| Clone Name | rbasd19o08 |
|---|---|
| Clone Library Name | barley_pub |
| No. | Definition | Score (bits) |
E Value |
1 | emb|AJ296273.1|HVU296273 Hordeum vulgare aba7 gene for stress re... | 242 | 4e-61 | 2 | emb|X69817.1|HVABA7 H.vulgare ABA7 mRNA for ABA-induced protein | 242 | 4e-61 | 3 | ref|XM_501986.1| Yarrowia lipolytica CLIB122, YALI0C18689g predi... | 40 | 2.6 | 4 | emb|CR382129.1| Yarrowia lipolytica chromosome C of strain CLIB1... | 40 | 2.6 | 5 | gb|L23858.1|YSJATPASEA Yarrowia lipolytica ATPase (PAY4) gene, c... | 40 | 2.6 |
|---|
>emb|AJ296273.1|HVU296273 Hordeum vulgare aba7 gene for stress responsive protein Length = 1841 Score = 242 bits (122), Expect = 4e-61 Identities = 185/205 (90%), Gaps = 5/205 (2%) Strand = Plus / Minus Query: 3 cacatgtngctaacaaaaactcaaccgactatgactcgngcancgata--tacgctgcaa 60 ||||||| |||||||||||||||||||||||| ||||| || |||| |||||||||| Sbjct: 1789 cacatgttgctaacaaaaactcaaccgactataactcgtacaacgatcagtacgctgcaa 1730 Query: 61 ggagcgcataatnttattcattncaatacaatacacacangtacgaaatgcaaatacgta 120 |||||||||||| ||||||||| |||||||||||||| | ||||||||||||||| | Sbjct: 1729 ggagcgcataattttattcattacaatacaatacaca--agatcgaaatgcaaatacg-a 1673 Query: 121 gctgccagcagcactaactccagggcttgntgcattgcttcatgaacggaagcaaggatt 180 ||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||| Sbjct: 1672 gctgccagcagcactaactccagggcttgttgcatttgttcatgaacggaagcaaggatt 1613 Query: 181 ttggcgctccatcctatccaatgct 205 |||||||||||||||| |||||||| Sbjct: 1612 ttggcgctccatcctagccaatgct 1588
>emb|X69817.1|HVABA7 H.vulgare ABA7 mRNA for ABA-induced protein Length = 841 Score = 242 bits (122), Expect = 4e-61 Identities = 185/205 (90%), Gaps = 5/205 (2%) Strand = Plus / Minus Query: 3 cacatgtngctaacaaaaactcaaccgactatgactcgngcancgata--tacgctgcaa 60 ||||||| |||||||||||||||||||||||| ||||| || |||| |||||||||| Sbjct: 789 cacatgttgctaacaaaaactcaaccgactataactcgtacaacgatcagtacgctgcaa 730 Query: 61 ggagcgcataatnttattcattncaatacaatacacacangtacgaaatgcaaatacgta 120 |||||||||||| ||||||||| |||||||||||||| | ||||||||||||||| | Sbjct: 729 ggagcgcataattttattcattacaatacaatacaca--agatcgaaatgcaaatacg-a 673 Query: 121 gctgccagcagcactaactccagggcttgntgcattgcttcatgaacggaagcaaggatt 180 ||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||| Sbjct: 672 gctgccagcagcactaactccagggcttgttgcatttgttcatgaacggaagcaaggatt 613 Query: 181 ttggcgctccatcctatccaatgct 205 |||||||||||||||| |||||||| Sbjct: 612 ttggcgctccatcctagccaatgct 588
>ref|XM_501986.1| Yarrowia lipolytica CLIB122, YALI0C18689g predicted mRNA Length = 3075 Score = 40.1 bits (20), Expect = 2.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 116 acgtagctgccagcagcact 135 |||||||||||||||||||| Sbjct: 1726 acgtagctgccagcagcact 1707
>emb|CR382129.1| Yarrowia lipolytica chromosome C of strain CLIB122 of Yarrowia lipolytica Length = 3272609 Score = 40.1 bits (20), Expect = 2.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 116 acgtagctgccagcagcact 135 |||||||||||||||||||| Sbjct: 2565734 acgtagctgccagcagcact 2565753
>gb|L23858.1|YSJATPASEA Yarrowia lipolytica ATPase (PAY4) gene, complete cds Length = 4567 Score = 40.1 bits (20), Expect = 2.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 116 acgtagctgccagcagcact 135 |||||||||||||||||||| Sbjct: 2722 acgtagctgccagcagcact 2703 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,123,403 Number of Sequences: 3902068 Number of extensions: 1123403 Number of successful extensions: 54286 Number of sequences better than 10.0: 5 Number of HSP's better than 10.0 without gapping: 5 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 54264 Number of HSP's gapped (non-prelim): 16 length of query: 205 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 183 effective length of database: 17,147,199,772 effective search space: 3137937558276 effective search space used: 3137937558276 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)