcaagtggttgatcagcgaatcttagagcantcgacggaagcgctgat 60
            |||||||||||||||||||||||||||||||||||||||||| || |||||||| |||||
Sbjct: 2432 gggctataggcagcaagtggttgatcagcgaatcttagagcagtccacggaagcactgat 2373

                                                                        
Query: 61   ggcgtaggggacgctgacgccgcacatggaggggatgccggctgnccttgncagcgttta 120
            |||||||||||||||||||||||||||||||||||| ||||| | ||||| |||||||||
Sbjct: 2372 ggcgtaggggacgctgacgccgcacatggaggggattccggc-ggccttgccagcgttta 2314

                                                                        
Query: 121  gcccaccancagcgctcttgatgcacttgcacgccgcttgtttgtcagcggtgctctggg 180
            |||||||  ||||||||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 2313 gcccacccgcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctggg 2254

                                               
Query: 181  cagcgccggccagtctnttgacgccgctgcancag 215
            | |||||||||||||| ||||| |||||||| |||
Sbjct: 2253 ctgcgccggccagtctcttgacaccgctgcagcag 2219
to top
>emb|Z66528.1|HVGLTP4X3 H.vulgare ltp4.3 gene
          Length = 1862

 Score =  315 bits (159), Expect = 3e-83
 Identities = 193/205 (94%), Gaps = 1/205 (0%)
 Strand = Plus / Minus

                                                                        
Query: 11   cagcaagtggttgatcagcgaatcttagagcantcgacggaagcgctgatggcgtagggg 70
            ||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 1391 cagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtagggg 1332

                                                                        
Query: 71   acgctgacgccgcacatggaggggatgccggctgnccttgncagcgtttagcccaccanc 130
            |||||||||||||||||||||||||| ||||| | ||||| ||||||||||||||||  |
Sbjct: 1331 acgctgacgccgcacatggaggggattccggc-ggccttgccagcgtttagcccacccgc 1273

                                                                        
Query: 131  agcgctcttgatgcacttgcacgccgcttgtttgtcagcggtgctctgggcagcgccggc 190
            |||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||
Sbjct: 1272 agcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggc 1213

                                     
Query: 191  cagtctnttgacgccgctgcancag 215
            |||||| |||||||||||||| |||
Sbjct: 1212 cagtctcttgacgccgctgcagcag 1188
to top
>emb|Z37115.1|HVLTPPB H.vulgare (clone pKG285) mRNA for lipid transfer protein precursor
          Length = 691

 Score =  307 bits (155), Expect = 8e-81
 Identities = 192/205 (93%), Gaps = 1/205 (0%)
 Strand = Plus / Minus

                                                                       
Query: 11  cagcaagtggttgatcagcgaatcttagagcantcgacggaagcgctgatggcgtagggg 70
           ||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 376 cagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtagggg 317

                                                                       
Query: 71  acgctgacgccgcacatggaggggatgccggctgnccttgncagcgtttagcccaccanc 130
           |||||||||||||||||||||||||||||||| | ||||| ||||||||||||||||  |
Sbjct: 316 acgctgacgccgcacatggaggggatgccggc-ggccttgccagcgtttagcccacccgc 258

                                                                       
Query: 131 agcgctcttgatgcacttgcacgccgcttgtttgtcagcggtgctctgggcagcgccggc 190
           |||||||||||||||||||||||||||||| ||||||||||||||||| || ||||||||
Sbjct: 257 agcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgcgctgcgccggc 198

                                    
Query: 191 cagtctnttgacgccgctgcancag 215
           || ||| |||||||||||||| |||
Sbjct: 197 caatctcttgacgccgctgcagcag 173
to top
>gb|U18127.1|HVU18127 Hordeum vulgare phospholipid transfer protein precursor gene,
           complete cds
          Length = 573

 Score =  256 bits (129), Expect = 2e-65
 Identities = 187/207 (90%), Gaps = 1/207 (0%)
 Strand = Plus / Minus

                                                                       
Query: 9   ggcagcaagtggttgatcagcgaatcttagagcantcgacggaagcgctgatggcgtagg 68
           ||||||||||||| |||||| ||||||||||||| |||||||||| |||||||| |||||
Sbjct: 449 ggcagcaagtggtcgatcagtgaatcttagagcagtcgacggaagtgctgatggagtagg 390

                                                                       
Query: 69  ggacgctgacgccgcacatggaggggatgccggctgnccttgncagcgtttagcccacca 128
           ||||||||||||||||| |||||||||||||||| | ||||| ||||||||| |||| | 
Sbjct: 389 ggacgctgacgccgcacttggaggggatgccggc-ggccttgccagcgtttaacccagcg 331

                                                                       
Query: 129 ncagcgctcttgatgcacttgcacgccgcttgtttgtcagcggtgctctgggcagcgccg 188
            ||||||||||||||||||||||| ||||||| ||||||||||||||||| || ||||||
Sbjct: 330 gcagcgctcttgatgcacttgcacaccgcttgcttgtcagcggtgctctgcgctgcgccg 271

                                      
Query: 189 gccagtctnttgacgccgctgcancag 215
           |||| ||| |||||||||||||| |||
Sbjct: 270 gccaatctcttgacgccgctgcagcag 244
to top
>emb|AJ852555.1| Triticum aestivum ltp9.2c gene for type 1 non specific lipid transfer
            protein precursor
          Length = 2122

 Score =  208 bits (105), Expect = 5e-51
 Identities = 156/173 (90%), Gaps = 1/173 (0%)
 Strand = Plus / Minus

                                                                        
Query: 9    ggcagcaagtggttgatcagcgaatcttagagcantcgacggaagcgctgatggcgtagg 68
            ||||||||||| | |||||||||||||||||||| ||||| |||| ||||||||||||||
Sbjct: 1633 ggcagcaagtgctcgatcagcgaatcttagagcagtcgaccgaagagctgatggcgtagg 1574

                                                                        
Query: 69   ggacgctgacgccgcacatggaggggatgccggctgnccttgncagcgtttagcccacca 128
            ||||||| ||||||||| | | |||||||||||| | ||||| ||||||| |||||| ||
Sbjct: 1573 ggacgctaacgccgcactttgtggggatgccggc-ggccttgccagcgttgagcccagca 1515

                                                                 
Query: 129  ncagcgctcttgatgcacttgcacgccgcttgtttgtcagcggtgctctgggc 181
             ||||||||||||||||||||||||||||||| ||||||||||||||| ||||
Sbjct: 1514 gcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctccgggc 1462
to top
>emb|AJ784903.1| Triticum turgidum subsp. durum partial mRNA for type 1 non-specific
           lipid transfer protein precursor (ltp9.2 gene)
          Length = 604

 Score =  200 bits (101), Expect = 1e-48
 Identities = 155/173 (89%), Gaps = 1/173 (0%)
 Strand = Plus / Minus

                                                                       
Query: 9   ggcagcaagtggttgatcagcgaatcttagagcantcgacggaagcgctgatggcgtagg 68
           ||||||||||| | |||||||||||||||||||| ||||| |||| |||||||||||| |
Sbjct: 329 ggcagcaagtgctcgatcagcgaatcttagagcagtcgaccgaagagctgatggcgtaag 270

                                                                       
Query: 69  ggacgctgacgccgcacatggaggggatgccggctgnccttgncagcgtttagcccacca 128
           ||||||| ||||||||| | | |||||||||||| | ||||| ||||||| |||||| ||
Sbjct: 269 ggacgctaacgccgcactttgtggggatgccggc-ggccttgccagcgttgagcccagca 211

                                                                
Query: 129 ncagcgctcttgatgcacttgcacgccgcttgtttgtcagcggtgctctgggc 181
            ||||||||||||||||||||||||||||||| ||||||||||||||| ||||
Sbjct: 210 gcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctccgggc 158
to top
>emb|AJ784901.1| Triticum aestivum mRNA for type 1 non-specific lipid transfer
           protein precursor (ltp9.2 gene)
          Length = 708

 Score =  184 bits (93), Expect = 7e-44
 Identities = 153/173 (88%), Gaps = 1/173 (0%)
 Strand = Plus / Minus

                                                                       
Query: 9   ggcagcaagtggttgatcagcgaatcttagagcantcgacggaagcgctgatggcgtagg 68
           ||||||| ||| | |||||||||||||||||||| ||||| |||| ||||||||||||||
Sbjct: 430 ggcagcatgtgctcgatcagcgaatcttagagcagtcgaccgaagagctgatggcgtagg 371

                                                                       
Query: 69  ggacgctgacgccgcacatggaggggatgccggctgnccttgncagcgtttagcccacca 128
           ||| ||| ||||||||| | | |||||||||||| | ||||| ||||||| |||||| ||
Sbjct: 370 ggatgctaacgccgcactttgtggggatgccggc-ggccttgccagcgttgagcccagca 312

                                                                
Query: 129 ncagcgctcttgatgcacttgcacgccgcttgtttgtcagcggtgctctgggc 181
            ||||||||||||| ||||||||||||||||| ||||||||||||||| ||||
Sbjct: 311 gcagcgctcttgatacacttgcacgccgcttgcttgtcagcggtgctccgggc 259
to top
>emb|AJ852556.1| Triticum aestivum ltp9.2d gene for type 1 non specific lipid transfer
            protein precursor
          Length = 2087

 Score =  184 bits (93), Expect = 7e-44
 Identities = 153/173 (88%), Gaps = 1/173 (0%)
 Strand = Plus / Minus

                                                                        
Query: 9    ggcagcaagtggttgatcagcgaatcttagagcantcgacggaagcgctgatggcgtagg 68
            ||||||||||| | |||||| ||||||||||||| ||||| |||| ||||||||||||||
Sbjct: 1621 ggcagcaagtgctcgatcagtgaatcttagagcagtcgaccgaagagctgatggcgtagg 1562

                                                                        
Query: 69   ggacgctgacgccgcacatggaggggatgccggctgnccttgncagcgtttagcccacca 128
            ||||||| ||||||||| | | |||||||||||| | ||||| |||| || |||||| ||
Sbjct: 1561 ggacgctaacgccgcactttgtggggatgccggc-ggccttgccagcattgagcccagca 1503

                                                                 
Query: 129  ncagcgctcttgatgcacttgcacgccgcttgtttgtcagcggtgctctgggc 181
             ||||||||||||||||||||||| ||||||| ||||||||||||||| ||||
Sbjct: 1502 gcagcgctcttgatgcacttgcacaccgcttgcttgtcagcggtgctccgggc 1450
to top
>gb|DQ465676.1| Triticum aestivum clone Lt10F9 non-specific lipid transfer protein
           1 precursor, mRNA, complete cds
          Length = 348

 Score =  176 bits (89), Expect = 2e-41
 Identities = 140/157 (89%), Gaps = 1/157 (0%)
 Strand = Plus / Minus

                                                                       
Query: 25  tcagcgaatcttagagcantcgacggaagcgctgatggcgtaggggacgctgacgccgca 84
           |||||||||||||||||| ||||| |||| ||||||||||||||||||||| ||||||||
Sbjct: 348 tcagcgaatcttagagcagtcgaccgaagagctgatggcgtaggggacgctaacgccgca 289

                                                                       
Query: 85  catggaggggatgccggctgnccttgncagcgtttagcccaccancagcgctcttgatgc 144
           | | | ||||||||| || | ||||| ||||||| |||||| || ||||||||||||| |
Sbjct: 288 ctttgtggggatgcccgc-ggccttgccagcgttgagcccagcagcagcgctcttgatac 230

                                                
Query: 145 acttgcacgccgcttgtttgtcagcggtgctctgggc 181
           |||||||||||||||| ||||||||||||||| ||||
Sbjct: 229 acttgcacgccgcttgcttgtcagcggtgctccgggc 193
to top
>gb|DQ465678.1| Triticum aestivum clone Lt10E10 non-specific lipid transfer protein
           1 precursor, mRNA, complete cds
          Length = 348

 Score =  176 bits (89), Expect = 2e-41
 Identities = 140/157 (89%), Gaps = 1/157 (0%)
 Strand = Plus / Minus

                                                                       
Query: 25  tcagcgaatcttagagcantcgacggaagcgctgatggcgtaggggacgctgacgccgca 84
           |||||||||||||||||| ||||| |||| ||||||||||||||||||||| ||||||||
Sbjct: 348 tcagcgaatcttagagcagtcgaccgaagagctgatggcgtaggggacgctaacgccgca 289

                                                                       
Query: 85  catggaggggatgccggctgnccttgncagcgtttagcccaccancagcgctcttgatgc 144
           | | | ||||||||| || | ||||| ||||||| |||||| || ||||||||||||| |
Sbjct: 288 ctttgtggggatgcccgc-ggccttgccagcgttgagcccagcagcagcgctcttgatac 230

                                                
Query: 145 acttgcacgccgcttgtttgtcagcggtgctctgggc 181
           |||||||||||||||| ||||||||||||||| ||||
Sbjct: 229 acttgcacgccgcttgcttgtcagcggtgctccgggc 193
to top
>gb|DQ465679.1| Triticum aestivum clone Lt19C10 non-specific lipid transfer protein
           1 precursor, mRNA, complete cds
          Length = 348

 Score =  176 bits (89), Expect = 2e-41
 Identities = 149/169 (88%), Gaps = 1/169 (0%)
 Strand = Plus / Minus

                                                                       
Query: 25  tcagcgaatcttagagcantcgacggaagcgctgatggcgtaggggacgctgacgccgca 84
           |||||||||||||||||| || ||||| | ||| ||||||||||||| ||||||||||||
Sbjct: 348 tcagcgaatcttagagcagtccacggatgagctaatggcgtaggggatgctgacgccgca 289

                                                                       
Query: 85  catggaggggatgccggctgnccttgncagcgtttagcccaccancagcgctcttgatgc 144
           | ||||||||||||| || | ||||  ||||||| ||||||||| |||| ||||| ||||
Sbjct: 288 cttggaggggatgcctgc-ggcctttccagcgttgagcccaccagcagcactcttaatgc 230

                                                            
Query: 145 acttgcacgccgcttgtttgtcagcggtgctctgggcagcgccggccag 193
           |||||||||||||||| ||||||||||||||| | || |||||||||||
Sbjct: 229 acttgcacgccgcttgcttgtcagcggtgctccgcgctgcgccggccag 181
to top
>emb|X68656.1|HVCW19 H.vulgare Cw-19 mRNA
          Length = 660

 Score =  119 bits (60), Expect = 4e-24
 Identities = 76/82 (92%)
 Strand = Plus / Minus

                                                                       
Query: 134 gctcttgatgcacttgcacgccgcttgtttgtcagcggtgctctgggcagcgccggccag 193
           |||||||| |||| ||||||||||||| |||||||||||||||||||| |||||||||||
Sbjct: 285 gctcttgaggcacctgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccag 226

                                 
Query: 194 tctnttgacgccgctgcancag 215
           ||| |||||||||||||| |||
Sbjct: 225 tctcttgacgccgctgcagcag 204
to top
>gb|AY566607.1| Triticum aestivum lipid transfer protein (LPT1) gene, complete cds
          Length = 3448

 Score =  105 bits (53), Expect = 6e-20
 Identities = 129/154 (83%), Gaps = 1/154 (0%)
 Strand = Plus / Minus

                                                                        
Query: 23   gatcagcgaatcttagagcantcgacggaagcgctgatggcgtaggggacgctgacgccg 82
            |||||| | ||||||||||| || ||||| |||||||||| |||||||| ||||||||||
Sbjct: 3206 gatcagtggatcttagagcagtccacggatgcgctgatggagtaggggatgctgacgccg 3147

                                                                        
Query: 83   cacatggaggggatgccggctgnccttgncagcgtttagcccaccancagcgctcttgat 142
            ||| |||||||||| |  || | ||||  | | ||| ||||||||  |||| ||||||||
Sbjct: 3146 cacttggaggggatacttgcag-cctttccggggttgagcccaccggcagcactcttgat 3088

                                              
Query: 143  gcacttgcacgccgcttgtttgtcagcggtgctc 176
            |||| |||| |||||||| ||||| |||||||||
Sbjct: 3087 gcacctgcatgccgcttgcttgtcggcggtgctc 3054
to top
>gb|AF302788.1|AF302788 Triticum aestivum lipid transfer protein precursor (LTP1) mRNA,
           complete cds
          Length = 737

 Score =  105 bits (53), Expect = 6e-20
 Identities = 129/154 (83%), Gaps = 1/154 (0%)
 Strand = Plus / Minus

                                                                       
Query: 23  gatcagcgaatcttagagcantcgacggaagcgctgatggcgtaggggacgctgacgccg 82
           |||||| | ||||||||||| || ||||| |||||||||| |||||||| ||||||||||
Sbjct: 410 gatcagtggatcttagagcagtccacggatgcgctgatggagtaggggatgctgacgccg 351

                                                                       
Query: 83  cacatggaggggatgccggctgnccttgncagcgtttagcccaccancagcgctcttgat 142
           ||| |||||||||| |  || | ||||  | | ||| ||||||||  |||| ||||||||
Sbjct: 350 cacttggaggggatacttgcag-cctttccggggttgagcccaccggcagcactcttgat 292

                                             
Query: 143 gcacttgcacgccgcttgtttgtcagcggtgctc 176
           |||| |||| |||||||| ||||| |||||||||
Sbjct: 291 gcacctgcatgccgcttgcttgtcggcggtgctc 258
to top
>gb|AY796184.1| Triticum aestivum lipid transfer protein (LTP1) mRNA, complete cds
          Length = 348

 Score =  103 bits (52), Expect = 2e-19
 Identities = 122/145 (84%), Gaps = 1/145 (0%)
 Strand = Plus / Minus

                                                                       
Query: 32  atcttagagcantcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggag 91
           ||||||||||| || ||||| |||||||||| |||||||| ||||||||||||| |||||
Sbjct: 341 atcttagagcagtccacggatgcgctgatggagtaggggatgctgacgccgcacttggag 282

                                                                       
Query: 92  gggatgccggctgnccttgncagcgtttagcccaccancagcgctcttgatgcacttgca 151
           ||||| |  || | ||||  | | ||| ||||||||  |||| |||||||||||| ||||
Sbjct: 281 gggatacttgcag-cctttccggggttgagcccaccggcagcactcttgatgcacctgca 223

                                    
Query: 152 cgccgcttgtttgtcagcggtgctc 176
            |||||||| ||||| |||||||||
Sbjct: 222 tgccgcttgcttgtcggcggtgctc 198
to top
>gb|DQ465677.1| Triticum aestivum clone Lt10B6 non-specific lipid transfer protein
           1 precursor, mRNA, complete cds
          Length = 348

 Score =  103 bits (52), Expect = 2e-19
 Identities = 122/145 (84%), Gaps = 1/145 (0%)
 Strand = Plus / Minus

                                                                       
Query: 32  atcttagagcantcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggag 91
           ||||||||||| || ||||| |||||||||| |||||||| ||||||||||||| |||||
Sbjct: 341 atcttagagcaatccacggatgcgctgatggagtaggggatgctgacgccgcacttggag 282

                                                                       
Query: 92  gggatgccggctgnccttgncagcgtttagcccaccancagcgctcttgatgcacttgca 151
           ||||| |  || | ||||  | | ||| ||||||||  |||| |||||||||||| ||||
Sbjct: 281 gggatacttgcag-cctttccggggttgagcccaccggcagcactcttgatgcacctgca 223

                                    
Query: 152 cgccgcttgtttgtcagcggtgctc 176
            |||||||| ||||| |||||||||
Sbjct: 222 tgccgcttgcttgtcggcggtgctc 198
to top
>gb|AC135561.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBa0086N07 map S790A, complete sequence
          Length = 178523

 Score = 95.6 bits (48), Expect = 5e-17
 Identities = 59/63 (93%)
 Strand = Plus / Plus

                                                                         
Query: 36    tagagcantcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggagggga 95
             ||||||| |||| |||||||||||||| |||||||||||||||||||||| |||||||||
Sbjct: 94021 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 94080

                
Query: 96    tgc 98
             |||
Sbjct: 94081 tgc 94083
to top
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score = 95.6 bits (48), Expect = 5e-17
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                            
Query: 36       tagagcantcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggagggga 95
                ||||||| |||| |||||||||||||| |||||||||||||||||||||| |||||||||
Sbjct: 13090059 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 13090000

                   
Query: 96       tgc 98
                |||
Sbjct: 13089999 tgc 13089997



 Score = 83.8 bits (42), Expect = 2e-13
 Identities = 56/61 (91%)
 Strand = Plus / Minus

                                                                          
Query: 38     gagcantcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 97
              ||||| |||| |||||||||||||| |||||||||||||||||||||| | |||||||||
Sbjct: 702441 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 702382

               
Query: 98     c 98
              |
Sbjct: 702381 c 702381



 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 54/61 (88%)
 Strand = Plus / Minus

                                                                          
Query: 38     gagcantcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 97
              ||||| |||| ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 692764 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 692705

               
Query: 98     c 98
              |
Sbjct: 692704 c 692704



 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 49/54 (90%)
 Strand = Plus / Minus

                                                                    
Query: 49     ggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatgccggc 102
              ||||| ||||||||||||||||| | ||||| ||||| ||||||||||||||||
Sbjct: 679458 ggaagggctgatggcgtaggggatgttgacgtcgcacttggaggggatgccggc 679405
to top
>dbj|AK071260.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023086A05, full
           insert sequence
          Length = 843

 Score = 95.6 bits (48), Expect = 5e-17
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                       
Query: 36  tagagcantcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggagggga 95
           ||||||| |||| |||||||||||||| |||||||||||||||||||||| |||||||||
Sbjct: 459 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 400

              
Query: 96  tgc 98
           |||
Sbjct: 399 tgc 397
to top
>dbj|AK061288.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-212-H12, full
           insert sequence
          Length = 846

 Score = 95.6 bits (48), Expect = 5e-17
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                       
Query: 36  tagagcantcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggagggga 95
           ||||||| |||| |||||||||||||| |||||||||||||||||||||| |||||||||
Sbjct: 458 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 399

              
Query: 96  tgc 98
           |||
Sbjct: 398 tgc 396
to top
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 95.6 bits (48), Expect = 5e-17
 Identities = 59/63 (93%)
 Strand = Plus / Minus

                                                                            
Query: 36       tagagcantcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggagggga 95
                ||||||| |||| |||||||||||||| |||||||||||||||||||||| |||||||||
Sbjct: 13170238 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 13170179

                   
Query: 96       tgc 98
                |||
Sbjct: 13170178 tgc 13170176



 Score = 83.8 bits (42), Expect = 2e-13
 Identities = 56/61 (91%)
 Strand = Plus / Minus

                                                                          
Query: 38     gagcantcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 97
              ||||| |||| |||||||||||||| |||||||||||||||||||||| | |||||||||
Sbjct: 702441 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 702382

               
Query: 98     c 98
              |
Sbjct: 702381 c 702381



 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 54/61 (88%)
 Strand = Plus / Minus

                                                                          
Query: 38     gagcantcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 97
              ||||| |||| ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 692764 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 692705

               
Query: 98     c 98
              |
Sbjct: 692704 c 692704



 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 49/54 (90%)
 Strand = Plus / Minus

                                                                    
Query: 49     ggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatgccggc 102
              ||||| ||||||||||||||||| | ||||| ||||| ||||||||||||||||
Sbjct: 679458 ggaagggctgatggcgtaggggatgttgacgtcgcacttggaggggatgccggc 679405
to top
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12,
              complete sequence
          Length = 27566993

 Score = 91.7 bits (46), Expect = 8e-16
 Identities = 57/61 (93%)
 Strand = Plus / Minus

                                                                          
Query: 38     gagcantcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 97
              ||||| |||| |||||||||||||| |||||||||||||||||||||| |||||||||||
Sbjct: 736743 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 736684

               
Query: 98     c 98
              |
Sbjct: 736683 c 736683



 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 54/61 (88%)
 Strand = Plus / Minus

                                                                          
Query: 38     gagcantcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 97
              ||||| |||| ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 732616 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 732557

               
Query: 98     c 98
              |
Sbjct: 732556 c 732556



 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 49/54 (90%)
 Strand = Plus / Minus

                                                                    
Query: 49     ggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatgccggc 102
              ||||| |||||| |||||||||| | ||||||||||| ||||||||||||||||
Sbjct: 722716 ggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatgccggc 722663
to top
>emb|Y08691.1|OSLPI O.sativa mRNA for lipid transfer protein
          Length = 799

 Score = 91.7 bits (46), Expect = 8e-16
 Identities = 57/61 (93%)
 Strand = Plus / Minus

                                                                       
Query: 38  gagcantcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 97
           ||||| |||| |||||||||||||| |||||||||||||||||||||| |||||||||||
Sbjct: 438 gagcaatcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 379

            
Query: 98  c 98
           |
Sbjct: 378 c 378
to top
>emb|X83435.1|OSLTPA15 O.sativa mRNA for lipid transfer protein, a15
          Length = 511

 Score = 91.7 bits (46), Expect = 8e-16
 Identities = 57/61 (93%)
 Strand = Plus / Minus

                                                                       
Query: 38  gagcantcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 97
           ||||| |||| |||||||||||||| |||||||||||||||||||||| |||||||||||
Sbjct: 413 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 354

            
Query: 98  c 98
           |
Sbjct: 353 c 353
to top
>dbj|AK059808.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-A04, full
           insert sequence
          Length = 995

 Score = 91.7 bits (46), Expect = 8e-16
 Identities = 57/61 (93%)
 Strand = Plus / Minus

                                                                       
Query: 38  gagcantcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 97
           ||||| |||| |||||||||||||| |||||||||||||||||||||| |||||||||||
Sbjct: 670 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 611

            
Query: 98  c 98
           |
Sbjct: 610 c 610
to top
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 91.7 bits (46), Expect = 8e-16
 Identities = 57/61 (93%)
 Strand = Plus / Minus

                                                                          
Query: 38     gagcantcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 97
              ||||| |||| |||||||||||||| |||||||||||||||||||||| |||||||||||
Sbjct: 736743 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 736684

               
Query: 98     c 98
              |
Sbjct: 736683 c 736683



 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 54/61 (88%)
 Strand = Plus / Minus

                                                                          
Query: 38     gagcantcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 97
              ||||| |||| ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 732616 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 732557

               
Query: 98     c 98
              |
Sbjct: 732556 c 732556



 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 49/54 (90%)
 Strand = Plus / Minus

                                                                    
Query: 49     ggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatgccggc 102
              ||||| |||||| |||||||||| | ||||||||||| ||||||||||||||||
Sbjct: 722716 ggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatgccggc 722663
to top
>emb|BX000511.2|CNS08CE1 Oryza sativa chromosome 12, . BAC OJ1136_E08 of library Monsanto from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 118211

 Score = 91.7 bits (46), Expect = 8e-16
 Identities = 57/61 (93%)
 Strand = Plus / Plus

                                                                         
Query: 38    gagcantcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 97
             ||||| |||| |||||||||||||| |||||||||||||||||||||| |||||||||||
Sbjct: 42391 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 42450

              
Query: 98    c 98
             |
Sbjct: 42451 c 42451



 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 49/54 (90%)
 Strand = Plus / Plus

                                                                   
Query: 49    ggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatgccggc 102
             ||||| |||||| |||||||||| | ||||||||||| ||||||||||||||||
Sbjct: 56418 ggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatgccggc 56471



 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 54/61 (88%)
 Strand = Plus / Plus

                                                                         
Query: 38    gagcantcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 97
             ||||| |||| ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 46518 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 46577

              
Query: 98    c 98
             |
Sbjct: 46578 c 46578
to top
>gb|U77295.1|OSU77295 Oryza sativa lipid transfer protein (LTP) mRNA, complete cds
          Length = 799

 Score = 91.7 bits (46), Expect = 8e-16
 Identities = 57/61 (93%)
 Strand = Plus / Minus

                                                                       
Query: 38  gagcantcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 97
           ||||| |||| |||||||||||||| |||||||||||||||||||||| |||||||||||
Sbjct: 438 gagcaatcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 379

            
Query: 98  c 98
           |
Sbjct: 378 c 378
to top
>gb|AY335485.1| Oryza sativa (japonica cultivar-group) lipid transfer protein LT1
           mRNA, complete cds
          Length = 530

 Score = 83.8 bits (42), Expect = 2e-13
 Identities = 56/61 (91%)
 Strand = Plus / Minus

                                                                       
Query: 38  gagcantcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 97
           ||||| |||| |||||||||||||| |||||||||||||||||||||| | |||||||||
Sbjct: 426 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 367

            
Query: 98  c 98
           |
Sbjct: 366 c 366
to top
>gb|AF334185.1|AF334185 Triticum aestivum lipid transfer protein precursor (LTP2) mRNA,
           complete cds
          Length = 730

 Score = 83.8 bits (42), Expect = 2e-13
 Identities = 68/77 (88%)
 Strand = Plus / Minus

                                                                       
Query: 23  gatcagcgaatcttagagcantcgacggaagcgctgatggcgtaggggacgctgacgccg 82
           |||||| | ||||||||||| || ||||| |||||||| | |||||||||||||||||||
Sbjct: 429 gatcagtggatcttagagcagtccacggatgcgctgatcgtgtaggggacgctgacgccg 370

                            
Query: 83  cacatggaggggatgcc 99
           ||| ||||||| |||||
Sbjct: 369 cacttggagggaatgcc 353
to top
>dbj|AK070414.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023053H09, full
            insert sequence
          Length = 2882

 Score = 83.8 bits (42), Expect = 2e-13
 Identities = 56/61 (91%)
 Strand = Plus / Minus

                                                                        
Query: 38   gagcantcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 97
            ||||| |||| |||||||||||||| |||||||||||||||||||||| | |||||||||
Sbjct: 2445 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 2386

             
Query: 98   c 98
            |
Sbjct: 2385 c 2385
to top
>dbj|AK058805.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-003-B09, full
           insert sequence
          Length = 551

 Score = 83.8 bits (42), Expect = 2e-13
 Identities = 56/61 (91%)
 Strand = Plus / Minus

                                                                       
Query: 38  gagcantcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 97
           ||||| |||| |||||||||||||| |||||||||||||||||||||| | |||||||||
Sbjct: 322 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 263

            
Query: 98  c 98
           |
Sbjct: 262 c 262
to top
>emb|AJ852557.1| Triticum aestivum ltp9.5b gene for type 1 non specific lipid
           transfer protein precursor
          Length = 496

 Score = 83.8 bits (42), Expect = 2e-13
 Identities = 68/77 (88%)
 Strand = Plus / Minus

                                                                       
Query: 23  gatcagcgaatcttagagcantcgacggaagcgctgatggcgtaggggacgctgacgccg 82
           |||||| | ||||||||||| || ||||| |||||||| | |||||||||||||||||||
Sbjct: 370 gatcagtggatcttagagcagtccacggatgcgctgatcgtgtaggggacgctgacgccg 311

                            
Query: 83  cacatggaggggatgcc 99
           ||| ||||||| |||||
Sbjct: 310 cacttggagggaatgcc 294
to top
>emb|BX000512.1|CNS08CE2 Oryza sativa chromosome 11, . BAC OSJNBa0025K19 of library OSJNBa from
             chromosome 11 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 181322

 Score = 83.8 bits (42), Expect = 2e-13
 Identities = 56/61 (91%)
 Strand = Plus / Plus

                                                                         
Query: 38    gagcantcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 97
             ||||| |||| |||||||||||||| |||||||||||||||||||||| | |||||||||
Sbjct: 40531 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 40590

              
Query: 98    c 98
             |
Sbjct: 40591 c 40591



 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 49/54 (90%)
 Strand = Plus / Plus

                                                                   
Query: 49    ggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatgccggc 102
             ||||| ||||||||||||||||| | ||||| ||||| ||||||||||||||||
Sbjct: 63514 ggaagggctgatggcgtaggggatgttgacgtcgcacttggaggggatgccggc 63567



 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 54/61 (88%)
 Strand = Plus / Plus

                                                                         
Query: 38    gagcantcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 97
             ||||| |||| ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 50208 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 50267

              
Query: 98    c 98
             |
Sbjct: 50268 c 50268
to top
>gb|AY754742.1| Triticum aestivum lipid transfer protein (LTP2) mRNA, complete cds
          Length = 348

 Score = 81.8 bits (41), Expect = 8e-13
 Identities = 61/68 (89%)
 Strand = Plus / Minus

                                                                       
Query: 32  atcttagagcantcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggag 91
           ||||||||||| || ||||| |||||||| | |||||||||||||||||||||| |||||
Sbjct: 341 atcttagagcagtccacggatgcgctgatcgtgtaggggacgctgacgccgcacttggag 282

                   
Query: 92  gggatgcc 99
           || |||||
Sbjct: 281 ggaatgcc 274
to top
>emb|X56547.1|HSBLT4 H. vulgare BLT4 mRNA
          Length = 724

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 67/77 (87%)
 Strand = Plus / Minus

                                                                       
Query: 23  gatcagcgaatcttagagcantcgacggaagcgctgatggcgtaggggacgctgacgccg 82
           |||||| | ||||||||||| |||||    |||||||| | |||||||||||||||||||
Sbjct: 420 gatcagtggatcttagagcagtcgacactggcgctgatcgtgtaggggacgctgacgccg 361

                            
Query: 83  cacatggaggggatgcc 99
           ||| |||||||||||||
Sbjct: 360 cacctggaggggatgcc 344
to top
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 50/54 (92%)
 Strand = Plus / Minus

                                                                      
Query: 49       ggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatgccggc 102
                ||||| ||||||||||||||||| | ||||||||||| ||||||||||||||||
Sbjct: 14437053 ggaagggctgatggcgtaggggatgttgacgccgcacttggaggggatgccggc 14437000
to top
>dbj|AP004134.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1116_C12
          Length = 116758

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 50/54 (92%)
 Strand = Plus / Minus

                                                                   
Query: 49    ggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatgccggc 102
             ||||| ||||||||||||||||| | ||||||||||| ||||||||||||||||
Sbjct: 45551 ggaagggctgatggcgtaggggatgttgacgccgcacttggaggggatgccggc 45498
to top
>gb|AF017361.1|AF017361 Oryza sativa lipid transfer protein LPT IV mRNA, complete cds
          Length = 507

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 47/50 (94%)
 Strand = Plus / Minus

                                                             
Query: 49  ggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatgc 98
           |||||||||||||| |||||||||||||||||||||| | ||||||||||
Sbjct: 362 ggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatgc 313
to top
>gb|AF017360.1|AF017360 Oryza sativa lipid transfer protein LPT III mRNA, complete cds
          Length = 805

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 56/61 (91%), Gaps = 1/61 (1%)
 Strand = Plus / Minus

                                                                       
Query: 38  gagcantcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 97
           ||||| |||| |||||||||||||| |||||| ||||||||||||||| |||||||||||
Sbjct: 412 gagcagtcgatggaagcgctgatggtgtaggg-acgctgacgccgcacttggaggggatg 354

            
Query: 98  c 98
           |
Sbjct: 353 c 353
to top
>emb|X71669.1|SVTLP1R S.vulgare ltp1 mRNA
          Length = 717

 Score = 71.9 bits (36), Expect = 8e-10
 Identities = 42/44 (95%)
 Strand = Plus / Minus

                                                       
Query: 55  gctgatggcgtaggggacgctgacgccgcacatggaggggatgc 98
           |||||||| |||||||||||||||||||||| ||||||||||||
Sbjct: 277 gctgatggtgtaggggacgctgacgccgcacttggaggggatgc 234
to top
>emb|X71667.1|SVLTP1 S.vulgare ltp1 gene
          Length = 1499

 Score = 71.9 bits (36), Expect = 8e-10
 Identities = 42/44 (95%)
 Strand = Plus / Minus

                                                       
Query: 55  gctgatggcgtaggggacgctgacgccgcacatggaggggatgc 98
           |||||||| |||||||||||||||||||||| ||||||||||||
Sbjct: 980 gctgatggtgtaggggacgctgacgccgcacttggaggggatgc 937
to top
>emb|Z37114.1|HVLTPPA H.vulgare (clone pKG2316) mRNA for lipid transfer protein precursor
          Length = 627

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 44/47 (93%)
 Strand = Plus / Minus

                                                          
Query: 53  gcgctgatggcgtaggggacgctgacgccgcacatggaggggatgcc 99
           |||||||| | |||||||||||||||||||||| |||||||||||||
Sbjct: 322 gcgctgatcgtgtaggggacgctgacgccgcacctggaggggatgcc 276
to top
>gb|AY327042.1| Oryza sativa (japonica cultivar-group) lipid transfer protein LPT1
           mRNA, complete cds
          Length = 647

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 54/61 (88%)
 Strand = Plus / Minus

                                                                       
Query: 38  gagcantcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 97
           ||||| |||| ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 469 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 410

            
Query: 98  c 98
           |
Sbjct: 409 c 409
to top
>emb|Z23271.1|OSLPTPRA O.sativa lipid transfer protein gene, complete CDS
          Length = 1485

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 54/61 (88%)
 Strand = Plus / Minus

                                                                       
Query: 38  gagcantcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 97
           ||||| |||| ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 701 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 642

            
Query: 98  c 98
           |
Sbjct: 641 c 641
to top
>emb|X83434.1|OSLTPB1 O.sativa mRNA for lipid transfer protein, b1
          Length = 692

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 54/61 (88%)
 Strand = Plus / Minus

                                                                       
Query: 38  gagcantcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 97
           ||||| |||| ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 331 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 272

            
Query: 98  c 98
           |
Sbjct: 271 c 271
to top
>dbj|AK104981.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-125-E10, full
           insert sequence
          Length = 793

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 49/54 (90%)
 Strand = Plus / Minus

                                                                 
Query: 49  ggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatgccggc 102
           ||||| |||||| |||||||||| | ||||||||||| ||||||||||||||||
Sbjct: 419 ggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatgccggc 366
to top
>dbj|AK102455.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033094A19, full
            insert sequence
          Length = 3876

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 49/54 (90%)
 Strand = Plus / Minus

                                                                  
Query: 49   ggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatgccggc 102
            ||||| |||||| |||||||||| | ||||||||||| ||||||||||||||||
Sbjct: 3505 ggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatgccggc 3452
to top
>dbj|AK073466.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033044B21, full
           insert sequence
          Length = 792

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 49/54 (90%)
 Strand = Plus / Minus

                                                                 
Query: 49  ggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatgccggc 102
           ||||| |||||| |||||||||| | ||||||||||| ||||||||||||||||
Sbjct: 421 ggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatgccggc 368
to top
>dbj|AK063683.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-119-E10, full
           insert sequence
          Length = 745

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 49/54 (90%)
 Strand = Plus / Minus

                                                                 
Query: 49  ggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatgccggc 102
           ||||| ||||||||||||||||| | ||||| ||||| ||||||||||||||||
Sbjct: 423 ggaagggctgatggcgtaggggatgttgacgtcgcacttggaggggatgccggc 370
to top
>dbj|AK059819.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-C07, full
           insert sequence
          Length = 1003

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 54/61 (88%)
 Strand = Plus / Minus

                                                                       
Query: 38  gagcantcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 97
           ||||| |||| ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 654 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 595

            
Query: 98  c 98
           |
Sbjct: 594 c 594
to top
>dbj|AK058896.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-G08, full
           insert sequence
          Length = 840

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 54/61 (88%)
 Strand = Plus / Minus

                                                                       
Query: 38  gagcantcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 97
           ||||| |||| ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 437 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 378

            
Query: 98  c 98
           |
Sbjct: 377 c 377
to top
>gb|AF017359.1|AF017359 Oryza sativa lipid transfer protein LPT II mRNA, complete cds
          Length = 845

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 54/61 (88%)
 Strand = Plus / Minus

                                                                       
Query: 38  gagcantcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 97
           ||||| |||| ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 419 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 360

            
Query: 98  c 98
           |
Sbjct: 359 c 359
to top
>gb|AF017358.1|AF017358 Oryza sativa lipid transfer protein mRNA, complete cds
          Length = 695

 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                            
Query: 50  gaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatgc 98
           |||| |||||||| |||||||| ||||||||||||| ||||||||||||
Sbjct: 325 gaagggctgatggtgtaggggatgctgacgccgcacttggaggggatgc 277
to top
>gb|BT018347.1| Zea mays clone EL01T0403E02.c mRNA sequence
          Length = 827

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 55  gctgatggcgtaggggacgctgacgccgcacatggaggggatgc 98
           |||||||| |||||||| ||||||||||||| ||||||||||||
Sbjct: 417 gctgatggtgtaggggatgctgacgccgcacttggaggggatgc 374
to top
>emb|X71668.1|SVLTP2 S.vulgare ltp2 gene
          Length = 1800

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 55  gctgatggcgtaggggacgctgacgccgcacatggaggggatgc 98
           |||||||| |||||||| ||||||||||||| ||||||||||||
Sbjct: 948 gctgatggtgtaggggatgctgacgccgcacttggaggggatgc 905
to top
>dbj|AK107447.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-128-C01, full
           insert sequence
          Length = 718

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                       
Query: 55  gctgatggcgtaggggacgctgacgccgcacatggaggggatgc 98
           |||||||| |||||||| ||||||||||||| ||||||||||||
Sbjct: 97  gctgatggtgtaggggatgctgacgccgcacttggaggggatgc 140
to top
>gb|U66105.1|ZMU66105 Zea mays phospholipid transfer protein mRNA, complete cds
          Length = 770

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 55  gctgatggcgtaggggacgctgacgccgcacatggaggggatgc 98
           |||||||| |||||||| ||||||||||||| ||||||||||||
Sbjct: 406 gctgatggtgtaggggatgctgacgccgcacttggaggggatgc 363
to top
>gb|DQ147213.1| Zea diploperennis isolate d7B phospholipid transfer protein 1
           (plt1) gene, partial cds
          Length = 698

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 55  gctgatggcgtaggggacgctgacgccgcacatggaggggatgc 98
           |||||||| |||||||| ||||||||||||| ||||||||||||
Sbjct: 316 gctgatggtgtaggggatgctgacgccgcacttggaggggatgc 273
to top
>gb|DQ147210.1| Zea diploperennis isolate d4 phospholipid transfer protein 1 (plt1)
           gene, partial cds
          Length = 514

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 55  gctgatggcgtaggggacgctgacgccgcacatggaggggatgc 98
           |||||||| |||||||| ||||||||||||| ||||||||||||
Sbjct: 308 gctgatggtgtaggggatgctgacgccgcacttggaggggatgc 265
to top
>gb|DQ147209.1| Zea diploperennis isolate d4a phospholipid transfer protein 1
           (plt1) gene, partial cds
          Length = 514

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 55  gctgatggcgtaggggacgctgacgccgcacatggaggggatgc 98
           |||||||| |||||||| ||||||||||||| ||||||||||||
Sbjct: 308 gctgatggtgtaggggatgctgacgccgcacttggaggggatgc 265
to top
>gb|DQ147205.1| Zea mays subsp. parviglumis isolate p15 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 804

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 55  gctgatggcgtaggggacgctgacgccgcacatggaggggatgc 98
           |||||||| |||||||| ||||||||||||| ||||||||||||
Sbjct: 417 gctgatggtgtaggggatgctgacgccgcacttggaggggatgc 374
to top
>gb|DQ147204.1| Zea mays subsp. parviglumis isolate p13 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 780

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 55  gctgatggcgtaggggacgctgacgccgcacatggaggggatgc 98
           |||||||| |||||||| ||||||||||||| ||||||||||||
Sbjct: 399 gctgatggtgtaggggatgctgacgccgcacttggaggggatgc 356
to top
>gb|DQ147203.1| Zea mays subsp. parviglumis isolate p12 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 714

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 55  gctgatggcgtaggggacgctgacgccgcacatggaggggatgc 98
           |||||||| |||||||| ||||||||||||| ||||||||||||
Sbjct: 324 gctgatggtgtaggggatgctgacgccgcacttggaggggatgc 281
to top
>gb|DQ147202.1| Zea mays subsp. parviglumis isolate p11 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 648

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 55  gctgatggcgtaggggacgctgacgccgcacatggaggggatgc 98
           |||||||| |||||||| ||||||||||||| ||||||||||||
Sbjct: 423 gctgatggtgtaggggatgctgacgccgcacttggaggggatgc 380
to top
>gb|DQ147201.1| Zea mays subsp. parviglumis isolate p11a phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 829

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 55  gctgatggcgtaggggacgctgacgccgcacatggaggggatgc 98
           |||||||| |||||||| ||||||||||||| ||||||||||||
Sbjct: 436 gctgatggtgtaggggatgctgacgccgcacttggaggggatgc 393
to top
>gb|DQ147199.1| Zea mays subsp. parviglumis isolate p8 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 831

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 55  gctgatggcgtaggggacgctgacgccgcacatggaggggatgc 98
           |||||||| |||||||| ||||||||||||| ||||||||||||
Sbjct: 438 gctgatggtgtaggggatgctgacgccgcacttggaggggatgc 395
to top
>gb|DQ147198.1| Zea mays subsp. parviglumis isolate p6 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 821

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 55  gctgatggcgtaggggacgctgacgccgcacatggaggggatgc 98
           |||||||| |||||||| ||||||||||||| ||||||||||||
Sbjct: 433 gctgatggtgtaggggatgctgacgccgcacttggaggggatgc 390
to top
>gb|DQ147197.1| Zea mays subsp. parviglumis isolate p5 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 832

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 55  gctgatggcgtaggggacgctgacgccgcacatggaggggatgc 98
           |||||||| |||||||| ||||||||||||| ||||||||||||
Sbjct: 436 gctgatggtgtaggggatgctgacgccgcacttggaggggatgc 393
to top
>gb|DQ147196.1| Zea mays subsp. parviglumis isolate p4 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 835

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 55  gctgatggcgtaggggacgctgacgccgcacatggaggggatgc 98
           |||||||| |||||||| ||||||||||||| ||||||||||||
Sbjct: 433 gctgatggtgtaggggatgctgacgccgcacttggaggggatgc 390
to top
>gb|DQ147194.1| Zea mays subsp. parviglumis isolate p2 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 814

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 55  gctgatggcgtaggggacgctgacgccgcacatggaggggatgc 98
           |||||||| |||||||| ||||||||||||| ||||||||||||
Sbjct: 433 gctgatggtgtaggggatgctgacgccgcacttggaggggatgc 390
to top
>gb|DQ147193.1| Zea mays subsp. parviglumis isolate p1 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 831

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 55  gctgatggcgtaggggacgctgacgccgcacatggaggggatgc 98
           |||||||| |||||||| ||||||||||||| ||||||||||||
Sbjct: 434 gctgatggtgtaggggatgctgacgccgcacttggaggggatgc 391
to top
>gb|DQ147192.1| Zea diploperennis isolate d8L phospholipid transfer protein 2
           (plt2) gene, partial cds
          Length = 639

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 55  gctgatggcgtaggggacgctgacgccgcacatggaggggatgc 98
           |||||||| |||||||| ||||||||||||| ||||||||||||
Sbjct: 327 gctgatggtgtaggggatgctgacgccgcacttggaggggatgc 284
to top
>gb|DQ147191.1| Zea diploperennis isolate d7 phospholipid transfer protein 2 (plt2)
           gene, partial cds
          Length = 639

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 55  gctgatggcgtaggggacgctgacgccgcacatggaggggatgc 98
           |||||||| |||||||| ||||||||||||| ||||||||||||
Sbjct: 327 gctgatggtgtaggggatgctgacgccgcacttggaggggatgc 284
to top
>gb|DQ147190.1| Zea diploperennis isolate d5b phospholipid transfer protein 2
           (plt2) gene, partial cds
          Length = 635

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 55  gctgatggcgtaggggacgctgacgccgcacatggaggggatgc 98
           |||||||| |||||||| ||||||||||||| ||||||||||||
Sbjct: 327 gctgatggtgtaggggatgctgacgccgcacttggaggggatgc 284
to top
>gb|DQ147189.1| Zea diploperennis isolate d5 phospholipid transfer protein 2 (plt2)
           gene, partial cds
          Length = 639

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 55  gctgatggcgtaggggacgctgacgccgcacatggaggggatgc 98
           |||||||| |||||||| ||||||||||||| ||||||||||||
Sbjct: 327 gctgatggtgtaggggatgctgacgccgcacttggaggggatgc 284
to top
>gb|DQ147188.1| Zea diploperennis isolate d6 phospholipid transfer protein 2 (plt2)
           gene, partial cds
          Length = 639

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 55  gctgatggcgtaggggacgctgacgccgcacatggaggggatgc 98
           |||||||| |||||||| ||||||||||||| ||||||||||||
Sbjct: 327 gctgatggtgtaggggatgctgacgccgcacttggaggggatgc 284
to top
>gb|DQ147187.1| Zea diploperennis isolate d4 phospholipid transfer protein 2 (plt2)
           gene, partial cds
          Length = 635

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 55  gctgatggcgtaggggacgctgacgccgcacatggaggggatgc 98
           |||||||| |||||||| ||||||||||||| ||||||||||||
Sbjct: 327 gctgatggtgtaggggatgctgacgccgcacttggaggggatgc 284
to top
>gb|DQ147186.1| Zea diploperennis isolate d3b phospholipid transfer protein 2
           (plt2) gene, partial cds
          Length = 635

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 55  gctgatggcgtaggggacgctgacgccgcacatggaggggatgc 98
           |||||||| |||||||| ||||||||||||| ||||||||||||
Sbjct: 327 gctgatggtgtaggggatgctgacgccgcacttggaggggatgc 284
to top
>gb|DQ147185.1| Zea diploperennis isolate d3a phospholipid transfer protein 2
           (plt2) gene, partial cds
          Length = 635

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 55  gctgatggcgtaggggacgctgacgccgcacatggaggggatgc 98
           |||||||| |||||||| ||||||||||||| ||||||||||||
Sbjct: 327 gctgatggtgtaggggatgctgacgccgcacttggaggggatgc 284
to top
>gb|DQ147184.1| Zea diploperennis isolate d2 phospholipid transfer protein 2 (plt2)
           gene, partial cds
          Length = 639

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 55  gctgatggcgtaggggacgctgacgccgcacatggaggggatgc 98
           |||||||| |||||||| ||||||||||||| ||||||||||||
Sbjct: 327 gctgatggtgtaggggatgctgacgccgcacttggaggggatgc 284
to top
>gb|DQ147183.1| Zea diploperennis isolate d1b phospholipid transfer protein 2
           (plt2) gene, partial cds
          Length = 613

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 55  gctgatggcgtaggggacgctgacgccgcacatggaggggatgc 98
           |||||||| |||||||| ||||||||||||| ||||||||||||
Sbjct: 301 gctgatggtgtaggggatgctgacgccgcacttggaggggatgc 258
to top
>gb|DQ147182.1| Zea diploperennis isolate d1a phospholipid transfer protein 2 (pl2)
           gene, partial cds
          Length = 613

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 55  gctgatggcgtaggggacgctgacgccgcacatggaggggatgc 98
           |||||||| |||||||| ||||||||||||| ||||||||||||
Sbjct: 301 gctgatggtgtaggggatgctgacgccgcacttggaggggatgc 258
to top
>gb|DQ147181.1| Zea mays subsp. parviglumis isolate p15 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 826

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 55  gctgatggcgtaggggacgctgacgccgcacatggaggggatgc 98
           |||||||| |||||||| ||||||||||||| ||||||||||||
Sbjct: 398 gctgatggtgtaggggatgctgacgccgcacttggaggggatgc 355
to top
>gb|DQ147180.1| Zea mays subsp. parviglumis isolate p14 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 822

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 55  gctgatggcgtaggggacgctgacgccgcacatggaggggatgc 98
           |||||||| |||||||| ||||||||||||| ||||||||||||
Sbjct: 398 gctgatggtgtaggggatgctgacgccgcacttggaggggatgc 355
to top
>gb|DQ147179.1| Zea mays subsp. parviglumis isolate p13 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 829

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 55  gctgatggcgtaggggacgctgacgccgcacatggaggggatgc 98
           |||||||| |||||||| ||||||||||||| ||||||||||||
Sbjct: 397 gctgatggtgtaggggatgctgacgccgcacttggaggggatgc 354
to top
>gb|DQ147178.1| Zea mays subsp. parviglumis isolate p12G phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 816

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 55  gctgatggcgtaggggacgctgacgccgcacatggaggggatgc 98
           |||||||| |||||||| ||||||||||||| ||||||||||||
Sbjct: 398 gctgatggtgtaggggatgctgacgccgcacttggaggggatgc 355
to top
>gb|DQ147177.1| Zea mays subsp. parviglumis isolate p11 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 824

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 55  gctgatggcgtaggggacgctgacgccgcacatggaggggatgc 98
           |||||||| |||||||| ||||||||||||| ||||||||||||
Sbjct: 398 gctgatggtgtaggggatgctgacgccgcacttggaggggatgc 355
to top
>gb|DQ147176.1| Zea mays subsp. parviglumis isolate p9 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 826

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 55  gctgatggcgtaggggacgctgacgccgcacatggaggggatgc 98
           |||||||| |||||||| ||||||||||||| ||||||||||||
Sbjct: 398 gctgatggtgtaggggatgctgacgccgcacttggaggggatgc 355
to top
>gb|DQ147175.1| Zea mays subsp. parviglumis isolate p8 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 818

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 55  gctgatggcgtaggggacgctgacgccgcacatggaggggatgc 98
           |||||||| |||||||| ||||||||||||| ||||||||||||
Sbjct: 398 gctgatggtgtaggggatgctgacgccgcacttggaggggatgc 355
to top
>gb|DQ147174.1| Zea mays subsp. parviglumis isolate p6U phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 822

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 55  gctgatggcgtaggggacgctgacgccgcacatggaggggatgc 98
           |||||||| |||||||| ||||||||||||| ||||||||||||
Sbjct: 398 gctgatggtgtaggggatgctgacgccgcacttggaggggatgc 355
to top
>gb|DQ147173.1| Zea mays subsp. parviglumis isolate p6L phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 824

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 55  gctgatggcgtaggggacgctgacgccgcacatggaggggatgc 98
           |||||||| |||||||| ||||||||||||| ||||||||||||
Sbjct: 398 gctgatggtgtaggggatgctgacgccgcacttggaggggatgc 355
to top
>gb|DQ147171.1| Zea mays subsp. parviglumis isolate p4 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 832

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 55  gctgatggcgtaggggacgctgacgccgcacatggaggggatgc 98
           |||||||| |||||||| ||||||||||||| ||||||||||||
Sbjct: 398 gctgatggtgtaggggatgctgacgccgcacttggaggggatgc 355
to top
>gb|DQ147170.1| Zea mays subsp. parviglumis isolate p3 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 820

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 55  gctgatggcgtaggggacgctgacgccgcacatggaggggatgc 98
           |||||||| |||||||| ||||||||||||| ||||||||||||
Sbjct: 398 gctgatggtgtaggggatgctgacgccgcacttggaggggatgc 355
to top
>gb|DQ147169.1| Zea mays subsp. parviglumis isolate p2 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 824

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 55  gctgatggcgtaggggacgctgacgccgcacatggaggggatgc 98
           |||||||| |||||||| ||||||||||||| ||||||||||||
Sbjct: 398 gctgatggtgtaggggatgctgacgccgcacttggaggggatgc 355
to top
>gb|M57249.1|MZEPLTPA Maize phospholipid transfer protein mRNA, 3' end
          Length = 677

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 55  gctgatggcgtaggggacgctgacgccgcacatggaggggatgc 98
           |||||||| |||||||| ||||||||||||| ||||||||||||
Sbjct: 247 gctgatggtgtaggggatgctgacgccgcacttggaggggatgc 204
to top
>gb|J04176.1|MZEPLTP Maize phospholipid transfer protein mRNA, complete cds. of clone
           9C2
          Length = 813

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 55  gctgatggcgtaggggacgctgacgccgcacatggaggggatgc 98
           |||||||| |||||||| ||||||||||||| ||||||||||||
Sbjct: 434 gctgatggtgtaggggatgctgacgccgcacttggaggggatgc 391
to top
>emb|X68655.1|HVCW18 H.vulgare Cw-18 mRNA
          Length = 732

 Score = 61.9 bits (31), Expect = 7e-07
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                          
Query: 53  gcgctgatggcgtaggggacgctgacgccgcacatggaggggatgcc 99
           |||||||| | ||||||||||||||| |||||| |||||||||||||
Sbjct: 393 gcgctgatcgtgtaggggacgctgaccccgcacctggaggggatgcc 347
to top
>gb|AF051369.1|AF051369 Oryza sativa lipid transfer protein mRNA, complete cds
          Length = 766

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                 
Query: 49  ggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatgccggc 102
           ||||| |||||| |||||||||| | |||| |||||| ||||||||||||||||
Sbjct: 373 ggaagggctgatagcgtaggggatgttgaccccgcacttggaggggatgccggc 320
to top
>dbj|D10955.1|RIC323PTP Oryza sativa mRNA for phospholipid trasfer protein
          Length = 372

 Score = 56.0 bits (28), Expect = 5e-05
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                               
Query: 49  ggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatgccg 100
           ||||| ||||||| ||||||||| | ||||| ||||| ||||||||||||||
Sbjct: 130 ggaagggctgatgccgtaggggatgttgacgtcgcacttggaggggatgccg 79
to top
>gb|AY662492.1| Hordeum vulgare subsp. vulgare non-specific lipid transfer protein 6
            (Ltp6) gene, promoter and complete cds
          Length = 3257

 Score = 56.0 bits (28), Expect = 5e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                            
Query: 55   gctgatggcgtaggggacgctgacgccgcacatggaggggatgccggc 102
            ||||||||||||||||| | ||||||||||| ||  ||||||||||||
Sbjct: 2770 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggc 2723
to top
>gb|DQ147207.1| Zea diploperennis isolate d2 phospholipid transfer protein 1 (plt1)
           gene, partial cds
          Length = 699

 Score = 56.0 bits (28), Expect = 5e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 55  gctgatggcgtaggggacgctgacgccgcacatggaggggatgc 98
           |||||||| |||||||| ||||||||||||| ||||||| ||||
Sbjct: 301 gctgatggtgtaggggatgctgacgccgcacttggagggtatgc 258
to top
>gb|DQ147200.1| Zea mays subsp. parviglumis isolate p9 phospholipid transfer
           protein 1 (plt1) gene, partial cds
          Length = 709

 Score = 56.0 bits (28), Expect = 5e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 55  gctgatggcgtaggggacgctgacgccgcacatggaggggatgc 98
           ||||||||  ||||||| ||||||||||||| ||||||||||||
Sbjct: 302 gctgatggtataggggatgctgacgccgcacttggaggggatgc 259
to top
>gb|DQ147195.1| Zea mays subsp. parviglumis isolate p3 phospholipid transfer
           protein 1 (plt1) gene, partial cds
          Length = 686

 Score = 56.0 bits (28), Expect = 5e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 55  gctgatggcgtaggggacgctgacgccgcacatggaggggatgc 98
           |||||||| |||||||| ||||||||| ||| ||||||||||||
Sbjct: 303 gctgatggtgtaggggatgctgacgccacacttggaggggatgc 260
to top
>gb|DQ147172.1| Zea mays subsp. parviglumis isolate p5_U phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 824

 Score = 56.0 bits (28), Expect = 5e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 55  gctgatggcgtaggggacgctgacgccgcacatggaggggatgc 98
           |||||||| |||||||| ||||||||||||| |||| |||||||
Sbjct: 398 gctgatggtgtaggggatgctgacgccgcacttggacgggatgc 355
to top
>gb|DQ147168.1| Zea mays subsp. parviglumis isolate p1 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 824

 Score = 56.0 bits (28), Expect = 5e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 55  gctgatggcgtaggggacgctgacgccgcacatggaggggatgc 98
           |||||||| |||||||| ||||||||||||| |||| |||||||
Sbjct: 398 gctgatggtgtaggggatgctgacgccgcacttggacgggatgc 355
to top
>gb|U31766.1|OSU31766 Oryza sativa lipid transfer protein precursor (LTP2) mRNA, complete
           cds
          Length = 840

 Score = 52.0 bits (26), Expect = 7e-04
 Identities = 52/61 (85%)
 Strand = Plus / Minus

                                                                       
Query: 38  gagcantcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 97
           ||||| |||| ||| | |||||||| ||||||||   ||||||||||| |||||||||||
Sbjct: 414 gagcagtcgatggaggggctgatggtgtaggggatcgtgacgccgcacttggaggggatg 355

            
Query: 98  c 98
           |
Sbjct: 354 c 354
to top
>gb|AY789644.1| Triticum aestivum lipid transfer protein 4 (LTP4) mRNA, complete
           cds
          Length = 345

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 64  gtaggggacgctgacgccgcacatggaggggat 96
           ||||||||||||||||| |||| ||||||||||
Sbjct: 309 gtaggggacgctgacgcggcacttggaggggat 277



 Score = 46.1 bits (23), Expect = 0.044
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 122 cccaccancagcgctcttgatgcacttgcacgccgcttgtttgtcagcgg 171
           ||||||  |||| ||||||||||||  |||||||||||  ||||||||||
Sbjct: 252 cccaccggcagcactcttgatgcacaggcacgccgctttcttgtcagcgg 203
to top
>gb|AY057932.1| Bromus inermis nonspecific lipid transfer protein (BG14) mRNA,
           complete cds
          Length = 841

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 57  tgatggcgtaggggacgctgacgccgcacatggaggggatgccggc 102
           |||||||||||||||   ||||||||||| ||  ||||||||||||
Sbjct: 401 tgatggcgtaggggatattgacgccgcacttgctggggatgccggc 356
to top
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 42.1 bits (21), Expect = 0.69
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 162      ttgtcagcggtgctctgggca 182
                |||||||||||||||||||||
Sbjct: 11569463 ttgtcagcggtgctctgggca 11569483
to top
>dbj|AP005383.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
              clone:OJ1034_C08
          Length = 154441

 Score = 42.1 bits (21), Expect = 0.69
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 162    ttgtcagcggtgctctgggca 182
              |||||||||||||||||||||
Sbjct: 123597 ttgtcagcggtgctctgggca 123617
to top
>dbj|AP004694.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
             clone:P0467G09
          Length = 158204

 Score = 42.1 bits (21), Expect = 0.69
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 162   ttgtcagcggtgctctgggca 182
             |||||||||||||||||||||
Sbjct: 29734 ttgtcagcggtgctctgggca 29754


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 782,560
Number of Sequences: 3902068
Number of extensions: 782560
Number of successful extensions: 45804
Number of sequences better than 10.0: 114
Number of HSP's better than 10.0 without gapping: 116
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 45438
Number of HSP's gapped (non-prelim): 351
length of query: 215
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 193
effective length of database: 17,147,199,772
effective search space: 3309409555996
effective search space used: 3309409555996
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top