ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd25a03
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|U86763.1|TAU86763 Triticum aestivum delta-type tonoplast intr... 482 e-133
2gb|AY525640.1| Triticum aestivum delta tonoplast intrinsic prote... 472 e-130
3gb|AY525641.1| Triticum aestivum delta tonoplast intrinsic prote... 468 e-129
4gb|AY525639.1| Triticum aestivum delta tonoplast intrinsic prote... 464 e-127
5dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 355 8e-95
6dbj|AP005449.3| Oryza sativa (japonica cultivar-group) genomic D... 355 8e-95
7dbj|AP004784.3| Oryza sativa (japonica cultivar-group) genomic D... 355 8e-95
8dbj|AK104464.1| Oryza sativa (japonica cultivar-group) cDNA clon... 355 8e-95
9dbj|AK104270.1| Oryza sativa (japonica cultivar-group) cDNA clon... 355 8e-95
10dbj|AK099616.1| Oryza sativa (japonica cultivar-group) cDNA clon... 355 8e-95
11dbj|AK099141.1| Oryza sativa (japonica cultivar-group) cDNA clon... 355 8e-95
12dbj|AK099015.1| Oryza sativa (japonica cultivar-group) cDNA clon... 355 8e-95
13dbj|AK073531.1| Oryza sativa (japonica cultivar-group) cDNA clon... 355 8e-95
14dbj|AK104377.1| Oryza sativa (japonica cultivar-group) cDNA clon... 347 2e-92
15dbj|AK100193.1| Oryza sativa (japonica cultivar-group) cDNA clon... 347 2e-92
16gb|AF326502.1|AF326502 Zea mays tonoplast membrane integral prot... 224 2e-55
17gb|AF326501.1|AF326501 Zea mays tonoplast membrane integral prot... 214 2e-52
18gb|AY105015.1| Zea mays PCO137646 mRNA sequence 214 2e-52
19ref|XM_467137.1| Oryza sativa (japonica cultivar-group), mRNA 186 4e-44
20dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 186 4e-44
21dbj|AP005006.3| Oryza sativa (japonica cultivar-group) genomic D... 186 4e-44
22dbj|AP005289.2| Oryza sativa (japonica cultivar-group) genomic D... 186 4e-44
23dbj|AB114830.1| Oryza sativa (japonica cultivar-group) OsTIP2 mR... 186 4e-44
24dbj|AK064728.1| Oryza sativa (japonica cultivar-group) cDNA clon... 186 4e-44
25emb|AJ307662.1|OSA307662 Oryza sativa genomic DNA fragment, chro... 186 4e-44
26gb|AY106931.1| Zea mays PCO140073 mRNA sequence 174 2e-40
27gb|AF057183.1|AF057183 Zea mays putative tonoplast aquaporin mRN... 174 2e-40
28gb|AY243804.1| Zea mays tonoplast water channel mRNA, complete cds 167 4e-38
29gb|AF326503.1|AF326503 Zea mays tonoplast membrane integral prot... 167 4e-38
30emb|X80266.1|HVGTIPP H.vulgare mRNA for gamma-TIP-like protein 149 9e-33
31ref|XM_473424.1| Oryza sativa (japonica cultivar-group), predic... 143 6e-31
32emb|AL663000.4|OSJN00201 Oryza sativa genomic DNA, chromosome 4,... 143 6e-31
33dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 143 6e-31
34emb|AJ005078.2|PAAJ5078 Picea abies mRNA for aquaporin-like protein 141 2e-30
35gb|AF254799.1|AF254799 Hordeum vulgare tonoplast intrinsic prote... 137 3e-29
36ref|XM_470213.1| Oryza sativa (japonica cultivar-group), predic... 121 2e-24
37gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 121 2e-24
38emb|AJ242805.1|SST242805 Sporobolus stapfianus mRNA for putative... 121 2e-24
39gb|AC090485.3|AC090485 Genomic Sequence for Oryza sativa, Nippon... 121 2e-24
40dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 121 2e-24
41dbj|D25534.1|RICYK333 Oryza sativa yk333 mRNA for gamma-Tip, com... 121 2e-24
42dbj|AK110727.1| Oryza sativa (japonica cultivar-group) cDNA clon... 121 2e-24
43dbj|AK104123.1| Oryza sativa (japonica cultivar-group) cDNA clon... 121 2e-24
44dbj|AK068986.1| Oryza sativa (japonica cultivar-group) cDNA clon... 121 2e-24
45dbj|AK059438.1| Oryza sativa (japonica cultivar-group) cDNA clon... 121 2e-24
46dbj|AK058322.1| Oryza sativa (japonica cultivar-group) cDNA clon... 121 2e-24
47gb|U86762.1|TAU86762 Triticum aestivum gamma-type tonoplast intr... 117 3e-23
48ref|NM_189497.1| Oryza sativa (japonica cultivar-group), predic... 98 3e-17
49gb|AY243803.1| Zea mays tonoplast water channel (TIP1-1) mRNA, c... 98 3e-17
50dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 98 3e-17
51dbj|AP003627.3| Oryza sativa (japonica cultivar-group) genomic D... 98 3e-17
52dbj|AK111768.1| Oryza sativa (japonica cultivar-group) cDNA clon... 98 3e-17
53dbj|AK111747.1| Oryza sativa (japonica cultivar-group) cDNA clon... 98 3e-17
54dbj|AB114829.1| Oryza sativa (japonica cultivar-group) OsTIP1 mR... 98 3e-17
55ref|NM_112495.2| Arabidopsis thaliana DELTA-TIP; water channel A... 96 1e-16
56ref|NM_112496.2| Arabidopsis thaliana electron carrier/ electron... 96 1e-16
57gb|AY081622.1| Arabidopsis thaliana delta tonoplast intrinsic pr... 96 1e-16
58gb|AY065181.1| Arabidopsis thaliana delta tonoplast intrinsic pr... 96 1e-16
59emb|BX823177.1|CNS0A5ZD Arabidopsis thaliana Full-length cDNA Co... 96 1e-16
60emb|BX823081.1|CNS0A5VY Arabidopsis thaliana Full-length cDNA Co... 96 1e-16
61emb|BX823757.1|CNS0A5CX Arabidopsis thaliana Full-length cDNA Co... 96 1e-16
62gb|AY085921.1| Arabidopsis thaliana clone 19689 mRNA, complete s... 96 1e-16
63dbj|AB023046.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 96 1e-16
64gb|U39485.1|ATU39485 Arabidopsis thaliana delta tonoplast integr... 96 1e-16
65gb|AF271661.1|AF271661 Vitis berlandieri x Vitis rupestris putat... 92 2e-15
66gb|AF326500.1|AF326500 Zea mays tonoplast membrane integral prot... 90 7e-15
67gb|AY112388.1| Zea mays CL24208_1 mRNA sequence 90 7e-15
68gb|AF037061.1|AF037061 Zea mays tonoplast intrinsic protein (ZmT... 90 7e-15
69dbj|AB010416.1| Raphanus sativus VIP3 mRNA for delta-VM23, compl... 88 3e-14
70gb|BT016300.1| Zea mays clone Contig133 mRNA sequence 86 1e-13
71gb|AY104464.1| Zea mays PCO114899 mRNA sequence 86 1e-13
72emb|AJ289866.2|VVI289866 Vitis vinifera mRNA for putative aquapo... 84 4e-13
73gb|U62778.1|GHU62778 Gossypium hirsutum delta-tonoplast intrinsi... 78 3e-11
74gb|U39486.1|ATU39486 Arabidopsis thaliana delta tonoplast integr... 78 3e-11
75gb|AF133532.1|AF133532 Mesembryanthemum crystallinum water chann... 70 7e-09
76gb|AF047173.1| Vernicia fordii aquaporin mRNA, complete cds 68 3e-08
77gb|AY389618.1| Hyacinthus orientalis mitochondrial tonoplast int... 66 1e-07
78gb|AC183494.1| Brassica oleracea Contig C, complete sequence 64 4e-07
79dbj|AB000506.1| Carrot mRNA for root specific gene, complete cds 64 4e-07
80gb|AF326505.1|AF326505 Zea mays tonoplast membrane integral prot... 62 2e-06
81gb|AF009567.1|AF009567 Gossypium hirsutum delta-TIP homolog (MIP... 62 2e-06
82emb|AJ314583.1|POC314583 Posidonia oceanica mRNA for putative to... 60 6e-06
83emb|AJ289696.1|POC289696 Posidonia oceanica partial mRNA for put... 60 6e-06
84gb|AF290618.1|AF290618 Nicotiana glauca putative delta TIP (MIP2... 60 6e-06
85ref|NM_188624.1| Oryza sativa (japonica cultivar-group), Ozsa822... 58 3e-05
86dbj|AP001550.1| Oryza sativa (japonica cultivar-group) genomic D... 58 3e-05
87dbj|AK069192.1| Oryza sativa (japonica cultivar-group) cDNA clon... 58 3e-05
88ref|NM_124117.2| Arabidopsis thaliana AtTIP2;3; water channel AT... 56 1e-04
89gb|BT011663.1| Arabidopsis thaliana At5g47450 mRNA, complete cds 56 1e-04
90gb|BT011212.1| Arabidopsis thaliana At5g47450 gene, complete cds 56 1e-04
91gb|AC183495.1| Brassica oleracea Contig A, complete sequence 56 1e-04
92gb|AF326508.1|AF326508 Zea mays tonoplast membrane integral prot... 56 1e-04
93emb|BX824373.1|CNS0A6WG Arabidopsis thaliana Full-length cDNA Co... 56 1e-04
94emb|BX822968.1|CNS0A5UC Arabidopsis thaliana Full-length cDNA Co... 56 1e-04
95dbj|AB025628.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 56 1e-04
96gb|L12257.1|SOYNODA Glycine max nodulin-26 mRNA, complete cds 56 1e-04
97ref|NM_117838.2| Arabidopsis thaliana DELTA-TIP2/TIP2;2; water c... 52 0.002
98emb|Z97343.1|ATFCA8 Arabidopsis thaliana DNA chromosome 4, ESSA ... 52 0.002
99emb|AL161546.2|ATCHRIV46 Arabidopsis thaliana DNA chromosome 4, ... 52 0.002
100gb|AY056063.1| Arabidopsis thaliana AT4g17340/dl4705w mRNA, comp... 52 0.002
101gb|AF367283.1|AF367283 Arabidopsis thaliana AT4g17340/dl4705w mR... 52 0.002
102emb|BX825196.1|CNS0A4OU Arabidopsis thaliana Full-length cDNA Co... 52 0.002
103emb|BX828364.1|CNS0A340 Arabidopsis thaliana Full-length cDNA Co... 52 0.002
104gb|AY088929.1| Arabidopsis thaliana clone 99796 mRNA, complete s... 52 0.002
105ref|NM_113559.3| Arabidopsis thaliana TIP2 (TONOPLAST INTRINSIC ... 48 0.025
106gb|DQ450071.1| Arachis hypogaea clone 8A4R19G1 putative major in... 48 0.025
107gb|DQ450067.1| Arachis hypogaea clone 2A1R19GZ delta-TIP-like pr... 48 0.025
108emb|X95650.1|TGTIP1GEN T.gesneriana mRNA for tonoplast intrinsic... 48 0.025
109emb|AJ243309.1|PSA243309 Pisum sativum mRNA for putative tonopla... 48 0.025
110gb|AY079114.1| Arabidopsis thaliana AT3g26520/MFE16_3 mRNA, comp... 48 0.025
111gb|AF419613.1|AF419613 Arabidopsis thaliana AT3g26520/MFE16_3 mR... 48 0.025
112gb|AF428341.1|AF428341 Arabidopsis thaliana AT3g26520/MFE16_3 mR... 48 0.025
113gb|AF004393.1|AF004393 Arabidopsis thaliana salt-stress induced ... 48 0.025
114gb|AF326509.1|AF326509 Zea mays tonoplast membrane integral prot... 48 0.025
115emb|BX822807.1|CNS0A75T Arabidopsis thaliana Full-length cDNA Co... 48 0.025
116emb|BX822624.1|CNS0A742 Arabidopsis thaliana Full-length cDNA Co... 48 0.025
117emb|BX824073.1|CNS0A6T2 Arabidopsis thaliana Full-length cDNA Co... 48 0.025
118emb|BX822975.1|CNS0A733 Arabidopsis thaliana Full-length cDNA Co... 48 0.025
119emb|BX824311.1|CNS0A6PE Arabidopsis thaliana Full-length cDNA Co... 48 0.025
120emb|BX823637.1|CNS0A6I3 Arabidopsis thaliana Full-length cDNA Co... 48 0.025
121emb|BX823607.1|CNS0A6MK Arabidopsis thaliana Full-length cDNA Co... 48 0.025
122dbj|AB028611.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 48 0.025
123dbj|AK060994.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.025
124gb|AF118381.1|AF118381 Brassica napus tonoplast intrinsic protei... 48 0.025
125dbj|D84669.1| Raphanus sativus mRNA for VM23, complete sequence 48 0.025
126dbj|AB012270.1| Aster tripolium mRNA for SAMIPD, partial cds 48 0.025
127ref|XM_470886.1| Oryza sativa (japonica cultivar-group), mRNA 46 0.097
128gb|AC091787.6| Oryza sativa (japonica cultivar-group) chromosome... 46 0.097
129emb|AL606622.3|OSJN00059 Oryza sativa genomic DNA, chromosome 4,... 46 0.097
130gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome 46 0.097
131emb|BX822304.1|CNS0A7A0 Arabidopsis thaliana Full-length cDNA Co... 46 0.097
132emb|BX823744.1|CNS0A6NJ Arabidopsis thaliana Full-length cDNA Co... 46 0.097
133dbj|AB206106.1| Mimosa pudica tip2;1 mRNA for tonoplast intrinsi... 46 0.097
134dbj|AK107457.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.097
135gb|AF057137.1|AF057137 Arabidopsis thaliana gamma tonoplast intr... 46 0.097
136dbj|AB012269.1| Aster tripolium mRNA for SAMIPC, partial cds 46 0.097
137ref|XM_856403.1| PREDICTED: Canis familiaris similar to aquapori... 44 0.39
138ref|XM_845359.1| PREDICTED: Canis familiaris similar to aquapori... 44 0.39
139emb|AJ245953.1|SOL245953 Spinacia oleracea mRNA for delta tonopl... 44 0.39
140gb|DQ226889.1| Boechera divaricarpa isolate SLW-D-E07 mRNA sequence 42 1.5
141ref|XM_001003742.1| PREDICTED: Mus musculus aquaporin 6 (Aqp6), ... 42 1.5
142ref|XM_994651.1| PREDICTED: Mus musculus aquaporin 6 (Aqp6), mRNA 42 1.5
143ref|XM_543677.2| PREDICTED: Canis familiaris similar to Aquapori... 42 1.5
144gb|AF521142.1| Kandelia candel tonoplast intrinsic protein mRNA,... 42 1.5
145emb|Z29946.1|TRGTIPLP T.repens (Huia) mRNA for gamma-Tip-like pr... 42 1.5
146emb|BX569693.1| Synechococcus sp. WH8102 complete genome; segmen... 42 1.5
147dbj|AK082699.1| Mus musculus 0 day neonate cerebellum cDNA, RIKE... 42 1.5
148emb|BX823199.1|CNS0A7SU Arabidopsis thaliana Full-length cDNA Co... 42 1.5
149emb|BX822791.1|CNS0A7SC Arabidopsis thaliana Full-length cDNA Co... 42 1.5
150emb|BX842163.1|CNS09YDT Arabidopsis thaliana Full-length cDNA Co... 42 1.5
151emb|BX842138.1|CNS09YDN Arabidopsis thaliana Full-length cDNA Co... 42 1.5
152emb|AJ555456.1|ECA555456 Equus caballus partial mRNA for aquapor... 42 1.5
153gb|AY610211.1| Sus scrofa clone Clu_9762.scr.msk.p1.Contig1, mRN... 42 1.5
154gb|AC139317.4| Mus musculus BAC clone RP24-495N6 from 15, comple... 42 1.5
155ref|NM_175087.2| Mus musculus aquaporin 6 (Aqp6), mRNA 42 1.5
156dbj|AB048248.1| Pyrus communis Py-gTIP mRNA for gamma tonoplast ... 42 1.5
157dbj|AB012271.1| Aster tripolium mRNA for SAMIPE, partial cds 42 1.5
158dbj|AB012267.1| Aster tripolium mRNA for SAMIPA, partial cds 42 1.5
159ref|NM_129238.2| Arabidopsis thaliana GAMMA-TIP; water channel A... 40 6.0
160gb|AC130604.4| Oryza sativa (japonica cultivar-group) chromosome... 40 6.0
161gb|CP000151.1| Burkholderia sp. 383 chromosome 1, complete sequence 40 6.0
162gb|AC108873.2| Oryza sativa (japonica cultivar-group) chromosome... 40 6.0
163gb|AC006012.2| Homo sapiens PAC clone RP5-942I16 from 7, complet... 40 6.0
164gb|AC137077.26| Medicago truncatula clone mth2-8g15, complete se... 40 6.0
165emb|X72581.1|ATGTIPMR A.thaliana mRNA for tonoplast intrinsic pr... 40 6.0
166emb|X63552.1|ATGTIPARA A.thaliana gene for tonoplast intrinsic p... 40 6.0
167gb|AY059134.1| Arabidopsis thaliana putative aquaporin (At2g3683... 40 6.0
168gb|AF370172.1| Arabidopsis thaliana putative tonoplast intrinsic... 40 6.0
169emb|X54854.1|ATROOTSP A. thaliana mRNA for root-specific gene 40 6.0
170emb|BX640419.1| Bordetella pertussis strain Tohama I, complete g... 40 6.0
171gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome 40 6.0
172gb|U92651.2|BOU92651 Brassica oleracea var. botrytis tonoplast i... 40 6.0
173gb|AC006922.7| Arabidopsis thaliana chromosome 2 clone T1J8 map ... 40 6.0
174gb|AC073589.6| Mus musculus strain C57BL/6J chromosome 12 clone ... 40 6.0
175gb|CP000264.1| Jannaschia sp. CCS1, complete genome 40 6.0
176dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.0
177dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.0
178dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.0
179emb|BX819301.1|CNS0AA93 Arabidopsis thaliana Full-length cDNA Co... 40 6.0
180emb|BX819066.1|CNS0AA99 Arabidopsis thaliana Full-length cDNA Co... 40 6.0
181emb|BX818765.1|CNS0AA8G Arabidopsis thaliana Full-length cDNA Co... 40 6.0
182emb|BX819619.1|CNS0A8TV Arabidopsis thaliana Full-length cDNA Co... 40 6.0
183emb|BX819585.1|CNS0A8ZS Arabidopsis thaliana Full-length cDNA Co... 40 6.0
184emb|BX819242.1|CNS0A8YI Arabidopsis thaliana Full-length cDNA Co... 40 6.0
185emb|BX818836.1|CNS0A8V6 Arabidopsis thaliana Full-length cDNA Co... 40 6.0
186emb|BX818785.1|CNS0A8WQ Arabidopsis thaliana Full-length cDNA Co... 40 6.0
187emb|BX820166.1|CNS0A8IR Arabidopsis thaliana Full-length cDNA Co... 40 6.0
188emb|BX825064.1|CNS0A6TA Arabidopsis thaliana Full-length cDNA Co... 40 6.0
189gb|AY087558.1| Arabidopsis thaliana clone 36633 mRNA, complete s... 40 6.0
190gb|AF497482.1| Micromonospora echinospora calicheamicin biosynth... 40 6.0
191dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.0
192dbj|AP005400.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.0
193dbj|AP004772.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.0
194dbj|AB126924.1| Prunus persica Pr-gTIP1 mRNA for tonoplast intri... 40 6.0
195dbj|AK101995.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.0
196gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, c... 40 6.0
197tpe|BN000872.1| TPA: TPA_exp: Mus musculus immunoglobulin heavy ... 40 6.0
198gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete ge... 40 6.0
199gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 40 6.0
200emb|AL731883.4|CNS08C8N Oryza sativa chromosome 12, . BAC OSJNBa... 40 6.0
201gb|U43291.1|MCU43291 Mesembryanthemum crystallinum tonoplast int... 40 6.0
202gb|M84344.1|ATHGTIP Arabidopsis thaliana tonoplast intrinsic pro... 40 6.0

>gb|U86763.1|TAU86763 Triticum aestivum delta-type tonoplast intrinsic protein mRNA,
           complete cds
          Length = 1067

 Score =  482 bits (243), Expect = e-133
 Identities = 375/420 (89%), Gaps = 17/420 (4%)
 Strand = Plus / Minus

                                                                       
Query: 35  gcttngatctgaaccaaacaacatgacgttcttcacatcatcgagacattc-------tg 87
           |||| |||||||||||||||||| || ||||||||||||||||| ||||||       ||
Sbjct: 932 gcttcgatctgaaccaaacaacaggatgttcttcacatcatcgaaacattcgtgagactg 873

                                                                       
Query: 88  accaccacgcacgcacttttttatgttgccgaaggcatcatggaaaccaaacaccgaacg 147
            |||||||| ||||||||||| |||||||||||||||| |||||         |||||||
Sbjct: 872 cccaccacgtacgcacttttt-atgttgccgaaggcattatgga---------ccgaacg 823

                                                                       
Query: 148 acccttcacatggatggcttagtagtcgttgctggcgacgggggtgtggttgtcgcacat 207
           || |||| ||||| |||||||||||||||||| |||||||||| |||||| ||| |||||
Sbjct: 822 actcttcccatggctggcttagtagtcgttgccggcgacggggctgtggtcgtcccacat 763

                                                                       
Query: 208 gtacaggtaccggtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 267
           ||| ||||| ||||| |||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 762 gtataggtatcggtaaacgacgccggcgaggccaccgccgatgagcgggccggcccagta 703

                                                                       
Query: 268 gatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggtt 327
            | ||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 702 aacccaaatgttggtgaagtcgccgctggcaacggcggggccgaaggagcgtgcagggtt 643

                                                                       
Query: 328 catggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaaaccgat 387
           |||||| |||||||| ||||||||||| |||||||||||||| ||||| ||||| |||||
Sbjct: 642 catggacccgccggaaaaggggccggccacgaggatgttggcgccgacaatgaagccgat 583

                                                                       
Query: 388 ggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcgtacac 447
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 582 ggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcgtacac 523



to top

>gb|AY525640.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;2 mRNA,
           complete cds
          Length = 853

 Score =  472 bits (238), Expect = e-130
 Identities = 271/282 (96%)
 Strand = Plus / Minus

                                                                       
Query: 166 ttagtagtcgttgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagac 225
           |||||||||||||| |||||||| | |||||| |||||||||||||| ||||||||||||
Sbjct: 801 ttagtagtcgttgccggcgacggagctgtggtcgtcgcacatgtacacgtaccggtagac 742

                                                                       
Query: 226 gatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaa 285
           || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 741 gacgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaa 682

                                                                       
Query: 286 gtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaa 345
           ||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||
Sbjct: 681 gtcgccgctggcaacggcggggccgaaggagcgtgcagggttcatggacccgccggagaa 622

                                                                       
Query: 346 ggggccggcaacgaggatgttggccccgacgatgaaaccgatggcgatgggggcgatggt 405
           |||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 621 ggggccggcaacgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatggt 562

                                                     
Query: 406 gccgagggatcccttcttggggtcggcggcggtggcgtacac 447
           ||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 561 gccgagggaacccttcttggggtcggcggcggtggcgtacac 520



to top

>gb|AY525641.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;3 mRNA,
           complete cds
          Length = 829

 Score =  468 bits (236), Expect = e-129
 Identities = 272/284 (95%)
 Strand = Plus / Minus

                                                                       
Query: 164 gcttagtagtcgttgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtag 223
           |||||||||||||||| |||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 800 gcttagtagtcgttgccggcgacggcggtgtggtcgtcgcacatgtacaggtaccggtag 741

                                                                       
Query: 224 acgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtg 283
           |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 740 acgacgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtg 681

                                                                       
Query: 284 aagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggag 343
           ||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||
Sbjct: 680 aagtcgccgctggcaacggcggggccgaaggagcgtgcagggttcatggacccgccggag 621

                                                                       
Query: 344 aaggggccggcaacgaggatgttggccccgacgatgaaaccgatggcgatgggggcgatg 403
           ||||||||||| |||||||||||||| ||||||||||| ||||||||||| || ||||||
Sbjct: 620 aaggggccggcgacgaggatgttggcgccgacgatgaagccgatggcgattggagcgatg 561

                                                       
Query: 404 gtgccgagggatcccttcttggggtcggcggcggtggcgtacac 447
           ||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 560 gtgccgagggaccccttcttggggtcggcggcggtggcgtacac 517



to top

>gb|AY525639.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;1 mRNA,
           complete cds
          Length = 817

 Score =  464 bits (234), Expect = e-127
 Identities = 273/286 (95%)
 Strand = Plus / Minus

                                                                       
Query: 162 tggcttagtagtcgttgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggt 221
           |||||||||||||||||| |||||||| | |||||| |||||||||||| ||||| ||||
Sbjct: 806 tggcttagtagtcgttgccggcgacggagctgtggtcgtcgcacatgtataggtatcggt 747

                                                                       
Query: 222 agacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttgg 281
           |||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 746 agacgacgccggcgaggccaccgccgatgagcgggccggcccagtagacccagatgttgg 687

                                                                       
Query: 282 tgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccgg 341
           ||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||
Sbjct: 686 tgaagtcgccgctggcaacggcggggccgaaggagcgtgcagggttcatggacccgccgg 627

                                                                       
Query: 342 agaaggggccggcaacgaggatgttggccccgacgatgaaaccgatggcgatgggggcga 401
           ||||||||||||| |||||||||||||| ||||||||||| |||||||||||||||||||
Sbjct: 626 agaaggggccggccacgaggatgttggcgccgacgatgaagccgatggcgatgggggcga 567

                                                         
Query: 402 tggtgccgagggatcccttcttggggtcggcggcggtggcgtacac 447
           ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 566 tggtgccgagggatcccttcttggggtcggcggcggtggcgtacac 521



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score =  355 bits (179), Expect = 8e-95
 Identities = 248/271 (91%)
 Strand = Plus / Minus

                                                                            
Query: 177      tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 236
                ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| ||||||||
Sbjct: 13251125 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 13251066

                                                                            
Query: 237      ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 296
                |||| ||||||| ||| |||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 13251065 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 13251006

                                                                            
Query: 297      caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 356
                | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| |
Sbjct: 13251005 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 13250946

                                                                            
Query: 357      cgaggatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgagggatc 416
                ||||||||||||| ||||||||||| |||||||||||||| |||||||||||||| || |
Sbjct: 13250945 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 13250886

                                               
Query: 417      ccttcttggggtcggcggcggtggcgtacac 447
                |||||||||||||||||||||||||||||||
Sbjct: 13250885 ccttcttggggtcggcggcggtggcgtacac 13250855



to top

>dbj|AP005449.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0427E01
          Length = 146395

 Score =  355 bits (179), Expect = 8e-95
 Identities = 248/271 (91%)
 Strand = Plus / Minus

                                                                         
Query: 177   tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 236
             ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| ||||||||
Sbjct: 12935 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 12876

                                                                         
Query: 237   ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 296
             |||| ||||||| ||| |||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 12875 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 12816

                                                                         
Query: 297   caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 356
             | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| |
Sbjct: 12815 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 12756

                                                                         
Query: 357   cgaggatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgagggatc 416
             ||||||||||||| ||||||||||| |||||||||||||| |||||||||||||| || |
Sbjct: 12755 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 12696

                                            
Query: 417   ccttcttggggtcggcggcggtggcgtacac 447
             |||||||||||||||||||||||||||||||
Sbjct: 12695 ccttcttggggtcggcggcggtggcgtacac 12665



to top

>dbj|AP004784.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
              clone:OSJNBa0012F14
          Length = 168629

 Score =  355 bits (179), Expect = 8e-95
 Identities = 248/271 (91%)
 Strand = Plus / Minus

                                                                          
Query: 177    tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 236
              ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| ||||||||
Sbjct: 168313 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 168254

                                                                          
Query: 237    ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 296
              |||| ||||||| ||| |||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 168253 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 168194

                                                                          
Query: 297    caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 356
              | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| |
Sbjct: 168193 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 168134

                                                                          
Query: 357    cgaggatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgagggatc 416
              ||||||||||||| ||||||||||| |||||||||||||| |||||||||||||| || |
Sbjct: 168133 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 168074

                                             
Query: 417    ccttcttggggtcggcggcggtggcgtacac 447
              |||||||||||||||||||||||||||||||
Sbjct: 168073 ccttcttggggtcggcggcggtggcgtacac 168043



to top

>dbj|AK104464.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C06, full
           insert sequence
          Length = 1194

 Score =  355 bits (179), Expect = 8e-95
 Identities = 248/271 (91%)
 Strand = Plus / Minus

                                                                       
Query: 177 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 236
           ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| ||||||||
Sbjct: 825 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 766

                                                                       
Query: 237 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 296
           |||| ||||||| ||| |||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 765 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 706

                                                                       
Query: 297 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 356
           | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| |
Sbjct: 705 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 646

                                                                       
Query: 357 cgaggatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgagggatc 416
           ||||||||||||| ||||||||||| |||||||||||||| |||||||||||||| || |
Sbjct: 645 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 586

                                          
Query: 417 ccttcttggggtcggcggcggtggcgtacac 447
           |||||||||||||||||||||||||||||||
Sbjct: 585 ccttcttggggtcggcggcggtggcgtacac 555



to top

>dbj|AK104270.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-F03, full
           insert sequence
          Length = 1214

 Score =  355 bits (179), Expect = 8e-95
 Identities = 248/271 (91%)
 Strand = Plus / Minus

                                                                       
Query: 177 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 236
           ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| ||||||||
Sbjct: 827 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 768

                                                                       
Query: 237 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 296
           |||| ||||||| ||| |||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 767 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 708

                                                                       
Query: 297 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 356
           | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| |
Sbjct: 707 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 648

                                                                       
Query: 357 cgaggatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgagggatc 416
           ||||||||||||| ||||||||||| |||||||||||||| |||||||||||||| || |
Sbjct: 647 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 588

                                          
Query: 417 ccttcttggggtcggcggcggtggcgtacac 447
           |||||||||||||||||||||||||||||||
Sbjct: 587 ccttcttggggtcggcggcggtggcgtacac 557



to top

>dbj|AK099616.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013050J20, full
           insert sequence
          Length = 1197

 Score =  355 bits (179), Expect = 8e-95
 Identities = 248/271 (91%)
 Strand = Plus / Minus

                                                                       
Query: 177 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 236
           ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| ||||||||
Sbjct: 828 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 769

                                                                       
Query: 237 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 296
           |||| ||||||| ||| |||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 768 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 709

                                                                       
Query: 297 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 356
           | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| |
Sbjct: 708 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 649

                                                                       
Query: 357 cgaggatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgagggatc 416
           ||||||||||||| ||||||||||| |||||||||||||| |||||||||||||| || |
Sbjct: 648 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 589

                                          
Query: 417 ccttcttggggtcggcggcggtggcgtacac 447
           |||||||||||||||||||||||||||||||
Sbjct: 588 ccttcttggggtcggcggcggtggcgtacac 558



to top

>dbj|AK099141.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023055A02, full
           insert sequence
          Length = 1195

 Score =  355 bits (179), Expect = 8e-95
 Identities = 248/271 (91%)
 Strand = Plus / Minus

                                                                       
Query: 177 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 236
           ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| ||||||||
Sbjct: 826 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 767

                                                                       
Query: 237 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 296
           |||| ||||||| ||| |||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 766 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 707

                                                                       
Query: 297 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 356
           | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| |
Sbjct: 706 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 647

                                                                       
Query: 357 cgaggatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgagggatc 416
           ||||||||||||| ||||||||||| |||||||||||||| |||||||||||||| || |
Sbjct: 646 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 587

                                          
Query: 417 ccttcttggggtcggcggcggtggcgtacac 447
           |||||||||||||||||||||||||||||||
Sbjct: 586 ccttcttggggtcggcggcggtggcgtacac 556



to top

>dbj|AK099015.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013116H02, full
           insert sequence
          Length = 1202

 Score =  355 bits (179), Expect = 8e-95
 Identities = 248/271 (91%)
 Strand = Plus / Minus

                                                                       
Query: 177 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 236
           ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| ||||||||
Sbjct: 828 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 769

                                                                       
Query: 237 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 296
           |||| ||||||| ||| |||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 768 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 709

                                                                       
Query: 297 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 356
           | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| |
Sbjct: 708 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 649

                                                                       
Query: 357 cgaggatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgagggatc 416
           ||||||||||||| ||||||||||| |||||||||||||| |||||||||||||| || |
Sbjct: 648 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 589

                                          
Query: 417 ccttcttggggtcggcggcggtggcgtacac 447
           |||||||||||||||||||||||||||||||
Sbjct: 588 ccttcttggggtcggcggcggtggcgtacac 558



to top

>dbj|AK073531.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033044F19, full
           insert sequence
          Length = 1220

 Score =  355 bits (179), Expect = 8e-95
 Identities = 248/271 (91%)
 Strand = Plus / Minus

                                                                       
Query: 177 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 236
           ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| ||||||||
Sbjct: 826 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 767

                                                                       
Query: 237 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 296
           |||| ||||||| ||| |||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 766 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 707

                                                                       
Query: 297 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 356
           | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| |
Sbjct: 706 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 647

                                                                       
Query: 357 cgaggatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgagggatc 416
           ||||||||||||| ||||||||||| |||||||||||||| |||||||||||||| || |
Sbjct: 646 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 587

                                          
Query: 417 ccttcttggggtcggcggcggtggcgtacac 447
           |||||||||||||||||||||||||||||||
Sbjct: 586 ccttcttggggtcggcggcggtggcgtacac 556



to top

>dbj|AK104377.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-035-G09, full
           insert sequence
          Length = 1196

 Score =  347 bits (175), Expect = 2e-92
 Identities = 247/271 (91%)
 Strand = Plus / Minus

                                                                       
Query: 177 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 236
           ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| ||||||||
Sbjct: 827 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 768

                                                                       
Query: 237 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 296
           |||| ||||||| ||| |||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 767 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 708

                                                                       
Query: 297 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 356
           | |||||||| ||||| ||||| || ||||||||||| |||||||||||||||||||| |
Sbjct: 707 cgacggcgggaccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 648

                                                                       
Query: 357 cgaggatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgagggatc 416
           ||||||||||||| ||||||||||| |||||||||||||| |||||||||||||| || |
Sbjct: 647 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 588

                                          
Query: 417 ccttcttggggtcggcggcggtggcgtacac 447
           |||||||||||||||||||||||||||||||
Sbjct: 587 ccttcttggggtcggcggcggtggcgtacac 557



to top

>dbj|AK100193.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023036J06, full
           insert sequence
          Length = 1074

 Score =  347 bits (175), Expect = 2e-92
 Identities = 247/271 (91%)
 Strand = Plus / Minus

                                                                       
Query: 177 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 236
           ||||||| ||||||| ||||| | |||||||||| | ||| |||||||||| ||||||||
Sbjct: 705 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaacggtagacgaggccggcga 646

                                                                       
Query: 237 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 296
           |||| ||||||| ||| |||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 645 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 586

                                                                       
Query: 297 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 356
           | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| |
Sbjct: 585 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 526

                                                                       
Query: 357 cgaggatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgagggatc 416
           ||||||||||||| ||||||||||| |||||||||||||| |||||||||||||| || |
Sbjct: 525 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 466

                                          
Query: 417 ccttcttggggtcggcggcggtggcgtacac 447
           |||||||||||||||||||||||||||||||
Sbjct: 465 ccttcttggggtcggcggcggtggcgtacac 435



to top

>gb|AF326502.1|AF326502 Zea mays tonoplast membrane integral protein ZmTIP2-2 mRNA,
           complete cds
          Length = 1073

 Score =  224 bits (113), Expect = 2e-55
 Identities = 202/229 (88%), Gaps = 2/229 (0%)
 Strand = Plus / Minus

                                                                       
Query: 220 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgtt 279
           |||||||| ||| ||||| || |||||||||||||||||| ||||||||| |||| ||  
Sbjct: 763 gtagacgaggccagcgagtccgccgccgatgagcgggccgacccagtagacccagttgcc 704

                                                                       
Query: 280 ggtgaagtcg-ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgc 338
           || ||||||| |||| ||| |||||||||||||| ||||| || ||||||||||| ||||
Sbjct: 703 ggcgaagtcggccgc-ggcgacggcggggccgaaggagcgggcggggttcatggagccgc 645

                                                                       
Query: 339 cggagaaggggccggcaacgaggatgttggccccgacgatgaaaccgatggcgatggggg 398
           ||  |||||| || ||  ||||||||||||| ||||||||||| |||||||||||||| |
Sbjct: 644 cgctgaagggccccgcggcgaggatgttggcgccgacgatgaagccgatggcgatgggcg 585

                                                            
Query: 399 cgatggtgccgagggatcccttcttggggtcggcggcggtggcgtacac 447
           |||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 584 cgatggtgccgagggagcccttcttggggtcggcggcggtggcgtacac 536



to top

>gb|AF326501.1|AF326501 Zea mays tonoplast membrane integral protein ZmTIP2-1 mRNA,
           complete cds
          Length = 1110

 Score =  214 bits (108), Expect = 2e-52
 Identities = 198/228 (86%)
 Strand = Plus / Minus

                                                                       
Query: 220 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgtt 279
           |||||||| ||| |||||||| ||||||| |||||||||| ||||||||| |||| |   
Sbjct: 920 gtagacgaggccagcgaggccgccgccgacgagcgggccgacccagtagacccagtttcc 861

                                                                       
Query: 280 ggtgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgcc 339
           || |||||||||   ||| |||||||||||||| ||||| || ||||||||||| |||||
Sbjct: 860 ggcgaagtcgcccgcggcgacggcggggccgaaggagcgggcggggttcatggagccgcc 801

                                                                       
Query: 340 ggagaaggggccggcaacgaggatgttggccccgacgatgaaaccgatggcgatgggggc 399
           |  |||||| || ||  ||||||||||||| ||||||||||| |||||||||||||| ||
Sbjct: 800 gctgaagggccccgcggcgaggatgttggcgccgacgatgaagccgatggcgatgggcgc 741

                                                           
Query: 400 gatggtgccgagggatcccttcttggggtcggcggcggtggcgtacac 447
           |||||||||||| || ||||||||||||||||||||||||||||||||
Sbjct: 740 gatggtgccgagcgagcccttcttggggtcggcggcggtggcgtacac 693



to top

>gb|AY105015.1| Zea mays PCO137646 mRNA sequence
          Length = 1238

 Score =  214 bits (108), Expect = 2e-52
 Identities = 198/228 (86%)
 Strand = Plus / Minus

                                                                       
Query: 220 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgtt 279
           |||||||| ||| |||||||| ||||||| |||||||||| ||||||||| |||| |   
Sbjct: 919 gtagacgaggccagcgaggccgccgccgacgagcgggccgacccagtagacccagtttcc 860

                                                                       
Query: 280 ggtgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgcc 339
           || |||||||||   ||| |||||||||||||| ||||| || ||||||||||| |||||
Sbjct: 859 ggcgaagtcgcccgcggcgacggcggggccgaaggagcgggcggggttcatggagccgcc 800

                                                                       
Query: 340 ggagaaggggccggcaacgaggatgttggccccgacgatgaaaccgatggcgatgggggc 399
           |  |||||| || ||  ||||||||||||| ||||||||||| |||||||||||||| ||
Sbjct: 799 gctgaagggccccgcggcgaggatgttggcgccgacgatgaagccgatggcgatgggcgc 740

                                                           
Query: 400 gatggtgccgagggatcccttcttggggtcggcggcggtggcgtacac 447
           |||||||||||| || ||||||||||||||||||||||||||||||||
Sbjct: 739 gatggtgccgagcgagcccttcttggggtcggcggcggtggcgtacac 692



to top

>ref|XM_467137.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 747

 Score =  186 bits (94), Expect = 4e-44
 Identities = 187/218 (85%)
 Strand = Plus / Minus

                                                                       
Query: 230 ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 289
           ||||||||||| |||||||| ||||||||| ||||||||| |||| ||   | ||||| |
Sbjct: 683 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 624

                                                                       
Query: 290 ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaagggg 349
           |||  ||| |||||||||||||| ||||| || ||||||||||| ||||||  ||| |||
Sbjct: 623 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 564

                                                                       
Query: 350 ccggcaacgaggatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccg 409
           |||||  ||||||||||||| ||||||||||| ||||| |||||||| ||||||||||||
Sbjct: 563 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccg 504

                                                 
Query: 410 agggatcccttcttggggtcggcggcggtggcgtacac 447
           || ||||||||||| ||||| || || |||||||||||
Sbjct: 503 agcgatcccttcttcgggtccgccgccgtggcgtacac 466



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  186 bits (94), Expect = 4e-44
 Identities = 187/218 (85%)
 Strand = Plus / Plus

                                                                            
Query: 230      ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 289
                ||||||||||| |||||||| ||||||||| ||||||||| |||| ||   | ||||| |
Sbjct: 26627183 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 26627242

                                                                            
Query: 290      ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaagggg 349
                |||  ||| |||||||||||||| ||||| || ||||||||||| ||||||  ||| |||
Sbjct: 26627243 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 26627302

                                                                            
Query: 350      ccggcaacgaggatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccg 409
                |||||  ||||||||||||| ||||||||||| ||||| |||||||| ||||||||||||
Sbjct: 26627303 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccg 26627362

                                                      
Query: 410      agggatcccttcttggggtcggcggcggtggcgtacac 447
                || ||||||||||| ||||| || || |||||||||||
Sbjct: 26627363 agcgatcccttcttcgggtccgccgccgtggcgtacac 26627400



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 375      cgatgaaaccgatggcgatg 394
                ||||||||||||||||||||
Sbjct: 19147388 cgatgaaaccgatggcgatg 19147369



to top

>dbj|AP005006.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0519E06
          Length = 170634

 Score =  186 bits (94), Expect = 4e-44
 Identities = 187/218 (85%)
 Strand = Plus / Plus

                                                                          
Query: 230    ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 289
              ||||||||||| |||||||| ||||||||| ||||||||| |||| ||   | ||||| |
Sbjct: 169564 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 169623

                                                                          
Query: 290    ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaagggg 349
              |||  ||| |||||||||||||| ||||| || ||||||||||| ||||||  ||| |||
Sbjct: 169624 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 169683

                                                                          
Query: 350    ccggcaacgaggatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccg 409
              |||||  ||||||||||||| ||||||||||| ||||| |||||||| ||||||||||||
Sbjct: 169684 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccg 169743

                                                    
Query: 410    agggatcccttcttggggtcggcggcggtggcgtacac 447
              || ||||||||||| ||||| || || |||||||||||
Sbjct: 169744 agcgatcccttcttcgggtccgccgccgtggcgtacac 169781



to top

>dbj|AP005289.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1112_F09
          Length = 139371

 Score =  186 bits (94), Expect = 4e-44
 Identities = 187/218 (85%)
 Strand = Plus / Plus

                                                                         
Query: 230   ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 289
             ||||||||||| |||||||| ||||||||| ||||||||| |||| ||   | ||||| |
Sbjct: 61344 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 61403

                                                                         
Query: 290   ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaagggg 349
             |||  ||| |||||||||||||| ||||| || ||||||||||| ||||||  ||| |||
Sbjct: 61404 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 61463

                                                                         
Query: 350   ccggcaacgaggatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccg 409
             |||||  ||||||||||||| ||||||||||| ||||| |||||||| ||||||||||||
Sbjct: 61464 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccg 61523

                                                   
Query: 410   agggatcccttcttggggtcggcggcggtggcgtacac 447
             || ||||||||||| ||||| || || |||||||||||
Sbjct: 61524 agcgatcccttcttcgggtccgccgccgtggcgtacac 61561



to top

>dbj|AB114830.1| Oryza sativa (japonica cultivar-group) OsTIP2 mRNA for tonoplast
           intrinsic protein, complete cds
          Length = 1013

 Score =  186 bits (94), Expect = 4e-44
 Identities = 187/218 (85%)
 Strand = Plus / Minus

                                                                       
Query: 230 ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 289
           ||||||||||| |||||||| ||||||||| ||||||||| |||| ||   | ||||| |
Sbjct: 756 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 697

                                                                       
Query: 290 ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaagggg 349
           |||  ||| |||||||||||||| ||||| || ||||||||||| ||||||  ||| |||
Sbjct: 696 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 637

                                                                       
Query: 350 ccggcaacgaggatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccg 409
           |||||  ||||||||||||| ||||||||||| ||||| |||||||| ||||||||||||
Sbjct: 636 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccg 577

                                                 
Query: 410 agggatcccttcttggggtcggcggcggtggcgtacac 447
           || ||||||||||| ||||| || || |||||||||||
Sbjct: 576 agcgatcccttcttcgggtccgccgccgtggcgtacac 539



to top

>dbj|AK064728.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-120-A10, full
           insert sequence
          Length = 873

 Score =  186 bits (94), Expect = 4e-44
 Identities = 187/218 (85%)
 Strand = Plus / Minus

                                                                       
Query: 230 ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 289
           ||||||||||| |||||||| ||||||||| ||||||||| |||| ||   | ||||| |
Sbjct: 558 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 499

                                                                       
Query: 290 ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaagggg 349
           |||  ||| |||||||||||||| ||||| || ||||||||||| ||||||  ||| |||
Sbjct: 498 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 439

                                                                       
Query: 350 ccggcaacgaggatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccg 409
           |||||  ||||||||||||| ||||||||||| ||||| |||||||| ||||||||||||
Sbjct: 438 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccg 379

                                                 
Query: 410 agggatcccttcttggggtcggcggcggtggcgtacac 447
           || ||||||||||| ||||| || || |||||||||||
Sbjct: 378 agcgatcccttcttcgggtccgccgccgtggcgtacac 341



to top

>emb|AJ307662.1|OSA307662 Oryza sativa genomic DNA fragment, chromosome 2
          Length = 339972

 Score =  186 bits (94), Expect = 4e-44
 Identities = 187/218 (85%)
 Strand = Plus / Minus

                                                                          
Query: 230    ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 289
              ||||||||||| |||||||| ||||||||| ||||||||| |||| ||   | ||||| |
Sbjct: 250651 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 250592

                                                                          
Query: 290    ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaagggg 349
              |||  ||| |||||||||||||| ||||| || ||||||||||| ||||||  ||| |||
Sbjct: 250591 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 250532

                                                                          
Query: 350    ccggcaacgaggatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccg 409
              |||||  ||||||||||||| ||||||||||| ||||| |||||||| ||||||||||||
Sbjct: 250531 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccg 250472

                                                    
Query: 410    agggatcccttcttggggtcggcggcggtggcgtacac 447
              || ||||||||||| ||||| || || |||||||||||
Sbjct: 250471 agcgatcccttcttcgggtccgccgccgtggcgtacac 250434



 Score =  119 bits (60), Expect = 8e-24
 Identities = 105/120 (87%)
 Strand = Plus / Plus

                                                                          
Query: 328    catggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaaaccgat 387
              |||||| ||||||  ||| ||||||||  ||||||||||||| ||||||||||| |||||
Sbjct: 332095 catggagccgccgctgaacgggccggcggcgaggatgttggcgccgacgatgaagccgat 332154

                                                                          
Query: 388    ggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcgtacac 447
               |||||||| |||||||||||||| ||||||||||| ||||| || || |||||||||||
Sbjct: 332155 cgcgatgggcgcgatggtgccgagcgatcccttcttcgggtccgccgccgtggcgtacac 332214



to top

>gb|AY106931.1| Zea mays PCO140073 mRNA sequence
          Length = 1069

 Score =  174 bits (88), Expect = 2e-40
 Identities = 181/212 (85%)
 Strand = Plus / Minus

                                                                       
Query: 236 aggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctg 295
           ||||||||||||| ||| |||||| ||||||| | |||| ||  || ||||| ||||   
Sbjct: 757 aggccaccgccgacgagggggccgacccagtacacccagttgccggcgaagttgccggcc 698

                                                                       
Query: 296 gcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggca 355
           || |||||||||||||| ||||| || ||||||||||| ||||||  |||||||||||| 
Sbjct: 697 gccacggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcg 638

                                                                       
Query: 356 acgaggatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgagggat 415
            | ||||||||||| ||||||||||| |||||||| ||||| ||||||||||| ||||| 
Sbjct: 637 gccaggatgttggcgccgacgatgaagccgatggccatgggcgcgatggtgcccagggac 578

                                           
Query: 416 cccttcttggggtcggcggcggtggcgtacac 447
           |||||||| |||||||| ||||||||||||||
Sbjct: 577 cccttcttcgggtcggccgcggtggcgtacac 546



to top

>gb|AF057183.1|AF057183 Zea mays putative tonoplast aquaporin mRNA, complete cds
          Length = 1060

 Score =  174 bits (88), Expect = 2e-40
 Identities = 181/212 (85%)
 Strand = Plus / Minus

                                                                       
Query: 236 aggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctg 295
           ||||||||||||| ||| |||||| ||||||| | |||| ||  || ||||| ||||   
Sbjct: 739 aggccaccgccgacgagggggccgacccagtacacccagttgccggcgaagttgccggcc 680

                                                                       
Query: 296 gcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggca 355
           || |||||||||||||| ||||| || ||||||||||| ||||||  |||||||||||| 
Sbjct: 679 gccacggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcg 620

                                                                       
Query: 356 acgaggatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgagggat 415
            | ||||||||||| ||||||||||| |||||||| ||||| ||||||||||| ||||| 
Sbjct: 619 gccaggatgttggcgccgacgatgaagccgatggccatgggcgcgatggtgcccagggac 560

                                           
Query: 416 cccttcttggggtcggcggcggtggcgtacac 447
           |||||||| |||||||| ||||||||||||||
Sbjct: 559 cccttcttcgggtcggccgcggtggcgtacac 528



to top

>gb|AY243804.1| Zea mays tonoplast water channel mRNA, complete cds
          Length = 968

 Score =  167 bits (84), Expect = 4e-38
 Identities = 180/212 (84%)
 Strand = Plus / Minus

                                                                       
Query: 236 aggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctg 295
           ||||||||||||| ||| |||||| ||||||| | |||| ||  || |||||  |||   
Sbjct: 680 aggccaccgccgacgagggggccgacccagtacacccagttgccggcgaagttaccggcc 621

                                                                       
Query: 296 gcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggca 355
           || |||||||||||||| ||||| || ||||||||||| ||||||  |||||||||||| 
Sbjct: 620 gccacggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcg 561

                                                                       
Query: 356 acgaggatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgagggat 415
            | ||||||||||| ||||||||||| |||||||| ||||| ||||||||||| ||||| 
Sbjct: 560 gccaggatgttggcgccgacgatgaagccgatggccatgggcgcgatggtgcccagggac 501

                                           
Query: 416 cccttcttggggtcggcggcggtggcgtacac 447
           |||||||| |||||||| ||||||||||||||
Sbjct: 500 cccttcttcgggtcggccgcggtggcgtacac 469



to top

>gb|AF326503.1|AF326503 Zea mays tonoplast membrane integral protein ZmTIP2-3 mRNA,
           complete cds
          Length = 1042

 Score =  167 bits (84), Expect = 4e-38
 Identities = 180/212 (84%)
 Strand = Plus / Minus

                                                                       
Query: 236 aggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctg 295
           ||||||||||||| ||| |||||| ||||||| | |||| ||  || |||||  |||   
Sbjct: 748 aggccaccgccgacgagggggccgacccagtacacccagttgccggcgaagttaccggcc 689

                                                                       
Query: 296 gcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggca 355
           || |||||||||||||| ||||| || ||||||||||| ||||||  |||||||||||| 
Sbjct: 688 gccacggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcg 629

                                                                       
Query: 356 acgaggatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgagggat 415
            | ||||||||||| ||||||||||| |||||||| ||||| ||||||||||| ||||| 
Sbjct: 628 gccaggatgttggcgccgacgatgaagccgatggccatgggcgcgatggtgcccagggac 569

                                           
Query: 416 cccttcttggggtcggcggcggtggcgtacac 447
           |||||||| |||||||| ||||||||||||||
Sbjct: 568 cccttcttcgggtcggccgcggtggcgtacac 537



to top

>emb|X80266.1|HVGTIPP H.vulgare mRNA for gamma-TIP-like protein
          Length = 1020

 Score =  149 bits (75), Expect = 9e-33
 Identities = 129/147 (87%)
 Strand = Plus / Minus

                                                                       
Query: 301 ggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgag 360
           |||||||||||| |||   || |||||||||||  |||||||||||| |||| | |||||
Sbjct: 681 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 622

                                                                       
Query: 361 gatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgagggatccctt 420
           ||||||||| ||||||||||| |||||||||||||| ||||||||||| |||   |||||
Sbjct: 621 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 562

                                      
Query: 421 cttggggtcggcggcggtggcgtacac 447
           |||||||||| ||||||||||||||||
Sbjct: 561 cttggggtcgacggcggtggcgtacac 535



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 220 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 267
           ||||| || |||||||||||| ||||||||||| |||||| |||||||
Sbjct: 762 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 715



to top

>ref|XM_473424.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 2307

 Score =  143 bits (72), Expect = 6e-31
 Identities = 189/228 (82%)
 Strand = Plus / Minus

                                                                       
Query: 220 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgtt 279
           ||||||||  ||||| |||||||| ||||| || |||||| ||||||| | |||| ||  
Sbjct: 696 gtagacgagcccggccaggccaccaccgatcagtgggccgacccagtacacccagttgcc 637

                                                                       
Query: 280 ggtgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgcc 339
           || ||||| ||||   || ||||| |||||||| ||||| |||||||||||||||| |||
Sbjct: 636 ggcgaagttgccggccgcgacggccgggccgaaggagcgggcagggttcatggaactgcc 577

                                                                       
Query: 340 ggagaaggggccggcaacgaggatgttggccccgacgatgaaaccgatggcgatgggggc 399
           |   ||||| || ||  | ||||||||||| ||||||||||| |||||||| ||||| ||
Sbjct: 576 gctaaagggccccgccgccaggatgttggcaccgacgatgaagccgatggccatgggcgc 517

                                                           
Query: 400 gatggtgccgagggatcccttcttggggtcggcggcggtggcgtacac 447
           || |||||||||||| |||||||| |||||||| || |||||||||||
Sbjct: 516 gacggtgccgagggaacccttcttcgggtcggccgccgtggcgtacac 469



to top

>emb|AL663000.4|OSJN00201 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0034G17,
             complete sequence
          Length = 127259

 Score =  143 bits (72), Expect = 6e-31
 Identities = 189/228 (82%)
 Strand = Plus / Plus

                                                                         
Query: 220   gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgtt 279
             ||||||||  ||||| |||||||| ||||| || |||||| ||||||| | |||| ||  
Sbjct: 92483 gtagacgagcccggccaggccaccaccgatcagtgggccgacccagtacacccagttgcc 92542

                                                                         
Query: 280   ggtgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgcc 339
             || ||||| ||||   || ||||| |||||||| ||||| |||||||||||||||| |||
Sbjct: 92543 ggcgaagttgccggccgcgacggccgggccgaaggagcgggcagggttcatggaactgcc 92602

                                                                         
Query: 340   ggagaaggggccggcaacgaggatgttggccccgacgatgaaaccgatggcgatgggggc 399
             |   ||||| || ||  | ||||||||||| ||||||||||| |||||||| ||||| ||
Sbjct: 92603 gctaaagggccccgccgccaggatgttggcaccgacgatgaagccgatggccatgggcgc 92662

                                                             
Query: 400   gatggtgccgagggatcccttcttggggtcggcggcggtggcgtacac 447
             || |||||||||||| |||||||| |||||||| || |||||||||||
Sbjct: 92663 gacggtgccgagggaacccttcttcgggtcggccgccgtggcgtacac 92710



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  143 bits (72), Expect = 6e-31
 Identities = 189/228 (82%)
 Strand = Plus / Plus

                                                                            
Query: 220      gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgtt 279
                ||||||||  ||||| |||||||| ||||| || |||||| ||||||| | |||| ||  
Sbjct: 27568507 gtagacgagcccggccaggccaccaccgatcagtgggccgacccagtacacccagttgcc 27568566

                                                                            
Query: 280      ggtgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgcc 339
                || ||||| ||||   || ||||| |||||||| ||||| |||||||||||||||| |||
Sbjct: 27568567 ggcgaagttgccggccgcgacggccgggccgaaggagcgggcagggttcatggaactgcc 27568626

                                                                            
Query: 340      ggagaaggggccggcaacgaggatgttggccccgacgatgaaaccgatggcgatgggggc 399
                |   ||||| || ||  | ||||||||||| ||||||||||| |||||||| ||||| ||
Sbjct: 27568627 gctaaagggccccgccgccaggatgttggcaccgacgatgaagccgatggccatgggcgc 27568686

                                                                
Query: 400      gatggtgccgagggatcccttcttggggtcggcggcggtggcgtacac 447
                || |||||||||||| |||||||| |||||||| || |||||||||||
Sbjct: 27568687 gacggtgccgagggaacccttcttcgggtcggccgccgtggcgtacac 27568734



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                       
Query: 273      agatgttggtgaagtcgccgctg 295
                |||||||||||||||||||||||
Sbjct: 25620210 agatgttggtgaagtcgccgctg 25620232



to top

>emb|AJ005078.2|PAAJ5078 Picea abies mRNA for aquaporin-like protein
          Length = 1007

 Score =  141 bits (71), Expect = 2e-30
 Identities = 188/227 (82%)
 Strand = Plus / Minus

                                                                       
Query: 218 cggtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatg 277
           ||||||||||| ||||| ||||| || |||||||| |||||| ||||||| | |||| ||
Sbjct: 775 cggtagacgataccggcaaggccgcctccgatgagggggccgacccagtacacccagttg 716

                                                                       
Query: 278 ttggtgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccg 337
           | ||||||||| |||||  |||| || ||| |||| ||||| || ||||||||||| |||
Sbjct: 715 tcggtgaagtctccgctcacaacagcagggtcgaaggagcgggcggggttcatggagccg 656

                                                                       
Query: 338 ccggagaaggggccggcaacgaggatgttggccccgacgatgaaaccgatggcgatgggg 397
           || ||||||||||| ||  | | ||||||||| || |||||||| || || || ||||| 
Sbjct: 655 ccagagaaggggcccgcggccaagatgttggcgcccacgatgaagccaatagcaatggga 596

                                                          
Query: 398 gcgatggtgccgagggatcccttcttggggtcggcggcggtggcgta 444
           ||||||||||| |||   |||||||| |||||||| |||||||||||
Sbjct: 595 gcgatggtgcccaggtcgcccttcttcgggtcggctgcggtggcgta 549



to top

>gb|AF254799.1|AF254799 Hordeum vulgare tonoplast intrinsic protein 1 (TIP1), tonoplast
             intrinsic protein 2 (TIP2), and Rar1 (Rar1) genes,
             complete cds
          Length = 65979

 Score =  137 bits (69), Expect = 3e-29
 Identities = 129/149 (86%)
 Strand = Plus / Minus

                                                                         
Query: 299   acggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacg 358
             ||||| || ||||| ||||| || ||||||||||| ||||||  |||||| |||||  ||
Sbjct: 44843 acggccggcccgaaggagcgcgccgggttcatggagccgccgctgaagggcccggcggcg 44784

                                                                         
Query: 359   aggatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgagggatccc 418
             ||||||||||| ||||||||||| ||||| || ||||| ||||||||||||||||| |||
Sbjct: 44783 aggatgttggcgccgacgatgaagccgatcgccatgggcgcgatggtgccgagggagccc 44724

                                          
Query: 419   ttcttggggtcggcggcggtggcgtacac 447
             |||||||||||||| || || ||||||||
Sbjct: 44723 ttcttggggtcggccgccgtcgcgtacac 44695



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                                 
Query: 282   tgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatgga 333
             |||||||||||||| |||| || || ||||| || || || |||||||||||
Sbjct: 46205 tgaagtcgccgctgacaaccgccggcccgaacgaccgcgcggggttcatgga 46154



to top

>ref|XM_470213.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 753

 Score =  121 bits (61), Expect = 2e-24
 Identities = 109/125 (87%)
 Strand = Plus / Minus

                                                                       
Query: 323 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaaa 382
           |||||||||||  |||||  ||| | |||| | ||||||||||| || ||||||||||| 
Sbjct: 596 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 537

                                                                       
Query: 383 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 442
           ||||||||||||||||||||||||||||||   ||||||||||||||  |||||||||||
Sbjct: 536 ccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcg 477

                
Query: 443 tacac 447
           |||||
Sbjct: 476 tacac 472



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 220 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 267
           ||||| || |||||||||||||||||||||||| |||||  |||||||
Sbjct: 699 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 652



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  121 bits (61), Expect = 2e-24
 Identities = 109/125 (87%)
 Strand = Plus / Plus

                                                                           
Query: 323     gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaaa 382
               |||||||||||  |||||  ||| | |||| | ||||||||||| || ||||||||||| 
Sbjct: 2544886 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 2544945

                                                                           
Query: 383     ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 442
               ||||||||||||||||||||||||||||||   ||||||||||||||  |||||||||||
Sbjct: 2544946 ccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcg 2545005

                    
Query: 443     tacac 447
               |||||
Sbjct: 2545006 tacac 2545010



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                               
Query: 220     gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 267
               ||||| || |||||||||||||||||||||||| |||||  |||||||
Sbjct: 2544783 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 2544830



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                       
Query: 273      agatgttggtgaagtcgccgctg 295
                |||||||||||||||||||||||
Sbjct: 15990586 agatgttggtgaagtcgccgctg 15990564



to top

>emb|AJ242805.1|SST242805 Sporobolus stapfianus mRNA for putative gamma tonoplast intrinsic
           protein (TIP)
          Length = 1146

 Score =  121 bits (61), Expect = 2e-24
 Identities = 109/125 (87%)
 Strand = Plus / Minus

                                                                       
Query: 323 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaaa 382
           |||||||||||  |||||  ||||| |||| | |||||||||||||| || |||||||| 
Sbjct: 675 gggttcatggacgcgccgtcgaaggcgccgccgacgaggatgttggcgcccacgatgaag 616

                                                                       
Query: 383 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 442
           |||||||||||||||||||||||||| |||   ||||||||||||||| | |||||||||
Sbjct: 615 ccgatggcgatgggggcgatggtgcccaggctgcccttcttggggtcgaccgcggtggcg 556

                
Query: 443 tacac 447
           |||||
Sbjct: 555 tacac 551



to top

>gb|AC090485.3|AC090485 Genomic Sequence for Oryza sativa, Nipponbare strain, clone
              OSJNBa0067N01, from chromosome 3, complete sequence
          Length = 159636

 Score =  121 bits (61), Expect = 2e-24
 Identities = 109/125 (87%)
 Strand = Plus / Minus

                                                                          
Query: 323    gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaaa 382
              |||||||||||  |||||  ||| | |||| | ||||||||||| || ||||||||||| 
Sbjct: 125208 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 125149

                                                                          
Query: 383    ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 442
              ||||||||||||||||||||||||||||||   ||||||||||||||  |||||||||||
Sbjct: 125148 ccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcg 125089

                   
Query: 443    tacac 447
              |||||
Sbjct: 125088 tacac 125084



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                              
Query: 220    gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 267
              ||||| || |||||||||||||||||||||||| |||||  |||||||
Sbjct: 125311 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 125264



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score =  121 bits (61), Expect = 2e-24
 Identities = 109/125 (87%)
 Strand = Plus / Plus

                                                                           
Query: 323     gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaaa 382
               |||||||||||  |||||  ||| | |||| | ||||||||||| || ||||||||||| 
Sbjct: 2544996 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 2545055

                                                                           
Query: 383     ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 442
               ||||||||||||||||||||||||||||||   ||||||||||||||  |||||||||||
Sbjct: 2545056 ccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcg 2545115

                    
Query: 443     tacac 447
               |||||
Sbjct: 2545116 tacac 2545120



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                               
Query: 220     gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 267
               ||||| || |||||||||||||||||||||||| |||||  |||||||
Sbjct: 2544893 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 2544940



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                       
Query: 273      agatgttggtgaagtcgccgctg 295
                |||||||||||||||||||||||
Sbjct: 15985120 agatgttggtgaagtcgccgctg 15985098



to top

>dbj|D25534.1|RICYK333 Oryza sativa yk333 mRNA for gamma-Tip, complete cds
          Length = 1080

 Score =  121 bits (61), Expect = 2e-24
 Identities = 109/125 (87%)
 Strand = Plus / Minus

                                                                       
Query: 323 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaaa 382
           |||||||||||  |||||  ||| | |||| | ||||||||||| || ||||||||||| 
Sbjct: 674 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 615

                                                                       
Query: 383 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 442
           ||||||||||||||||||||||||||||||   ||||||||||||||  |||||||||||
Sbjct: 614 ccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcg 555

                
Query: 443 tacac 447
           |||||
Sbjct: 554 tacac 550



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 220 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 267
           ||||| || |||||||||||||||||||||||| |||||  |||||||
Sbjct: 777 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 730



to top

>dbj|AK110727.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-170-E06, full
           insert sequence
          Length = 1024

 Score =  121 bits (61), Expect = 2e-24
 Identities = 109/125 (87%)
 Strand = Plus / Plus

                                                                       
Query: 323 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaaa 382
           |||||||||||  |||||  ||| | |||| | ||||||||||| || ||||||||||| 
Sbjct: 295 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 354

                                                                       
Query: 383 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 442
           ||||||||||||||||||||||||||||||   ||||||||||||||  |||||||||||
Sbjct: 355 ccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcg 414

                
Query: 443 tacac 447
           |||||
Sbjct: 415 tacac 419



to top

>dbj|AK104123.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-C12, full
           insert sequence
          Length = 1034

 Score =  121 bits (61), Expect = 2e-24
 Identities = 109/125 (87%)
 Strand = Plus / Minus

                                                                       
Query: 323 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaaa 382
           |||||||||||  |||||  ||| | |||| | ||||||||||| || ||||||||||| 
Sbjct: 683 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 624

                                                                       
Query: 383 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 442
           ||||||||||||||||||||||||||||||   ||||||||||||||  |||||||||||
Sbjct: 623 ccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcg 564

                
Query: 443 tacac 447
           |||||
Sbjct: 563 tacac 559



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 220 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 267
           ||||| || |||||||||||||||||||||||| |||||  |||||||
Sbjct: 786 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 739



to top

>dbj|AK068986.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023003E16, full
           insert sequence
          Length = 1082

 Score =  121 bits (61), Expect = 2e-24
 Identities = 109/125 (87%)
 Strand = Plus / Minus

                                                                       
Query: 323 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaaa 382
           |||||||||||  |||||  ||| | |||| | ||||||||||| || ||||||||||| 
Sbjct: 685 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 626

                                                                       
Query: 383 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 442
           ||||||||||||||||||||||||||||||   ||||||||||||||  |||||||||||
Sbjct: 625 ccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcg 566

                
Query: 443 tacac 447
           |||||
Sbjct: 565 tacac 561



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 220 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 267
           ||||| || |||||||||||||||||||||||| |||||  |||||||
Sbjct: 788 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 741



to top

>dbj|AK059438.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-027-G11, full
           insert sequence
          Length = 551

 Score =  121 bits (61), Expect = 2e-24
 Identities = 109/125 (87%)
 Strand = Plus / Minus

                                                                       
Query: 323 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaaa 382
           |||||||||||  |||||  ||| | |||| | ||||||||||| || ||||||||||| 
Sbjct: 209 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 150

                                                                       
Query: 383 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 442
           ||||||||||||||||||||||||||||||   ||||||||||||||  |||||||||||
Sbjct: 149 ccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcg 90

                
Query: 443 tacac 447
           |||||
Sbjct: 89  tacac 85



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 220 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 267
           ||||| || |||||||||||||||||||||||| |||||  |||||||
Sbjct: 312 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 265



to top

>dbj|AK058322.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B06, full
           insert sequence
          Length = 1055

 Score =  121 bits (61), Expect = 2e-24
 Identities = 109/125 (87%)
 Strand = Plus / Minus

                                                                       
Query: 323 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaaa 382
           |||||||||||  |||||  ||| | |||| | ||||||||||| || ||||||||||| 
Sbjct: 681 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 622

                                                                       
Query: 383 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 442
           ||||||||||||||||||||||||||||||   ||||||||||||||  |||||||||||
Sbjct: 621 ccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcg 562

                
Query: 443 tacac 447
           |||||
Sbjct: 561 tacac 557



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 220 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 267
           ||||| || |||||||||||||||||||||||| |||||  |||||||
Sbjct: 784 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 737



to top

>gb|U86762.1|TAU86762 Triticum aestivum gamma-type tonoplast intrinsic protein mRNA,
           complete cds
          Length = 1133

 Score =  117 bits (59), Expect = 3e-23
 Identities = 125/147 (85%)
 Strand = Plus / Minus

                                                                       
Query: 301 ggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgag 360
           |||||||||||| |||   || |||||||||||  |||||||||||| |||| | || ||
Sbjct: 712 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgcccaccag 653

                                                                       
Query: 361 gatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgagggatccctt 420
           ||||||||| || |||||||| |||||||||||||| ||||||||||| |||   |||||
Sbjct: 652 gatgttggcgcccacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 593

                                      
Query: 421 cttggggtcggcggcggtggcgtacac 447
           |||||||||  |||| |||||||||||
Sbjct: 592 cttggggtccacggccgtggcgtacac 566



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 220 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 267
           ||||| || |||||||||||| ||||||||||| |||||| |||||||
Sbjct: 793 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 746



to top

>ref|NM_189497.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 759

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 124/149 (83%)
 Strand = Plus / Minus

                                                                       
Query: 299 acggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacg 358
           |||||||||||||| |||   || |||||||||||  |||||  ||||| |||| |  ||
Sbjct: 623 acggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgccggcg 564

                                                                       
Query: 359 aggatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgagggatccc 418
           ||||||||||| ||||||||||| |||||||||||||||||||||   ||||||   |||
Sbjct: 563 aggatgttggcgccgacgatgaagccgatggcgatgggggcgatgacaccgaggtcgccc 504

                                        
Query: 419 ttcttggggtcggcggcggtggcgtacac 447
           |||||||| ||  | ||||||||||||||
Sbjct: 503 ttcttgggatccaccgcggtggcgtacac 475



to top

>gb|AY243803.1| Zea mays tonoplast water channel (TIP1-1) mRNA, complete cds
          Length = 1039

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 106/125 (84%)
 Strand = Plus / Minus

                                                                       
Query: 323 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaaa 382
           |||||||||||  |||||  ||||| |||| | || |||||||||||||| |||||||| 
Sbjct: 597 gggttcatggacgcgccgtcgaaggcgccgcccaccaggatgttggcccccacgatgaag 538

                                                                       
Query: 383 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 442
           |||||||||||||||||||||||||| |||   |||||||| |||||  | || ||||||
Sbjct: 537 ccgatggcgatgggggcgatggtgcccaggctgcccttcttcgggtccaccgccgtggcg 478

                
Query: 443 tacac 447
           |||||
Sbjct: 477 tacac 473



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 220 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 267
           ||||| || |||||||||||| ||||||||||| |||||| |||||||
Sbjct: 700 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 653



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 124/149 (83%)
 Strand = Plus / Plus

                                                                            
Query: 299      acggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacg 358
                |||||||||||||| |||   || |||||||||||  |||||  ||||| |||| |  ||
Sbjct: 43108804 acggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgccggcg 43108863

                                                                            
Query: 359      aggatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgagggatccc 418
                ||||||||||| ||||||||||| |||||||||||||||||||||   ||||||   |||
Sbjct: 43108864 aggatgttggcgccgacgatgaagccgatggcgatgggggcgatgacaccgaggtcgccc 43108923

                                             
Query: 419      ttcttggggtcggcggcggtggcgtacac 447
                |||||||| ||  | ||||||||||||||
Sbjct: 43108924 ttcttgggatccaccgcggtggcgtacac 43108952



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 62/73 (84%)
 Strand = Plus / Minus

                                                                           
Query: 305     gggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatg 364
               |||||||| ||||| || |||||||||||  |||||||| |||| ||| |  ||||||||
Sbjct: 7297471 gggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccggcgaggatg 7297412

                            
Query: 365     ttggccccgacga 377
               ||||| |||||||
Sbjct: 7297411 ttggcgccgacga 7297399



to top

>dbj|AP003627.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0459B04
          Length = 142475

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 124/149 (83%)
 Strand = Plus / Plus

                                                                          
Query: 299    acggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacg 358
              |||||||||||||| |||   || |||||||||||  |||||  ||||| |||| |  ||
Sbjct: 105833 acggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgccggcg 105892

                                                                          
Query: 359    aggatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgagggatccc 418
              ||||||||||| ||||||||||| |||||||||||||||||||||   ||||||   |||
Sbjct: 105893 aggatgttggcgccgacgatgaagccgatggcgatgggggcgatgacaccgaggtcgccc 105952

                                           
Query: 419    ttcttggggtcggcggcggtggcgtacac 447
              |||||||| ||  | ||||||||||||||
Sbjct: 105953 ttcttgggatccaccgcggtggcgtacac 105981



to top

>dbj|AK111768.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023066H10, full
           insert sequence
          Length = 1346

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 124/149 (83%)
 Strand = Plus / Minus

                                                                       
Query: 299 acggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacg 358
           |||||||||||||| |||   || |||||||||||  |||||  ||||| |||| |  ||
Sbjct: 647 acggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgccggcg 588

                                                                       
Query: 359 aggatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgagggatccc 418
           ||||||||||| ||||||||||| |||||||||||||||||||||   ||||||   |||
Sbjct: 587 aggatgttggcgccgacgatgaagccgatggcgatgggggcgatgacaccgaggtcgccc 528

                                        
Query: 419 ttcttggggtcggcggcggtggcgtacac 447
           |||||||| ||  | ||||||||||||||
Sbjct: 527 ttcttgggatccaccgcggtggcgtacac 499



to top

>dbj|AK111747.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023050B20, full
           insert sequence
          Length = 1149

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 124/149 (83%)
 Strand = Plus / Minus

                                                                       
Query: 299 acggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacg 358
           |||||||||||||| |||   || |||||||||||  |||||  ||||| |||| |  ||
Sbjct: 696 acggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgccggcg 637

                                                                       
Query: 359 aggatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgagggatccc 418
           ||||||||||| ||||||||||| |||||||||||||||||||||   ||||||   |||
Sbjct: 636 aggatgttggcgccgacgatgaagccgatggcgatgggggcgatgacaccgaggtcgccc 577

                                        
Query: 419 ttcttggggtcggcggcggtggcgtacac 447
           |||||||| ||  | ||||||||||||||
Sbjct: 576 ttcttgggatccaccgcggtggcgtacac 548



to top

>dbj|AB114829.1| Oryza sativa (japonica cultivar-group) OsTIP1 mRNA for tonoplast
           intrinsic protein, complete cds
          Length = 970

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 124/149 (83%)
 Strand = Plus / Minus

                                                                       
Query: 299 acggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacg 358
           |||||||||||||| |||   || |||||||||||  |||||  ||||| |||| |  ||
Sbjct: 633 acggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgccggcg 574

                                                                       
Query: 359 aggatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgagggatccc 418
           ||||||||||| ||||||||||| |||||||||||||||||||||   ||||||   |||
Sbjct: 573 aggatgttggcgccgacgatgaagccgatggcgatgggggcgatgacaccgaggtcgccc 514

                                        
Query: 419 ttcttggggtcggcggcggtggcgtacac 447
           |||||||| ||  | ||||||||||||||
Sbjct: 513 ttcttgggatccaccgcggtggcgtacac 485



to top

>ref|NM_112495.2| Arabidopsis thaliana DELTA-TIP; water channel AT3G16240 (DELTA-TIP)
           mRNA, complete cds
          Length = 1125

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 108/128 (84%)
 Strand = Plus / Minus

                                                                       
Query: 317 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 376
           ||||| ||||||||||| || |||||||| || |||||  ||||||||||||| || |||
Sbjct: 709 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 650

                                                                       
Query: 377 atgaaaccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcg 436
           || | ||| |||||||  || |||||||| ||||| || ||||||||||| || ||||||
Sbjct: 649 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcg 590

                   
Query: 437 gtggcgta 444
           ||||||||
Sbjct: 589 gtggcgta 582



to top

>ref|NM_112496.2| Arabidopsis thaliana electron carrier/ electron transporter/ iron ion
            binding AT3G16250 mRNA, complete cds
          Length = 1538

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 108/128 (84%)
 Strand = Plus / Plus

                                                                        
Query: 317  cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 376
            ||||| ||||||||||| || |||||||| || |||||  ||||||||||||| || |||
Sbjct: 1166 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 1225

                                                                        
Query: 377  atgaaaccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcg 436
            || | ||| |||||||  || |||||||| ||||| || ||||||||||| || ||||||
Sbjct: 1226 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcg 1285

                    
Query: 437  gtggcgta 444
            ||||||||
Sbjct: 1286 gtggcgta 1293



to top

>gb|AY081622.1| Arabidopsis thaliana delta tonoplast intrinsic protein (At3g16230)
           mRNA, complete cds
          Length = 853

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 108/128 (84%)
 Strand = Plus / Minus

                                                                       
Query: 317 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 376
           ||||| ||||||||||| || |||||||| || |||||  ||||||||||||| || |||
Sbjct: 599 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 540

                                                                       
Query: 377 atgaaaccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcg 436
           || | ||| |||||||  || |||||||| ||||| || ||||||||||| || ||||||
Sbjct: 539 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcg 480

                   
Query: 437 gtggcgta 444
           ||||||||
Sbjct: 479 gtggcgta 472



to top

>gb|AY065181.1| Arabidopsis thaliana delta tonoplast intrinsic protein (At3g16230;
           MYA6.5) mRNA, complete cds
          Length = 929

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 108/128 (84%)
 Strand = Plus / Minus

                                                                       
Query: 317 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 376
           ||||| ||||||||||| || |||||||| || |||||  ||||||||||||| || |||
Sbjct: 670 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 611

                                                                       
Query: 377 atgaaaccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcg 436
           || | ||| |||||||  || |||||||| ||||| || ||||||||||| || ||||||
Sbjct: 610 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcg 551

                   
Query: 437 gtggcgta 444
           ||||||||
Sbjct: 550 gtggcgta 543



to top

>emb|BX823177.1|CNS0A5ZD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB95ZE06 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 903

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 108/128 (84%)
 Strand = Plus / Minus

                                                                       
Query: 317 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 376
           ||||| ||||||||||| || |||||||| || |||||  ||||||||||||| || |||
Sbjct: 647 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 588

                                                                       
Query: 377 atgaaaccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcg 436
           || | ||| |||||||  || |||||||| ||||| || ||||||||||| || ||||||
Sbjct: 587 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcg 528

                   
Query: 437 gtggcgta 444
           ||||||||
Sbjct: 527 gtggcgta 520



to top

>emb|BX823081.1|CNS0A5VY Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB88ZH07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 957

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 108/128 (84%)
 Strand = Plus / Minus

                                                                       
Query: 317 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 376
           ||||| ||||||||||| || |||||||| || |||||  ||||||||||||| || |||
Sbjct: 652 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 593

                                                                       
Query: 377 atgaaaccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcg 436
           || | ||| |||||||  || |||||||| ||||| || ||||||||||| || ||||||
Sbjct: 592 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcg 533

                   
Query: 437 gtggcgta 444
           ||||||||
Sbjct: 532 gtggcgta 525



to top

>emb|BX823757.1|CNS0A5CX Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS72ZD10 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 945

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 108/128 (84%)
 Strand = Plus / Minus

                                                                       
Query: 317 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 376
           ||||| ||||||||||| || |||||||| || |||||  ||||||||||||| || |||
Sbjct: 649 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 590

                                                                       
Query: 377 atgaaaccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcg 436
           || | ||| |||||||  || |||||||| ||||| || ||||||||||| || ||||||
Sbjct: 589 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcg 530

                   
Query: 437 gtggcgta 444
           ||||||||
Sbjct: 529 gtggcgta 522



to top

>gb|AY085921.1| Arabidopsis thaliana clone 19689 mRNA, complete sequence
          Length = 978

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 108/128 (84%)
 Strand = Plus / Minus

                                                                       
Query: 317 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 376
           ||||| ||||||||||| || |||||||| || |||||  ||||||||||||| || |||
Sbjct: 671 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 612

                                                                       
Query: 377 atgaaaccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcg 436
           || | ||| |||||||  || |||||||| ||||| || ||||||||||| || ||||||
Sbjct: 611 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcg 552

                   
Query: 437 gtggcgta 444
           ||||||||
Sbjct: 551 gtggcgta 544



to top

>dbj|AB023046.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MYA6
          Length = 75289

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 108/128 (84%)
 Strand = Plus / Minus

                                                                         
Query: 317   cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 376
             ||||| ||||||||||| || |||||||| || |||||  ||||||||||||| || |||
Sbjct: 19498 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 19439

                                                                         
Query: 377   atgaaaccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcg 436
             || | ||| |||||||  || |||||||| ||||| || ||||||||||| || ||||||
Sbjct: 19438 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcg 19379

                     
Query: 437   gtggcgta 444
             ||||||||
Sbjct: 19378 gtggcgta 19371



to top

>gb|U39485.1|ATU39485 Arabidopsis thaliana delta tonoplast integral protein mRNA,
           complete cds
          Length = 939

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 108/128 (84%)
 Strand = Plus / Minus

                                                                       
Query: 317 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 376
           ||||| ||||||||||| || |||||||| || |||||  ||||||||||||| || |||
Sbjct: 616 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 557

                                                                       
Query: 377 atgaaaccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcg 436
           || | ||| |||||||  || |||||||| ||||| || ||||||||||| || ||||||
Sbjct: 556 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcg 497

                   
Query: 437 gtggcgta 444
           ||||||||
Sbjct: 496 gtggcgta 489



to top

>gb|AF271661.1|AF271661 Vitis berlandieri x Vitis rupestris putative aquaporin TIP1 (TIP1)
           mRNA, complete cds
          Length = 1057

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 91/106 (85%)
 Strand = Plus / Minus

                                                                       
Query: 261 cccagtagatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgagcgtg 320
           |||||||||||||| |||   |||||||||||||| | |||||||||||||| ||||| |
Sbjct: 697 cccagtagatccagttgtccttgaagtcgccgctgacgacggcggggccgaaggagcggg 638

                                                         
Query: 321 cagggttcatggaaccgccggagaaggggccggcaacgaggatgtt 366
           | |||||||| || || |||||||| ||||||||| | ||||||||
Sbjct: 637 cggggttcattgatccaccggagaatgggccggcagccaggatgtt 592



to top

>gb|AF326500.1|AF326500 Zea mays tonoplast membrane integral protein ZmTIP1-2 mRNA,
           complete cds
          Length = 1021

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 78/89 (87%)
 Strand = Plus / Minus

                                                                       
Query: 359 aggatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgagggatccc 418
           ||||||||||| ||||||||||| |||||||||||||| ||||||  |||||||   |||
Sbjct: 577 aggatgttggcgccgacgatgaagccgatggcgatgggcgcgatgacgccgaggtcgccc 518

                                        
Query: 419 ttcttggggtcggcggcggtggcgtacac 447
           |||||||||||  |||| |||||||||||
Sbjct: 517 ttcttggggtccacggccgtggcgtacac 489



to top

>gb|AY112388.1| Zea mays CL24208_1 mRNA sequence
          Length = 833

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 78/89 (87%)
 Strand = Plus / Plus

                                                                       
Query: 359 aggatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgagggatccc 418
           ||||||||||| ||||||||||| |||||||||||||| ||||||  |||||||   |||
Sbjct: 434 aggatgttggcgccgacgatgaagccgatggcgatgggcgcgatgacgccgaggtcgccc 493

                                        
Query: 419 ttcttggggtcggcggcggtggcgtacac 447
           |||||||||||  |||| |||||||||||
Sbjct: 494 ttcttggggtccacggccgtggcgtacac 522



to top

>gb|AF037061.1|AF037061 Zea mays tonoplast intrinsic protein (ZmTIP1) mRNA, complete cds
          Length = 1097

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 105/125 (84%)
 Strand = Plus / Minus

                                                                       
Query: 323 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaaa 382
           |||||||||||  |||||  ||||| |||| | || |||||||||||||| |||||||| 
Sbjct: 689 gggttcatggacgcgccgtcgaaggcgccgcccaccaggatgttggcccccacgatgaag 630

                                                                       
Query: 383 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 442
           |||||||| ||||||||||||||||| |||   |||||||| |||||  | || ||||||
Sbjct: 629 ccgatggcaatgggggcgatggtgcccaggctgcccttcttcgggtccaccgccgtggcg 570

                
Query: 443 tacac 447
           |||||
Sbjct: 569 tacac 565



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 220 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 267
           ||||| || |||||||||||| ||||||||||| || ||| |||||||
Sbjct: 792 gtagatgacgccggcgaggccgccgccgatgaggggcccgacccagta 745



to top

>dbj|AB010416.1| Raphanus sativus VIP3 mRNA for delta-VM23, complete cds
          Length = 911

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 104/124 (83%)
 Strand = Plus / Minus

                                                                       
Query: 317 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 376
           ||||| ||||||||||| || || ||||| || |||||  | ||||||||||| ||||||
Sbjct: 640 cgtgctgggttcatggatccaccagagaatggaccggcggctaggatgttggcaccgacg 581

                                                                       
Query: 377 atgaaaccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcg 436
           |||| ||| ||||||| ||| |||||||| ||||| || ||||| ||||| || ||||||
Sbjct: 580 atgagaccaatggcgaggggagcgatggttccgagagaaccctttttgggatcagcggcg 521

               
Query: 437 gtgg 440
           ||||
Sbjct: 520 gtgg 517



to top

>gb|BT016300.1| Zea mays clone Contig133 mRNA sequence
          Length = 1112

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 91/107 (85%)
 Strand = Plus / Minus

                                                                       
Query: 323 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaaa 382
           |||||||||||  |||||  ||||| |||| | || ||||||||||| || |||||||| 
Sbjct: 693 gggttcatggacgcgccgtcgaaggcgccgcccaccaggatgttggcgcccacgatgaag 634

                                                          
Query: 383 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtc 429
           |||||||||||||||||||||||||| |||   |||||||| |||||
Sbjct: 633 ccgatggcgatgggggcgatggtgcccaggctgcccttcttcgggtc 587



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 220 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 267
           ||||| || |||||||||||| ||||||||||| || ||| |||||||
Sbjct: 796 gtagatgacgccggcgaggccgccgccgatgaggggcccgacccagta 749



to top

>gb|AY104464.1| Zea mays PCO114899 mRNA sequence
          Length = 1167

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 91/107 (85%)
 Strand = Plus / Minus

                                                                       
Query: 323 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaaa 382
           |||||||||||  |||||  ||||| |||| | || |||||||||||||| |||||||| 
Sbjct: 692 gggttcatggacgcgccgtcgaaggcgccgcccaccaggatgttggcccccacgatgaag 633

                                                          
Query: 383 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtc 429
           |||||||| ||||||||||||||||| |||   |||||||| |||||
Sbjct: 632 ccgatggcaatgggggcgatggtgcccaggctgcccttcttcgggtc 586



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 220 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 267
           ||||| || |||||||||||| ||||||||||| |||||| |||||||
Sbjct: 795 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 748



to top

>emb|AJ289866.2|VVI289866 Vitis vinifera mRNA for putative aquaporin (delta-TIP gene)
          Length = 1017

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 90/106 (84%)
 Strand = Plus / Minus

                                                                       
Query: 261 cccagtagatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgagcgtg 320
           |||||||||||||| |||   |||||||||||||| | |||||||||||||| ||||| |
Sbjct: 655 cccagtagatccagttgtccttgaagtcgccgctgacgacggcggggccgaaggagcggg 596

                                                         
Query: 321 cagggttcatggaaccgccggagaaggggccggcaacgaggatgtt 366
           | |||||||| || || |||||||| ||||| ||| | ||||||||
Sbjct: 595 cggggttcattgatccaccggagaatgggcctgcagccaggatgtt 550



to top

>gb|U62778.1|GHU62778 Gossypium hirsutum delta-tonoplast intrinsic protein mRNA, complete
           cds
          Length = 997

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 150/187 (80%)
 Strand = Plus / Minus

                                                                       
Query: 261 cccagtagatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgagcgtg 320
           ||||||||||||| |||  | |||||||||| || || || || || ||||| ||||| |
Sbjct: 692 cccagtagatccatatgccgttgaagtcgccactagccactgctggtccgaaggagcgag 633

                                                                       
Query: 321 cagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatga 380
           | ||||||||||| || || ||||| || || ||  | | ||||||||| || || ||||
Sbjct: 632 ctgggttcatggatccaccagagaatggaccagcggccaagatgttggcaccaacaatga 573

                                                                       
Query: 381 aaccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtgg 440
           | |||||||| ||||| || ||||| ||||| ||||||||||| ||||| || ||||| |
Sbjct: 572 agccgatggcaatgggtgcaatggtcccgagtgatcccttctttgggtcagctgcggttg 513

                  
Query: 441 cgtacac 447
           | |||||
Sbjct: 512 catacac 506



to top

>gb|U39486.1|ATU39486 Arabidopsis thaliana delta tonoplast integral protein gene, partial
            cds
          Length = 2235

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 90/107 (84%)
 Strand = Plus / Minus

                                                                        
Query: 338  ccggagaaggggccggcaacgaggatgttggccccgacgatgaaaccgatggcgatgggg 397
            |||||||| || |||||  ||||||||||||| || ||||| | ||| |||||||  || 
Sbjct: 2228 ccggagaatggaccggcggcgaggatgttggcaccaacgataagaccaatggcgagagga 2169

                                                           
Query: 398  gcgatggtgccgagggatcccttcttggggtcggcggcggtggcgta 444
            |||||||| ||||| || ||||||||||| || ||||||||||||||
Sbjct: 2168 gcgatggttccgagagaacccttcttgggatcagcggcggtggcgta 2122



to top

>gb|AF133532.1|AF133532 Mesembryanthemum crystallinum water channel protein MipK (MipK)
           mRNA, complete cds
          Length = 1076

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 116/143 (81%)
 Strand = Plus / Minus

                                                                       
Query: 302 gcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgagg 361
           ||||| ||||||||||| || ||||||||||| || || ||||| ||||||||  | | |
Sbjct: 696 gcgggcccgaatgagcgggctgggttcatggatccaccagagaatgggccggcggccaag 637

                                                                       
Query: 362 atgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgagggatcccttc 421
           |||||||| || || ||||| || || || |||||||| |||||||| |  || ||| ||
Sbjct: 636 atgttggctccaacaatgaacccaatagcaatgggggcaatggtgcccactgagcccctc 577

                                  
Query: 422 ttggggtcggcggcggtggcgta 444
           ||||||||  | |||||||||||
Sbjct: 576 ttggggtcaactgcggtggcgta 554



to top

>gb|AF047173.1| Vernicia fordii aquaporin mRNA, complete cds
          Length = 1049

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 142/178 (79%)
 Strand = Plus / Minus

                                                                       
Query: 261 cccagtagatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgagcgtg 320
           |||||||||||||| ||| |  |||||| |||||  | || || || ||||| ||||| |
Sbjct: 736 cccagtagatccagttgtcgtggaagtcaccgcttaccacagctggcccgaaggagcggg 677

                                                                       
Query: 321 cagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatga 380
           | |||| |||||| || || ||||| ||||| ||| | |  |||||||| || || ||||
Sbjct: 676 ctgggtacatggatccaccagagaatgggcctgcagccaaaatgttggcaccaacaatga 617

                                                                     
Query: 381 aaccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggt 438
           |||| ||||| ||||| || |||||||| || ||||| ||||||||||| || |||||
Sbjct: 616 aaccaatggcaatgggagcaatggtgcctagtgatcctttcttggggtcagctgcggt 559



to top

>gb|AY389618.1| Hyacinthus orientalis mitochondrial tonoplast intrinsic protein
           (TIP1) mRNA, partial cds
          Length = 662

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 75/89 (84%)
 Strand = Plus / Minus

                                                                       
Query: 359 aggatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgagggatccc 418
           |||||||||||||| |||||||| ||||| |||||||| ||||| || || |||   |||
Sbjct: 556 aggatgttggcccccacgatgaagccgatcgcgatgggcgcgatcgtccccaggctcccc 497

                                        
Query: 419 ttcttggggtcggcggcggtggcgtacac 447
           ||||| |||||   |||||||||||||||
Sbjct: 496 ttcttcgggtcaatggcggtggcgtacac 468



to top

>gb|AC183494.1| Brassica oleracea Contig C, complete sequence
          Length = 285752

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 74/88 (84%)
 Strand = Plus / Minus

                                                                          
Query: 357    cgaggatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgagggatc 416
              ||||||||||||| || ||||||||||| || ||||| || |||||||| ||||| ||||
Sbjct: 123743 cgaggatgttggcaccaacgatgaaaccaatagcgattggtgcgatggttccgagcgatc 123684

                                          
Query: 417    ccttcttggggtcggcggcggtggcgta 444
              | ||||| || || || || ||||||||
Sbjct: 123683 ctttctttggatcagcagctgtggcgta 123656



to top

>dbj|AB000506.1| Carrot mRNA for root specific gene, complete cds
          Length = 992

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 113/140 (80%)
 Strand = Plus / Minus

                                                                       
Query: 305 gggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatg 364
           ||||||||||| || || |||||||| || || |||  ||| ||||| ||| | |  |||
Sbjct: 639 gggccgaatgatcgggccgggttcattgagccaccgctgaatgggccagcagccaaaatg 580

                                                                       
Query: 365 ttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgagggatcccttcttg 424
           ||||| || ||||||||||| ||||| ||||| || |||||||| || || ||||| |||
Sbjct: 579 ttggcaccaacgatgaaaccaatggcaatgggtgcaatggtgcctagtgagccctttttg 520

                               
Query: 425 gggtcggcggcggtggcgta 444
           || || ||||| ||||||||
Sbjct: 519 ggatccgcggctgtggcgta 500



to top

>gb|AF326505.1|AF326505 Zea mays tonoplast membrane integral protein ZmTIP4-1 mRNA,
           complete cds
          Length = 1125

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 112/139 (80%)
 Strand = Plus / Minus

                                                                       
Query: 242 ccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctggcaacg 301
           |||||||  |||||||||  |||||||| ||||  ||| ||  |||| ||| |||| | |
Sbjct: 825 ccgccgagcagcgggccgatccagtagacccagtggtttgtccagtccccggtggccagg 766

                                                                       
Query: 302 gcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgagg 361
           || |||||||| |||||||| |||||||||||  |||||| ||||  |||| |  |||||
Sbjct: 765 gccgggccgaaggagcgtgccgggttcatggacgcgccggtgaagttgccgccggcgagg 706

                              
Query: 362 atgttggccccgacgatga 380
            ||||||| ||||||||||
Sbjct: 705 ctgttggcgccgacgatga 687



to top

>gb|AF009567.1|AF009567 Gossypium hirsutum delta-TIP homolog (MIP) mRNA, partial cds
          Length = 316

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 73/87 (83%)
 Strand = Plus / Minus

                                                                       
Query: 361 gatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgagggatccctt 420
           ||||||||| || || ||||| |||||||| ||||| || ||||| ||||| ||||||||
Sbjct: 289 gatgttggcaccaacaatgaagccgatggcaatgggtgcaatggtcccgagtgatccctt 230

                                      
Query: 421 cttggggtcggcggcggtggcgtacac 447
           ||| ||||| || ||||| || |||||
Sbjct: 229 ctttgggtcagctgcggttgcatacac 203



to top

>emb|AJ314583.1|POC314583 Posidonia oceanica mRNA for putative tonoplast intrinsic protein
           (tip1 gene)
          Length = 1112

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                       
Query: 383 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 442
           |||||||||| ||| ||||| ||||||| || ||| ||||||||||||  ||||||||||
Sbjct: 615 ccgatggcgaggggagcgatagtgccgatggctcctttcttggggtcgatggcggtggcg 556

             
Query: 443 ta 444
           ||
Sbjct: 555 ta 554



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 219 ggtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccag 274
           |||||||||||||||||| | |  | ||||  || |||||| ||||||||||||||
Sbjct: 779 ggtagacgatgccggcgatggctgcaccgactagtgggccgacccagtagatccag 724



to top

>emb|AJ289696.1|POC289696 Posidonia oceanica partial mRNA for putative aquaporin (aq1 gene)
          Length = 428

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                       
Query: 383 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 442
           |||||||||| ||| ||||| ||||||| || ||| ||||||||||||  ||||||||||
Sbjct: 303 ccgatggcgaggggagcgatagtgccgatggctcctttcttggggtcgatggcggtggcg 244

             
Query: 443 ta 444
           ||
Sbjct: 243 ta 242



to top

>gb|AF290618.1|AF290618 Nicotiana glauca putative delta TIP (MIP2) mRNA, complete cds
          Length = 1072

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 81/98 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 ccggcccagtagatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgag 316
           ||||||||||| |||||| |||| ||||||||||| ||||| || || || || ||||| 
Sbjct: 719 ccggcccagtaaatccagttgttagtgaagtcgccactggccacagcaggcccaaatgaa 660

                                                 
Query: 317 cgtgcagggttcatggaaccgccggagaaggggccggc 354
           || || || ||||| || || |||||||| ||||||||
Sbjct: 659 cgggccggattcattgatccaccggagaatgggccggc 622



to top

>ref|NM_188624.1| Oryza sativa (japonica cultivar-group), Ozsa8227 predicted mRNA
          Length = 756

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 62/73 (84%)
 Strand = Plus / Minus

                                                                       
Query: 305 gggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatg 364
           |||||||| ||||| || |||||||||||  |||||||| |||| ||| |  ||||||||
Sbjct: 608 gggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccggcgaggatg 549

                        
Query: 365 ttggccccgacga 377
           ||||| |||||||
Sbjct: 548 ttggcgccgacga 536



to top

>dbj|AP001550.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0431F01
          Length = 143209

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 62/73 (84%)
 Strand = Plus / Minus

                                                                         
Query: 305   gggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatg 364
             |||||||| ||||| || |||||||||||  |||||||| |||| ||| |  ||||||||
Sbjct: 98901 gggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccggcgaggatg 98842

                          
Query: 365   ttggccccgacga 377
             ||||| |||||||
Sbjct: 98841 ttggcgccgacga 98829



to top

>dbj|AK069192.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023007E01, full
           insert sequence
          Length = 1112

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 62/73 (84%)
 Strand = Plus / Minus

                                                                       
Query: 305 gggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatg 364
           |||||||| ||||| || |||||||||||  |||||||| |||| ||| |  ||||||||
Sbjct: 611 gggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccggcgaggatg 552

                        
Query: 365 ttggccccgacga 377
           ||||| |||||||
Sbjct: 551 ttggcgccgacga 539



to top

>ref|NM_124117.2| Arabidopsis thaliana AtTIP2;3; water channel AT5G47450 (AtTIP2;3)
           mRNA, complete cds
          Length = 1051

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 73/88 (82%)
 Strand = Plus / Minus

                                                                       
Query: 357 cgaggatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgagggatc 416
           ||||||||||||| || || ||||| ||||||||||| || |||||||| || || ||||
Sbjct: 597 cgaggatgttggcaccaactatgaagccgatggcgattggagcgatggtccctagcgatc 538

                                       
Query: 417 ccttcttggggtcggcggcggtggcgta 444
           | ||||| || || || || ||||||||
Sbjct: 537 ctttctttggatcagctgctgtggcgta 510



to top

>gb|BT011663.1| Arabidopsis thaliana At5g47450 mRNA, complete cds
          Length = 753

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 73/88 (82%)
 Strand = Plus / Minus

                                                                       
Query: 357 cgaggatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgagggatc 416
           ||||||||||||| || || ||||| ||||||||||| || |||||||| || || ||||
Sbjct: 559 cgaggatgttggcaccaactatgaagccgatggcgattggagcgatggtccctagcgatc 500

                                       
Query: 417 ccttcttggggtcggcggcggtggcgta 444
           | ||||| || || || || ||||||||
Sbjct: 499 ctttctttggatcagctgctgtggcgta 472



to top

>gb|BT011212.1| Arabidopsis thaliana At5g47450 gene, complete cds
          Length = 853

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 73/88 (82%)
 Strand = Plus / Minus

                                                                       
Query: 357 cgaggatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgagggatc 416
           ||||||||||||| || || ||||| ||||||||||| || |||||||| || || ||||
Sbjct: 587 cgaggatgttggcaccaactatgaagccgatggcgattggagcgatggtccctagcgatc 528

                                       
Query: 417 ccttcttggggtcggcggcggtggcgta 444
           | ||||| || || || || ||||||||
Sbjct: 527 ctttctttggatcagctgctgtggcgta 500



to top

>gb|AC183495.1| Brassica oleracea Contig A, complete sequence
          Length = 356505

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 73/88 (82%)
 Strand = Plus / Minus

                                                                          
Query: 357    cgaggatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgagggatc 416
              ||||||| ||||| || ||||||||||| || ||||| || || ||||| ||||| ||||
Sbjct: 101446 cgaggatattggcaccaacgatgaaaccaatagcgatcggagcaatggttccgagcgatc 101387

                                          
Query: 417    ccttcttggggtcggcggcggtggcgta 444
              |||| || || || || |||||||||||
Sbjct: 101386 ccttttttggatcagcagcggtggcgta 101359



to top

>gb|AF326508.1|AF326508 Zea mays tonoplast membrane integral protein ZmTIP4-4 mRNA,
           complete cds
          Length = 955

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 64/76 (84%)
 Strand = Plus / Minus

                                                                       
Query: 302 gcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgagg 361
           ||||||||||| ||||| || |||||||||||  ||||||||||||| ||| |  |||| 
Sbjct: 708 gcggggccgaaggagcgcgcggggttcatggacgcgccggagaagggcccgccggcgagc 649

                           
Query: 362 atgttggccccgacga 377
           | |||||| |||||||
Sbjct: 648 acgttggcgccgacga 633



to top

>emb|BX824373.1|CNS0A6WG Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH44ZA10 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 887

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 73/88 (82%)
 Strand = Plus / Minus

                                                                       
Query: 357 cgaggatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgagggatc 416
           |||||||||| || || ||||||||||| |||||||| || ||||| || ||||| |  |
Sbjct: 448 cgaggatgttcgctccaacgatgaaacctatggcgattggtgcgattgttccgagagtgc 389

                                       
Query: 417 ccttcttggggtcggcggcggtggcgta 444
           | |||||||||||  |||| ||||||||
Sbjct: 388 cgttcttggggtcaacggctgtggcgta 361



to top

>emb|BX822968.1|CNS0A5UC Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB77ZF06 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 945

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 103/128 (80%)
 Strand = Plus / Minus

                                                                       
Query: 317 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 376
           ||||| ||||||||||| || |||||||| || |||||  || ||  |||||| || |||
Sbjct: 654 cgtgctgggttcatggatccaccggagaatggaccggcggcgggggggttggcaccaacg 595

                                                                       
Query: 377 atgaaaccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcg 436
           || | ||| ||||  |  || |||||||| ||||| || ||||||||||| || ||||||
Sbjct: 594 ataagaccaatggaaagaggagcgatggttccgagagaacccttcttgggatcagcggcg 535

                   
Query: 437 gtggcgta 444
           ||||||||
Sbjct: 534 gtggcgta 527



to top

>dbj|AB025628.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MNJ7
          Length = 80117

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 73/88 (82%)
 Strand = Plus / Plus

                                                                        
Query: 357  cgaggatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgagggatc 416
            ||||||||||||| || || ||||| ||||||||||| || |||||||| || || ||||
Sbjct: 8647 cgaggatgttggcaccaactatgaagccgatggcgattggagcgatggtccctagcgatc 8706

                                        
Query: 417  ccttcttggggtcggcggcggtggcgta 444
            | ||||| || || || || ||||||||
Sbjct: 8707 ctttctttggatcagctgctgtggcgta 8734



to top

>gb|L12257.1|SOYNODA Glycine max nodulin-26 mRNA, complete cds
          Length = 1047

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 239 ccaccgccgatgagcgggccggcccagtagatccag 274
           ||||| |||||||| |||||||||||||||||||||
Sbjct: 788 ccacctccgatgagagggccggcccagtagatccag 753



to top

>ref|NM_117838.2| Arabidopsis thaliana DELTA-TIP2/TIP2;2; water channel AT4G17340
           (DELTA-TIP2/TIP2;2) mRNA, complete cds
          Length = 977

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 98/122 (80%)
 Strand = Plus / Minus

                                                                       
Query: 323 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaaa 382
           |||||||||||||| |||   ||||| || ||  ||||||||||||| || |||||||||
Sbjct: 658 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 599

                                                                       
Query: 383 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 442
           ||||| || || || || ||||| ||||| || || ||||| || || || || ||||||
Sbjct: 598 ccgatagcaattggagcaatggtcccgagtgaacctttctttggatcagccgctgtggcg 539

             
Query: 443 ta 444
           ||
Sbjct: 538 ta 537



to top

>emb|Z97343.1|ATFCA8 Arabidopsis thaliana DNA chromosome 4, ESSA I FCA contig fragment No. 8
          Length = 207674

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 98/122 (80%)
 Strand = Plus / Minus

                                                                         
Query: 323   gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaaa 382
             |||||||||||||| |||   ||||| || ||  ||||||||||||| || |||||||||
Sbjct: 64861 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 64802

                                                                         
Query: 383   ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 442
             ||||| || || || || ||||| ||||| || || ||||| || || || || ||||||
Sbjct: 64801 ccgatagcaattggagcaatggtcccgagtgaacctttctttggatcagccgctgtggcg 64742

               
Query: 443   ta 444
             ||
Sbjct: 64741 ta 64740



to top

>emb|AL161546.2|ATCHRIV46 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 46
          Length = 198788

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 98/122 (80%)
 Strand = Plus / Minus

                                                                         
Query: 323   gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaaa 382
             |||||||||||||| |||   ||||| || ||  ||||||||||||| || |||||||||
Sbjct: 54226 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 54167

                                                                         
Query: 383   ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 442
             ||||| || || || || ||||| ||||| || || ||||| || || || || ||||||
Sbjct: 54166 ccgatagcaattggagcaatggtcccgagtgaacctttctttggatcagccgctgtggcg 54107

               
Query: 443   ta 444
             ||
Sbjct: 54106 ta 54105



to top

>gb|AY056063.1| Arabidopsis thaliana AT4g17340/dl4705w mRNA, complete cds
          Length = 753

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 98/122 (80%)
 Strand = Plus / Minus

                                                                       
Query: 323 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaaa 382
           |||||||||||||| |||   ||||| || ||  ||||||||||||| || |||||||||
Sbjct: 593 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 534

                                                                       
Query: 383 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 442
           ||||| || || || || ||||| ||||| || || ||||| || || || || ||||||
Sbjct: 533 ccgatagcaattggagcaatggtcccgagtgaacctttctttggatcagccgctgtggcg 474

             
Query: 443 ta 444
           ||
Sbjct: 473 ta 472



to top

>gb|AF367283.1|AF367283 Arabidopsis thaliana AT4g17340/dl4705w mRNA, complete cds
          Length = 972

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 98/122 (80%)
 Strand = Plus / Minus

                                                                       
Query: 323 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaaa 382
           |||||||||||||| |||   ||||| || ||  ||||||||||||| || |||||||||
Sbjct: 655 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 596

                                                                       
Query: 383 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 442
           ||||| || || || || ||||| ||||| || || ||||| || || || || ||||||
Sbjct: 595 ccgatagcaattggagcaatggtcccgagtgaacctttctttggatcagccgctgtggcg 536

             
Query: 443 ta 444
           ||
Sbjct: 535 ta 534



to top

>emb|BX825196.1|CNS0A4OU Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL1ZB11 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 954

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 98/122 (80%)
 Strand = Plus / Minus

                                                                       
Query: 323 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaaa 382
           |||||||||||||| |||   ||||| || ||  ||||||||||||| || |||||||||
Sbjct: 641 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 582

                                                                       
Query: 383 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 442
           ||||| || || || || ||||| ||||| || || ||||| || || || || ||||||
Sbjct: 581 ccgatagcaattggagcaatggtcccgagtgaacctttctttggatcagccgctgtggcg 522

             
Query: 443 ta 444
           ||
Sbjct: 521 ta 520



to top

>emb|BX828364.1|CNS0A340 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH80ZD07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 936

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 98/122 (80%)
 Strand = Plus / Minus

                                                                       
Query: 323 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaaa 382
           |||||||||||||| |||   ||||| || ||  ||||||||||||| || |||||||||
Sbjct: 616 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 557

                                                                       
Query: 383 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 442
           ||||| || || || || ||||| ||||| || || ||||| || || || || ||||||
Sbjct: 556 ccgatagcaattggagcaatggtcccgagtgaacctttctttggatcagccgctgtggcg 497

             
Query: 443 ta 444
           ||
Sbjct: 496 ta 495



to top

>gb|AY088929.1| Arabidopsis thaliana clone 99796 mRNA, complete sequence
          Length = 969

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 98/122 (80%)
 Strand = Plus / Minus

                                                                       
Query: 323 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaaa 382
           |||||||||||||| |||   ||||| || ||  ||||||||||||| || |||||||||
Sbjct: 659 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 600

                                                                       
Query: 383 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 442
           ||||| || || || || ||||| ||||| || || ||||| || || || || ||||||
Sbjct: 599 ccgatagcaattggagcaatggtcccgagtgaacctttctttggatcagccgctgtggcg 540

             
Query: 443 ta 444
           ||
Sbjct: 539 ta 538



to top

>ref|NM_113559.3| Arabidopsis thaliana TIP2 (TONOPLAST INTRINSIC PROTEIN 2); water
           channel AT3G26520 (TIP2) mRNA, complete cds
          Length = 1201

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 72/88 (81%)
 Strand = Plus / Minus

                                                                       
Query: 357 cgaggatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgagggatc 416
           |||||||||| || || ||||||||||| |||||||| || ||||| || |||||    |
Sbjct: 680 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 621

                                       
Query: 417 ccttcttggggtcggcggcggtggcgta 444
           | |||||||||||  |||| ||||||||
Sbjct: 620 cgttcttggggtcaacggctgtggcgta 593



to top

>gb|DQ450071.1| Arachis hypogaea clone 8A4R19G1 putative major intrinsic protein
           mRNA, partial cds
          Length = 770

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 108/136 (79%)
 Strand = Plus / Minus

                                                                       
Query: 261 cccagtagatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgagcgtg 320
           ||||||||||||||   || |||||||| || |||  ||| || || || || |||||||
Sbjct: 484 cccagtagatccagtgattagtgaagtctccactgataacagcaggtccaaaggagcgtg 425

                                                                       
Query: 321 cagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatga 380
           |||||||||| || ||||| ||||| |  || ||| | | ||||||||| || || ||||
Sbjct: 424 cagggttcattgagccgccagagaatgcccctgcagccaagatgttggcacctacaatga 365

                           
Query: 381 aaccgatggcgatggg 396
           |||| ||||| |||||
Sbjct: 364 aaccaatggcaatggg 349



to top

>gb|DQ450067.1| Arachis hypogaea clone 2A1R19GZ delta-TIP-like protein mRNA,
           partial cds
          Length = 684

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 108/136 (79%)
 Strand = Plus / Minus

                                                                       
Query: 261 cccagtagatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgagcgtg 320
           ||||||||||||||   || |||||||| || |||  ||| || || || || |||||||
Sbjct: 397 cccagtagatccagtgattagtgaagtctccactgataacagcaggtccaaaggagcgtg 338

                                                                       
Query: 321 cagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatga 380
           |||||||||| || ||||| ||||| |  || ||| | | ||||||||| || || ||||
Sbjct: 337 cagggttcattgagccgccagagaatgcccctgcagccaagatgttggcacctacaatga 278

                           
Query: 381 aaccgatggcgatggg 396
           |||| ||||| |||||
Sbjct: 277 aaccaatggcaatggg 262



to top

>emb|X95650.1|TGTIP1GEN T.gesneriana mRNA for tonoplast intrinsic protein
          Length = 992

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 362 atgttggccccgacgatgaaaccgatggcgatgggggcgatggt 405
           |||||||| ||||||||||| ||||| || ||||| ||||||||
Sbjct: 580 atgttggcaccgacgatgaatccgatcgcaatgggagcgatggt 537



to top

>emb|AJ243309.1|PSA243309 Pisum sativum mRNA for putative tonoplast intrinsic protein (gene
           tip1-1)
          Length = 1104

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 239 ccaccgccgatgagcgggccggcccagtagatccag 274
           ||||| ||||| || |||||||||||||||||||||
Sbjct: 755 ccaccaccgataagtgggccggcccagtagatccag 720



to top

>gb|AY079114.1| Arabidopsis thaliana AT3g26520/MFE16_3 mRNA, complete cds
          Length = 762

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 72/88 (81%)
 Strand = Plus / Minus

                                                                       
Query: 357 cgaggatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgagggatc 416
           |||||||||| || || ||||||||||| |||||||| || ||||| || |||||    |
Sbjct: 568 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 509

                                       
Query: 417 ccttcttggggtcggcggcggtggcgta 444
           | |||||||||||  |||| ||||||||
Sbjct: 508 cgttcttggggtcaacggctgtggcgta 481



to top

>gb|AF419613.1|AF419613 Arabidopsis thaliana AT3g26520/MFE16_3 mRNA, complete cds
          Length = 1061

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 72/88 (81%)
 Strand = Plus / Minus

                                                                       
Query: 357 cgaggatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgagggatc 416
           |||||||||| || || ||||||||||| |||||||| || ||||| || |||||    |
Sbjct: 630 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 571

                                       
Query: 417 ccttcttggggtcggcggcggtggcgta 444
           | |||||||||||  |||| ||||||||
Sbjct: 570 cgttcttggggtcaacggctgtggcgta 543



to top

>gb|AF428341.1|AF428341 Arabidopsis thaliana AT3g26520/MFE16_3 mRNA, complete cds
          Length = 1066

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 72/88 (81%)
 Strand = Plus / Minus

                                                                       
Query: 357 cgaggatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgagggatc 416
           |||||||||| || || ||||||||||| |||||||| || ||||| || |||||    |
Sbjct: 635 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 576

                                       
Query: 417 ccttcttggggtcggcggcggtggcgta 444
           | |||||||||||  |||| ||||||||
Sbjct: 575 cgttcttggggtcaacggctgtggcgta 548



to top

>gb|AF004393.1|AF004393 Arabidopsis thaliana salt-stress induced tonoplast intrinsic
           protein mRNA, complete cds
          Length = 1072

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 72/88 (81%)
 Strand = Plus / Minus

                                                                       
Query: 357 cgaggatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgagggatc 416
           |||||||||| || || ||||||||||| |||||||| || ||||| || |||||    |
Sbjct: 642 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 583

                                       
Query: 417 ccttcttggggtcggcggcggtggcgta 444
           | |||||||||||  |||| ||||||||
Sbjct: 582 cgttcttggggtcaacggctgtggcgta 555



to top

>gb|AF326509.1|AF326509 Zea mays tonoplast membrane integral protein ZmTIP5-1 mRNA,
           complete cds
          Length = 1021

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 282 tgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatgga 333
           |||||| ||||||| | ||||| |||||||| ||||| || |||||||||||
Sbjct: 719 tgaagtggccgctgacgacggccgggccgaacgagcgggccgggttcatgga 668



to top

>emb|BX822807.1|CNS0A75T Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB65ZD08 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1010

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 72/88 (81%)
 Strand = Plus / Minus

                                                                       
Query: 357 cgaggatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgagggatc 416
           |||||||||| || || ||||||||||| |||||||| || ||||| || |||||    |
Sbjct: 618 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 559

                                       
Query: 417 ccttcttggggtcggcggcggtggcgta 444
           | |||||||||||  |||| ||||||||
Sbjct: 558 cgttcttggggtcaacggctgtggcgta 531



to top

>emb|BX822624.1|CNS0A742 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB53ZH08 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1020

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 72/88 (81%)
 Strand = Plus / Minus

                                                                       
Query: 357 cgaggatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgagggatc 416
           |||||||||| || || ||||||||||| |||||||| || ||||| || |||||    |
Sbjct: 616 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 557

                                       
Query: 417 ccttcttggggtcggcggcggtggcgta 444
           | |||||||||||  |||| ||||||||
Sbjct: 556 cgttcttggggtcaacggctgtggcgta 529



to top

>emb|BX824073.1|CNS0A6T2 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH1ZE06 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1008

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 72/88 (81%)
 Strand = Plus / Minus

                                                                       
Query: 357 cgaggatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgagggatc 416
           |||||||||| || || ||||||||||| |||||||| || ||||| || |||||    |
Sbjct: 616 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 557

                                       
Query: 417 ccttcttggggtcggcggcggtggcgta 444
           | |||||||||||  |||| ||||||||
Sbjct: 556 cgttcttggggtcaacggctgtggcgta 529



to top

>emb|BX822975.1|CNS0A733 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB78ZD01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1054

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 72/88 (81%)
 Strand = Plus / Minus

                                                                       
Query: 357 cgaggatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgagggatc 416
           |||||||||| || || ||||||||||| |||||||| || ||||| || |||||    |
Sbjct: 607 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 548

                                       
Query: 417 ccttcttggggtcggcggcggtggcgta 444
           | |||||||||||  |||| ||||||||
Sbjct: 547 cgttcttggggtcaacggctgtggcgta 520



to top

>emb|BX824311.1|CNS0A6PE Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH38ZH05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 995

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 72/88 (81%)
 Strand = Plus / Minus

                                                                       
Query: 357 cgaggatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgagggatc 416
           |||||||||| || || ||||||||||| |||||||| || ||||| || |||||    |
Sbjct: 625 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 566

                                       
Query: 417 ccttcttggggtcggcggcggtggcgta 444
           | |||||||||||  |||| ||||||||
Sbjct: 565 cgttcttggggtcaacggctgtggcgta 538



to top

>emb|BX823637.1|CNS0A6I3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS5ZE05 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 960

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 72/88 (81%)
 Strand = Plus / Minus

                                                                       
Query: 357 cgaggatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgagggatc 416
           |||||||||| || || ||||||||||| |||||||| || ||||| || |||||    |
Sbjct: 439 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 380

                                       
Query: 417 ccttcttggggtcggcggcggtggcgta 444
           | |||||||||||  |||| ||||||||
Sbjct: 379 cgttcttggggtcaacggctgtggcgta 352



to top

>emb|BX823607.1|CNS0A6MK Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS56ZB09 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1012

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 72/88 (81%)
 Strand = Plus / Minus

                                                                       
Query: 357 cgaggatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgagggatc 416
           |||||||||| || || ||||||||||| |||||||| || ||||| || |||||    |
Sbjct: 616 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 557

                                       
Query: 417 ccttcttggggtcggcggcggtggcgta 444
           | |||||||||||  |||| ||||||||
Sbjct: 556 cgttcttggggtcaacggctgtggcgta 529



to top

>dbj|AB028611.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MFE16
          Length = 82646

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 72/88 (81%)
 Strand = Plus / Plus

                                                                         
Query: 357   cgaggatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgagggatc 416
             |||||||||| || || ||||||||||| |||||||| || ||||| || |||||    |
Sbjct: 15558 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 15617

                                         
Query: 417   ccttcttggggtcggcggcggtggcgta 444
             | |||||||||||  |||| ||||||||
Sbjct: 15618 cgttcttggggtcaacggctgtggcgta 15645



to top

>dbj|AK060994.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-E02, full
           insert sequence
          Length = 870

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 416 cccttcttggggtcggcggcggtggcgtacac 447
           ||||||||||||||  ||||||||||||||||
Sbjct: 588 cccttcttggggtcaacggcggtggcgtacac 557



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 220 gtagacgatgccggcgaggccaccgccgatg 250
           ||||| || ||||||||||||||||||||||
Sbjct: 622 gtagatgacgccggcgaggccaccgccgatg 592



to top

>gb|AF118381.1|AF118381 Brassica napus tonoplast intrinsic protein (gamma-TIP2) mRNA,
           complete cds
          Length = 1020

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 72/88 (81%)
 Strand = Plus / Minus

                                                                       
Query: 357 cgaggatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgagggatc 416
           |||||||||| || || ||||||||||| |||||||| || ||||| || |||||    |
Sbjct: 577 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 518

                                       
Query: 417 ccttcttggggtcggcggcggtggcgta 444
           | |||||||||||  |||| ||||||||
Sbjct: 517 cgttcttggggtcaacggctgtggcgta 490



to top

>dbj|D84669.1| Raphanus sativus mRNA for VM23, complete sequence
          Length = 1054

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 72/88 (81%)
 Strand = Plus / Minus

                                                                       
Query: 357 cgaggatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgagggatc 416
           |||||||||| || || ||||||||||| ||||| || || ||||| || |||||    |
Sbjct: 638 cgaggatgttagctccaacgatgaaacctatggcaattggtgcgattgttccgagactac 579

                                       
Query: 417 ccttcttggggtcggcggcggtggcgta 444
           | |||||||||||| |||| ||||||||
Sbjct: 578 cgttcttggggtcgacggctgtggcgta 551



to top

>dbj|AB012270.1| Aster tripolium mRNA for SAMIPD, partial cds
          Length = 321

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 361 gatgttggccccgacgatgaaaccgatggcgatggg 396
           ||||||||| ||||||||||| |||||||| |||||
Sbjct: 321 gatgttggcgccgacgatgaagccgatggcaatggg 286



to top

>ref|XM_470886.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1812

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 273 agatgttggtgaagtcgccgctg 295
           |||||||||||||||||||||||
Sbjct: 877 agatgttggtgaagtcgccgctg 855



to top

>gb|AC091787.6| Oryza sativa (japonica cultivar-group) chromosome 3 clone
             OSJNBa0087G11, complete sequence
          Length = 169728

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 273   agatgttggtgaagtcgccgctg 295
             |||||||||||||||||||||||
Sbjct: 59831 agatgttggtgaagtcgccgctg 59853



to top

>emb|AL606622.3|OSJN00059 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0004N05,
              complete sequence
          Length = 158601

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 273    agatgttggtgaagtcgccgctg 295
              |||||||||||||||||||||||
Sbjct: 106408 agatgttggtgaagtcgccgctg 106430



to top

>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome
          Length = 5331656

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 229    gccggcgaggccaccgccgatga 251
              |||||||||||||||||||||||
Sbjct: 505313 gccggcgaggccaccgccgatga 505291



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 229     gccggcgaggccaccgccga 248
               ||||||||||||||||||||
Sbjct: 1274146 gccggcgaggccaccgccga 1274165



to top

>emb|BX822304.1|CNS0A7A0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB27ZF06 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 628

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 357 cgaggatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgag 411
           |||||||||| || || ||||||||||| |||||||| || ||||| || |||||
Sbjct: 182 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgag 128



to top

>emb|BX823744.1|CNS0A6NJ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS71ZE09 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 573

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 357 cgaggatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgag 411
           |||||||||| || || ||||||||||| |||||||| || ||||| || |||||
Sbjct: 143 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgag 89



to top

>dbj|AB206106.1| Mimosa pudica tip2;1 mRNA for tonoplast intrinsic protein 2;1,
           complete cds
          Length = 1001

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 65/79 (82%)
 Strand = Plus / Minus

                                                                       
Query: 261 cccagtagatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgagcgtg 320
           ||||||||||||||  |||||||||||| |||    |  |||| ||||||||||| || |
Sbjct: 707 cccagtagatccagtagttggtgaagtcaccggatacggcggctgggccgaatgaacggg 648

                              
Query: 321 cagggttcatggaaccgcc 339
           | |||||||| ||||||||
Sbjct: 647 ccgggttcattgaaccgcc 629



to top

>dbj|AK107457.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-128-C11, full
           insert sequence
          Length = 1679

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 273 agatgttggtgaagtcgccgctg 295
           |||||||||||||||||||||||
Sbjct: 794 agatgttggtgaagtcgccgctg 816



to top

>gb|AF057137.1|AF057137 Arabidopsis thaliana gamma tonoplast intrinsic protein 2 (TIP2)
           mRNA, complete cds
          Length = 1035

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 357 cgaggatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgag 411
           |||||||||| || || ||||||||||| |||||||| || ||||| || |||||
Sbjct: 621 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgag 567



to top

>dbj|AB012269.1| Aster tripolium mRNA for SAMIPC, partial cds
          Length = 321

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 371 ccgacgatgaaaccgatggcgatgggggcgatggtgccgagggatcccttcttggggtc 429
           ||||||||||| ||||||||||  || || ||||| ||||  || ||||||||||||||
Sbjct: 311 ccgacgatgaagccgatggcgactggtgcaatggttccgaacgagcccttcttggggtc 253



to top

>ref|XM_856403.1| PREDICTED: Canis familiaris similar to aquaporin 6, transcript
           variant 2 (LOC607978), mRNA
          Length = 1082

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 301 ggcggggccgaatgagcgtgcagggttcatggaaccgccggagaag 346
           |||||||||||| ||||| || ||||||||||| | ||||| ||||
Sbjct: 588 ggcggggccgaaggagcgggccgggttcatggagcagccggtgaag 543



to top

>ref|XM_845359.1| PREDICTED: Canis familiaris similar to aquaporin 6, transcript
           variant 1 (LOC607978), mRNA
          Length = 1067

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 301 ggcggggccgaatgagcgtgcagggttcatggaaccgccggagaag 346
           |||||||||||| ||||| || ||||||||||| | ||||| ||||
Sbjct: 573 ggcggggccgaaggagcgggccgggttcatggagcagccggtgaag 528



to top

>emb|AJ245953.1|SOL245953 Spinacia oleracea mRNA for delta tonoplast intrinsic protein (dtip
           gene)
          Length = 1101

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 305 gggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggc 354
           ||||||||||| || || |||||||| ||||| || ||||| ||||||||
Sbjct: 713 gggccgaatgaacgggctgggttcattgaaccaccagagaacgggccggc 664



to top

>gb|DQ226889.1| Boechera divaricarpa isolate SLW-D-E07 mRNA sequence
          Length = 980

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 230 ccggcgaggccaccgccgatgagcgggccggcccagtagatccag 274
           |||||||  |||||||||| ||| || ||||||||||||| ||||
Sbjct: 705 ccggcgattccaccgccgacgagaggtccggcccagtagacccag 661



to top

>ref|XM_001003742.1| PREDICTED: Mus musculus aquaporin 6 (Aqp6), mRNA
          Length = 890

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 299 acggcggggccgaatgagcgtgcagggttcatggaac 335
           ||||| |||||||| ||||| || |||||||||||||
Sbjct: 613 acggcagggccgaaggagcgggctgggttcatggaac 577



to top

>ref|XM_994651.1| PREDICTED: Mus musculus aquaporin 6 (Aqp6), mRNA
          Length = 890

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 299 acggcggggccgaatgagcgtgcagggttcatggaac 335
           ||||| |||||||| ||||| || |||||||||||||
Sbjct: 613 acggcagggccgaaggagcgggctgggttcatggaac 577



to top

>ref|XM_543677.2| PREDICTED: Canis familiaris similar to Aquaporin 5 (LOC486551),
           mRNA
          Length = 1556

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 302 gcggggccgaatgagcgtgcagggttcatggaaccgccggagaag 346
           ||||||||||| ||||| || ||||||||||| | ||||| ||||
Sbjct: 794 gcggggccgaaagagcgggccgggttcatggagcagccggtgaag 750



to top

>gb|AF521142.1| Kandelia candel tonoplast intrinsic protein mRNA, partial cds
          Length = 175

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 364 gttggccccgacgatgaaaccgatggcgatgggggcgatggtgcc 408
           |||||| || || ||||||||||||||||| || ||||| |||||
Sbjct: 62  gttggcacccacaatgaaaccgatggcgattggcgcgattgtgcc 18



to top

>emb|Z29946.1|TRGTIPLP T.repens (Huia) mRNA for gamma-Tip-like protein
          Length = 991

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 254 gggccggcccagtagatccag 274
           |||||||||||||||||||||
Sbjct: 655 gggccggcccagtagatccag 635



to top

>emb|BX569693.1| Synechococcus sp. WH8102 complete genome; segment 5/7
          Length = 349213

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 417    ccttcttggggtcggcggcgg 437
              |||||||||||||||||||||
Sbjct: 320884 ccttcttggggtcggcggcgg 320864



to top

>dbj|AK082699.1| Mus musculus 0 day neonate cerebellum cDNA, RIKEN full-length
           enriched library, clone:C230090D02 product:aquaporin 6,
           full insert sequence
          Length = 2066

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 299 acggcggggccgaatgagcgtgcagggttcatggaac 335
           ||||| |||||||| ||||| || |||||||||||||
Sbjct: 614 acggcagggccgaaggagcgggctgggttcatggaac 578



to top

>emb|BX823199.1|CNS0A7SU Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB9ZH07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 481

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 357 cgaggatgttggccccgacgatgaaaccgatggcgat 393
           |||||||||| || || ||||||||||| ||||||||
Sbjct: 46  cgaggatgttagctccaacgatgaaacctatggcgat 10



to top

>emb|BX822791.1|CNS0A7SC Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB64ZD05 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 503

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 357 cgaggatgttggccccgacgatgaaaccgatggcgat 393
           |||||||||| || || ||||||||||| ||||||||
Sbjct: 55  cgaggatgttagctccaacgatgaaacctatggcgat 19



to top

>emb|BX842163.1|CNS09YDT Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH74ZE01 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 921

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 357 cgaggatgttggccccgacgatgaaaccgatggcgat 393
           |||||||||| || || ||||||||||| ||||||||
Sbjct: 615 cgaggatgttagctccaacgatgaaacctatggcgat 579



to top

>emb|BX842138.1|CNS09YDN Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS54ZD02 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1062

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 69/85 (81%)
 Strand = Plus / Minus

                                                                       
Query: 360 ggatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgagggatccct 419
           ||||||| || || ||||||||||| |||||||| || ||||| || |||||    || |
Sbjct: 613 ggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactaccgt 554

                                    
Query: 420 tcttggggtcggcggcggtggcgta 444
           ||||||||||  |||| ||||||||
Sbjct: 553 tcttggggtcaacggctgtggcgta 529



to top

>emb|AJ555456.1|ECA555456 Equus caballus partial mRNA for aquaporin 5 (aqp5 gene)
          Length = 535

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 302 gcggggccgaatgagcgtgcagggttcatggaaccgccggagaag 346
           ||||||||||| ||||| || ||||||||||| | ||||| ||||
Sbjct: 534 gcggggccgaaagagcgggctgggttcatggagcagccggtgaag 490



to top

>gb|AY610211.1| Sus scrofa clone Clu_9762.scr.msk.p1.Contig1, mRNA sequence
          Length = 2291

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                         
Query: 302  gcggggccgaatgagcgtgcagggttcatggaaccgccggagaag 346
            ||||||||||| ||||| || ||||||||||| | ||||| ||||
Sbjct: 2227 gcggggccgaaagagcgggctgggttcatggagcagccggtgaag 2271



to top

>gb|AC139317.4| Mus musculus BAC clone RP24-495N6 from 15, complete sequence
          Length = 182415

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                  
Query: 299   acggcggggccgaatgagcgtgcagggttcatggaac 335
             ||||| |||||||| ||||| || |||||||||||||
Sbjct: 98545 acggcagggccgaaggagcgggctgggttcatggaac 98581



to top

>ref|NM_175087.2| Mus musculus aquaporin 6 (Aqp6), mRNA
          Length = 2066

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 299 acggcggggccgaatgagcgtgcagggttcatggaac 335
           ||||| |||||||| ||||| || |||||||||||||
Sbjct: 614 acggcagggccgaaggagcgggctgggttcatggaac 578



to top

>dbj|AB048248.1| Pyrus communis Py-gTIP mRNA for gamma tonoplast intrinsic protein,
           complete cds
          Length = 1122

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 362 atgttggccccgacgatgaaaccgatggcgatgggggcgat 402
           |||||||| || ||||||||||| || |||||||| |||||
Sbjct: 631 atgttggcgccaacgatgaaaccaatcgcgatgggcgcgat 591



to top

>dbj|AB012271.1| Aster tripolium mRNA for SAMIPE, partial cds
          Length = 321

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 57/69 (82%)
 Strand = Plus / Minus

                                                                       
Query: 361 gatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgagggatccctt 420
           ||||||||| |||||||| || ||||||||||| || || || ||||| |  |  |||||
Sbjct: 321 gatgttggcgccgacgataaagccgatggcgatcggtgcaattgtgcccaatgcaccctt 262

                    
Query: 421 cttggggtc 429
           |||||||||
Sbjct: 261 cttggggtc 253



to top

>dbj|AB012267.1| Aster tripolium mRNA for SAMIPA, partial cds
          Length = 321

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                       
Query: 365 ttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgagggatcccttcttg 424
           ||||| |||||||| || ||||||||||| || || ||||| || || |||||||| || 
Sbjct: 317 ttggcgccgacgataaagccgatggcgattggtgcaatggttcctagtgatcccttttta 258

                
Query: 425 gggtc 429
           |||||
Sbjct: 257 gggtc 253



to top

>ref|NM_129238.2| Arabidopsis thaliana GAMMA-TIP; water channel AT2G36830 (GAMMA-TIP)
           mRNA, complete cds
          Length = 1058

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 239 ccaccgccgatgagcgggccggcccagtagatccag 274
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 747 ccaccgccgacgagaggtccggcccagtagacccag 712



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 361 gatgttggccccgacgatgaaaccgatggcgatggg 396
           ||||||||| || || ||||||||||| ||||||||
Sbjct: 625 gatgttggctccaacaatgaaaccgattgcgatggg 590



to top

>gb|AC130604.4| Oryza sativa (japonica cultivar-group) chromosome 5 clone B1155G07,
             complete sequence
          Length = 146712

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 424   ggggtcggcggcggtggcgt 443
             ||||||||||||||||||||
Sbjct: 72271 ggggtcggcggcggtggcgt 72290



to top

>gb|CP000151.1| Burkholderia sp. 383 chromosome 1, complete sequence
          Length = 3694126

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 371     ccgacgatgaaaccgatggcgatg 394
               |||||||||||||||||| |||||
Sbjct: 1499042 ccgacgatgaaaccgatgacgatg 1499019



to top

>gb|AC108873.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1005_B11,
              complete sequence
          Length = 162772

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 424    ggggtcggcggcggtggcgt 443
              ||||||||||||||||||||
Sbjct: 152085 ggggtcggcggcggtggcgt 152104



to top

>gb|AC006012.2| Homo sapiens PAC clone RP5-942I16 from 7, complete sequence
          Length = 121598

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 121    ggcatcatggaaaccaaaca 140
              ||||||||||||||||||||
Sbjct: 113843 ggcatcatggaaaccaaaca 113824



to top

>gb|AC137077.26| Medicago truncatula clone mth2-8g15, complete sequence
          Length = 138303

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 305   gggccgaatgagcgtgcagggttcatggaacc 336
             |||||||||||||| || |||||||| |||||
Sbjct: 90944 gggccgaatgagcgagccgggttcattgaacc 90913



to top

>emb|X72581.1|ATGTIPMR A.thaliana mRNA for tonoplast intrinsic protein gamma (gamma-TIP)
          Length = 933

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 361 gatgttggccccgacgatgaaaccgatggcgatggg 396
           ||||||||| || || ||||||||||| ||||||||
Sbjct: 594 gatgttggctccaacaatgaaaccgattgcgatggg 559



to top

>emb|X63552.1|ATGTIPARA A.thaliana gene for tonoplast intrinsic protein gamma-TIP(Ara)
          Length = 1398

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 239  ccaccgccgatgagcgggccggcccagtagatccag 274
            |||||||||| ||| || ||||||||||||| ||||
Sbjct: 1132 ccaccgccgacgagaggtccggcccagtagacccag 1097



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 361  gatgttggccccgacgatgaaaccgatggcgatggg 396
            ||||||||| || || ||||||||||| ||||||||
Sbjct: 1010 gatgttggctccaacaatgaaaccgattgcgatggg 975



to top

>gb|AY059134.1| Arabidopsis thaliana putative aquaporin (At2g36830) mRNA, complete
           cds
          Length = 787

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 239 ccaccgccgatgagcgggccggcccagtagatccag 274
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 683 ccaccgccgacgagaggtccggcccagtagacccag 648



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 361 gatgttggccccgacgatgaaaccgatggcgatggg 396
           ||||||||| || || ||||||||||| ||||||||
Sbjct: 561 gatgttggctccaacaatgaaaccgattgcgatggg 526



to top

>gb|AF370172.1| Arabidopsis thaliana putative tonoplast intrinsic protein gamma,
           aquaporin (At2g36830) mRNA, complete cds
          Length = 1030

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 239 ccaccgccgatgagcgggccggcccagtagatccag 274
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 741 ccaccgccgacgagaggtccggcccagtagacccag 706



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 361 gatgttggccccgacgatgaaaccgatggcgatggg 396
           ||||||||| || || ||||||||||| ||||||||
Sbjct: 619 gatgttggctccaacaatgaaaccgattgcgatggg 584



to top

>emb|X54854.1|ATROOTSP A. thaliana mRNA for root-specific gene
          Length = 993

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 239 ccaccgccgatgagcgggccggcccagtagatccag 274
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 725 ccaccgccgacgagaggtccggcccagtagacccag 690



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 361 gatgttggccccgacgatgaaaccgatggcgatggg 396
           ||||||||| || || ||||||||||| ||||||||
Sbjct: 603 gatgttggctccaacaatgaaaccgattgcgatggg 568



to top

>emb|BX640419.1| Bordetella pertussis strain Tohama I, complete genome; segment 9/12
          Length = 349672

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 425    gggtcggcggcggtggcgta 444
              ||||||||||||||||||||
Sbjct: 330461 gggtcggcggcggtggcgta 330480



to top

>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome
          Length = 5513844

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 229     gccggcgaggccaccgccga 248
               ||||||||||||||||||||
Sbjct: 4535021 gccggcgaggccaccgccga 4535040



to top

>gb|U92651.2|BOU92651 Brassica oleracea var. botrytis tonoplast intrinsic protein
           bobTIP26-1 mRNA, complete cds
          Length = 942

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 68/84 (80%)
 Strand = Plus / Minus

                                                                       
Query: 361 gatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgagggatccctt 420
           ||||||||| || || ||||||||||| |||||||| || || || || ||   ||| ||
Sbjct: 597 gatgttggcaccaacaatgaaaccgatagcgatgggagctattgttccaagacttccgtt 538

                                   
Query: 421 cttggggtcggcggcggtggcgta 444
           |||||| ||  |||||||||||||
Sbjct: 537 cttgggatcaacggcggtggcgta 514



to top

>gb|AC006922.7| Arabidopsis thaliana chromosome 2 clone T1J8 map g6825, complete
            sequence
          Length = 134151

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 239  ccaccgccgatgagcgggccggcccagtagatccag 274
            |||||||||| ||| || ||||||||||||| ||||
Sbjct: 7442 ccaccgccgacgagaggtccggcccagtagacccag 7407



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 361  gatgttggccccgacgatgaaaccgatggcgatggg 396
            ||||||||| || || ||||||||||| ||||||||
Sbjct: 7320 gatgttggctccaacaatgaaaccgattgcgatggg 7285



to top

>gb|AC073589.6| Mus musculus strain C57BL/6J chromosome 12 clone RP23-147E23, complete
              sequence
          Length = 222430

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 42     tctgaaccaaacaacatgac 61
              ||||||||||||||||||||
Sbjct: 111593 tctgaaccaaacaacatgac 111574



to top

>gb|CP000264.1| Jannaschia sp. CCS1, complete genome
          Length = 4317977

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 231     cggcgaggccaccgccgatg 250
               ||||||||||||||||||||
Sbjct: 1656225 cggcgaggccaccgccgatg 1656206



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 424      ggggtcggcggcggtggcgt 443
                ||||||||||||||||||||
Sbjct: 12938957 ggggtcggcggcggtggcgt 12938938



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 418      cttcttggggtcggcggcgg 437
                ||||||||||||||||||||
Sbjct: 10869674 cttcttggggtcggcggcgg 10869655



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 424      ggggtcggcggcggtggcgt 443
                ||||||||||||||||||||
Sbjct: 25209430 ggggtcggcggcggtggcgt 25209449



to top

>emb|BX819301.1|CNS0AA93 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB66ZE04 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 996

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 239 ccaccgccgatgagcgggccggcccagtagatccag 274
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 722 ccaccgccgacgagaggtccggcccagtagacccag 687



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 361 gatgttggccccgacgatgaaaccgatggcgatggg 396
           ||||||||| || || ||||||||||| ||||||||
Sbjct: 600 gatgttggctccaacaatgaaaccgattgcgatggg 565



to top

>emb|BX819066.1|CNS0AA99 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB42ZA01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1009

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 239 ccaccgccgatgagcgggccggcccagtagatccag 274
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 712 ccaccgccgacgagaggtccggcccagtagacccag 677



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 361 gatgttggccccgacgatgaaaccgatggcgatggg 396
           ||||||||| || || ||||||||||| ||||||||
Sbjct: 590 gatgttggctccaacaatgaaaccgattgcgatggg 555



to top

>emb|BX818765.1|CNS0AA8G Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB10ZD11 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 950

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 239 ccaccgccgatgagcgggccggcccagtagatccag 274
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 727 ccaccgccgacgagaggtccggcccagtagacccag 692



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 361 gatgttggccccgacgatgaaaccgatggcgatggg 396
           ||||||||| || || ||||||||||| ||||||||
Sbjct: 605 gatgttggctccaacaatgaaaccgattgcgatggg 570



to top

>emb|BX819619.1|CNS0A8TV Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB95ZA10 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 885

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 239 ccaccgccgatgagcgggccggcccagtagatccag 274
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 728 ccaccgccgacgagaggtccggcccagtagacccag 693



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 361 gatgttggccccgacgatgaaaccgatggcgatggg 396
           ||||||||| || || ||||||||||| ||||||||
Sbjct: 606 gatgttggctccaacaatgaaaccgattgcgatggg 571



to top

>emb|BX819585.1|CNS0A8ZS Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB91ZD10 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 975

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 239 ccaccgccgatgagcgggccggcccagtagatccag 274
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 728 ccaccgccgacgagaggtccggcccagtagacccag 693



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 361 gatgttggccccgacgatgaaaccgatggcgatggg 396
           ||||||||| || || ||||||||||| ||||||||
Sbjct: 606 gatgttggctccaacaatgaaaccgattgcgatggg 571



to top

>emb|BX819242.1|CNS0A8YI Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB5ZD01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 904

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 239 ccaccgccgatgagcgggccggcccagtagatccag 274
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 726 ccaccgccgacgagaggtccggcccagtagacccag 691



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 361 gatgttggccccgacgatgaaaccgatggcgatggg 396
           ||||||||| || || ||||||||||| ||||||||
Sbjct: 604 gatgttggctccaacaatgaaaccgattgcgatggg 569



to top

>emb|BX818836.1|CNS0A8V6 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB18ZB03 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 995

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 239 ccaccgccgatgagcgggccggcccagtagatccag 274
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 727 ccaccgccgacgagaggtccggcccagtagacccag 692



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 361 gatgttggccccgacgatgaaaccgatggcgatggg 396
           ||||||||| || || ||||||||||| ||||||||
Sbjct: 605 gatgttggctccaacaatgaaaccgattgcgatggg 570



to top

>emb|BX818785.1|CNS0A8WQ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB13ZC03 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 973

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 239 ccaccgccgatgagcgggccggcccagtagatccag 274
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 726 ccaccgccgacgagaggtccggcccagtagacccag 691



to top

>emb|BX820166.1|CNS0A8IR Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS84ZH08 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 961

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 239 ccaccgccgatgagcgggccggcccagtagatccag 274
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 718 ccaccgccgacgagaggtccggcccagtagacccag 683



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 361 gatgttggccccgacgatgaaaccgatggcgatggg 396
           ||||||||| || || ||||||||||| ||||||||
Sbjct: 596 gatgttggctccaacaatgaaaccgattgcgatggg 561



to top

>emb|BX825064.1|CNS0A6TA Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH92ZF07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 931

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 71/88 (80%)
 Strand = Plus / Minus

                                                                       
Query: 357 cgaggatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgagggatc 416
           |||||||||| || || ||||||||||  |||||||| || |||||  |||||||    |
Sbjct: 604 cgaggatgttcgctccaacgatgaaacttatggcgattggtgcgattttgccgagaatac 545

                                       
Query: 417 ccttcttggggtcggcggcggtggcgta 444
           | |||||||||||  |||| ||||||||
Sbjct: 544 cgttcttggggtcaacggctgtggcgta 517



to top

>gb|AY087558.1| Arabidopsis thaliana clone 36633 mRNA, complete sequence
          Length = 1042

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 239 ccaccgccgatgagcgggccggcccagtagatccag 274
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 747 ccaccgccgacgagaggtccggcccagtagacccag 712



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 361 gatgttggccccgacgatgaaaccgatggcgatggg 396
           ||||||||| || || ||||||||||| ||||||||
Sbjct: 625 gatgttggctccaacaatgaaaccgattgcgatggg 590



to top

>gb|AF497482.1| Micromonospora echinospora calicheamicin biosynthetic locus, complete
            sequence
          Length = 90348

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 242  ccgccgatgagcgggccggc 261
            ||||||||||||||||||||
Sbjct: 7090 ccgccgatgagcgggccggc 7109



to top

>dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0512H04
          Length = 151049

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 418   cttcttggggtcggcggcgg 437
             ||||||||||||||||||||
Sbjct: 93397 cttcttggggtcggcggcgg 93378



to top

>dbj|AP005400.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
            clone:P0698G06
          Length = 138282

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 418  cttcttggggtcggcggcgg 437
            ||||||||||||||||||||
Sbjct: 9379 cttcttggggtcggcggcgg 9360



to top

>dbj|AP004772.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0415B12
          Length = 157419

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 375   cgatgaaaccgatggcgatg 394
             ||||||||||||||||||||
Sbjct: 45637 cgatgaaaccgatggcgatg 45618



to top

>dbj|AB126924.1| Prunus persica Pr-gTIP1 mRNA for tonoplast intrinsic protein,
           complete cds
          Length = 1143

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 239 ccaccgccgatgagcgggccggcccagtagatccag 274
           ||||||||||| |  || ||||||||||||||||||
Sbjct: 783 ccaccgccgatcaaaggcccggcccagtagatccag 748



to top

>dbj|AK101995.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033079I19, full
           insert sequence
          Length = 1652

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 418 cttcttggggtcggcggcgg 437
           ||||||||||||||||||||
Sbjct: 101 cttcttggggtcggcggcgg 82



to top

>gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, complete sequence
          Length = 3131724

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 240    caccgccgatgagcgggccg 259
              ||||||||||||||||||||
Sbjct: 557849 caccgccgatgagcgggccg 557868



to top

>tpe|BN000872.1| TPA: TPA_exp: Mus musculus immunoglobulin heavy chain variable region
               locus, strain C57BL/6
          Length = 2500000

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 42      tctgaaccaaacaacatgac 61
               ||||||||||||||||||||
Sbjct: 1893522 tctgaaccaaacaacatgac 1893503



to top

>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome
          Length = 4751080

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                   
Query: 366     tggccccgacgatgaaaccgatggcgatgggggcga 401
               |||| ||||||||||| ||| || ||||||||||||
Sbjct: 3239016 tggcgccgacgatgaagccggtgacgatgggggcga 3238981



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 424      ggggtcggcggcggtggcgt 443
                ||||||||||||||||||||
Sbjct: 12893231 ggggtcggcggcggtggcgt 12893212



to top

>emb|AL731883.4|CNS08C8N Oryza sativa chromosome 12, . BAC OSJNBa0024B03 of library OSJNBa from
              chromosome 12 of cultivar Nipponbare of ssp. japonica of
              Oryza sativa (rice), complete sequence
          Length = 148110

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 424    ggggtcggcggcggtggcgt 443
              ||||||||||||||||||||
Sbjct: 129013 ggggtcggcggcggtggcgt 129032



to top

>gb|U43291.1|MCU43291 Mesembryanthemum crystallinum tonoplast intrinsic protein (TIP)
           mRNA, complete cds
          Length = 1235

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                               
Query: 361 gatgttggccccgacgatgaaaccgatggcgatgggggcgatggtgccgagg 412
           ||||||||| || ||||||||||| ||||| || ||||| ||| | ||||||
Sbjct: 612 gatgttggctccaacgatgaaaccaatggcaattggggcaatgattccgagg 561



to top

>gb|M84344.1|ATHGTIP Arabidopsis thaliana tonoplast intrinsic protein (gamma-TIP) gene,
            complete cds
          Length = 1398

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 239  ccaccgccgatgagcgggccggcccagtagatccag 274
            |||||||||| ||| || ||||||||||||| ||||
Sbjct: 1132 ccaccgccgacgagaggtccggcccagtagacccag 1097



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 361  gatgttggccccgacgatgaaaccgatggcgatggg 396
            ||||||||| || || ||||||||||| ||||||||
Sbjct: 1010 gatgttggctccaacaatgaaaccgattgcgatggg 975


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,998,570
Number of Sequences: 3902068
Number of extensions: 2998570
Number of successful extensions: 66900
Number of sequences better than 10.0: 202
Number of HSP's better than 10.0 without gapping: 204
Number of HSP's successfully gapped in prelim test: 2
Number of HSP's that attempted gapping in prelim test: 65315
Number of HSP's gapped (non-prelim): 1538
length of query: 447
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 425
effective length of database: 17,147,199,772
effective search space: 7287559903100
effective search space used: 7287559903100
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top