| Clone Name | rbasd21h21 |
|---|---|
| Clone Library Name | barley_pub |
| No. | Definition | Score (bits) |
E Value |
1 | dbj|D38089.1|WHTPH2AC Triticum aestivum mRNA for protein H2A, co... | 68 | 5e-09 | 2 | dbj|D38091.1|WHTPH2AE Triticum aestivum mRNA for protein H2A, co... | 58 | 5e-06 |
|---|
>dbj|D38089.1|WHTPH2AC Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-4 Length = 725 Score = 67.9 bits (34), Expect = 5e-09 Identities = 47/52 (90%) Strand = Plus / Minus Query: 49 tagtaaaacgcaacacctangcaacacttgantgcagacgctactacacaga 100 ||||||||||||||||||| ||||||||| | || | ||||||||||||||| Sbjct: 585 tagtaaaacgcaacacctaggcaacacttaactgaacacgctactacacaga 534
>dbj|D38091.1|WHTPH2AE Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-10 Length = 691 Score = 58.0 bits (29), Expect = 5e-06 Identities = 45/51 (88%) Strand = Plus / Minus Query: 50 agtaaaacgcaacacctangcaacacttgantgcagacgctactacacaga 100 |||||||||||||||||| |||||| || | || | ||||||||||||||| Sbjct: 586 agtaaaacgcaacacctaggcaacatttaactgaacacgctactacacaga 536 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 138,582 Number of Sequences: 3902068 Number of extensions: 138582 Number of successful extensions: 4567 Number of sequences better than 10.0: 2 Number of HSP's better than 10.0 without gapping: 2 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 4563 Number of HSP's gapped (non-prelim): 4 length of query: 104 length of database: 17,233,045,268 effective HSP length: 21 effective length of query: 83 effective length of database: 17,151,101,840 effective search space: 1423541452720 effective search space used: 1423541452720 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)