>gb|AC115022.11| Mus musculus chromosome 7, clone RP24-233J11, complete sequence
          Length = 150060

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 131 ctcctgggagaaggctttgga 151
           |||||||||||||||||||||
Sbjct: 260 ctcctgggagaaggctttgga 280

>gb|AC119880.11| Mus musculus chromosome 7, clone RP24-428H4, complete sequence
          Length = 187158

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 131    ctcctgggagaaggctttgga 151
              |||||||||||||||||||||
Sbjct: 164170 ctcctgggagaaggctttgga 164190

>gb|AF384559.1|AF384559 Mus musculus myosin VIIa gene, promoter and partial cds
          Length = 3845

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 131  ctcctgggagaaggctttgga 151
            |||||||||||||||||||||
Sbjct: 2046 ctcctgggagaaggctttgga 2066

>ref|NM_001031593.1| Gallus gallus vacuolar protein sorting 45A (yeast) (VPS45A), mRNA
          Length = 3362

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 157  gcccggctggtgatgctcta 176
            ||||||||||||||||||||
Sbjct: 1271 gcccggctggtgatgctcta 1290

>gb|AC068607.5| Mus musculus strain C57BL6/J chromosome 6 clone RP23-392C14, complete
             sequence
          Length = 218081

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 134   ctgggagaaggctttggaaggacg 157
             |||||||| |||||||||||||||
Sbjct: 22725 ctgggagagggctttggaaggacg 22748

>gb|AY528242.1| Mus musculus neuronal cell adhesion molecule short isoform (Nrcam)
            mRNA, complete cds, alternatively spliced
          Length = 4486

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 308  ggaaaaaatggtatggttgg 327
            ||||||||||||||||||||
Sbjct: 2194 ggaaaaaatggtatggttgg 2213

>emb|AJ720470.1| Gallus gallus mRNA for hypothetical protein, clone 18g1
          Length = 3362

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 157  gcccggctggtgatgctcta 176
            ||||||||||||||||||||
Sbjct: 1271 gcccggctggtgatgctcta 1290

>dbj|AK021089.1| Mus musculus adult male corpus striatum cDNA, RIKEN full-length
           enriched library, clone:C030017F07 product:inferred:
           NgCAM-related related cell adhesion molecule {Homo
           sapiens}, full insert sequence
          Length = 1038

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 308 ggaaaaaatggtatggttgg 327
           ||||||||||||||||||||
Sbjct: 681 ggaaaaaatggtatggttgg 700

>gb|AC156563.1| Mus musculus BAC clone RP24-255E14 from 12, complete sequence
          Length = 175641

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 308   ggaaaaaatggtatggttgg 327
             ||||||||||||||||||||
Sbjct: 46277 ggaaaaaatggtatggttgg 46296

>dbj|AK122252.1| Mus musculus mRNA for mKIAA0343 protein
          Length = 5608

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 308  ggaaaaaatggtatggttgg 327
            ||||||||||||||||||||
Sbjct: 5120 ggaaaaaatggtatggttgg 5139


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,689,606
Number of Sequences: 3902068
Number of extensions: 2689606
Number of successful extensions: 43677
Number of sequences better than 10.0: 10
Number of HSP's better than 10.0 without gapping: 10
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 43665
Number of HSP's gapped (non-prelim): 12
length of query: 425
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 403
effective length of database: 17,147,199,772
effective search space: 6910321508116
effective search space used: 6910321508116
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)