Clone Name	rbasd19n05
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	gb|AY327044.1| Oryza sativa (japonica cultivar-group) GTP-bindin...	624	e-176
2	dbj|AK060095.1| Oryza sativa (japonica cultivar-group) cDNA clon...	624	e-176
3	ref|NM_191227.1| Oryza sativa (japonica cultivar-group), predic...	613	e-172
4	dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...	408	e-110
5	dbj|AP003076.3| Oryza sativa (japonica cultivar-group) genomic D...	408	e-110
6	dbj|AK066450.1| Oryza sativa (japonica cultivar-group) cDNA clon...	408	e-110
7	ref|XM_475714.1| Oryza sativa (japonica cultivar-group), predic...	311	2e-81
8	dbj|AK061969.1| Oryza sativa (japonica cultivar-group) cDNA clon...	311	2e-81
9	dbj|AK060246.1| Oryza sativa (japonica cultivar-group) cDNA clon...	303	4e-79
10	emb|AJ234567.1|HVU234567 Hordeum vulgare genomic DNA fragment; c...	244	3e-61
11	gb|AF327517.1|AF327517 Oryza sativa GTP-binding protein mRNA, co...	226	8e-56
12	dbj|D13758.1|RICSS230 Oryza sativa ss230 mRNA for ras-related GT...	226	8e-56
13	dbj|AK066548.1| Oryza sativa (japonica cultivar-group) cDNA clon...	226	8e-56
14	gb|AC130603.2| Oryza sativa (japonica cultivar-group) chromosome...	208	2e-50
15	dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D...	208	2e-50
16	gb|AY103999.1| Zea mays PCO068021 mRNA sequence	188	2e-44
17	dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D...	170	4e-39
18	dbj|AP003686.3| Oryza sativa (japonica cultivar-group) genomic D...	170	4e-39
19	dbj|AK109344.2| Oryza sativa (japonica cultivar-group) cDNA clon...	149	1e-32
20	dbj|AK073075.1| Oryza sativa (japonica cultivar-group) cDNA clon...	149	1e-32
21	gb|AY110177.1| Zea mays CL8907_1 mRNA sequence	149	1e-32
22	gb|AY110109.1| Zea mays CL16448_2 mRNA sequence	139	1e-29
23	ref|XM_450547.1| Oryza sativa (japonica cultivar-group), mRNA	137	6e-29
24	gb|AC124143.2| Oryza sativa (japonica cultivar-group) chromosome...	137	6e-29
25	dbj|AK071461.1| Oryza sativa (japonica cultivar-group) cDNA clon...	137	6e-29
26	dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D...	131	3e-27
27	dbj|AP005811.3| Oryza sativa (japonica cultivar-group) genomic D...	131	3e-27
28	dbj|D17779.1|RICSS23015 Oryza sativa SS230 mRNA for ras-related ...	121	3e-24
29	gb|AY690483.1| Triticum aestivum rab GTP-binding protein mRNA, c...	117	5e-23
30	gb|AF532625.1| Glycine max GTP-binding protein mRNA, complete cds	115	2e-22
31	gb|BT023992.1| Zea mays clone EL01N0409D10 mRNA sequence	111	3e-21
32	ref|XM_475070.1| Oryza sativa (japonica cultivar-group), predic...	105	2e-19
33	dbj|AK102713.1| Oryza sativa (japonica cultivar-group) cDNA clon...	105	2e-19
34	dbj|D31906.1|MZEMGP2 Maize mRNA for mgp2 GTP-binding protein, co...	105	2e-19
35	gb|AY110333.1| Zea mays CL8515_1 mRNA sequence	103	8e-19
36	gb|AF532626.1| Glycine max small GTP-binding protein mRNA, compl...	101	3e-18
37	gb|AC104285.2| Oryza sativa (japonica cultivar-group) chromosome...	100	1e-17
38	gb|AC084818.3| Oryza sativa (japonica cultivar-group) chromosome...	100	1e-17
39	ref|NM_190607.1| Oryza sativa (japonica cultivar-group), predic...	98	5e-17
40	dbj|AK071303.1| Oryza sativa (japonica cultivar-group) cDNA clon...	98	5e-17
41	ref|NM_112368.2| Arabidopsis thaliana GTP binding AT3G15060 mRNA...	96	2e-16
42	gb|BT005565.1| Arabidopsis thaliana clone U51331 putative Ras fa...	96	2e-16
43	dbj|AK118727.1| Arabidopsis thaliana At3g15060 mRNA for putative...	96	2e-16
44	ref|NM_125479.2| Arabidopsis thaliana GTP binding AT5G60860 mRNA...	94	7e-16
45	gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3	94	7e-16
46	dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D...	94	7e-16
47	gb|BT005238.1| Arabidopsis thaliana At5g60860 mRNA, complete cds	94	7e-16
48	gb|AC093018.4| Oryza sativa chromosome 3 BAC OSJNBb0081B07 genom...	94	7e-16
49	dbj|AK118670.1| Arabidopsis thaliana At5g60860 mRNA for putative...	94	7e-16
50	dbj|AK067508.1| Oryza sativa (japonica cultivar-group) cDNA clon...	94	7e-16
51	dbj|AP004127.1| Oryza sativa (japonica cultivar-group) genomic D...	92	3e-15
52	gb|AY111070.1| Zea mays CL9832_1 mRNA sequence	92	3e-15
53	ref|XM_524087.1| PREDICTED: Pan troglodytes similar to RAB11B, m...	90	1e-14
54	gb|BT019535.1| Homo sapiens RAB11B, member RAS oncogene family m...	90	1e-14
55	emb|X79780.1|HSYPT31 H.sapiens YPT3 mRNA	90	1e-14
56	emb|BX647356.1|HSM807500 Homo sapiens mRNA; cDNA DKFZp686E23256 ...	90	1e-14
57	emb|CR626645.1| full-length cDNA clone CS0DF009YF12 of Fetal bra...	90	1e-14
58	emb|CR626143.1| full-length cDNA clone CS0DC025YN21 of Neuroblas...	90	1e-14
59	emb|CR625102.1| full-length cDNA clone CS0DI043YG14 of Placenta ...	90	1e-14
60	emb|CR624386.1| full-length cDNA clone CS0DI036YM17 of Placenta ...	90	1e-14
61	emb|CR621845.1| full-length cDNA clone CS0DM009YH13 of Fetal liv...	90	1e-14
62	emb|CR620665.1| full-length cDNA clone CS0DI043YL09 of Placenta ...	90	1e-14
63	emb|CR618667.1| full-length cDNA clone CS0DF019YH19 of Fetal bra...	90	1e-14
64	emb|CR618647.1| full-length cDNA clone CS0DB001YO22 of Neuroblas...	90	1e-14
65	emb|CR613277.1| full-length cDNA clone CS0DC001YK14 of Neuroblas...	90	1e-14
66	emb|CR613165.1| full-length cDNA clone CS0DF009YE08 of Fetal bra...	90	1e-14
67	emb|CR609776.1| full-length cDNA clone CS0DI016YA05 of Placenta ...	90	1e-14
68	emb|CR606883.1| full-length cDNA clone CS0DC005YE07 of Neuroblas...	90	1e-14
69	emb|CR606224.1| full-length cDNA clone CS0DI084YB14 of Placenta ...	90	1e-14
70	emb|CR605393.1| full-length cDNA clone CS0DI061YI16 of Placenta ...	90	1e-14
71	emb|CR600800.1| full-length cDNA clone CS0DI019YH19 of Placenta ...	90	1e-14
72	emb|CR600179.1| full-length cDNA clone CS0DI018YH16 of Placenta ...	90	1e-14
73	emb|CR597131.1| full-length cDNA clone CS0DH001YC15 of T cells (...	90	1e-14
74	emb|CR596517.1| full-length cDNA clone CS0DN003YC06 of Adult bra...	90	1e-14
75	emb|CR594452.1| full-length cDNA clone CS0CAP008YH11 of Thymus o...	90	1e-14
76	emb|CR593439.1| full-length cDNA clone CS0DF030YO19 of Fetal bra...	90	1e-14
77	emb|CR593189.1| full-length cDNA clone CL0BA003ZE06 of Placenta ...	90	1e-14
78	emb|CR592281.1| full-length cDNA clone CS0DF006YF01 of Fetal bra...	90	1e-14
79	emb|CR592057.1| full-length cDNA clone CS0DC023YD19 of Neuroblas...	90	1e-14
80	emb|CR590650.1| full-length cDNA clone CS0DA005YP15 of Neuroblas...	90	1e-14
81	gb|AF498947.1| Homo sapiens small GTP binding protein RAB11B (RA...	90	1e-14
82	emb|CR541691.1| Homo sapiens full open reading frame cDNA clone ...	90	1e-14
83	emb|CR536494.1| Homo sapiens full open reading frame cDNA clone ...	90	1e-14
84	gb|AC092300.2| Homo sapiens chromosome 19 clone LLNLF-176H4, com...	90	1e-14
85	gb|AC010323.8| Homo sapiens chromosome 19 clone CTD-2550O8, comp...	90	1e-14
86	gb|AC136469.2| Homo sapiens chromosome 19 clone RP11-886P16, com...	90	1e-14
87	gb|AY894025.1| Synthetic construct Homo sapiens clone FLH131057....	90	1e-14
88	gb|BC110081.1| Homo sapiens RAB11B, member RAS oncogene family, ...	90	1e-14
89	ref|NM_004218.1| Homo sapiens RAB11B, member RAS oncogene family...	90	1e-14
90	dbj|D38516.1|HUMRAB11B Human Rab11B mRNA	90	1e-14
91	ref|NM_185154.1| Oryza sativa (japonica cultivar-group), mRNA	88	5e-14
92	dbj|AK061336.1| Oryza sativa (japonica cultivar-group) cDNA clon...	88	5e-14
93	dbj|D31905.1|MZEMGP1 Maize mRNA for mgp1 GTP-binding protein, co...	86	2e-13
94	gb|BT019536.1| Homo sapiens RAB11B, member RAS oncogene family m...	82	3e-12
95	gb|AY192009.1| Bos taurus RAB11B gene, partial sequence	82	3e-12
96	dbj|AB169492.1| Macaca fascicularis brain cDNA, clone: QccE-1096...	82	3e-12
97	gb|AY888214.1| Synthetic construct Homo sapiens clone FLH010496....	82	3e-12
98	dbj|AP000370.1| Arabidopsis thaliana genomic DNA, chromosome 3, ...	82	3e-12
99	gb|BC105162.1| Bos taurus RAB11A, member RAS oncogene family, mR...	82	3e-12
100	ref|NM_001035391.1| Bos taurus RAB11A, member RAS oncogene famil...	82	3e-12
101	ref|XM_470373.1| Oryza sativa (japonica cultivar-group), mRNA	80	1e-11
102	ref|XM_457123.1| Debaryomyces hansenii CBS767 hypothetical prote...	80	1e-11
103	gb|AC092852.6| Oryza sativa chromosome 3 BAC OSJNBa0032G11 genom...	80	1e-11
104	emb|X96990.1|PHRB112 P.hybrida mRNA for GTP-binding protein, hom...	80	1e-11
105	emb|CR382134.1| Debaryomyces hansenii chromosome B of strain CBS...	80	1e-11
106	dbj|AP005681.3| Oryza sativa (japonica cultivar-group) genomic D...	80	1e-11
107	dbj|AK111543.1| Oryza sativa (japonica cultivar-group) cDNA clon...	80	1e-11
108	dbj|AK111499.1| Oryza sativa (japonica cultivar-group) cDNA clon...	80	1e-11
109	dbj|AK104527.1| Oryza sativa (japonica cultivar-group) cDNA clon...	80	1e-11
110	dbj|AK104362.1| Oryza sativa (japonica cultivar-group) cDNA clon...	80	1e-11
111	emb|Z73952.1|LJRAB11D L.japonicus mRNA for small GTP-binding pro...	78	4e-11
112	gb|AY107805.1| Zea mays PCO073002 mRNA sequence	78	4e-11
113	dbj|AK111872.1| Oryza sativa (japonica cultivar-group) cDNA clon...	76	2e-10
114	gb|BC085270.1| Mus musculus RAB11B, member RAS oncogene family, ...	74	7e-10
115	gb|BC054753.1| Mus musculus RAB11B, member RAS oncogene family, ...	74	7e-10
116	ref|NM_008997.1| Mus musculus RAB11B, member RAS oncogene family...	74	7e-10
117	emb|Z73957.1|LJRAB11I L.japonicus mRNA for small GTP-binding pro...	74	7e-10
118	gb|AC079935.3| Genomic sequence for Oryza sativa (japonica culti...	74	7e-10
119	dbj|AK134125.1| Mus musculus adult male thymus cDNA, RIKEN full-...	74	7e-10
120	dbj|AK148106.1| Mus musculus B16 F10Y cells cDNA, RIKEN full-len...	74	7e-10
121	dbj|AK147077.1| Mus musculus 17 days pregnant adult female amnio...	74	7e-10
122	dbj|AK146978.1| Mus musculus 17 days embryo kidney cDNA, RIKEN f...	74	7e-10
123	dbj|AK148022.1| Mus musculus melanocyte cDNA, RIKEN full-length ...	74	7e-10
124	dbj|AK146623.1| Mus musculus 17 days pregnant adult female amnio...	74	7e-10
125	dbj|AK146460.1| Mus musculus 16 days embryo heart cDNA, RIKEN fu...	74	7e-10
126	dbj|AK146452.1| Mus musculus 17 days embryo kidney cDNA, RIKEN f...	74	7e-10
127	ref|NG_001431.1| Mus musculus RAB11b, member RAS oncogene family...	74	7e-10
128	dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D...	74	7e-10
129	dbj|AK195913.1| Mus musculus cDNA, clone:Y1G0120B01, strand:plus...	74	7e-10
130	dbj|AK186595.1| Mus musculus cDNA, clone:Y0G0137P06, strand:plus...	74	7e-10
131	gb|AY104562.1| Zea mays PCO063085 mRNA sequence	74	7e-10
132	gb|AF127663.1|AF127663 Mus musculus Rab11b pseudogene, partial s...	74	7e-10
133	emb|CT030732.13| Mouse DNA sequence from clone RP23-27D5 on chro...	74	7e-10
134	gb|L26528.1|MUSRAB11B Mus musculus Rab11b mRNA, complete cds	74	7e-10
135	gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome...	74	7e-10
136	ref|NM_191928.1| Oryza sativa (japonica cultivar-group), predic...	72	3e-09
137	ref|XM_849306.1| PREDICTED: Canis familiaris similar to RAB11B, ...	72	3e-09
138	gb|AC166092.4| Glycine max clone gmw1-93l19, complete sequence	72	3e-09
139	dbj|AK111561.1| Oryza sativa (japonica cultivar-group) cDNA clon...	72	3e-09
140	gb|DQ099227.1| Arachis hypogaea clone Ah1TC6H03 microsatellite s...	70	1e-08
141	gb|DQ099152.1| Arachis hypogaea clone AH2TC9F10 microsatellite s...	70	1e-08
142	gb|L29269.1|TOBNTRAB Nicotiana tabacum SR1 Nt-rab11b mRNA, compl...	70	1e-08
143	ref|NM_100615.1| Arabidopsis thaliana GTP binding AT1G07410 mRNA...	68	4e-08
144	ref|XM_368165.1| Magnaporthe grisea 70-15 chromosome VI hypothet...	68	4e-08
145	emb|AJ245570.1|LES245570 Lycopersicon esculentum mRNA for Rab11 ...	68	4e-08
146	gb|AC022464.4|AC022464 Genomic sequence for Arabidopsis thaliana...	68	4e-08
147	dbj|AK188436.1| Mus musculus cDNA, clone:Y0G0145D08, strand:plus...	68	4e-08
148	dbj|AK177220.1| Mus musculus cDNA, clone:Y0G0102A22, strand:minu...	68	4e-08
149	gb|AY974574.1| Mus musculus RAB11B member RAS oncogene family-li...	68	4e-08
150	dbj|AK104132.1| Oryza sativa (japonica cultivar-group) cDNA clon...	68	4e-08
151	dbj|D12546.1|PEAGTPBP07 Pisum sativum mRNA for GTP-binding prote...	68	4e-08
152	ref|XM_476275.1| Oryza sativa (japonica cultivar-group), predic...	66	2e-07
153	gb|BT017614.1| Zea mays clone EL01N0433D01.c mRNA sequence	66	2e-07
154	gb|AC130609.2| Oryza sativa (japonica cultivar-group) chromosome...	66	2e-07
155	ref|XM_978657.1| PREDICTED: Mus musculus similar to Ras-related ...	66	2e-07
156	ref|XM_978704.1| PREDICTED: Mus musculus similar to Ras-related ...	66	2e-07
157	ref|XM_979126.1| PREDICTED: Mus musculus similar to Ras-related ...	66	2e-07
158	ref|XM_979168.1| PREDICTED: Mus musculus similar to Ras-related ...	66	2e-07
159	gb|AC129188.3| Mus musculus BAC clone RP23-446G23 from chromosom...	66	2e-07
160	gb|AC163276.4| Mus musculus chromosome 19, clone RP24-316F20, co...	66	2e-07
161	dbj|AP003760.4| Oryza sativa (japonica cultivar-group) genomic D...	66	2e-07
162	dbj|AK189626.1| Mus musculus cDNA, clone:Y0G0149M24, strand:plus...	66	2e-07
163	dbj|AK120316.1| Oryza sativa (japonica cultivar-group) cDNA clon...	66	2e-07
164	gb|AY105457.1| Zea mays PCO149506 mRNA sequence	66	2e-07
165	dbj|D13152.1|RICRGP2 Oryza sativa (japonica cultivar-group) rgp2...	66	2e-07
166	ref|NM_123942.1| Arabidopsis thaliana GTP binding AT5G45750 mRNA...	64	7e-07
167	emb|Z73956.1|LJRAB11H L.japonicus mRNA for small GTP-binding pro...	64	7e-07
168	emb|CR732017.2|CNS0GRRQ Tetraodon nigroviridis full-length cDNA	64	7e-07
169	emb|CR725844.2|CNS0GN0A Tetraodon nigroviridis full-length cDNA	64	7e-07
170	emb|CR724419.1|CNS0GLWP Tetraodon nigroviridis full-length cDNA	64	7e-07
171	gb|AY059111.1| Arabidopsis thaliana putative Rab-type small GTP-...	64	7e-07
172	gb|AF370219.1| Arabidopsis thaliana putative Rab-type small GTP-...	64	7e-07
173	emb|BX833318.1|CNS09Z2Q Arabidopsis thaliana Full-length cDNA Co...	64	7e-07
174	gb|AY084274.1| Arabidopsis thaliana clone 102017 mRNA, complete ...	64	7e-07
175	dbj|AB012245.1| Arabidopsis thaliana genomic DNA, chromosome 5, ...	64	7e-07
176	emb|CR726838.2|CNS0GNRW Tetraodon nigroviridis full-length cDNA	62	3e-06
177	emb|CR721379.2|CNS0GJK9 Tetraodon nigroviridis full-length cDNA	62	3e-06
178	emb|CR703337.2|CNS0G5N9 Tetraodon nigroviridis full-length cDNA	62	3e-06
179	emb|CR696136.2|CNS0G038 Tetraodon nigroviridis full-length cDNA	62	3e-06
180	emb|CR693620.2|CNS0FY5C Tetraodon nigroviridis full-length cDNA	62	3e-06
181	emb|CR691488.1|CNS0FWI4 Tetraodon nigroviridis full-length cDNA	62	3e-06
182	emb|CR690348.1|CNS0FVMG Tetraodon nigroviridis full-length cDNA	62	3e-06
183	emb|CR670562.2|CNS0FGDK Tetraodon nigroviridis full-length cDNA	62	3e-06
184	emb|CR670147.2|CNS0FG21 Tetraodon nigroviridis full-length cDNA	62	3e-06
185	emb|CR657336.2|CNS0F666 Tetraodon nigroviridis full-length cDNA	62	3e-06
186	emb|CR640051.2|CNS0ESU1 Tetraodon nigroviridis full-length cDNA	62	3e-06
187	emb|CR639739.2|CNS0ESLD Tetraodon nigroviridis full-length cDNA	62	3e-06
188	emb|CR637627.2|CNS0EQYP Tetraodon nigroviridis full-length cDNA	62	3e-06
189	gb|DQ242522.1| Gracilaria lemaneiformis small GTPase Rab11-D mRN...	60	1e-05
190	ref|XM_483418.1| Oryza sativa (japonica cultivar-group), mRNA	60	1e-05
191	gb|DQ019225.2| Gracilaria lemaneiformis small GTPase Rab11 (GLRa...	60	1e-05
192	gb|BT013111.1| Lycopersicon esculentum clone 114398R, mRNA sequence	60	1e-05
193	ref|XM_384503.1| Gibberella zeae PH-1 chromosome 2 hypothetical ...	60	1e-05
194	emb|X63874.1|NPYPT3 N.plumbaginifolia mRNA Np-ypt3	60	1e-05
195	gb|DQ062156.1| Gracilaria lemaneiformis small GTPase rab11-3 (ra...	60	1e-05
196	dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D...	60	1e-05
197	dbj|AP003888.4| Oryza sativa (japonica cultivar-group) genomic D...	60	1e-05
198	dbj|AK103220.1| Oryza sativa (japonica cultivar-group) cDNA clon...	60	1e-05
199	gb|AY904354.1| Gracilariopsis lemaneiformis small GTPase (Rab) m...	60	1e-05
200	ref|NM_101553.2| Arabidopsis thaliana RAB11; GTP binding AT1G169...	58	4e-05
201	ref|NM_100520.2| Arabidopsis thaliana ARA2; GTP binding AT1G0640...	58	4e-05
202	emb|Z71276.1|MIRABX M.indica mRNA for small GTPase	58	4e-05
203	gb|AF332428.1| Arabidopsis thaliana putative GTP-binding protein...	58	4e-05
204	gb|AY096439.1| Arabidopsis thaliana putative GTP-binding protein...	58	4e-05
205	gb|AY065306.1| Arabidopsis thaliana putative GTP-binding protein...	58	4e-05
206	gb|BT006406.1| Arabidopsis thaliana At1g16920 gene, complete cds	58	4e-05
207	emb|BX815056.1|CNS0ACVQ Arabidopsis thaliana Full-length cDNA Co...	58	4e-05
208	gb|AY086881.1| Arabidopsis thaliana clone 2904 mRNA, complete se...	58	4e-05
209	dbj|D01024.1|ATHARA2 Arabidopsis thaliana mRNA for small GTP-bin...	58	4e-05
210	gb|L18883.1|ATHSGBP Arabidopsis thaliana small GTP-binding prote...	58	4e-05
211	ref|NM_117956.2| Arabidopsis thaliana GTP binding AT4G18430 mRNA...	56	2e-04
212	ref|XM_951879.1| Neurospora crassa OR74A hypothetical protein ( ...	56	2e-04
213	ref|XM_327961.1| Neurospora crassa OR74A hypothetical protein ( ...	56	2e-04
214	gb|AY550123.1| Saussurea medusa GTP binding-protein-like mRNA, p...	56	2e-04
215	gb|BT012784.1| Lycopersicon esculentum clone 113774R, mRNA sequence	56	2e-04
216	gb|BT011645.1| Arabidopsis thaliana At4g18430 mRNA, complete cds	56	2e-04
217	emb|CR933463.1| Paramecium tetraurelia, Small GTPase rab, putati...	56	2e-04
218	gb|BT010933.1| Arabidopsis thaliana At4g18430 gene, complete cds	56	2e-04
219	emb|CR719388.2|CNS0GI0Y Tetraodon nigroviridis full-length cDNA	56	2e-04
220	emb|AL670003.1|NCB9G16 Neurospora crassa DNA linkage group II BA...	56	2e-04
221	gb|AC090054.2|AC090054 Oryza sativa chromosome 9 clone PAC0645D0...	56	2e-04
222	dbj|AP006727.2| Oryza sativa (japonica cultivar-group) genomic D...	56	2e-04
223	gb|AY106908.1| Zea mays PCO095284 mRNA sequence	56	2e-04
224	dbj|AP004977.1| Lotus japonicus genomic DNA, chromosome 3, clone...	56	2e-04
225	gb|AC155338.1| Brassica rapa subsp. pekinensis chromosome Cytoge...	56	2e-04
226	ref|NM_102623.1| Arabidopsis thaliana GTP binding AT1G28550 mRNA...	54	6e-04
227	ref|XM_429101.1| PREDICTED: Gallus gallus similar to RAB11a, mem...	54	6e-04
228	ref|XM_978616.1| PREDICTED: Mus musculus similar to Ras-related ...	54	6e-04
229	ref|XM_979097.1| PREDICTED: Mus musculus similar to Ras-related ...	54	6e-04
230	emb|Z29592.1|VFGNRPR3 V.faba mRNA for guanine nucleotide regulat...	54	6e-04
231	gb|DQ056467.1| Arabidopsis thaliana putative Ras-related GTP-bin...	54	6e-04
232	emb|BX934641.1| Gallus gallus finished cDNA, clone ChEST386e2	54	6e-04
233	dbj|AB015472.1| Arabidopsis thaliana genomic DNA, chromosome 5, ...	54	6e-04
234	gb|BC062041.1| Rattus norvegicus RAB11B, member RAS oncogene fam...	52	0.003
235	ref|XM_752705.1| Ustilago maydis 521 hypothetical protein (UM016...	52	0.003
236	ref|XM_647684.1| Entamoeba histolytica HM-1:IMSS Rab family GTPa...	52	0.003
237	emb|AL161548.2|ATCHRIV48 Arabidopsis thaliana DNA chromosome 4, ...	52	0.003
238	emb|AL021710.1|ATF28J12 Arabidopsis thaliana DNA chromosome 4, B...	52	0.003
239	gb|DQ062155.1| Gracilaria lemaneiformis small GTPase Rab11-2 (ra...	52	0.003
240	dbj|AB054587.1| Entamoeba histolytica EhRab11B mRNA for small GT...	52	0.003
241	ref|NM_032617.2| Rattus norvegicus RAB11B, member RAS oncogene f...	52	0.003
242	gb|AF286534.1|AF286534 Rattus norvegicus GTP-binding protein RAB...	52	0.003
243	gb|L03303.1|RABGTPBP Oryctolagus cuniculus GTP-binding protein (...	52	0.003
244	dbj|D01046.1| Rattus norvegicus mRNA for GTP binding protein, co...	52	0.003
245	ref|NM_117996.2| Arabidopsis thaliana GTP binding AT4G18800 mRNA...	50	0.010
246	emb|Z73953.1|LJRAB11E L.japonicus mRNA for small GTP-binding pro...	50	0.010
247	emb|X59276.1|OSRGP1 Rice rgp1 mRNA for a ras-related GTP-binding...	50	0.010
248	gb|BT004936.1| Arabidopsis thaliana clone U20645 putative ras-re...	50	0.010
249	gb|BT003901.1| Arabidopsis thaliana clone RAFL15-17-A17 (R20645)...	50	0.010
250	dbj|AP003614.2| Oryza sativa (japonica cultivar-group) genomic D...	50	0.010
251	gb|AY107436.1| Zea mays PCO103364 mRNA sequence	50	0.010
252	ref|NM_100462.4| Arabidopsis thaliana ARA; GTP binding AT1G05810...	48	0.040
253	ref|NM_125305.2| Arabidopsis thaliana GTP binding AT5G59150 mRNA...	48	0.040
254	ref|XM_445283.1| Candida glabrata CBS138, CAGL0C02453g partial mRNA	48	0.040
255	emb|Z73955.1|LJRAB11G L.japonicus mRNA for small GTP-binding pro...	48	0.040
256	emb|CR728730.2|CNS0GP8G Tetraodon nigroviridis full-length cDNA	48	0.040
257	emb|CR728084.2|CNS0GOQI Tetraodon nigroviridis full-length cDNA	48	0.040
258	emb|X77301.1|GMGMR2 G.max gmr2 gene	48	0.040
259	gb|AY063847.1| Arabidopsis thaliana putative RAS-related protein...	48	0.040
260	gb|AY040051.1| Arabidopsis thaliana putative GTP-binding protein...	48	0.040
261	gb|AF370127.1| Arabidopsis thaliana putative GTP-binding protein...	48	0.040
262	emb|CR380949.1| Candida glabrata strain CBS138 chromosome C comp...	48	0.040
263	gb|AF332457.1| Arabidopsis thaliana clone C00163 putative RAS-re...	48	0.040
264	gb|BT006190.1| Arabidopsis thaliana clone C00163 (i) putative RA...	48	0.040
265	emb|AL116167.1|CNS01CZ3 Botrytis cinerea strain T4 cDNA library	48	0.040
266	gb|M25471.1|ATHRAS Arabidopsis thaliana ras-related protein (ara...	48	0.040
267	emb|BX815293.1|CNS0ACTO Arabidopsis thaliana Full-length cDNA Co...	48	0.040
268	emb|BX833729.1|CNS09YYS Arabidopsis thaliana Full-length cDNA Co...	48	0.040
269	gb|AC068143.4|T2D23 Sequence of BAC T2D23 from Arabidopsis thali...	48	0.040
270	dbj|AB016890.1| Arabidopsis thaliana genomic DNA, chromosome 5, ...	48	0.040
271	gb|AC009999.2|T20M3 Sequence of BAC T20M3 from Arabidopsis thali...	48	0.040
272	dbj|AP006666.1| Lotus japonicus genomic DNA, chromosome 3, clone...	48	0.040
273	ref|NM_100835.2| Arabidopsis thaliana ATRAB11C; GTP binding AT1G...	46	0.16
274	ref|NM_106022.1| Arabidopsis thaliana GTP binding AT1G73640 mRNA...	46	0.16
275	gb|DQ235201.1| Solanum tuberosum clone 171F12 unknown mRNA	46	0.16
276	gb|AC116792.17| Mus musculus chromosome 6, clone RP24-304O23, co...	46	0.16
277	gb|DQ222491.1| Solanum tuberosum clone 099C08 unknown mRNA	46	0.16
278	gb|BC078572.1| Xenopus laevis RAB11B, member RAS oncogene family...	46	0.16
279	ref|XM_414313.1| PREDICTED: Gallus gallus similar to Ras-related...	46	0.16
280	ref|XM_868308.1| PREDICTED: Bos taurus similar to Ras-related pr...	46	0.16
281	gb|BC007147.1| Mus musculus RAB4B, member RAS oncogene family, m...	46	0.16
282	ref|XM_705303.1| Candida albicans SC5314 putative rab family GTP...	46	0.16
283	ref|XM_705295.1| Candida albicans SC5314 putative rab family GTP...	46	0.16
284	ref|NM_029391.1| Mus musculus RAB4B, member RAS oncogene family ...	46	0.16
285	gb|BT013071.1| Lycopersicon esculentum clone 114328R, mRNA sequence	46	0.16
286	gb|BC033081.1| Homo sapiens cDNA clone MGC:45640 IMAGE:5456088, ...	46	0.16
287	gb|AY220456.1| Limulus polyphemus rab11-2 mRNA, complete cds	46	0.16
288	ref|XM_800897.1| Trypanosoma cruzi strain CL Brener rab1 small G...	46	0.16
289	gb|BC041250.1| Xenopus laevis RAB11B, member RAS oncogene family...	46	0.16
290	gb|AC146746.15| Medicago truncatula clone mth2-108p9, complete s...	46	0.16
291	gb|BC087555.1| Mus musculus cDNA clone IMAGE:6391751, **** WARNI...	46	0.16
292	gb|BC010248.1| Mus musculus RIKEN cDNA 1810048P08 gene, mRNA (cD...	46	0.16
293	gb|AF087861.1| Homo sapiens rab4b mRNA, complete cds	46	0.16
294	gb|AY324134.1| Babesia bovis Rab1a mRNA, complete cds	46	0.16
295	gb|AY297922.1| Toxoplasma gondii Rab11 (rab11) mRNA, complete cds	46	0.16
296	emb|X65650.1|PSGTPBP P.sativum mRNA rab for ras-related GTP-bind...	46	0.16
297	gb|AC157553.10| Mus musculus chromosome 7, clone RP24-68L4, comp...	46	0.16
298	emb|AJ534465.1|MMU534465 Mus musculus mRNA for Ras-related prote...	46	0.16
299	gb|AC157561.10| Mus musculus chromosome 7, clone RP23-356A20, co...	46	0.16
300	gb|AY133657.1| Arabidopsis thaliana At1g09630/F21M12_2 mRNA, com...	46	0.16
301	gb|AF498935.1| Homo sapiens small GTP binding protein RAB4B (RAB...	46	0.16
302	ref|NM_136122.2| Drosophila melanogaster Rab9 CG9994-RA (Rab9), ...	46	0.16
303	ref|NM_016154.3| Homo sapiens RAB4B, member RAS oncogene family ...	46	0.16
304	dbj|AK140513.1| Mus musculus 10 days neonate cerebellum cDNA, RI...	46	0.16
305	gb|AY071139.1| Drosophila melanogaster RE17845 full length cDNA	46	0.16
306	ref|XM_946370.1| PREDICTED: Homo sapiens similar to RAB4B, membe...	46	0.16
307	dbj|AK158283.1| Mus musculus adult inner ear cDNA, RIKEN full-le...	46	0.16
308	gb|AF408432.1|AF408432 Mus musculus GTP-binding protein RAB4 (Ra...	46	0.16
309	dbj|AK170552.1| Mus musculus NOD-derived CD11c +ve dendritic cel...	46	0.16
310	dbj|AK010874.1| Mus musculus 13 days embryo liver cDNA, RIKEN fu...	46	0.16
311	gb|AC158626.6| Mus musculus 6 BAC RP23-4F16 (Roswell Park Cancer...	46	0.16
312	gb|AY045620.1| Arabidopsis thaliana At1g09630/F21M12_2 mRNA, com...	46	0.16
313	dbj|AK005314.1| Mus musculus adult male cerebellum cDNA, RIKEN f...	46	0.16
314	gb|BC096654.1| Mus musculus RAB4B, member RAS oncogene family, m...	46	0.16
315	ref|NM_001039394.1| Mus musculus RIKEN cDNA 1810048P08 gene (181...	46	0.16
316	ref|NM_133717.2| Mus musculus RIKEN cDNA 1810048P08 gene (181004...	46	0.16
317	dbj|AK007834.1| Mus musculus 10 day old male pancreas cDNA, RIKE...	46	0.16
318	emb|BX813531.1|CNS0AEJF Arabidopsis thaliana Full-length cDNA Co...	46	0.16
319	emb|BX829134.1|CNS0A4D6 Arabidopsis thaliana Full-length cDNA Co...	46	0.16
320	gb|AC012679.5|AC012679 Arabidopsis thaliana chromosome 1 BAC F25...	46	0.16
321	ref|NM_174447.2| Bos taurus RAB3B, member RAS oncogene family (R...	46	0.16
322	gb|AC008537.5|AC008537 Homo sapiens chromosome 19 clone CTC-490E...	46	0.16
323	gb|AF217985.1|AF217985 Homo sapiens clone PP1596 unknown mRNA	46	0.16
324	gb|AY085684.1| Arabidopsis thaliana clone 17081 mRNA, complete s...	46	0.16
325	gb|AY084805.1| Arabidopsis thaliana clone 118351 mRNA, complete ...	46	0.16
326	gb|AC026237.4|AC026237 Arabidopsis thaliana chromosome I BAC F17...	46	0.16
327	gb|AC051629.3|AC051629 Arabidopsis thaliana chromosome I BAC F6I...	46	0.16
328	gb|AY104765.1| Zea mays PCO111506 mRNA sequence	46	0.16
329	gb|AF165522.1|AF165522 Homo sapiens ras-related GTP-binding prot...	46	0.16
330	dbj|D12544.1|PEAGTPBP05 Pisum sativum mRNA for GTP-binding prote...	46	0.16
331	gb|BC087498.1| Xenopus laevis hypothetical LOC496163, mRNA (cDNA...	46	0.16
332	gb|BC082421.1| Xenopus laevis hypothetical LOC494642, mRNA (cDNA...	46	0.16
333	gb|BC046927.1| Homo sapiens RAB4B, member RAS oncogene family, m...	46	0.16
334	gb|U74669.1|ATU74669 Arabidopsis thaliana ras-related small GTPa...	46	0.16
335	gb|AC000132.1|F21M12 Sequence of BAC F21M12 from Arabidopsis tha...	46	0.16
336	gb|U13169.1|CRU13169 Chlamydomonas reinhardtii YptC6 (yptC6) gen...	46	0.16
337	gb|L29275.1|TOBNTRAH Nicotiana tabacum SR1 Nt-rab7b mRNA, comple...	46	0.16
338	gb|L08128.1|VVCPTVA Volvox carteri GTP-binding protein (yptV2) g...	46	0.16
339	gb|M19886.1|BOVBPGTPB Bovine GTP-binding protein (smg p25B) mRNA...	46	0.16
340	gb|BC086715.1| Danio rerio zgc:101648, mRNA (cDNA clone MGC:1016...	44	0.62
341	ref|XM_513873.1| PREDICTED: Pan troglodytes LOC457382 (LOC457382...	44	0.62
342	ref|NM_020387.1| Homo sapiens RAB25, member RAS oncogene family ...	44	0.62
343	gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome	44	0.62
344	gb|AC024875.1| Caenorhabditis elegans cosmid Y92C3B, complete se...	44	0.62
345	ref|XM_744876.1| Aspergillus fumigatus Af293 Ras GTPase Rab11 (A...	44	0.62
346	gb|BC009831.2| Homo sapiens RAB25, member RAS oncogene family, m...	44	0.62
347	gb|BC033322.1| Homo sapiens RAB25, member RAS oncogene family, m...	44	0.62
348	gb|AY896291.1| Trichomonas vaginalis strain G3 small Rab GTPase ...	44	0.62
349	emb|AL355388.30| Human DNA sequence from clone RP11-336K24 on ch...	44	0.62
350	gb|AY299636.1| Toxoplasma gondii Rab11b (rab11b) mRNA, complete cds	44	0.62
351	emb|X72833.1|SCYPT31 S.cerevisiae YPT3A gene	44	0.62
352	emb|BX572593.1| Rhodopseudomonas palustris CGA009 complete genom...	44	0.62
353	gb|AF274025.1| Homo sapiens GTP-binding protein Rab25 mRNA, comp...	44	0.62
354	emb|CR599507.1| full-length cDNA clone CS0DI015YB14 of Placenta ...	44	0.62
355	gb|AC011411.4| Homo sapiens chromosome 5 clone CTB-78O21, comple...	44	0.62
356	gb|AC099017.1| Drosophila melanogaster, chromosome 2L, region 37...	44	0.62
357	dbj|AK003260.1| Mus musculus 18-day embryo whole body cDNA, RIKE...	44	0.62
358	ref|NM_171861.3| Caenorhabditis elegans RAB family member (rab-1...	44	0.62
359	ref|NM_171081.2| Caenorhabditis elegans RAB family member (rab-1...	44	0.62
360	ref|NM_016899.2| Mus musculus RAB25, member RAS oncogene family ...	44	0.62
361	gb|AC007082.5|AC007082 Drosophila melanogaster, chromosome 2L, r...	44	0.62
362	ref|NM_001017936.1| Bos taurus RAB25, member RAS oncogene family...	44	0.62
363	gb|AF307520.1|AF307520 Candida albicans glycosyl-phosphatidylino...	44	0.62
364	gb|U18778.1|SCE9537 Saccharomyces cerevisiae chromosome V cosmid...	44	0.62
365	ref|XM_227404.3| PREDICTED: Rattus norvegicus RAB25, member RAS ...	44	0.62
366	gb|AF083124.1|AF083124 Homo sapiens CATX-8 mRNA, complete cds	44	0.62
367	ref|NM_001008641.1| Danio rerio zgc:101648 (zgc:101648), mRNA	44	0.62
368	gb|AF119676.1|AF119676 Mus musculus small GTP-binding protein RA...	44	0.62
369	gb|AF119675.1|AF119675 Mus musculus small GTP-binding protein RA...	44	0.62
370	gb|BT021481.1| Bos taurus RAB25, member RAS oncogene family (RAB...	44	0.62
371	gb|BC006624.1| Mus musculus RAB25, member RAS oncogene family, m...	44	0.62
372	emb|BX890617.13| Zebrafish DNA sequence from clone DKEYP-84F11 i...	44	0.62
373	gb|AE003662.3| Drosophila melanogaster chromosome 2L, section 71...	44	0.62
374	gb|DQ331635.1| Synthetic construct Saccharomyces cerevisiae clon...	44	0.62
375	gb|AC145168.5| Mus musculus BAC clone RP23-398K14 from 3, comple...	44	0.62
376	gb|L17070.1|YSCGP Saccharomyces cerevisiae Ypt/Rab family GTPase...	44	0.62
377	ref|XM_526915.1| PREDICTED: Pan troglodytes similar to RAB3C, me...	42	2.4
378	ref|XM_472821.1| Oryza sativa (japonica cultivar-group), predic...	42	2.4
379	ref|NM_138453.2| Homo sapiens RAB3C, member RAS oncogene family ...	42	2.4
380	gb|BC074609.1| Xenopus tropicalis RAB30, member RAS oncogene fam...	42	2.4
381	ref|NM_133685.1| Mus musculus RAB31, member RAS oncogene family ...	42	2.4
382	ref|NM_176873.2| Bos taurus RAB3C, member RAS oncogene family (R...	42	2.4
383	ref|XM_881629.1| PREDICTED: Bos taurus similar to Ras-related pr...	42	2.4
384	ref|XM_868411.1| PREDICTED: Bos taurus similar to Ras-related pr...	42	2.4
385	gb|AC139751.2| Mus musculus BAC clone RP24-403E24 from chromosom...	42	2.4
386	gb|BC114066.1| Bos taurus RAB26, member RAS oncogene family, mRN...	42	2.4
387	gb|AY815497.1| Schistosoma japonicum SJCHGC05511 protein mRNA, c...	42	2.4
388	ref|XM_975497.1| PREDICTED: Mus musculus RAB3C, member RAS oncog...	42	2.4
389	ref|XM_975535.1| PREDICTED: Mus musculus RAB3C, member RAS oncog...	42	2.4
390	ref|XM_975624.1| PREDICTED: Mus musculus RAB3C, member RAS oncog...	42	2.4
391	ref|XM_975586.1| PREDICTED: Mus musculus RAB3C, member RAS oncog...	42	2.4
392	gb|AY026936.1| Homo sapiens Rab3c mRNA, complete cds	42	2.4
393	emb|CR933377.1| Paramecium tetraurelia, Small GTPase rab, putati...	42	2.4
394	gb|AC133171.5| Mus musculus BAC clone RP24-271D14 from chromosom...	42	2.4
395	emb|Z73950.1|LJRAB11B L.japonicus mRNA for small GTP-binding pro...	42	2.4
396	gb|AF312037.1| Mus musculus small GTP binding protein Rab3C mRNA...	42	2.4
397	ref|XM_774066.1| Giardia lamblia ATCC 50803 hypothetical protein...	42	2.4
398	ref|XM_760032.1| Theileria parva strain Muguga hypothetical prot...	42	2.4
399	ref|XM_845952.1| PREDICTED: Canis familiaris similar to RAB3C, m...	42	2.4
400	gb|AC155344.1| Brassica rapa subsp. pekinensis clone KBrH080A08,...	42	2.4
401	gb|BC112795.1| Bos taurus similar to RAB3C, member RAS oncogene ...	42	2.4
402	ref|XM_782033.1| PREDICTED: Strongylocentrotus purpuratus simila...	42	2.4
403	ref|NM_001006108.1| Xenopus tropicalis RAB30, member RAS oncogen...	42	2.4
404	gb|BC013063.1| Mus musculus RAB31, member RAS oncogene family, m...	42	2.4
405	gb|BC013033.2| Homo sapiens RAB3C, member RAS oncogene family, m...	42	2.4
406	ref|NM_023852.2| Mus musculus RAB3C, member RAS oncogene family ...	42	2.4
407	ref|NM_170170.1| Drosophila melanogaster RabX4 CG31118-RA (RabX4...	42	2.4
408	dbj|AK148904.1| Mus musculus 2 days neonate sympathetic ganglion...	42	2.4
409	gb|BC114335.1| Mus musculus RAB3C, member RAS oncogene family, m...	42	2.4
410	dbj|AK159095.1| Mus musculus osteoclast-like cell cDNA, RIKEN fu...	42	2.4
411	dbj|AK164316.1| Mus musculus 12 days embryo spinal ganglion cDNA...	42	2.4
412	dbj|AK161006.1| Mus musculus 15 days embryo head cDNA, RIKEN ful...	42	2.4
413	dbj|AK156677.1| Mus musculus activated spleen cDNA, RIKEN full-l...	42	2.4
414	ref|NM_133536.1| Rattus norvegicus RAB3C, member RAS oncogene fa...	42	2.4
415	gb|AY026947.1| Mus musculus small GTP-binding protein Rab3C mRNA...	42	2.4
416	dbj|AK014050.1| Mus musculus 13 days embryo head cDNA, RIKEN ful...	42	2.4
417	dbj|AK014132.1| Mus musculus 13 days embryo head cDNA, RIKEN ful...	42	2.4
418	dbj|AK051270.1| Mus musculus 12 days embryo spinal ganglion cDNA...	42	2.4
419	dbj|AK079574.1| Mus musculus adult male hypothalamus cDNA, RIKEN...	42	2.4
420	dbj|AK012468.1| Mus musculus 11 days embryo whole body cDNA, RIK...	42	2.4
421	gb|BT022967.1| Drosophila melanogaster IP11168 full insert cDNA	42	2.4
422	gb|AC008205.7|AC008205 Drosophila melanogaster, chromosome 3R, r...	42	2.4
423	ref|XM_575675.1| PREDICTED: Rattus norvegicus similar to hypothe...	42	2.4
424	dbj|AK059799.1| Oryza sativa (japonica cultivar-group) cDNA clon...	42	2.4
425	gb|AE003749.3| Drosophila melanogaster chromosome 3R, section 87...	42	2.4
426	emb|CR848349.2| Xenopus tropicalis finished cDNA, clone TNeu085g12	42	2.4
427	emb|CR762280.2| Xenopus tropicalis finished cDNA, clone TGas029m23	42	2.4
428	emb|CR926288.2| Xenopus tropicalis finished cDNA, clone TEgg143e20	42	2.4
429	gb|U54807.1|RNU54807 Rattus norvegicus GTP-binding protein (rab ...	42	2.4
430	gb|U37099.1|RNU37099 Rattus norvegicus small GTP-binding protein...	42	2.4
431	gb|AY610070.1| Sus scrofa clone Clu_62863.scr.msk.p1.Contig1, mR...	42	2.4
432	gb|AC150274.2| Mus musculus BAC clone RP23-348G11 from 18, compl...	42	2.4
433	emb|CT032436.1| Platynereis dumerilii EST IB0AAA38BB01EM1	42	2.4
434	emb|CT485723.1| Xenopus tropicalis finished cDNA, clone TGas043g15	42	2.4
435	gb|U68262.1|CEU68262 Caenorhabditis elegans RAM1-like mRNA, part...	42	2.4
436	gb|U17085.1|TBU17085 Trypanosoma brucei brucei RAN/TC4 GTPase ho...	42	2.4
437	emb|AJ310532.1|MMU310532 Mus musculus mRNA for Rab3C protein	42	2.4
438	gb|DQ252515.1| Solanum tuberosum clone 097A06 putative translati...	42	2.4
439	gb|M19887.1|BOVBPGTPC Bovine GTP-binding protein (smg p25C) mRNA...	42	2.4
440	dbj|D78197.1|RATRAB3C Rat mRNA for rab3C, complete cds	42	2.4
441	dbj|AB028162.1| Giardia intestinalis GlRabB mRNA for rab-like pr...	42	2.4
442	ref|NM_100002.2| Arabidopsis thaliana GTP binding AT1G01200 mRNA...	40	9.7
443	ref|NM_114475.2| Arabidopsis thaliana ARA3; GTP binding AT3G4606...	40	9.7
444	ref|NM_114550.2| Arabidopsis thaliana GTP binding AT3G46830 mRNA...	40	9.7
445	gb|AC008201.8| Drosophila melanogaster clone BACR11E07, complete...	40	9.7
446	ref|XM_598573.2| PREDICTED: Bos taurus similar to RAS and EF han...	40	9.7
447	gb|CP000356.1| Sphingopyxis alaskensis RB2256, complete genome	40	9.7
448	ref|XM_363259.1| Magnaporthe grisea 70-15 hypothetical protein (...	40	9.7
449	ref|XM_865487.1| PREDICTED: Bos taurus similar to Ras-related pr...	40	9.7
450	ref|XM_876116.1| PREDICTED: Bos taurus similar to Ras-related pr...	40	9.7
451	gb|BT012805.1| Lycopersicon esculentum clone 113821R, mRNA sequence	40	9.7
452	emb|CR318646.27| Zebrafish DNA sequence from clone DKEY-83F18 in...	40	9.7
453	gb|BT010979.1| Arabidopsis thaliana At1g01200 mRNA, complete cds	40	9.7
454	gb|BT010707.1| Arabidopsis thaliana At1g01200 mRNA, complete cds	40	9.7
455	emb|CR675762.2|CNS0FKE0 Tetraodon nigroviridis full-length cDNA	40	9.7
456	gb|BC114760.1| Bos taurus cDNA clone MGC:137938 IMAGE:8087670, c...	40	9.7
457	gb|AC096691.6| Oryza sativa chromosome 10 BAC OSJNBa0083M08 geno...	40	9.7
458	emb|Y11882.1|TPRAB7LP Trichinella pseudospiralis partial mRNA fo...	40	9.7
459	emb|Y11885.1|TSRAB5ALP Trichinella spiralis partial mRNA for rab...	40	9.7
460	emb|Y08904.1|ATRAB11 A.thaliana mRNA for Rab11 protein	40	9.7
461	gb|AY096545.1| Arabidopsis thaliana putative GTP-binding protein...	40	9.7
462	emb|X77795.1|ZMYPTM3 Z.mays yptm3 mRNA	40	9.7
463	gb|AY065380.1| Arabidopsis thaliana putative GTP-binding protein...	40	9.7
464	gb|AY035132.1| Arabidopsis thaliana putative GTP-binding protein...	40	9.7
465	ref|NM_001037268.1| Xenopus tropicalis tubulin, beta 2 (tubb2a),...	40	9.7
466	emb|AL355775.1|ATF12M12 Arabidopsis thaliana DNA chromosome 3, B...	40	9.7
467	emb|AL161549.2|ATCHRIV49 Arabidopsis thaliana DNA chromosome 4, ...	40	9.7
468	emb|AL096859.2|ATT6H20 Arabidopsis thaliana DNA chromosome 3, BA...	40	9.7
469	emb|AL035526.1|ATF28A21 Arabidopsis thaliana DNA chromosome 4, B...	40	9.7
470	emb|AJ851582.1| Gallus gallus mRNA for hypothetical protein, clo...	40	9.7
471	emb|AJ578178.1|HIM578178 Human immunodeficiency virus 1 partial ...	40	9.7
472	emb|AJ518934.1|HVU518934 Hordeum vulgare subsp. vulgare mRNA for...	40	9.7
473	emb|AJ304407.1|PPA304407 Pichia pastoris partial frs1 gene for p...	40	9.7
474	emb|AJ277892.2|HSA277892 Homo sapiens partial TTN gene for titin	40	9.7
475	gb|AF461435.1| Babesia gibsoni small GTP binding protein rab11 (...	40	9.7
476	gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome	40	9.7
477	ref|NM_001012551.1| Gallus gallus RAB11B, member RAS oncogene fa...	40	9.7
478	gb|AC145332.48| Felis catus clone rp86-207p24, complete sequence	40	9.7
479	gb|BC090613.1| Xenopus tropicalis tubulin, beta 2, mRNA (cDNA cl...	40	9.7
480	gb|AF454358.1| Pythium torulosum isolate 18-5 ras-like protein g...	40	9.7
481	ref|NM_001024331.1| Rattus norvegicus Ras-related protein RAB43 ...	40	9.7
482	gb|S72944.1| synaptic vesicle specific GTP-binding protein [Disc...	40	9.7
483	gb|AE009951.2| Fusobacterium nucleatum subsp. nucleatum ATCC 255...	40	9.7
484	emb|CR388820.1| Gallus gallus finished cDNA, clone ChEST687a1	40	9.7
485	gb|AY042795.1| Arabidopsis thaliana GTP-binding protein ara-3 (F...	40	9.7
486	gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome	40	9.7
487	emb|BX822900.1|CNS0A74N Arabidopsis thaliana Full-length cDNA Co...	40	9.7
488	emb|BX823100.1|CNS0A5TM Arabidopsis thaliana Full-length cDNA Co...	40	9.7
489	emb|BX824081.1|CNS0A5HW Arabidopsis thaliana Full-length cDNA Co...	40	9.7
490	emb|BX823852.1|CNS0A5F7 Arabidopsis thaliana Full-length cDNA Co...	40	9.7
491	emb|BX841708.1|CNS09YJT Arabidopsis thaliana Full-length cDNA Co...	40	9.7
492	gb|AY593256.1| Rattus norvegicus Ras-related protein RAB43 (Rab4...	40	9.7
493	gb|AY087450.1| Arabidopsis thaliana clone 35596 mRNA, complete s...	40	9.7
494	gb|AC016888.23| Homo sapiens chromosome 17, clone RP11-452I5, co...	40	9.7
495	gb|AC023270.7| Homo sapiens BAC clone RP11-88L24 from 2, complet...	40	9.7
496	dbj|D01025.1|ATHARA3 Arabidopsis thaliana mRNA for small GTP-bin...	40	9.7
497	gb|BT002186.1| Arabidopsis thaliana GTP-binding protein ara-3 (A...	40	9.7
498	gb|AY104330.1| Zea mays PCO103212 mRNA sequence	40	9.7
499	gb|AE003745.4| Drosophila melanogaster chromosome 3R, section 83...	40	9.7
500	emb|CR942335.2| Xenopus tropicalis finished cDNA, clone TGas079h22	40	9.7

---

>gb|AY327044.1| Oryza sativa (japonica cultivar-group) GTP-binding protein GTP1
           mRNA, complete cds
          Length = 960

 Score =  624 bits (315), Expect = e-176
 Identities = 524/591 (88%), Gaps = 2/591 (0%)
 Strand = Plus / Minus

                                                                       
Query: 116 aatgcatctataccctaacttgagcagcagccggctctcttcagcgaagacacgtcgtct 175
           ||||||||| ||| |||| ||||||| |||||   ||||||||||| ||||||||| |||
Sbjct: 758 aatgcatctctactctaatttgagcaacagccaattctcttcagcgcagacacgtcatct 699

                                                                       
Query: 176 ttcacatttatattctcccctttgcttggggcagatgagccgtcgtctcctgcatcaacc 235
           |||||||| || ||||| |||||| |||| |||  ||| || || |||  ||| ||||||
Sbjct: 698 ttcacattaatcttctctcctttgattggagcatttgatccatcatctgatgcctcaacc 639

                                                                       
Query: 236 gtcttcctgctcgcaatacggtatatctgagtcaaaacttctgagaaagcgttgtctaca 295
           |||||| ||||  || |  ||||||||||||||||||||||||  ||||| || ||||||
Sbjct: 638 gtcttcttgctgacagtttggtatatctgagtcaaaacttctgcaaaagcattctctaca 579

                                                                       
Query: 296 tttgtcgcgtctaatgcagatgtttccatgaagtacagtgactccgcctcagcatattcc 355
           ||||| ||||||||||||||||| ||||||||||||| |||||| |||||||||||||||
Sbjct: 578 tttgtggcgtctaatgcagatgtctccatgaagtacaatgactcagcctcagcatattcc 519

                                                                       
Query: 356 tgcccatcttcagttgaaacagccaccaagtggcgaaggtcagatttgttgccaactagc 415
           |  |||||||||||||||||||||||||  ||||| || || ||||||||||| ||||||
Sbjct: 518 tttccatcttcagttgaaacagccaccagatggcggagatcggatttgttgcctactagc 459

                                                                       
Query: 416 atgacaacaatgctagggtcagtatgatctcttagctcttttagccagcgcgccacattg 475
           ||||||||||| ||||||||||| || ||||| ||||||||||||||||| |||||||| 
Sbjct: 458 atgacaacaatactagggtcagtgtggtctctcagctcttttagccagcgtgccacatta 399

                                                                       
Query: 476 tcgaatgtagccgggcgagtgacatcatacaccagcaacgcacctactgctcctctataa 535
           ||||| |||||  | |||||||||||||| || ||||  ||||||||||||||||| |||
Sbjct: 398 tcgaaagtagcacgccgagtgacatcatagacaagcagtgcacctactgctcctctgtaa 339

                                                                       
Query: 536 taggcactcgtaatagcacggtatctctcctggccagcggtgtcccaaatctgggccttg 595
           |||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 338 taggcacttgtaatagcacggtatctctcctggccggcggtgtcccaaatctgggccttg 279

                                                                       
Query: 596 acgacctttgccgtcgacctggaggctgcgggtggcgaactcgaccccgatggtggactt 655
           |||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 278 acgacc-ttgccgtcgacctggatgctgcgggtggcgaactcgaccccgatggtggactt 220

                                                              
Query: 656 ggattcgaggcagaactcgttcttggtgaagcgcgagangcaggttggact 706
           ||| |||||||||||||||||||||||||| ||||| | ||||||||||||
Sbjct: 219 ggactcgaggcagaactcgttcttggtgaaacgcgaca-gcaggttggact 170

---

>dbj|AK060095.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-307-F01, full
           insert sequence
          Length = 1005

 Score =  624 bits (315), Expect = e-176
 Identities = 524/591 (88%), Gaps = 2/591 (0%)
 Strand = Plus / Minus

                                                                       
Query: 116 aatgcatctataccctaacttgagcagcagccggctctcttcagcgaagacacgtcgtct 175
           ||||||||| ||| |||| ||||||| |||||   ||||||||||| ||||||||| |||
Sbjct: 752 aatgcatctctactctaatttgagcaacagccaattctcttcagcgcagacacgtcatct 693

                                                                       
Query: 176 ttcacatttatattctcccctttgcttggggcagatgagccgtcgtctcctgcatcaacc 235
           |||||||| || ||||| |||||| |||| |||  ||| || || |||  ||| ||||||
Sbjct: 692 ttcacattaatcttctctcctttgattggagcatttgatccatcatctgatgcctcaacc 633

                                                                       
Query: 236 gtcttcctgctcgcaatacggtatatctgagtcaaaacttctgagaaagcgttgtctaca 295
           |||||| ||||  || |  ||||||||||||||||||||||||  ||||| || ||||||
Sbjct: 632 gtcttcttgctgacagtttggtatatctgagtcaaaacttctgcaaaagcattctctaca 573

                                                                       
Query: 296 tttgtcgcgtctaatgcagatgtttccatgaagtacagtgactccgcctcagcatattcc 355
           ||||| ||||||||||||||||| ||||||||||||| |||||| |||||||||||||||
Sbjct: 572 tttgtggcgtctaatgcagatgtctccatgaagtacaatgactcagcctcagcatattcc 513

                                                                       
Query: 356 tgcccatcttcagttgaaacagccaccaagtggcgaaggtcagatttgttgccaactagc 415
           |  |||||||||||||||||||||||||  ||||| || || ||||||||||| ||||||
Sbjct: 512 tttccatcttcagttgaaacagccaccagatggcggagatcggatttgttgcctactagc 453

                                                                       
Query: 416 atgacaacaatgctagggtcagtatgatctcttagctcttttagccagcgcgccacattg 475
           ||||||||||| ||||||||||| || ||||| ||||||||||||||||| |||||||| 
Sbjct: 452 atgacaacaatactagggtcagtgtggtctctcagctcttttagccagcgtgccacatta 393

                                                                       
Query: 476 tcgaatgtagccgggcgagtgacatcatacaccagcaacgcacctactgctcctctataa 535
           ||||| |||||  | |||||||||||||| || ||||  ||||||||||||||||| |||
Sbjct: 392 tcgaaagtagcacgccgagtgacatcatagacaagcagtgcacctactgctcctctgtaa 333

                                                                       
Query: 536 taggcactcgtaatagcacggtatctctcctggccagcggtgtcccaaatctgggccttg 595
           |||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 332 taggcacttgtaatagcacggtatctctcctggccggcggtgtcccaaatctgggccttg 273

                                                                       
Query: 596 acgacctttgccgtcgacctggaggctgcgggtggcgaactcgaccccgatggtggactt 655
           |||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 272 acgacc-ttgccgtcgacctggatgctgcgggtggcgaactcgaccccgatggtggactt 214

                                                              
Query: 656 ggattcgaggcagaactcgttcttggtgaagcgcgagangcaggttggact 706
           ||| |||||||||||||||||||||||||| ||||| | ||||||||||||
Sbjct: 213 ggactcgaggcagaactcgttcttggtgaaacgcgaca-gcaggttggact 164

---

>ref|NM_191227.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 666

 Score =  613 bits (309), Expect = e-172
 Identities = 512/577 (88%), Gaps = 2/577 (0%)
 Strand = Plus / Minus

                                                                       
Query: 130 ctaacttgagcagcagccggctctcttcagcgaagacacgtcgtctttcacatttatatt 189
           |||| ||||||| |||||   ||||||||||| ||||||||| ||||||||||| || ||
Sbjct: 666 ctaatttgagcaacagccaattctcttcagcgcagacacgtcatctttcacattaatctt 607

                                                                       
Query: 190 ctcccctttgcttggggcagatgagccgtcgtctcctgcatcaaccgtcttcctgctcgc 249
           ||| |||||| |||| |||  ||| || || |||  ||| |||||||||||| ||||  |
Sbjct: 606 ctctcctttgattggagcatttgatccatcatctgatgcctcaaccgtcttcttgctgac 547

                                                                       
Query: 250 aatacggtatatctgagtcaaaacttctgagaaagcgttgtctacatttgtcgcgtctaa 309
           | |  ||||||||||||||||||||||||  ||||| || ||||||||||| ||||||||
Sbjct: 546 agtttggtatatctgagtcaaaacttctgcaaaagcattctctacatttgtggcgtctaa 487

                                                                       
Query: 310 tgcagatgtttccatgaagtacagtgactccgcctcagcatattcctgcccatcttcagt 369
           ||||||||| ||||||||||||| |||||| ||||||||||||||||  |||||||||||
Sbjct: 486 tgcagatgtctccatgaagtacaatgactcagcctcagcatattcctttccatcttcagt 427

                                                                       
Query: 370 tgaaacagccaccaagtggcgaaggtcagatttgttgccaactagcatgacaacaatgct 429
           ||||||||||||||  ||||| || || ||||||||||| ||||||||||||||||| ||
Sbjct: 426 tgaaacagccaccagatggcggagatcggatttgttgcctactagcatgacaacaatact 367

                                                                       
Query: 430 agggtcagtatgatctcttagctcttttagccagcgcgccacattgtcgaatgtagccgg 489
           ||||||||| || ||||| ||||||||||||||||| |||||||| ||||| |||||  |
Sbjct: 366 agggtcagtgtggtctctcagctcttttagccagcgtgccacattatcgaaagtagcacg 307

                                                                       
Query: 490 gcgagtgacatcatacaccagcaacgcacctactgctcctctataataggcactcgtaat 549
            |||||||||||||| || ||||  ||||||||||||||||| ||||||||||| |||||
Sbjct: 306 ccgagtgacatcatagacaagcagtgcacctactgctcctctgtaataggcacttgtaat 247

                                                                       
Query: 550 agcacggtatctctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgt 609
           ||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||
Sbjct: 246 agcacggtatctctcctggccggcggtgtcccaaatctgggccttgacgacc-ttgccgt 188

                                                                       
Query: 610 cgacctggaggctgcgggtggcgaactcgaccccgatggtggacttggattcgaggcaga 669
           ||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 187 cgacctggatgctgcgggtggcgaactcgaccccgatggtggacttggactcgaggcaga 128

                                                
Query: 670 actcgttcttggtgaagcgcgagangcaggttggact 706
           |||||||||||||||| ||||| | ||||||||||||
Sbjct: 127 actcgttcttggtgaaacgcgaca-gcaggttggact 92

---

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  408 bits (206), Expect = e-110
 Identities = 386/446 (86%)
 Strand = Plus / Minus

                                                                            
Query: 116      aatgcatctataccctaacttgagcagcagccggctctcttcagcgaagacacgtcgtct 175
                ||||||||| ||| |||| ||||||| |||||   ||||||||||| ||||||||| |||
Sbjct: 31400266 aatgcatctctactctaatttgagcaacagccaattctcttcagcgcagacacgtcatct 31400207

                                                                            
Query: 176      ttcacatttatattctcccctttgcttggggcagatgagccgtcgtctcctgcatcaacc 235
                |||||||| || ||||| |||||| |||| |||  ||| || || |||  ||| ||||||
Sbjct: 31400206 ttcacattaatcttctctcctttgattggagcatttgatccatcatctgatgcctcaacc 31400147

                                                                            
Query: 236      gtcttcctgctcgcaatacggtatatctgagtcaaaacttctgagaaagcgttgtctaca 295
                |||||| ||||  || |  ||||||||||||||||||||||||  ||||| || ||||||
Sbjct: 31400146 gtcttcttgctgacagtttggtatatctgagtcaaaacttctgcaaaagcattctctaca 31400087

                                                                            
Query: 296      tttgtcgcgtctaatgcagatgtttccatgaagtacagtgactccgcctcagcatattcc 355
                ||||| ||||||||||||||||| ||||||||||||| |||||| |||||||||||||||
Sbjct: 31400086 tttgtggcgtctaatgcagatgtctccatgaagtacaatgactcagcctcagcatattcc 31400027

                                                                            
Query: 356      tgcccatcttcagttgaaacagccaccaagtggcgaaggtcagatttgttgccaactagc 415
                |  |||||||||||||||||||||||||  ||||| || || ||||||||||| ||||||
Sbjct: 31400026 tttccatcttcagttgaaacagccaccagatggcggagatcggatttgttgcctactagc 31399967

                                                                            
Query: 416      atgacaacaatgctagggtcagtatgatctcttagctcttttagccagcgcgccacattg 475
                ||||||||||| ||||||||||| || ||||| ||||||||||||||||| |||||||| 
Sbjct: 31399966 atgacaacaatactagggtcagtgtggtctctcagctcttttagccagcgtgccacatta 31399907

                                                                            
Query: 476      tcgaatgtagccgggcgagtgacatcatacaccagcaacgcacctactgctcctctataa 535
                ||||| |||||  | |||||||||||||| || ||||  ||||||||||||||||| |||
Sbjct: 31399906 tcgaaagtagcacgccgagtgacatcatagacaagcagtgcacctactgctcctctgtaa 31399847

                                          
Query: 536      taggcactcgtaatagcacggtatct 561
                |||||||| |||||||||||||||||
Sbjct: 31399846 taggcacttgtaatagcacggtatct 31399821



 Score =  220 bits (111), Expect = 5e-54
 Identities = 140/147 (95%), Gaps = 2/147 (1%)
 Strand = Plus / Minus

                                                                            
Query: 560      ctctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggag 619
                ||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||| 
Sbjct: 31397402 ctctcctggccggcggtgtcccaaatctgggccttgacgacctt-gccgtcgacctggat 31397344

                                                                            
Query: 620      gctgcgggtggcgaactcgaccccgatggtggacttggattcgaggcagaactcgttctt 679
                ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 31397343 gctgcgggtggcgaactcgaccccgatggtggacttggactcgaggcagaactcgttctt 31397284

                                           
Query: 680      ggtgaagcgcgagangcaggttggact 706
                |||||| ||||| | ||||||||||||
Sbjct: 31397283 ggtgaaacgcgaca-gcaggttggact 31397258



 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 73/82 (89%)
 Strand = Plus / Plus

                                                                            
Query: 612      acctggaggctgcgggtggcgaactcgaccccgatggtggacttggattcgaggcagaac 671
                ||||| ||| ||||||||||||||||||| ||||||||||||||||| |||||| |||||
Sbjct: 36463353 acctgcagggtgcgggtggcgaactcgacgccgatggtggacttggactcgaggaagaac 36463412

                                      
Query: 672      tcgttcttggtgaagcgcgaga 693
                |||||   ||||||||| ||||
Sbjct: 36463413 tcgttgcgggtgaagcgggaga 36463434



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 100/121 (82%), Gaps = 1/121 (0%)
 Strand = Plus / Minus

                                                                            
Query: 555      ggtatctctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacc 614
                |||| ||||| ||||| ||||||||||| |||||||||||||||| |  || ||||||| 
Sbjct: 27295216 ggtacctctcttggccggcggtgtcccagatctgggccttgacgagc-ctgtcgtcgacg 27295158

                                                                            
Query: 615      tggaggctgcgggtggcgaactcgaccccgatggtggacttggattcgaggcagaactcg 674
                 ||| | |   ||||||||||||||| |||||||||||| |||  || |||| |||||||
Sbjct: 27295157 cggacggtcttggtggcgaactcgacgccgatggtggacctggtctccaggctgaactcg 27295098

                 
Query: 675      t 675
                |
Sbjct: 27295097 t 27295097



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                            
Query: 533      taataggcactcgtaatagcacggtatctctcctggccagcggtgtcccaaatctgggcc 592
                ||||| |||||||| || |||||||||||||| || || || |||||||| ||||| |||
Sbjct: 36461882 taataagcactcgtgattgcacggtatctctcttgacctgccgtgtcccatatctgagcc 36461941

                    
Query: 593      ttga 596
                ||||
Sbjct: 36461942 ttga 36461945

---

>dbj|AP003076.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0481E12
          Length = 161563

 Score =  408 bits (206), Expect = e-110
 Identities = 386/446 (86%)
 Strand = Plus / Minus

                                                                          
Query: 116    aatgcatctataccctaacttgagcagcagccggctctcttcagcgaagacacgtcgtct 175
              ||||||||| ||| |||| ||||||| |||||   ||||||||||| ||||||||| |||
Sbjct: 154549 aatgcatctctactctaatttgagcaacagccaattctcttcagcgcagacacgtcatct 154490

                                                                          
Query: 176    ttcacatttatattctcccctttgcttggggcagatgagccgtcgtctcctgcatcaacc 235
              |||||||| || ||||| |||||| |||| |||  ||| || || |||  ||| ||||||
Sbjct: 154489 ttcacattaatcttctctcctttgattggagcatttgatccatcatctgatgcctcaacc 154430

                                                                          
Query: 236    gtcttcctgctcgcaatacggtatatctgagtcaaaacttctgagaaagcgttgtctaca 295
              |||||| ||||  || |  ||||||||||||||||||||||||  ||||| || ||||||
Sbjct: 154429 gtcttcttgctgacagtttggtatatctgagtcaaaacttctgcaaaagcattctctaca 154370

                                                                          
Query: 296    tttgtcgcgtctaatgcagatgtttccatgaagtacagtgactccgcctcagcatattcc 355
              ||||| ||||||||||||||||| ||||||||||||| |||||| |||||||||||||||
Sbjct: 154369 tttgtggcgtctaatgcagatgtctccatgaagtacaatgactcagcctcagcatattcc 154310

                                                                          
Query: 356    tgcccatcttcagttgaaacagccaccaagtggcgaaggtcagatttgttgccaactagc 415
              |  |||||||||||||||||||||||||  ||||| || || ||||||||||| ||||||
Sbjct: 154309 tttccatcttcagttgaaacagccaccagatggcggagatcggatttgttgcctactagc 154250

                                                                          
Query: 416    atgacaacaatgctagggtcagtatgatctcttagctcttttagccagcgcgccacattg 475
              ||||||||||| ||||||||||| || ||||| ||||||||||||||||| |||||||| 
Sbjct: 154249 atgacaacaatactagggtcagtgtggtctctcagctcttttagccagcgtgccacatta 154190

                                                                          
Query: 476    tcgaatgtagccgggcgagtgacatcatacaccagcaacgcacctactgctcctctataa 535
              ||||| |||||  | |||||||||||||| || ||||  ||||||||||||||||| |||
Sbjct: 154189 tcgaaagtagcacgccgagtgacatcatagacaagcagtgcacctactgctcctctgtaa 154130

                                        
Query: 536    taggcactcgtaatagcacggtatct 561
              |||||||| |||||||||||||||||
Sbjct: 154129 taggcacttgtaatagcacggtatct 154104



 Score =  220 bits (111), Expect = 5e-54
 Identities = 140/147 (95%), Gaps = 2/147 (1%)
 Strand = Plus / Minus

                                                                          
Query: 560    ctctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggag 619
              ||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||| 
Sbjct: 151685 ctctcctggccggcggtgtcccaaatctgggccttgacgacctt-gccgtcgacctggat 151627

                                                                          
Query: 620    gctgcgggtggcgaactcgaccccgatggtggacttggattcgaggcagaactcgttctt 679
              ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 151626 gctgcgggtggcgaactcgaccccgatggtggacttggactcgaggcagaactcgttctt 151567

                                         
Query: 680    ggtgaagcgcgagangcaggttggact 706
              |||||| ||||| | ||||||||||||
Sbjct: 151566 ggtgaaacgcgaca-gcaggttggact 151541

---

>dbj|AK066450.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013061B07, full
            insert sequence
          Length = 3356

 Score =  408 bits (206), Expect = e-110
 Identities = 386/446 (86%)
 Strand = Plus / Minus

                                                                        
Query: 116  aatgcatctataccctaacttgagcagcagccggctctcttcagcgaagacacgtcgtct 175
            ||||||||| ||| |||| ||||||| |||||   ||||||||||| ||||||||| |||
Sbjct: 3214 aatgcatctctactctaatttgagcaacagccaattctcttcagcgcagacacgtcatct 3155

                                                                        
Query: 176  ttcacatttatattctcccctttgcttggggcagatgagccgtcgtctcctgcatcaacc 235
            |||||||| || ||||| |||||| |||| |||  ||| || || |||  ||| ||||||
Sbjct: 3154 ttcacattaatcttctctcctttgattggagcatttgatccatcatctgatgcctcaacc 3095

                                                                        
Query: 236  gtcttcctgctcgcaatacggtatatctgagtcaaaacttctgagaaagcgttgtctaca 295
            |||||| ||||  || |  ||||||||||||||||||||||||  ||||| || ||||||
Sbjct: 3094 gtcttcttgctgacagtttggtatatctgagtcaaaacttctgcaaaagcattctctaca 3035

                                                                        
Query: 296  tttgtcgcgtctaatgcagatgtttccatgaagtacagtgactccgcctcagcatattcc 355
            ||||| ||||||||||||||||| ||||||||||||| |||||| |||||||||||||||
Sbjct: 3034 tttgtggcgtctaatgcagatgtctccatgaagtacaatgactcagcctcagcatattcc 2975

                                                                        
Query: 356  tgcccatcttcagttgaaacagccaccaagtggcgaaggtcagatttgttgccaactagc 415
            |  |||||||||||||||||||||||||  ||||| || || ||||||||||| ||||||
Sbjct: 2974 tttccatcttcagttgaaacagccaccagatggcggagatcggatttgttgcctactagc 2915

                                                                        
Query: 416  atgacaacaatgctagggtcagtatgatctcttagctcttttagccagcgcgccacattg 475
            ||||||||||| ||||||||||| || ||||| ||||||||||||||||| |||||||| 
Sbjct: 2914 atgacaacaatactagggtcagtgtggtctctcagctcttttagccagcgtgccacatta 2855

                                                                        
Query: 476  tcgaatgtagccgggcgagtgacatcatacaccagcaacgcacctactgctcctctataa 535
            ||||| |||||  | |||||||||||||| || ||||  ||||||||||||||||| |||
Sbjct: 2854 tcgaaagtagcacgccgagtgacatcatagacaagcagtgcacctactgctcctctgtaa 2795

                                      
Query: 536  taggcactcgtaatagcacggtatct 561
            |||||||| |||||||||||||||||
Sbjct: 2794 taggcacttgtaatagcacggtatct 2769



 Score =  220 bits (111), Expect = 5e-54
 Identities = 140/147 (95%), Gaps = 2/147 (1%)
 Strand = Plus / Minus

                                                                       
Query: 560 ctctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggag 619
           ||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||| 
Sbjct: 350 ctctcctggccggcggtgtcccaaatctgggccttgacgacctt-gccgtcgacctggat 292

                                                                       
Query: 620 gctgcgggtggcgaactcgaccccgatggtggacttggattcgaggcagaactcgttctt 679
           ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 291 gctgcgggtggcgaactcgaccccgatggtggacttggactcgaggcagaactcgttctt 232

                                      
Query: 680 ggtgaagcgcgagangcaggttggact 706
           |||||| ||||| | ||||||||||||
Sbjct: 231 ggtgaaacgcgaca-gcaggttggact 206

---

>ref|XM_475714.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 663

 Score =  311 bits (157), Expect = 2e-81
 Identities = 380/452 (84%), Gaps = 2/452 (0%)
 Strand = Plus / Minus

                                                                       
Query: 255 ggtatatctgagtcaaaacttctgagaaagcgttgtctacatttgtcgcgtctaatgcag 314
           |||||||||||||||  || || | ||| || ||||| || || || ||||| |  ||||
Sbjct: 538 ggtatatctgagtcaggacctccgcgaacgcattgtcgacgttggtagcgtcgagcgcag 479

                                                                       
Query: 315 atgtttccatgaagtacagtgactccgcctcagcatattcctgcccatcttcagttgaaa 374
           | |||||||||||||||| ||| || || |||||| | || |  || || || ||||| |
Sbjct: 478 aagtttccatgaagtacattgattcggcttcagcaaactctttgccgtcctcggttgaga 419

                                                                       
Query: 375 cagccaccaagtggcgaaggtcagatttgttgccaactagcatgacaacaatgctagggt 434
           |||||||||||||||| || || |||||||||||||  ||||||   ||||||||||| |
Sbjct: 418 cagccaccaagtggcggagatcggatttgttgccaatcagcatgcagacaatgctaggat 359

                                                                       
Query: 435 cagtatgatctcttagctcttttagccagcgcgccacattgtcgaatgtagccgggcgag 494
           |||| || ||||| |||||  ||||||||||  |||| ||||||||||||||  | || |
Sbjct: 358 cagtgtggtctctaagctcccttagccagcgtcccacgttgtcgaatgtagcacgacggg 299

                                                                       
Query: 495 tgacatcatacaccagcaacgcacctactgctcctctataataggcactcgtaatagcac 554
           ||||||| || || ||||| || || || ||||| |  ||||||||||| || |||||||
Sbjct: 298 tgacatcgtagacgagcaatgctcccacagctccccggtaataggcactagtgatagcac 239

                                                                       
Query: 555 ggtatctctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacc 614
           | || ||||||||||| ||||||||||||||||||||||||| |||| ||||||||||||
Sbjct: 238 gatacctctcctggccggcggtgtcccaaatctgggccttgatgacc-ttgccgtcgacc 180

                                                                       
Query: 615 tggaggctgcgggtggcgaactcgaccccgatggtggacttggattcgaggcagaactcg 674
           |||||||||||||||||||||||||| ||||||||||||||||| ||||||| |||||||
Sbjct: 179 tggaggctgcgggtggcgaactcgacgccgatggtggacttggactcgaggctgaactcg 120

                                           
Query: 675 ttcttggtgaagcgcgagangcaggttggact 706
           |||||||||||||| |||| | ||||||||||
Sbjct: 119 ttcttggtgaagcgggagagg-aggttggact 89

---

>dbj|AK061969.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-042-H05, full
           insert sequence
          Length = 968

 Score =  311 bits (157), Expect = 2e-81
 Identities = 380/452 (84%), Gaps = 2/452 (0%)
 Strand = Plus / Minus

                                                                       
Query: 255 ggtatatctgagtcaaaacttctgagaaagcgttgtctacatttgtcgcgtctaatgcag 314
           |||||||||||||||  || || | ||| || ||||| || || || ||||| |  ||||
Sbjct: 590 ggtatatctgagtcaggacctccgcgaacgcattgtcgacgttggtagcgtcgagcgcag 531

                                                                       
Query: 315 atgtttccatgaagtacagtgactccgcctcagcatattcctgcccatcttcagttgaaa 374
           | |||||||||||||||| ||| || || |||||| | || |  || || || ||||| |
Sbjct: 530 aagtttccatgaagtacattgattcggcttcagcaaactctttgccgtcctcggttgaga 471

                                                                       
Query: 375 cagccaccaagtggcgaaggtcagatttgttgccaactagcatgacaacaatgctagggt 434
           |||||||||||||||| || || |||||||||||||  ||||||   ||||||||||| |
Sbjct: 470 cagccaccaagtggcggagatcggatttgttgccaatcagcatgcagacaatgctaggat 411

                                                                       
Query: 435 cagtatgatctcttagctcttttagccagcgcgccacattgtcgaatgtagccgggcgag 494
           |||| || ||||| |||||  ||||||||||  |||| ||||||||||||||  | || |
Sbjct: 410 cagtgtggtctctaagctcccttagccagcgtcccacgttgtcgaatgtagcacgacggg 351

                                                                       
Query: 495 tgacatcatacaccagcaacgcacctactgctcctctataataggcactcgtaatagcac 554
           ||||||| || || ||||| || || || ||||| |  ||||||||||| || |||||||
Sbjct: 350 tgacatcgtagacgagcaatgctcccacagctccccggtaataggcactagtgatagcac 291

                                                                       
Query: 555 ggtatctctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacc 614
           | || ||||||||||| ||||||||||||||||||||||||| |||| ||||||||||||
Sbjct: 290 gatacctctcctggccggcggtgtcccaaatctgggccttgatgacc-ttgccgtcgacc 232

                                                                       
Query: 615 tggaggctgcgggtggcgaactcgaccccgatggtggacttggattcgaggcagaactcg 674
           |||||||||||||||||||||||||| ||||||||||||||||| ||||||| |||||||
Sbjct: 231 tggaggctgcgggtggcgaactcgacgccgatggtggacttggactcgaggctgaactcg 172

                                           
Query: 675 ttcttggtgaagcgcgagangcaggttggact 706
           |||||||||||||| |||| | ||||||||||
Sbjct: 171 ttcttggtgaagcgggagagg-aggttggact 141

---

>dbj|AK060246.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-003-H10, full
           insert sequence
          Length = 1344

 Score =  303 bits (153), Expect = 4e-79
 Identities = 337/396 (85%), Gaps = 2/396 (0%)
 Strand = Plus / Minus

                                                                       
Query: 311 gcagatgtttccatgaagtacagtgactccgcctcagcatattcctgcccatcttcagtt 370
           ||||| |||||||||||||||| ||| || || |||||| | || |  || || || |||
Sbjct: 525 gcagaagtttccatgaagtacattgattcggcttcagcaaactctttgccgtcctcggtt 466

                                                                       
Query: 371 gaaacagccaccaagtggcgaaggtcagatttgttgccaactagcatgacaacaatgcta 430
           || ||||||||||||||||| || || |||||||||||||  ||||||   |||||||||
Sbjct: 465 gagacagccaccaagtggcggagatcggatttgttgccaatcagcatgcagacaatgcta 406

                                                                       
Query: 431 gggtcagtatgatctcttagctcttttagccagcgcgccacattgtcgaatgtagccggg 490
           || ||||| || ||||| |||||  ||||||||||  |||| |||||||||| |||  | 
Sbjct: 405 ggatcagtgtggtctctaagctcccttagccagcgtcccacgttgtcgaatgcagcacga 346

                                                                       
Query: 491 cgagtgacatcatacaccagcaacgcacctactgctcctctataataggcactcgtaata 550
           || |||||||| || || ||||| || || || ||||| |  ||||||||||| || |||
Sbjct: 345 cgggtgacatcgtagacgagcaatgctcccacagctccccggtaataggcactagtgata 286

                                                                       
Query: 551 gcacggtatctctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtc 610
           ||||| || ||||||||||| ||||||||||||||||||||||||| |||| ||||||||
Sbjct: 285 gcacgatacctctcctggccggcggtgtcccaaatctgggccttgatgacc-ttgccgtc 227

                                                                       
Query: 611 gacctggaggctgcgggtggcgaactcgaccccgatggtggacttggattcgaggcagaa 670
           |||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |||
Sbjct: 226 gacctggaggctgcgggtggcgaactcgacgccgatggtggacttggactcgaggctgaa 167

                                               
Query: 671 ctcgttcttggtgaagcgcgagangcaggttggact 706
           |||||||||||||||||| |||| | ||||||||||
Sbjct: 166 ctcgttcttggtgaagcgggagagg-aggttggact 132

---

>emb|AJ234567.1|HVU234567 Hordeum vulgare genomic DNA fragment; clone MWG0812
          Length = 1096

 Score =  244 bits (123), Expect = 3e-61
 Identities = 144/147 (97%), Gaps = 3/147 (2%)
 Strand = Plus / Minus

                                                                       
Query: 560 ctctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggag 619
           |||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||
Sbjct: 466 ctctcctggccagcggtgtcccaaatctgg-ccttgacgacctt-gccgtcgacctggag 409

                                                                       
Query: 620 gctgcgggtggcgaactcgaccccgatggtggacttggattcgaggcagaactcgttctt 679
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 408 gctgcgggtggcgaactcgaccccgatggtggacttggattcgaggcagaactcgttctt 349

                                      
Query: 680 ggtgaagcgcgagangcaggttggact 706
           |||||||||||||| ||||||||||||
Sbjct: 348 ggtgaagcgcgaga-gcaggttggact 323

---

>gb|AF327517.1|AF327517 Oryza sativa GTP-binding protein mRNA, complete cds
          Length = 1406

 Score =  226 bits (114), Expect = 8e-56
 Identities = 271/321 (84%), Gaps = 2/321 (0%)
 Strand = Plus / Minus

                                                                       
Query: 386 tggcgaaggtcagatttgttgccaactagcatgacaacaatgctagggtcagtatgatct 445
           ||||| || ||||| ||||||||||||||||||||||| ||| | ||||| ||||| || 
Sbjct: 877 tggcgcagatcagacttgttgccaactagcatgacaactatgtttgggtctgtatggtcc 818

                                                                       
Query: 446 cttagctcttttagccagcgcgccacattgtcgaatgtagccgggcgagtgacatcatac 505
           || |  || || | ||||||| | ||||| || || || |   | || ||||||||||| 
Sbjct: 817 ctcaattccttcaaccagcgctcaacattctcaaaggttgagtgccgggtgacatcatag 758

                                                                       
Query: 506 accagcaacgcacctactgctcctctataataggcactcgtaatagcacggtatctctcc 565
           || |||||||| || || || ||||  ||||| ||||| |||||||||||||||| ||||
Sbjct: 757 acaagcaacgctccaacagcacctcggtaatatgcactagtaatagcacggtatcgctcc 698

                                                                       
Query: 566 tggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggctgcg 625
           ||||| |||||||||||||||||||||||||||||| ||||||||||||||||||  |||
Sbjct: 697 tggccggcggtgtcccaaatctgggccttgacgacc-ttgccgtcgacctggagggagcg 639

                                                                       
Query: 626 ggtggcgaactcgaccccgatggtggacttggattcgaggcagaactcgttcttggtgaa 685
           ||||||||||||||| ||||||||||||||||| ||||||| |||||||||   ||||||
Sbjct: 638 ggtggcgaactcgacgccgatggtggacttggactcgaggctgaactcgttgcgggtgaa 579

                                
Query: 686 gcgcgagangcaggttggact 706
           ||| |||| | ||||||||||
Sbjct: 578 gcgggagagg-aggttggact 559

---

>dbj|D13758.1|RICSS230 Oryza sativa ss230 mRNA for ras-related GTP binding protein,
           complete cds
          Length = 946

 Score =  226 bits (114), Expect = 8e-56
 Identities = 271/321 (84%), Gaps = 2/321 (0%)
 Strand = Plus / Minus

                                                                       
Query: 386 tggcgaaggtcagatttgttgccaactagcatgacaacaatgctagggtcagtatgatct 445
           ||||| || ||||| ||||||||||||||||||||||| ||| | ||||| ||||| || 
Sbjct: 453 tggcgcagatcagacttgttgccaactagcatgacaactatgtttgggtctgtatggtcc 394

                                                                       
Query: 446 cttagctcttttagccagcgcgccacattgtcgaatgtagccgggcgagtgacatcatac 505
           || |  || || | ||||||| | ||||| || || || |   | || ||||||||||| 
Sbjct: 393 ctcaattccttcaaccagcgctcaacattctcaaaggttgagtgccgggtgacatcatag 334

                                                                       
Query: 506 accagcaacgcacctactgctcctctataataggcactcgtaatagcacggtatctctcc 565
           || |||||||| || || || ||||  ||||| ||||| |||||||||||||||| ||||
Sbjct: 333 acaagcaacgctccaacagcacctcggtaatatgcactagtaatagcacggtatcgctcc 274

                                                                       
Query: 566 tggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggctgcg 625
           ||||| |||||||||||||||||||||||||||||| ||||||||||||||||||  |||
Sbjct: 273 tggccggcggtgtcccaaatctgggccttgacgacc-ttgccgtcgacctggagggagcg 215

                                                                       
Query: 626 ggtggcgaactcgaccccgatggtggacttggattcgaggcagaactcgttcttggtgaa 685
           ||||||||||||||| ||||||||||||||||| ||||||| |||||||||   ||||||
Sbjct: 214 ggtggcgaactcgacgccgatggtggacttggactcgaggctgaactcgttgcgggtgaa 155

                                
Query: 686 gcgcgagangcaggttggact 706
           ||| |||| | ||||||||||
Sbjct: 154 gcgggagagg-aggttggact 135

---

>dbj|AK066548.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013069H14, full
           insert sequence
          Length = 1006

 Score =  226 bits (114), Expect = 8e-56
 Identities = 271/321 (84%), Gaps = 2/321 (0%)
 Strand = Plus / Minus

                                                                       
Query: 386 tggcgaaggtcagatttgttgccaactagcatgacaacaatgctagggtcagtatgatct 445
           ||||| || ||||| ||||||||||||||||||||||| ||| | ||||| ||||| || 
Sbjct: 488 tggcgcagatcagacttgttgccaactagcatgacaactatgtttgggtctgtatggtcc 429

                                                                       
Query: 446 cttagctcttttagccagcgcgccacattgtcgaatgtagccgggcgagtgacatcatac 505
           || |  || || | ||||||| | ||||| || || || |   | || ||||||||||| 
Sbjct: 428 ctcaattccttcaaccagcgctcaacattctcaaaggttgagtgccgggtgacatcatag 369

                                                                       
Query: 506 accagcaacgcacctactgctcctctataataggcactcgtaatagcacggtatctctcc 565
           || |||||||| || || || ||||  ||||| ||||| |||||||||||||||| ||||
Sbjct: 368 acaagcaacgctccaacagcacctcggtaatatgcactagtaatagcacggtatcgctcc 309

                                                                       
Query: 566 tggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggctgcg 625
           ||||| |||||||||||||||||||||||||||||| ||||||||||||||||||  |||
Sbjct: 308 tggccggcggtgtcccaaatctgggccttgacgacc-ttgccgtcgacctggagggagcg 250

                                                                       
Query: 626 ggtggcgaactcgaccccgatggtggacttggattcgaggcagaactcgttcttggtgaa 685
           ||||||||||||||| ||||||||||||||||| ||||||| |||||||||   ||||||
Sbjct: 249 ggtggcgaactcgacgccgatggtggacttggactcgaggctgaactcgttgcgggtgaa 190

                                
Query: 686 gcgcgagangcaggttggact 706
           ||| |||| | ||||||||||
Sbjct: 189 gcgggagagg-aggttggact 170

---

>gb|AC130603.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone B1130G10,
             complete sequence
          Length = 143073

 Score =  208 bits (105), Expect = 2e-50
 Identities = 142/152 (93%), Gaps = 2/152 (1%)
 Strand = Plus / Plus

                                                                         
Query: 555   ggtatctctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacc 614
             |||| ||||||||||| ||||||||||||||||||||||||| |||||| ||||||||||
Sbjct: 66907 ggtacctctcctggccggcggtgtcccaaatctgggccttgatgacctt-gccgtcgacc 66965

                                                                         
Query: 615   tggaggctgcgggtggcgaactcgaccccgatggtggacttggattcgaggcagaactcg 674
             |||||||||||||||||||||||||| ||||||||||||||||| ||||||| |||||||
Sbjct: 66966 tggaggctgcgggtggcgaactcgacgccgatggtggacttggactcgaggctgaactcg 67025

                                             
Query: 675   ttcttggtgaagcgcgagangcaggttggact 706
             |||||||||||||| |||| | ||||||||||
Sbjct: 67026 ttcttggtgaagcgggagagg-aggttggact 67056



 Score =  113 bits (57), Expect = 8e-22
 Identities = 240/301 (79%)
 Strand = Plus / Plus

                                                                         
Query: 255   ggtatatctgagtcaaaacttctgagaaagcgttgtctacatttgtcgcgtctaatgcag 314
             |||||||||||||||  || || | ||| || ||||| || || || ||||| |  ||||
Sbjct: 65536 ggtatatctgagtcaggacctccgcgaacgcattgtcgacgttggtagcgtcgagcgcag 65595

                                                                         
Query: 315   atgtttccatgaagtacagtgactccgcctcagcatattcctgcccatcttcagttgaaa 374
             | |||||||||||||||| ||| || || |||||| | || |  || || || ||||| |
Sbjct: 65596 aagtttccatgaagtacattgattcggcttcagcaaactctttgccgtcctcggttgaga 65655

                                                                         
Query: 375   cagccaccaagtggcgaaggtcagatttgttgccaactagcatgacaacaatgctagggt 434
             |||||||||||||||| || || |||||||||||||  ||||||   ||||||||||| |
Sbjct: 65656 cagccaccaagtggcggagatcggatttgttgccaatcagcatgcagacaatgctaggat 65715

                                                                         
Query: 435   cagtatgatctcttagctcttttagccagcgcgccacattgtcgaatgtagccgggcgag 494
             |||| || ||||| |||||  ||||||||||  |||| ||||||||||||||  | || |
Sbjct: 65716 cagtgtggtctctaagctcccttagccagcgtcccacgttgtcgaatgtagcacgacggg 65775

                                                                         
Query: 495   tgacatcatacaccagcaacgcacctactgctcctctataataggcactcgtaatagcac 554
             ||||||| || || ||||| || || || ||||| |  ||||||||||| || |||||||
Sbjct: 65776 tgacatcgtagacgagcaatgctcccacagctccccggtaataggcactagtgatagcac 65835

              
Query: 555   g 555
             |
Sbjct: 65836 g 65836

---

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  208 bits (105), Expect = 2e-50
 Identities = 142/152 (93%), Gaps = 2/152 (1%)
 Strand = Plus / Plus

                                                                            
Query: 555      ggtatctctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacc 614
                |||| ||||||||||| ||||||||||||||||||||||||| |||||| ||||||||||
Sbjct: 25426546 ggtacctctcctggccggcggtgtcccaaatctgggccttgatgacctt-gccgtcgacc 25426604

                                                                            
Query: 615      tggaggctgcgggtggcgaactcgaccccgatggtggacttggattcgaggcagaactcg 674
                |||||||||||||||||||||||||| ||||||||||||||||| ||||||| |||||||
Sbjct: 25426605 tggaggctgcgggtggcgaactcgacgccgatggtggacttggactcgaggctgaactcg 25426664

                                                
Query: 675      ttcttggtgaagcgcgagangcaggttggact 706
                |||||||||||||| |||| | ||||||||||
Sbjct: 25426665 ttcttggtgaagcgggagagg-aggttggact 25426695



 Score =  137 bits (69), Expect = 6e-29
 Identities = 97/105 (92%), Gaps = 1/105 (0%)
 Strand = Plus / Plus

                                                                            
Query: 572      gcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggctgcgggtggc 631
                ||||||||||| |||||||||||||||||||| | ||||||| |||| ||||||||||||
Sbjct: 27873854 gcggtgtcccagatctgggccttgacgacctt-gtcgtcgacgtggatgctgcgggtggc 27873912

                                                             
Query: 632      gaactcgaccccgatggtggacttggattcgaggcagaactcgtt 676
                ||||||||| ||||||||||||||||| ||||||| |||||||||
Sbjct: 27873913 gaactcgacgccgatggtggacttggactcgaggctgaactcgtt 27873957



 Score =  113 bits (57), Expect = 8e-22
 Identities = 240/301 (79%)
 Strand = Plus / Plus

                                                                            
Query: 255      ggtatatctgagtcaaaacttctgagaaagcgttgtctacatttgtcgcgtctaatgcag 314
                |||||||||||||||  || || | ||| || ||||| || || || ||||| |  ||||
Sbjct: 25425175 ggtatatctgagtcaggacctccgcgaacgcattgtcgacgttggtagcgtcgagcgcag 25425234

                                                                            
Query: 315      atgtttccatgaagtacagtgactccgcctcagcatattcctgcccatcttcagttgaaa 374
                | |||||||||||||||| ||| || || |||||| | || |  || || || ||||| |
Sbjct: 25425235 aagtttccatgaagtacattgattcggcttcagcaaactctttgccgtcctcggttgaga 25425294

                                                                            
Query: 375      cagccaccaagtggcgaaggtcagatttgttgccaactagcatgacaacaatgctagggt 434
                |||||||||||||||| || || |||||||||||||  ||||||   ||||||||||| |
Sbjct: 25425295 cagccaccaagtggcggagatcggatttgttgccaatcagcatgcagacaatgctaggat 25425354

                                                                            
Query: 435      cagtatgatctcttagctcttttagccagcgcgccacattgtcgaatgtagccgggcgag 494
                |||| || ||||| |||||  ||||||||||  |||| ||||||||||||||  | || |
Sbjct: 25425355 cagtgtggtctctaagctcccttagccagcgtcccacgttgtcgaatgtagcacgacggg 25425414

                                                                            
Query: 495      tgacatcatacaccagcaacgcacctactgctcctctataataggcactcgtaatagcac 554
                ||||||| || || ||||| || || || ||||| |  ||||||||||| || |||||||
Sbjct: 25425415 tgacatcgtagacgagcaatgctcccacagctccccggtaataggcactagtgatagcac 25425474

                 
Query: 555      g 555
                |
Sbjct: 25425475 g 25425475



 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 59/62 (95%)
 Strand = Plus / Minus

                                                                          
Query: 615    tggaggctgcgggtggcgaactcgaccccgatggtggacttggattcgaggcagaactcg 674
              |||||| ||||||||||||||||||| ||||||||||||||||| |||||||||||||||
Sbjct: 253903 tggagggtgcgggtggcgaactcgacgccgatggtggacttggactcgaggcagaactcg 253844

                
Query: 675    tt 676
              ||
Sbjct: 253843 tt 253842



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 42/45 (93%)
 Strand = Plus / Plus

                                                             
Query: 626      ggtggcgaactcgaccccgatggtggacttggattcgaggcagaa 670
                ||||||||||||||| ||||||||||||||||| |||||| ||||
Sbjct: 11625110 ggtggcgaactcgacgccgatggtggacttggagtcgagggagaa 11625154



 Score = 40.1 bits (20), Expect = 9.7
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                            
Query: 551      gcacggtatctctcctggccagcggtgtcccaaatctgggcctt 594
                ||||| ||||||||||| || || |||||||| ||||| |||||
Sbjct: 11624002 gcacgatatctctcctgtcctgctgtgtcccagatctgagcctt 11624045

---

>gb|AY103999.1| Zea mays PCO068021 mRNA sequence
          Length = 903

 Score =  188 bits (95), Expect = 2e-44
 Identities = 243/291 (83%), Gaps = 1/291 (0%)
 Strand = Plus / Minus

                                                                       
Query: 386 tggcgaaggtcagatttgttgccaactagcatgacaacaatgctagggtcagtatgatct 445
           ||||| || ||||||||||||||||| ||||| ||||| ||  | ||||| || || |||
Sbjct: 466 tggcggagatcagatttgttgccaaccagcataacaactatattggggtctgtgtggtct 407

                                                                       
Query: 446 cttagctcttttagccagcgcgccacattgtcgaatgtagccgggcgagtgacatcatac 505
           || ||||| || ||||| ||| | || || || || || |   |||||||||| ||||| 
Sbjct: 406 ctcagctccttcagccaacgctcaacgttctcaaaggttgagtggcgagtgacgtcatat 347

                                                                       
Query: 506 accagcaacgcacctactgctcctctataataggcactcgtaatagcacggtatctctcc 565
           || |||||||| || || || ||||  ||||| ||||| || || ||||||||||  |||
Sbjct: 346 acaagcaacgccccaacagcgcctcggtaatacgcactagtgattgcacggtatcgttcc 287

                                                                       
Query: 566 tggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggctgcg 625
           ||||| |||||||||||||||||||||||||||||| |||||||||||||||||   |||
Sbjct: 286 tggccggcggtgtcccaaatctgggccttgacgacc-ttgccgtcgacctggagagagcg 228

                                                              
Query: 626 ggtggcgaactcgaccccgatggtggacttggattcgaggcagaactcgtt 676
           ||||||||||||||| ||||||||||||||||| ||||||| |||||||||
Sbjct: 227 ggtggcgaactcgacgccgatggtggacttggactcgaggctgaactcgtt 177

---

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score =  170 bits (86), Expect = 4e-39
 Identities = 132/145 (91%), Gaps = 2/145 (1%)
 Strand = Plus / Plus

                                                                            
Query: 562      ctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggc 621
                ||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||| 
Sbjct: 20553523 ctcctggccggcggtgtcccaaatctgggccttgacgacctt-gccgtcgacctggaggg 20553581

                                                                            
Query: 622      tgcgggtggcgaactcgaccccgatggtggacttggattcgaggcagaactcgttcttgg 681
                 |||||||||||||||||| ||||||||||||||||| ||||||| |||||||||   ||
Sbjct: 20553582 agcgggtggcgaactcgacgccgatggtggacttggactcgaggctgaactcgttgcggg 20553641

                                         
Query: 682      tgaagcgcgagangcaggttggact 706
                ||||||| |||| | ||||||||||
Sbjct: 20553642 tgaagcgggagagg-aggttggact 20553665



 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 140/176 (79%)
 Strand = Plus / Plus

                                                                            
Query: 386      tggcgaaggtcagatttgttgccaactagcatgacaacaatgctagggtcagtatgatct 445
                ||||| || ||||| ||||||||||||||||||||||| ||| | ||||| ||||| || 
Sbjct: 20548833 tggcgcagatcagacttgttgccaactagcatgacaactatgtttgggtctgtatggtcc 20548892

                                                                            
Query: 446      cttagctcttttagccagcgcgccacattgtcgaatgtagccgggcgagtgacatcatac 505
                || |  || || | ||||||| | ||||| || || || |   | || ||||||||||| 
Sbjct: 20548893 ctcaattccttcaaccagcgctcaacattctcaaaggttgagtgccgggtgacatcatag 20548952

                                                                        
Query: 506      accagcaacgcacctactgctcctctataataggcactcgtaatagcacggtatct 561
                || |||||||| || || || ||||  ||||| ||||| |||||||||||||||||
Sbjct: 20548953 acaagcaacgctccaacagcacctcggtaatatgcactagtaatagcacggtatct 20549008



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                         
Query: 554      cggtatctctcctggccagcggtgtcccaaatctgggcctt 594
                ||||| |||||||| || ||||||||||| |||||||||||
Sbjct: 29820827 cggtacctctcctgccccgcggtgtcccagatctgggcctt 29820867

---

>dbj|AP003686.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0659D09
          Length = 168253

 Score =  170 bits (86), Expect = 4e-39
 Identities = 132/145 (91%), Gaps = 2/145 (1%)
 Strand = Plus / Plus

                                                                          
Query: 562    ctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggc 621
              ||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||| 
Sbjct: 125818 ctcctggccggcggtgtcccaaatctgggccttgacgacctt-gccgtcgacctggaggg 125876

                                                                          
Query: 622    tgcgggtggcgaactcgaccccgatggtggacttggattcgaggcagaactcgttcttgg 681
               |||||||||||||||||| ||||||||||||||||| ||||||| |||||||||   ||
Sbjct: 125877 agcgggtggcgaactcgacgccgatggtggacttggactcgaggctgaactcgttgcggg 125936

                                       
Query: 682    tgaagcgcgagangcaggttggact 706
              ||||||| |||| | ||||||||||
Sbjct: 125937 tgaagcgggagagg-aggttggact 125960



 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 140/176 (79%)
 Strand = Plus / Plus

                                                                          
Query: 386    tggcgaaggtcagatttgttgccaactagcatgacaacaatgctagggtcagtatgatct 445
              ||||| || ||||| ||||||||||||||||||||||| ||| | ||||| ||||| || 
Sbjct: 121128 tggcgcagatcagacttgttgccaactagcatgacaactatgtttgggtctgtatggtcc 121187

                                                                          
Query: 446    cttagctcttttagccagcgcgccacattgtcgaatgtagccgggcgagtgacatcatac 505
              || |  || || | ||||||| | ||||| || || || |   | || ||||||||||| 
Sbjct: 121188 ctcaattccttcaaccagcgctcaacattctcaaaggttgagtgccgggtgacatcatag 121247

                                                                      
Query: 506    accagcaacgcacctactgctcctctataataggcactcgtaatagcacggtatct 561
              || |||||||| || || || ||||  ||||| ||||| |||||||||||||||||
Sbjct: 121248 acaagcaacgctccaacagcacctcggtaatatgcactagtaatagcacggtatct 121303

---

>dbj|AK109344.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-A06, full
           insert sequence
          Length = 1091

 Score =  149 bits (75), Expect = 1e-32
 Identities = 139/159 (87%), Gaps = 1/159 (0%)
 Strand = Plus / Minus

                                                                       
Query: 518 cctactgctcctctataataggcactcgtaatagcacggtatctctcctggccagcggtg 577
           ||||||||||| | ||| || || || |||||||| || ||||| || || || ||||||
Sbjct: 439 cctactgctccgcgatagtatgcgcttgtaatagctcgatatctttcttgcccggcggtg 380

                                                                       
Query: 578 tcccaaatctgggccttgacgacctttgccgtcgacctggaggctgcgggtggcgaactc 637
           ||||| |||||||||||||||||||| | ||||||| |||| ||||||||||||||||||
Sbjct: 379 tcccagatctgggccttgacgacctt-gtcgtcgacgtggatgctgcgggtggcgaactc 321

                                                  
Query: 638 gaccccgatggtggacttggattcgaggcagaactcgtt 676
           ||| ||||||||||||||||| ||||||| |||||||||
Sbjct: 320 gacgccgatggtggacttggactcgaggctgaactcgtt 282

---

>dbj|AK073075.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033007H18, full
           insert sequence
          Length = 1124

 Score =  149 bits (75), Expect = 1e-32
 Identities = 139/159 (87%), Gaps = 1/159 (0%)
 Strand = Plus / Minus

                                                                       
Query: 518 cctactgctcctctataataggcactcgtaatagcacggtatctctcctggccagcggtg 577
           ||||||||||| | ||| || || || |||||||| || ||||| || || || ||||||
Sbjct: 445 cctactgctccgcgatagtatgcgcttgtaatagctcgatatctttcttgcccggcggtg 386

                                                                       
Query: 578 tcccaaatctgggccttgacgacctttgccgtcgacctggaggctgcgggtggcgaactc 637
           ||||| |||||||||||||||||||| | ||||||| |||| ||||||||||||||||||
Sbjct: 385 tcccagatctgggccttgacgacctt-gtcgtcgacgtggatgctgcgggtggcgaactc 327

                                                  
Query: 638 gaccccgatggtggacttggattcgaggcagaactcgtt 676
           ||| ||||||||||||||||| ||||||| |||||||||
Sbjct: 326 gacgccgatggtggacttggactcgaggctgaactcgtt 288

---

>gb|AY110177.1| Zea mays CL8907_1 mRNA sequence
          Length = 659

 Score =  149 bits (75), Expect = 1e-32
 Identities = 112/123 (91%), Gaps = 1/123 (0%)
 Strand = Plus / Plus

                                                                       
Query: 518 cctactgctcctctataataggcactcgtaatagcacggtatctctcctggccagcggtg 577
           ||||| |||||||  ||||||||||| || || |||||||| ||||||||||| ||||||
Sbjct: 535 cctacggctcctcggtaataggcacttgtgattgcacggtacctctcctggccggcggtg 594

                                                                       
Query: 578 tcccaaatctgggccttgacgacctttgccgtcgacctggaggctgcgggtggcgaactc 637
           ||||||||||||||||||| |||| ||||||||||||||||| |||||||||||||||||
Sbjct: 595 tcccaaatctgggccttgatgacc-ttgccgtcgacctggagactgcgggtggcgaactc 653

              
Query: 638 gac 640
           |||
Sbjct: 654 gac 656

---

>gb|AY110109.1| Zea mays CL16448_2 mRNA sequence
          Length = 958

 Score =  139 bits (70), Expect = 1e-29
 Identities = 131/150 (87%), Gaps = 1/150 (0%)
 Strand = Plus / Minus

                                                                       
Query: 527 cctctataataggcactcgtaatagcacggtatctctcctggccagcggtgtcccaaatc 586
           |||||||| || ||||| ||||| || || || ||||||||||| ||||||||||| |||
Sbjct: 323 cctctatagtacgcacttgtaattgcccgatacctctcctggccggcggtgtcccagatc 264

                                                                       
Query: 587 tgggccttgacgacctttgccgtcgacctggaggctgcgggtggcgaactcgaccccgat 646
           ||||||||||||||| ||| ||||||||  || ||| | |||||| ||||||||||||||
Sbjct: 263 tgggccttgacgacc-ttgtcgtcgaccctgatgctcctggtggcaaactcgaccccgat 205

                                         
Query: 647 ggtggacttggattcgaggcagaactcgtt 676
           |||||||||||| ||||||| |||||||||
Sbjct: 204 ggtggacttggactcgaggctgaactcgtt 175

---

>ref|XM_450547.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1200

 Score =  137 bits (69), Expect = 6e-29
 Identities = 148/173 (85%), Gaps = 1/173 (0%)
 Strand = Plus / Minus

                                                                       
Query: 521 actgctcctctataataggcactcgtaatagcacggtatctctcctggccagcggtgtcc 580
           ||||| |||| ||| || ||||| ||||| || || || ||||||||||| |||||||||
Sbjct: 382 actgcccctcgatagtatgcacttgtaatcgcccgatacctctcctggccggcggtgtcc 323

                                                                       
Query: 581 caaatctgggccttgacgacctttgccgtcgacctggaggctgcgggtggcgaactcgac 640
           || |||||||||||||||||||| | |||||||  ||| ||| | |||||||||||||||
Sbjct: 322 cagatctgggccttgacgacctt-gtcgtcgacgcggatgctcctggtggcgaactcgac 264

                                                                
Query: 641 cccgatggtggacttggattcgaggcagaactcgttcttggtgaagcgcgaga 693
            ||||||||||||||||| ||||||| |||||||||   ||||||||| ||||
Sbjct: 263 gccgatggtggacttggactcgaggctgaactcgttgcgggtgaagcgggaga 211

---

>gb|AC124143.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0053D02,
              complete sequence
          Length = 157106

 Score =  137 bits (69), Expect = 6e-29
 Identities = 97/105 (92%), Gaps = 1/105 (0%)
 Strand = Plus / Plus

                                                                          
Query: 572    gcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggctgcgggtggc 631
              ||||||||||| |||||||||||||||||||| | ||||||| |||| ||||||||||||
Sbjct: 104271 gcggtgtcccagatctgggccttgacgacctt-gtcgtcgacgtggatgctgcgggtggc 104329

                                                           
Query: 632    gaactcgaccccgatggtggacttggattcgaggcagaactcgtt 676
              ||||||||| ||||||||||||||||| ||||||| |||||||||
Sbjct: 104330 gaactcgacgccgatggtggacttggactcgaggctgaactcgtt 104374

---

>dbj|AK071461.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023092H24, full
           insert sequence
          Length = 1200

 Score =  137 bits (69), Expect = 6e-29
 Identities = 148/173 (85%), Gaps = 1/173 (0%)
 Strand = Plus / Minus

                                                                       
Query: 521 actgctcctctataataggcactcgtaatagcacggtatctctcctggccagcggtgtcc 580
           ||||| |||| ||| || ||||| ||||| || || || ||||||||||| |||||||||
Sbjct: 382 actgcccctcgatagtatgcacttgtaatcgcccgatacctctcctggccggcggtgtcc 323

                                                                       
Query: 581 caaatctgggccttgacgacctttgccgtcgacctggaggctgcgggtggcgaactcgac 640
           || |||||||||||||||||||| | |||||||  ||| ||| | |||||||||||||||
Sbjct: 322 cagatctgggccttgacgacctt-gtcgtcgacgcggatgctcctggtggcgaactcgac 264

                                                                
Query: 641 cccgatggtggacttggattcgaggcagaactcgttcttggtgaagcgcgaga 693
            ||||||||||||||||| ||||||| |||||||||   ||||||||| ||||
Sbjct: 263 gccgatggtggacttggactcgaggctgaactcgttgcgggtgaagcgggaga 211

---

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
               sequence
          Length = 22696651

 Score =  131 bits (66), Expect = 3e-27
 Identities = 118/134 (88%), Gaps = 1/134 (0%)
 Strand = Plus / Plus

                                                                           
Query: 560     ctctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggag 619
               ||||||||||| ||||||||||| |||||||||||||||||||| | |||||||  ||| 
Sbjct: 9592601 ctctcctggccggcggtgtcccagatctgggccttgacgacctt-gtcgtcgacgcggat 9592659

                                                                           
Query: 620     gctgcgggtggcgaactcgaccccgatggtggacttggattcgaggcagaactcgttctt 679
               ||| | ||||||||||||||| ||||||||||||||||| ||||||| |||||||||   
Sbjct: 9592660 gctcctggtggcgaactcgacgccgatggtggacttggactcgaggctgaactcgttgcg 9592719

                             
Query: 680     ggtgaagcgcgaga 693
               ||||||||| ||||
Sbjct: 9592720 ggtgaagcgggaga 9592733



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 101/120 (84%), Gaps = 1/120 (0%)
 Strand = Plus / Minus

                                                                            
Query: 566      tggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggctgcg 625
                ||||| ||||||||||| |||||||||||||||  ||| || || ||    |||| ||||
Sbjct: 20336875 tggccggcggtgtcccagatctgggccttgacgcgctt-gcggtggagggagagggtgcg 20336817

                                                                            
Query: 626      ggtggcgaactcgaccccgatggtggacttggattcgaggcagaactcgttcttggtgaa 685
                |||   ||||||||| ||||||||||||||||| |||||| ||||||||| |||||||||
Sbjct: 20336816 ggtctggaactcgacgccgatggtggacttggagtcgaggaagaactcgtccttggtgaa 20336757



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                                   
Query: 563     tcctggccagcggtgtcccaaatctgggccttgacg 598
               |||||||| ||||||||||| |||||||||||||||
Sbjct: 5968464 tcctggccggcggtgtcccagatctgggccttgacg 5968429

---

>dbj|AP005811.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0706E03
          Length = 188028

 Score =  131 bits (66), Expect = 3e-27
 Identities = 118/134 (88%), Gaps = 1/134 (0%)
 Strand = Plus / Plus

                                                                         
Query: 560   ctctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggag 619
             ||||||||||| ||||||||||| |||||||||||||||||||| | |||||||  ||| 
Sbjct: 32698 ctctcctggccggcggtgtcccagatctgggccttgacgacctt-gtcgtcgacgcggat 32756

                                                                         
Query: 620   gctgcgggtggcgaactcgaccccgatggtggacttggattcgaggcagaactcgttctt 679
             ||| | ||||||||||||||| ||||||||||||||||| ||||||| |||||||||   
Sbjct: 32757 gctcctggtggcgaactcgacgccgatggtggacttggactcgaggctgaactcgttgcg 32816

                           
Query: 680   ggtgaagcgcgaga 693
             ||||||||| ||||
Sbjct: 32817 ggtgaagcgggaga 32830

---

>dbj|D17779.1|RICSS23015 Oryza sativa SS230 mRNA for ras-related GTP-binding protein,
           partial sequence
          Length = 312

 Score =  121 bits (61), Expect = 3e-24
 Identities = 117/134 (87%), Gaps = 2/134 (1%)
 Strand = Plus / Minus

                                                                       
Query: 533 taataggcactcgtaatagcacggtatctctcctggccagcggtgtcccaaatctgggcc 592
           ||||| ||||| |||||||||||||||| | |||||    ||||||||||||||||||||
Sbjct: 309 taatatgcactagtaatagcacggtatcgcncctggangacggtgtcccaaatctgggcc 250

                                                                       
Query: 593 ttgacgacctttgccgtcgacctggaggctgc-gggtggcgaactcgaccccgatggtgg 651
           ||||||| ||| |||||||||||| |||  || ||||| |||||||||| ||||||||||
Sbjct: 249 ttgacganctt-gccgtcgacctgcagggagccgggtgacgaactcgacgccgatggtgg 191

                         
Query: 652 acttggattcgagg 665
           ||||||| ||||||
Sbjct: 190 acttggaatcgagg 177

---

>gb|AY690483.1| Triticum aestivum rab GTP-binding protein mRNA, complete cds
          Length = 1280

 Score =  117 bits (59), Expect = 5e-23
 Identities = 237/295 (80%), Gaps = 1/295 (0%)
 Strand = Plus / Minus

                                                                       
Query: 382 caagtggcgaaggtcagatttgttgccaactagcatgacaacaatgctagggtcagtatg 441
           ||||||||| |||||||  |||||||| ||||||||||  |||||| |||  || |||||
Sbjct: 641 caagtggcgcaggtcagccttgttgccgactagcatgatcacaatgttagcatcggtatg 582

                                                                       
Query: 442 atctcttagctcttttagccagcgcgccacattgtcgaatgtagccgggcgagtgacatc 501
            ||  | ||||| || ||||| | | ||||||| ||||| ||  |  |||| || |||||
Sbjct: 581 gtccttgagctccttcagccacctctccacattctcgaaggtcacatggcgtgtcacatc 522

                                                                       
Query: 502 atacaccagcaacgcacctactgctcctctataataggcactcgtaatagcacggtatct 561
           |||||| |  | |||||| || |||||||| ||||| || || ||||| ||||| |||||
Sbjct: 521 atacacaacaagcgcaccgacagctcctctgtaatatgcgcttgtaattgcacgatatct 462

                                                                       
Query: 562 ctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggc 621
           ||| |||||||| || ||||| ||||| |||||||||||| ||  ||||||||   | ||
Sbjct: 461 ctcttggccagccgtatcccagatctgcgccttgacgacc-ttatcgtcgaccctaatgc 403

                                                                  
Query: 622 tgcgggtggcgaactcgaccccgatggtggacttggattcgaggcagaactcgtt 676
           | | ||||||||||||||||||||| |||||||| || || |||| |||||||||
Sbjct: 402 tcctggtggcgaactcgaccccgattgtggactttgactccaggctgaactcgtt 348

---

>gb|AF532625.1| Glycine max GTP-binding protein mRNA, complete cds
          Length = 949

 Score =  115 bits (58), Expect = 2e-22
 Identities = 194/237 (81%), Gaps = 2/237 (0%)
 Strand = Plus / Minus

                                                                       
Query: 470 acattgtcgaatgtagccgggcgagtgacatcatacaccagcaacgcacctactgctcct 529
           ||||| || ||||| ||| ||||||||||||||||||| || |  ||||| ||||| || 
Sbjct: 399 acattttcaaatgttgcctggcgagtgacatcatacacgagaagtgcaccgactgcccca 340

                                                                       
Query: 530 ctataataggcactcgtaatagcacggtatctctcctggccagcggtgtcccaaatctgg 589
           | ||| || ||||| || || ||||| || || || ||||| ||||||||||| ||||||
Sbjct: 339 cgatagtatgcactggtgatggcacgatacctttcttggcctgcggtgtcccagatctgg 280

                                                                       
Query: 590 gccttgacgacctttgccgtcgacctggaggctgcgggtggcgaactcgaccccgatggt 649
           ||||||| ||| ||||   ||||| |  | | ||||||||||||||||||| || |||||
Sbjct: 279 gccttgatgac-tttggaatcgacgtccaaggtgcgggtggcgaactcgacgccaatggt 221

                                                                    
Query: 650 ggacttggattcgaggcagaactcgttcttggtgaagcgcgagangcaggttggact 706
           ||||||||| || | |  ||||||||||||||||||||| |||| | ||||||||||
Sbjct: 220 ggacttggactccaagttgaactcgttcttggtgaagcgagagagg-aggttggact 165



 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 317 gtttccatgaagtacagtgactccgcctcagcatattcctgcccatcttcagttgaaaca 376
           |||||||||||||| ||||| |||  |||||||||   || ||||||||||||||| || 
Sbjct: 552 gtttccatgaagtaaagtgattccttctcagcataggacttcccatcttcagttgacacg 493

                                                              
Query: 377 gccaccaagtggcgaaggtcagatttgttgccaactagcatgacaacaatg 427
           || || | ||| |||||||| ||||| || || || ||||| |||||||||
Sbjct: 492 gctacaaggtgacgaaggtctgatttattacccacgagcatcacaacaatg 442

---

>gb|BT023992.1| Zea mays clone EL01N0409D10 mRNA sequence
          Length = 1150

 Score =  111 bits (56), Expect = 3e-21
 Identities = 65/68 (95%)
 Strand = Plus / Minus

                                                                       
Query: 609 tcgacctggaggctgcgggtggcgaactcgaccccgatggtggacttggattcgaggcag 668
           |||||||||||| ||||||||||||||||||| ||||||||||||||||| |||||||||
Sbjct: 294 tcgacctggagggtgcgggtggcgaactcgacgccgatggtggacttggactcgaggcag 235

                   
Query: 669 aactcgtt 676
           ||||||||
Sbjct: 234 aactcgtt 227

---

>ref|XM_475070.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 663

 Score =  105 bits (53), Expect = 2e-19
 Identities = 93/105 (88%), Gaps = 1/105 (0%)
 Strand = Plus / Minus

                                                                       
Query: 572 gcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggctgcgggtggc 631
           ||||||||||| ||||| |||||||  | ||| ||| || || |||||| ||||||||||
Sbjct: 212 gcggtgtcccagatctgcgccttgattatctt-gccctccacatggagggtgcgggtggc 154

                                                        
Query: 632 gaactcgaccccgatggtggacttggattcgaggcagaactcgtt 676
           ||||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 153 gaactcgacgccgatggtggacttggactcgaggcagaactcgtt 109

---

>dbj|AK102713.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033104P17, full
           insert sequence
          Length = 874

 Score =  105 bits (53), Expect = 2e-19
 Identities = 93/105 (88%), Gaps = 1/105 (0%)
 Strand = Plus / Minus

                                                                       
Query: 572 gcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggctgcgggtggc 631
           ||||||||||| ||||| |||||||  | ||| ||| || || |||||| ||||||||||
Sbjct: 301 gcggtgtcccagatctgcgccttgattatctt-gccctccacatggagggtgcgggtggc 243

                                                        
Query: 632 gaactcgaccccgatggtggacttggattcgaggcagaactcgtt 676
           ||||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 242 gaactcgacgccgatggtggacttggactcgaggcagaactcgtt 198

---

>dbj|D31906.1|MZEMGP2 Maize mRNA for mgp2 GTP-binding protein, complete cds
          Length = 769

 Score =  105 bits (53), Expect = 2e-19
 Identities = 98/113 (86%)
 Strand = Plus / Minus

                                                                       
Query: 491 cgagtgacatcatacaccagcaacgcacctactgctcctctataataggcactcgtaata 550
           ||||| || ||||| |||||||| ||||| || ||||||| ||| ||||||||||| || 
Sbjct: 368 cgagtcacgtcataaaccagcaatgcaccaacagctcctcgatagtaggcactcgtgatt 309

                                                                
Query: 551 gcacggtatctctcctggccagcggtgtcccaaatctgggccttgacgacctt 603
           ||||| ||||| |||||||| ||||||||||||||||| ||||| ||||||||
Sbjct: 308 gcacgatatctttcctggccggcggtgtcccaaatctgagccttaacgacctt 256

---

>gb|AY110333.1| Zea mays CL8515_1 mRNA sequence
          Length = 1118

 Score =  103 bits (52), Expect = 8e-19
 Identities = 64/68 (94%)
 Strand = Plus / Plus

                                                                       
Query: 609 tcgacctggaggctgcgggtggcgaactcgaccccgatggtggacttggattcgaggcag 668
           |||| ||||||| ||||||||||||||||||| ||||||||||||||||| |||||||||
Sbjct: 831 tcgatctggagggtgcgggtggcgaactcgacgccgatggtggacttggactcgaggcag 890

                   
Query: 669 aactcgtt 676
           ||||||||
Sbjct: 891 aactcgtt 898

---

>gb|AF532626.1| Glycine max small GTP-binding protein mRNA, complete cds
          Length = 1263

 Score =  101 bits (51), Expect = 3e-18
 Identities = 156/191 (81%)
 Strand = Plus / Minus

                                                                       
Query: 413 agcatgacaacaatgctagggtcagtatgatctcttagctcttttagccagcgcgccaca 472
           |||||||| |||||| | ||||| || |||||||| | |||||| | ||| |  ||  ||
Sbjct: 498 agcatgaccacaatgttggggtctgtgtgatctctcaactctttcaaccatcttgcagca 439

                                                                       
Query: 473 ttgtcgaatgtagccgggcgagtgacatcatacaccagcaacgcacctactgctcctcta 532
           || || ||||||||  |||| ||||||||||| || || || ||||| || |||||||  
Sbjct: 438 ttctcaaatgtagcacggcgtgtgacatcatagacaagtaaggcaccaacagctcctcgg 379

                                                                       
Query: 533 taataggcactcgtaatagcacggtatctctcctggccagcggtgtcccaaatctgggcc 592
           || || ||||| ||||| |||||||| || |||||||||||||||||||||||||| |||
Sbjct: 378 tagtaagcactagtaatggcacggtacctttcctggccagcggtgtcccaaatctgagcc 319

                      
Query: 593 ttgacgacctt 603
           |||| ||||||
Sbjct: 318 ttgatgacctt 308



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 70/81 (86%), Gaps = 1/81 (1%)
 Strand = Plus / Minus

                                                                       
Query: 626 ggtggcgaactcgaccccgatggtggacttggattcgaggcagaactcgttcttggtgaa 685
           |||||||||||| ||||| |||||||||||||| || |    |||||||||| |||||||
Sbjct: 286 ggtggcgaactcaacccctatggtggacttggactccaaattgaactcgttcctggtgaa 227

                                
Query: 686 gcgcgagangcaggttggact 706
           |||||| | ||||||||||||
Sbjct: 226 gcgcga-aagcaggttggact 207



 Score = 44.1 bits (22), Expect = 0.62
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 305 tctaatgcagatgtttccatgaagta 330
           ||||||||||| ||||||||||||||
Sbjct: 606 tctaatgcagaagtttccatgaagta 581

---

>gb|AC104285.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBb0035J08, complete sequence
          Length = 117555

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 59/62 (95%)
 Strand = Plus / Minus

                                                                         
Query: 615   tggaggctgcgggtggcgaactcgaccccgatggtggacttggattcgaggcagaactcg 674
             |||||| ||||||||||||||||||| ||||||||||||||||| |||||||||||||||
Sbjct: 29423 tggagggtgcgggtggcgaactcgacgccgatggtggacttggactcgaggcagaactcg 29364

               
Query: 675   tt 676
             ||
Sbjct: 29363 tt 29362

---

>gb|AC084818.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0668H12,
              complete sequence
          Length = 160603

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 59/62 (95%)
 Strand = Plus / Minus

                                                                          
Query: 615    tggaggctgcgggtggcgaactcgaccccgatggtggacttggattcgaggcagaactcg 674
              |||||| ||||||||||||||||||| ||||||||||||||||| |||||||||||||||
Sbjct: 136087 tggagggtgcgggtggcgaactcgacgccgatggtggacttggactcgaggcagaactcg 136028

                
Query: 675    tt 676
              ||
Sbjct: 136027 tt 136026

---

>ref|NM_190607.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 651

 Score = 97.6 bits (49), Expect = 5e-17
 Identities = 134/161 (83%), Gaps = 1/161 (0%)
 Strand = Plus / Minus

                                                                       
Query: 533 taataggcactcgtaatagcacggtatctctcctggccagcggtgtcccaaatctgggcc 592
           ||||| |||||||| || |||||||||||||| || || || |||||||| ||||| |||
Sbjct: 245 taataagcactcgtgattgcacggtatctctcttgacctgccgtgtcccatatctgagcc 186

                                                                       
Query: 593 ttgacgacctttgccgtcgacctggaggctgcgggtggcgaactcgaccccgatggtgga 652
           ||||    |||  || || | ||| ||| ||||||||||||||||||| |||||||||||
Sbjct: 185 ttgatagtcttc-ccttctatctgcagggtgcgggtggcgaactcgacgccgatggtgga 127

                                                    
Query: 653 cttggattcgaggcagaactcgttcttggtgaagcgcgaga 693
           |||||| |||||| ||||||||||   ||||||||| ||||
Sbjct: 126 cttggactcgaggaagaactcgttgcgggtgaagcgggaga 86

---

>dbj|AK071303.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023087L18, full
           insert sequence
          Length = 1131

 Score = 97.6 bits (49), Expect = 5e-17
 Identities = 134/161 (83%), Gaps = 1/161 (0%)
 Strand = Plus / Minus

                                                                       
Query: 533 taataggcactcgtaatagcacggtatctctcctggccagcggtgtcccaaatctgggcc 592
           ||||| |||||||| || |||||||||||||| || || || |||||||| ||||| |||
Sbjct: 427 taataagcactcgtgattgcacggtatctctcttgacctgccgtgtcccatatctgagcc 368

                                                                       
Query: 593 ttgacgacctttgccgtcgacctggaggctgcgggtggcgaactcgaccccgatggtgga 652
           ||||    |||  || || | ||| ||| ||||||||||||||||||| |||||||||||
Sbjct: 367 ttgatagtcttc-ccttctatctgcagggtgcgggtggcgaactcgacgccgatggtgga 309

                                                    
Query: 653 cttggattcgaggcagaactcgttcttggtgaagcgcgaga 693
           |||||| |||||| ||||||||||   ||||||||| ||||
Sbjct: 308 cttggactcgaggaagaactcgttgcgggtgaagcgggaga 268

---

>ref|NM_112368.2| Arabidopsis thaliana GTP binding AT3G15060 mRNA, complete cds
          Length = 886

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 148/180 (82%), Gaps = 1/180 (0%)
 Strand = Plus / Minus

                                                                       
Query: 497 acatcatacaccagcaacgcacctactgctcctctataataggcactcgtaatagcacgg 556
           |||||||| || ||||| || || || ||||||| ||| || || || || || || |||
Sbjct: 341 acatcataaacaagcaaagccccaacagctcctcgatagtatgcgcttgtgattgctcgg 282

                                                                       
Query: 557 tatctctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctg 616
           |||||||| ||||| ||||||||||||||||| ||||||||||  |||  | ||||| ||
Sbjct: 281 tatctctcttggccggcggtgtcccaaatctgagccttgacga-ttttttcatcgacatg 223

                                                                       
Query: 617 gaggctgcgggtggcgaactcgaccccgatggtggacttggattcgaggcagaactcgtt 676
            | ||| ||||||||||| ||||| ||||||||||| || || ||||||| |||||||||
Sbjct: 222 aatgcttcgggtggcgaattcgacaccgatggtggatttagactcgaggctgaactcgtt 163

---

>gb|BT005565.1| Arabidopsis thaliana clone U51331 putative Ras family GTP-binding
           protein (At3g15060) mRNA, complete cds
          Length = 685

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 148/180 (82%), Gaps = 1/180 (0%)
 Strand = Plus / Minus

                                                                       
Query: 497 acatcatacaccagcaacgcacctactgctcctctataataggcactcgtaatagcacgg 556
           |||||||| || ||||| || || || ||||||| ||| || || || || || || |||
Sbjct: 284 acatcataaacaagcaaagccccaacagctcctcgatagtatgcgcttgtgattgctcgg 225

                                                                       
Query: 557 tatctctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctg 616
           |||||||| ||||| ||||||||||||||||| ||||||||||  |||  | ||||| ||
Sbjct: 224 tatctctcttggccggcggtgtcccaaatctgagccttgacga-ttttttcatcgacatg 166

                                                                       
Query: 617 gaggctgcgggtggcgaactcgaccccgatggtggacttggattcgaggcagaactcgtt 676
            | ||| ||||||||||| ||||| ||||||||||| || || ||||||| |||||||||
Sbjct: 165 aatgcttcgggtggcgaattcgacaccgatggtggatttagactcgaggctgaactcgtt 106

---

>dbj|AK118727.1| Arabidopsis thaliana At3g15060 mRNA for putative ras-related
           GTP-binding protein, complete cds, clone: RAFL21-06-O17
          Length = 867

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 148/180 (82%), Gaps = 1/180 (0%)
 Strand = Plus / Minus

                                                                       
Query: 497 acatcatacaccagcaacgcacctactgctcctctataataggcactcgtaatagcacgg 556
           |||||||| || ||||| || || || ||||||| ||| || || || || || || |||
Sbjct: 341 acatcataaacaagcaaagccccaacagctcctcgatagtatgcgcttgtgattgctcgg 282

                                                                       
Query: 557 tatctctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctg 616
           |||||||| ||||| ||||||||||||||||| ||||||||||  |||  | ||||| ||
Sbjct: 281 tatctctcttggccggcggtgtcccaaatctgagccttgacga-ttttttcatcgacatg 223

                                                                       
Query: 617 gaggctgcgggtggcgaactcgaccccgatggtggacttggattcgaggcagaactcgtt 676
            | ||| ||||||||||| ||||| ||||||||||| || || ||||||| |||||||||
Sbjct: 222 aatgcttcgggtggcgaattcgacaccgatggtggatttagactcgaggctgaactcgtt 163

---

>ref|NM_125479.2| Arabidopsis thaliana GTP binding AT5G60860 mRNA, complete cds
          Length = 915

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 150/183 (81%), Gaps = 1/183 (0%)
 Strand = Plus / Minus

                                                                       
Query: 494 gtgacatcatacaccagcaacgcacctactgctcctctataataggcactcgtaatagca 553
           |||||||| ||||| |||||||| ||||| |||||||| ||||| ||||| || || || 
Sbjct: 408 gtgacatcgtacacaagcaacgctcctacagctcctctgtaatatgcacttgtgattgct 349

                                                                       
Query: 554 cggtatctctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgac 613
           || ||||| || ||||||||||| ||||||||||| || ||||||| | ||  | |||||
Sbjct: 348 cgatatctttcttggccagcggtatcccaaatctgagctttgacgatc-ttatcatcgac 290

                                                                       
Query: 614 ctggaggctgcgggtggcgaactcgaccccgatggtggacttggattcgaggcagaactc 673
            |||| ||| || |||||||| || || ||||| ||||| || |||||||| | ||||||
Sbjct: 289 atggatgctacgagtggcgaattctacaccgatcgtggatttagattcgagactgaactc 230

              
Query: 674 gtt 676
           |||
Sbjct: 229 gtt 227

---

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 74/83 (89%)
 Strand = Plus / Plus

                                                                            
Query: 611      gacctggaggctgcgggtggcgaactcgaccccgatggtggacttggattcgaggcagaa 670
                |||||||||  ||||||||||||||||||| || |||||||||||||| |||||||||||
Sbjct: 34292147 gacctggagcgtgcgggtggcgaactcgacgccaatggtggacttggactcgaggcagaa 34292206

                                       
Query: 671      ctcgttcttggtgaagcgcgaga 693
                ||||||   |||||| |||||||
Sbjct: 34292207 ctcgttgcgggtgaatcgcgaga 34292229



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 55/60 (91%)
 Strand = Plus / Plus

                                                                            
Query: 611      gacctggaggctgcgggtggcgaactcgaccccgatggtggacttggattcgaggcagaa 670
                |||||||| | ||||||||||||||||||| ||||||||||||||||| |||||| ||||
Sbjct: 35130330 gacctggatggtgcgggtggcgaactcgacgccgatggtggacttggagtcgagggagaa 35130389

---

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 74/83 (89%)
 Strand = Plus / Plus

                                                                            
Query: 611      gacctggaggctgcgggtggcgaactcgaccccgatggtggacttggattcgaggcagaa 670
                |||||||||  ||||||||||||||||||| || |||||||||||||| |||||||||||
Sbjct: 34382619 gacctggagcgtgcgggtggcgaactcgacgccaatggtggacttggactcgaggcagaa 34382678

                                       
Query: 671      ctcgttcttggtgaagcgcgaga 693
                ||||||   |||||| |||||||
Sbjct: 34382679 ctcgttgcgggtgaatcgcgaga 34382701



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 55/60 (91%)
 Strand = Plus / Plus

                                                                            
Query: 611      gacctggaggctgcgggtggcgaactcgaccccgatggtggacttggattcgaggcagaa 670
                |||||||| | ||||||||||||||||||| ||||||||||||||||| |||||| ||||
Sbjct: 35220402 gacctggatggtgcgggtggcgaactcgacgccgatggtggacttggagtcgagggagaa 35220461

---

>gb|BT005238.1| Arabidopsis thaliana At5g60860 mRNA, complete cds
          Length = 654

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 150/183 (81%), Gaps = 1/183 (0%)
 Strand = Plus / Minus

                                                                       
Query: 494 gtgacatcatacaccagcaacgcacctactgctcctctataataggcactcgtaatagca 553
           |||||||| ||||| |||||||| ||||| |||||||| ||||| ||||| || || || 
Sbjct: 287 gtgacatcgtacacaagcaacgctcctacagctcctctgtaatatgcacttgtgattgct 228

                                                                       
Query: 554 cggtatctctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgac 613
           || ||||| || ||||||||||| ||||||||||| || ||||||| | ||  | |||||
Sbjct: 227 cgatatctttcttggccagcggtatcccaaatctgagctttgacgatc-ttatcatcgac 169

                                                                       
Query: 614 ctggaggctgcgggtggcgaactcgaccccgatggtggacttggattcgaggcagaactc 673
            |||| ||| || |||||||| || || ||||| ||||| || |||||||| | ||||||
Sbjct: 168 atggatgctacgagtggcgaattctacaccgatcgtggatttagattcgagactgaactc 109

              
Query: 674 gtt 676
           |||
Sbjct: 108 gtt 106

---

>gb|AC093018.4| Oryza sativa chromosome 3 BAC OSJNBb0081B07 genomic sequence, complete
             sequence
          Length = 143205

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 74/83 (89%)
 Strand = Plus / Minus

                                                                         
Query: 611   gacctggaggctgcgggtggcgaactcgaccccgatggtggacttggattcgaggcagaa 670
             |||||||||  ||||||||||||||||||| || |||||||||||||| |||||||||||
Sbjct: 42851 gacctggagcgtgcgggtggcgaactcgacgccaatggtggacttggactcgaggcagaa 42792

                                    
Query: 671   ctcgttcttggtgaagcgcgaga 693
             ||||||   |||||| |||||||
Sbjct: 42791 ctcgttgcgggtgaatcgcgaga 42769

---

>dbj|AK118670.1| Arabidopsis thaliana At5g60860 mRNA for putative GTP-binding
           protein, complete cds, clone: RAFL19-94-D08
          Length = 915

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 150/183 (81%), Gaps = 1/183 (0%)
 Strand = Plus / Minus

                                                                       
Query: 494 gtgacatcatacaccagcaacgcacctactgctcctctataataggcactcgtaatagca 553
           |||||||| ||||| |||||||| ||||| |||||||| ||||| ||||| || || || 
Sbjct: 408 gtgacatcgtacacaagcaacgctcctacagctcctctgtaatatgcacttgtgattgct 349

                                                                       
Query: 554 cggtatctctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgac 613
           || ||||| || ||||||||||| ||||||||||| || ||||||| | ||  | |||||
Sbjct: 348 cgatatctttcttggccagcggtatcccaaatctgagctttgacgatc-ttatcatcgac 290

                                                                       
Query: 614 ctggaggctgcgggtggcgaactcgaccccgatggtggacttggattcgaggcagaactc 673
            |||| ||| || |||||||| || || ||||| ||||| || |||||||| | ||||||
Sbjct: 289 atggatgctacgagtggcgaattctacaccgatcgtggatttagattcgagactgaactc 230

              
Query: 674 gtt 676
           |||
Sbjct: 229 gtt 227

---

>dbj|AK067508.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013110L21, full
           insert sequence
          Length = 3009

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 74/83 (89%)
 Strand = Plus / Minus

                                                                       
Query: 611 gacctggaggctgcgggtggcgaactcgaccccgatggtggacttggattcgaggcagaa 670
           |||||||||  ||||||||||||||||||| || |||||||||||||| |||||||||||
Sbjct: 303 gacctggagcgtgcgggtggcgaactcgacgccaatggtggacttggactcgaggcagaa 244

                                  
Query: 671 ctcgttcttggtgaagcgcgaga 693
           ||||||   |||||| |||||||
Sbjct: 243 ctcgttgcgggtgaatcgcgaga 221

---

>dbj|AP004127.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1,
              clone:P0005H10
          Length = 142885

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 73/82 (89%)
 Strand = Plus / Plus

                                                                          
Query: 612    acctggaggctgcgggtggcgaactcgaccccgatggtggacttggattcgaggcagaac 671
              ||||| ||| ||||||||||||||||||| ||||||||||||||||| |||||| |||||
Sbjct: 115192 acctgcagggtgcgggtggcgaactcgacgccgatggtggacttggactcgaggaagaac 115251

                                    
Query: 672    tcgttcttggtgaagcgcgaga 693
              |||||   ||||||||| ||||
Sbjct: 115252 tcgttgcgggtgaagcgggaga 115273



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                          
Query: 533    taataggcactcgtaatagcacggtatctctcctggccagcggtgtcccaaatctgggcc 592
              ||||| |||||||| || |||||||||||||| || || || |||||||| ||||| |||
Sbjct: 113721 taataagcactcgtgattgcacggtatctctcttgacctgccgtgtcccatatctgagcc 113780

                  
Query: 593    ttga 596
              ||||
Sbjct: 113781 ttga 113784

---

>gb|AY111070.1| Zea mays CL9832_1 mRNA sequence
          Length = 987

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 122/145 (84%), Gaps = 2/145 (1%)
 Strand = Plus / Plus

                                                                       
Query: 562 ctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggc 621
           ||||||||| || |||||||| ||||| ||||||| || ||| ||| || || |||||  
Sbjct: 596 ctcctggcctgccgtgtcccagatctgcgccttgatgatctt-gccctcaacatggagtg 654

                                                                       
Query: 622 tgcgggtggcgaactcgaccccgatggtggacttggattcgaggcagaactcgttcttgg 681
           | || |||||||| ||||| ||||||||||||||||| |||||||||||||||||   ||
Sbjct: 655 tccgtgtggcgaattcgacgccgatggtggacttggactcgaggcagaactcgttgcggg 714

                                    
Query: 682 tgaagcgcgagangcaggttggact 706
           ||||||| |||| | ||||||||||
Sbjct: 715 tgaagcgggagagg-aggttggact 738

---

>ref|XM_524087.1| PREDICTED: Pan troglodytes similar to RAB11B, member RAS oncogene
            family (LOC468700), mRNA
          Length = 2202

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 79/89 (88%), Gaps = 1/89 (1%)
 Strand = Plus / Minus

                                                                        
Query: 562  ctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggc 621
            ||||||||||||||||||||| ||||| ||||||| |  ||| |||||| ||||||| ||
Sbjct: 1368 ctcctggccagcggtgtcccagatctgcgccttgatggtctt-gccgtccacctggatgc 1310

                                         
Query: 622  tgcgggtggcgaactcgaccccgatggtg 650
            |||||||||||||||| || |||||||||
Sbjct: 1309 tgcgggtggcgaactccacgccgatggtg 1281

---

>gb|BT019535.1| Homo sapiens RAB11B, member RAS oncogene family mRNA, complete cds
          Length = 657

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 79/89 (88%), Gaps = 1/89 (1%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggc 621
           ||||||||||||||||||||| ||||| ||||||| |  ||| |||||| ||||||| ||
Sbjct: 213 ctcctggccagcggtgtcccagatctgcgccttgatggtctt-gccgtccacctggatgc 155

                                        
Query: 622 tgcgggtggcgaactcgaccccgatggtg 650
           |||||||||||||||| || |||||||||
Sbjct: 154 tgcgggtggcgaactccacgccgatggtg 126

---

>emb|X79780.1|HSYPT31 H.sapiens YPT3 mRNA
          Length = 701

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 79/89 (88%), Gaps = 1/89 (1%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggc 621
           ||||||||||||||||||||| ||||| ||||||| |  ||| |||||| ||||||| ||
Sbjct: 219 ctcctggccagcggtgtcccagatctgcgccttgatggtctt-gccgtccacctggatgc 161

                                        
Query: 622 tgcgggtggcgaactcgaccccgatggtg 650
           |||||||||||||||| || |||||||||
Sbjct: 160 tgcgggtggcgaactccacgccgatggtg 132

---

>emb|BX647356.1|HSM807500 Homo sapiens mRNA; cDNA DKFZp686E23256 (from clone DKFZp686E23256)
          Length = 4328

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 79/89 (88%), Gaps = 1/89 (1%)
 Strand = Plus / Minus

                                                                        
Query: 562  ctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggc 621
            ||||||||||||||||||||| ||||| ||||||| |  ||| |||||| ||||||| ||
Sbjct: 2311 ctcctggccagcggtgtcccagatctgcgccttgatggtctt-gccgtccacctggatgc 2253

                                         
Query: 622  tgcgggtggcgaactcgaccccgatggtg 650
            |||||||||||||||| || |||||||||
Sbjct: 2252 tgcgggtggcgaactccacgccgatggtg 2224

---

>emb|CR626645.1| full-length cDNA clone CS0DF009YF12 of Fetal brain of Homo sapiens
           (human)
          Length = 1568

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 79/89 (88%), Gaps = 1/89 (1%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggc 621
           ||||||||||||||||||||| ||||| ||||||| |  ||| |||||| ||||||| ||
Sbjct: 285 ctcctggccagcggtgtcccagatctgcgccttgatggtctt-gccgtccacctggatgc 227

                                        
Query: 622 tgcgggtggcgaactcgaccccgatggtg 650
           |||||||||||||||| || |||||||||
Sbjct: 226 tgcgggtggcgaactccacgccgatggtg 198

---

>emb|CR626143.1| full-length cDNA clone CS0DC025YN21 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 1513

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 79/89 (88%), Gaps = 1/89 (1%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggc 621
           ||||||||||||||||||||| ||||| ||||||| |  ||| |||||| ||||||| ||
Sbjct: 230 ctcctggccagcggtgtcccagatctgcgccttgatggtctt-gccgtccacctggatgc 172

                                        
Query: 622 tgcgggtggcgaactcgaccccgatggtg 650
           |||||||||||||||| || |||||||||
Sbjct: 171 tgcgggtggcgaactccacgccgatggtg 143

---

>emb|CR625102.1| full-length cDNA clone CS0DI043YG14 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1516

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 79/89 (88%), Gaps = 1/89 (1%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggc 621
           ||||||||||||||||||||| ||||| ||||||| |  ||| |||||| ||||||| ||
Sbjct: 258 ctcctggccagcggtgtcccagatctgcgccttgatggtctt-gccgtccacctggatgc 200

                                        
Query: 622 tgcgggtggcgaactcgaccccgatggtg 650
           |||||||||||||||| || |||||||||
Sbjct: 199 tgcgggtggcgaactccacgccgatggtg 171

---

>emb|CR624386.1| full-length cDNA clone CS0DI036YM17 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1432

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 79/89 (88%), Gaps = 1/89 (1%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggc 621
           ||||||||||||||||||||| ||||| ||||||| |  ||| |||||| ||||||| ||
Sbjct: 253 ctcctggccagcggtgtcccagatctgcgccttgatggtctt-gccgtccacctggatgc 195

                                        
Query: 622 tgcgggtggcgaactcgaccccgatggtg 650
           |||||||||||||||| || |||||||||
Sbjct: 194 tgcgggtggcgaactccacgccgatggtg 166

---

>emb|CR621845.1| full-length cDNA clone CS0DM009YH13 of Fetal liver of Homo sapiens
           (human)
          Length = 1520

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 79/89 (88%), Gaps = 1/89 (1%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggc 621
           ||||||||||||||||||||| ||||| ||||||| |  ||| |||||| ||||||| ||
Sbjct: 268 ctcctggccagcggtgtcccagatctgcgccttgatggtctt-gccgtccacctggatgc 210

                                        
Query: 622 tgcgggtggcgaactcgaccccgatggtg 650
           |||||||||||||||| || |||||||||
Sbjct: 209 tgcgggtggcgaactccacgccgatggtg 181

---

>emb|CR620665.1| full-length cDNA clone CS0DI043YL09 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1489

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 79/89 (88%), Gaps = 1/89 (1%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggc 621
           ||||||||||||||||||||| ||||| ||||||| |  ||| |||||| ||||||| ||
Sbjct: 286 ctcctggccagcggtgtcccagatctgcgccttgatggtctt-gccgtccacctggatgc 228

                                        
Query: 622 tgcgggtggcgaactcgaccccgatggtg 650
           |||||||||||||||| || |||||||||
Sbjct: 227 tgcgggtggcgaactccacgccgatggtg 199

---

>emb|CR618667.1| full-length cDNA clone CS0DF019YH19 of Fetal brain of Homo sapiens
           (human)
          Length = 1509

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 79/89 (88%), Gaps = 1/89 (1%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggc 621
           ||||||||||||||||||||| ||||| ||||||| |  ||| |||||| ||||||| ||
Sbjct: 250 ctcctggccagcggtgtcccagatctgcgccttgatggtctt-gccgtccacctggatgc 192

                                        
Query: 622 tgcgggtggcgaactcgaccccgatggtg 650
           |||||||||||||||| || |||||||||
Sbjct: 191 tgcgggtggcgaactccacgccgatggtg 163

---

>emb|CR618647.1| full-length cDNA clone CS0DB001YO22 of Neuroblastoma Cot
           10-normalized of Homo sapiens (human)
          Length = 1522

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 79/89 (88%), Gaps = 1/89 (1%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggc 621
           ||||||||||||||||||||| ||||| ||||||| |  ||| |||||| ||||||| ||
Sbjct: 213 ctcctggccagcggtgtcccagatctgcgccttgatggtctt-gccgtccacctggatgc 155

                                        
Query: 622 tgcgggtggcgaactcgaccccgatggtg 650
           |||||||||||||||| || |||||||||
Sbjct: 154 tgcgggtggcgaactccacgccgatggtg 126

---

>emb|CR613277.1| full-length cDNA clone CS0DC001YK14 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 1458

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 79/89 (88%), Gaps = 1/89 (1%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggc 621
           ||||||||||||||||||||| ||||| ||||||| |  ||| |||||| ||||||| ||
Sbjct: 173 ctcctggccagcggtgtcccagatctgcgccttgatggtctt-gccgtccacctggatgc 115

                                        
Query: 622 tgcgggtggcgaactcgaccccgatggtg 650
           |||||||||||||||| || |||||||||
Sbjct: 114 tgcgggtggcgaactccacgccgatggtg 86

---

>emb|CR613165.1| full-length cDNA clone CS0DF009YE08 of Fetal brain of Homo sapiens
           (human)
          Length = 1444

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 79/89 (88%), Gaps = 1/89 (1%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggc 621
           ||||||||||||||||||||| ||||| ||||||| |  ||| |||||| ||||||| ||
Sbjct: 246 ctcctggccagcggtgtcccagatctgcgccttgatggtctt-gccgtccacctggatgc 188

                                        
Query: 622 tgcgggtggcgaactcgaccccgatggtg 650
           |||||||||||||||| || |||||||||
Sbjct: 187 tgcgggtggcgaactccacgccgatggtg 159

---

>emb|CR609776.1| full-length cDNA clone CS0DI016YA05 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1108

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 79/89 (88%), Gaps = 1/89 (1%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggc 621
           ||||||||||||||||||||| ||||| ||||||| |  ||| |||||| ||||||| ||
Sbjct: 218 ctcctggccagcggtgtcccagatctgcgccttgatggtctt-gccgtccacctggatgc 160

                                        
Query: 622 tgcgggtggcgaactcgaccccgatggtg 650
           |||||||||||||||| || |||||||||
Sbjct: 159 tgcgggtggcgaactccacgccgatggtg 131

---

>emb|CR606883.1| full-length cDNA clone CS0DC005YE07 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 1535

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 79/89 (88%), Gaps = 1/89 (1%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggc 621
           ||||||||||||||||||||| ||||| ||||||| |  ||| |||||| ||||||| ||
Sbjct: 230 ctcctggccagcggtgtcccagatctgcgccttgatggtctt-gccgtccacctggatgc 172

                                        
Query: 622 tgcgggtggcgaactcgaccccgatggtg 650
           |||||||||||||||| || |||||||||
Sbjct: 171 tgcgggtggcgaactccacgccgatggtg 143

---

>emb|CR606224.1| full-length cDNA clone CS0DI084YB14 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1462

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 79/89 (88%), Gaps = 1/89 (1%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggc 621
           ||||||||||||||||||||| ||||| ||||||| |  ||| |||||| ||||||| ||
Sbjct: 284 ctcctggccagcggtgtcccagatctgcgccttgatggtctt-gccgtccacctggatgc 226

                                        
Query: 622 tgcgggtggcgaactcgaccccgatggtg 650
           |||||||||||||||| || |||||||||
Sbjct: 225 tgcgggtggcgaactccacgccgatggtg 197

---

>emb|CR605393.1| full-length cDNA clone CS0DI061YI16 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1581

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 79/89 (88%), Gaps = 1/89 (1%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggc 621
           ||||||||||||||||||||| ||||| ||||||| |  ||| |||||| ||||||| ||
Sbjct: 295 ctcctggccagcggtgtcccagatctgcgccttgatggtctt-gccgtccacctggatgc 237

                                        
Query: 622 tgcgggtggcgaactcgaccccgatggtg 650
           |||||||||||||||| || |||||||||
Sbjct: 236 tgcgggtggcgaactccacgccgatggtg 208

---

>emb|CR600800.1| full-length cDNA clone CS0DI019YH19 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1444

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 79/89 (88%), Gaps = 1/89 (1%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggc 621
           ||||||||||||||||||||| ||||| ||||||| |  ||| |||||| ||||||| ||
Sbjct: 203 ctcctggccagcggtgtcccagatctgcgccttgatggtctt-gccgtccacctggatgc 145

                                        
Query: 622 tgcgggtggcgaactcgaccccgatggtg 650
           |||||||||||||||| || |||||||||
Sbjct: 144 tgcgggtggcgaactccacgccgatggtg 116

---

>emb|CR600179.1| full-length cDNA clone CS0DI018YH16 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1378

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 79/89 (88%), Gaps = 1/89 (1%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggc 621
           ||||||||||||||||||||| ||||| ||||||| |  ||| |||||| ||||||| ||
Sbjct: 250 ctcctggccagcggtgtcccagatctgcgccttgatggtctt-gccgtccacctggatgc 192

                                        
Query: 622 tgcgggtggcgaactcgaccccgatggtg 650
           |||||||||||||||| || |||||||||
Sbjct: 191 tgcgggtggcgaactccacgccgatggtg 163

---

>emb|CR597131.1| full-length cDNA clone CS0DH001YC15 of T cells (Jurkat cell line)
           of Homo sapiens (human)
          Length = 1346

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 79/89 (88%), Gaps = 1/89 (1%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggc 621
           ||||||||||||||||||||| ||||| ||||||| |  ||| |||||| ||||||| ||
Sbjct: 237 ctcctggccagcggtgtcccagatctgcgccttgatggtctt-gccgtccacctggatgc 179

                                        
Query: 622 tgcgggtggcgaactcgaccccgatggtg 650
           |||||||||||||||| || |||||||||
Sbjct: 178 tgcgggtggcgaactccacgccgatggtg 150

---

>emb|CR596517.1| full-length cDNA clone CS0DN003YC06 of Adult brain of Homo sapiens
           (human)
          Length = 1480

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 79/89 (88%), Gaps = 1/89 (1%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggc 621
           ||||||||||||||||||||| ||||| ||||||| |  ||| |||||| ||||||| ||
Sbjct: 175 ctcctggccagcggtgtcccagatctgcgccttgatggtctt-gccgtccacctggatgc 117

                                        
Query: 622 tgcgggtggcgaactcgaccccgatggtg 650
           |||||||||||||||| || |||||||||
Sbjct: 116 tgcgggtggcgaactccacgccgatggtg 88

---

>emb|CR594452.1| full-length cDNA clone CS0CAP008YH11 of Thymus of Homo sapiens
           (human)
          Length = 1378

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 79/89 (88%), Gaps = 1/89 (1%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggc 621
           ||||||||||||||||||||| ||||| ||||||| |  ||| |||||| ||||||| ||
Sbjct: 257 ctcctggccagcggtgtcccagatctgcgccttgatggtctt-gccgtccacctggatgc 199

                                        
Query: 622 tgcgggtggcgaactcgaccccgatggtg 650
           |||||||||||||||| || |||||||||
Sbjct: 198 tgcgggtggcgaactccacgccgatggtg 170

---

>emb|CR593439.1| full-length cDNA clone CS0DF030YO19 of Fetal brain of Homo sapiens
           (human)
          Length = 1502

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 79/89 (88%), Gaps = 1/89 (1%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggc 621
           ||||||||||||||||||||| ||||| ||||||| |  ||| |||||| ||||||| ||
Sbjct: 206 ctcctggccagcggtgtcccagatctgcgccttgatggtctt-gccgtccacctggatgc 148

                                        
Query: 622 tgcgggtggcgaactcgaccccgatggtg 650
           |||||||||||||||| || |||||||||
Sbjct: 147 tgcgggtggcgaactccacgccgatggtg 119

---

>emb|CR593189.1| full-length cDNA clone CL0BA003ZE06 of Placenta of Homo sapiens
           (human)
          Length = 1530

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 79/89 (88%), Gaps = 1/89 (1%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggc 621
           ||||||||||||||||||||| ||||| ||||||| |  ||| |||||| ||||||| ||
Sbjct: 210 ctcctggccagcggtgtcccagatctgcgccttgatggtctt-gccgtccacctggatgc 152

                                        
Query: 622 tgcgggtggcgaactcgaccccgatggtg 650
           |||||||||||||||| || |||||||||
Sbjct: 151 tgcgggtggcgaactccacgccgatggtg 123

---

>emb|CR592281.1| full-length cDNA clone CS0DF006YF01 of Fetal brain of Homo sapiens
           (human)
          Length = 1596

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 79/89 (88%), Gaps = 1/89 (1%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggc 621
           ||||||||||||||||||||| ||||| ||||||| |  ||| |||||| ||||||| ||
Sbjct: 285 ctcctggccagcggtgtcccagatctgcgccttgatggtctt-gccgtccacctggatgc 227

                                        
Query: 622 tgcgggtggcgaactcgaccccgatggtg 650
           |||||||||||||||| || |||||||||
Sbjct: 226 tgcgggtggcgaactccacgccgatggtg 198

---

>emb|CR592057.1| full-length cDNA clone CS0DC023YD19 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 1390

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 79/89 (88%), Gaps = 1/89 (1%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggc 621
           ||||||||||||||||||||| ||||| ||||||| |  ||| |||||| ||||||| ||
Sbjct: 285 ctcctggccagcggtgtcccagatctgcgccttgatggtctt-gccgtccacctggatgc 227

                                        
Query: 622 tgcgggtggcgaactcgaccccgatggtg 650
           |||||||||||||||| || |||||||||
Sbjct: 226 tgcgggtggcgaactccacgccgatggtg 198

---

>emb|CR590650.1| full-length cDNA clone CS0DA005YP15 of Neuroblastoma of Homo
           sapiens (human)
          Length = 1525

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 79/89 (88%), Gaps = 1/89 (1%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggc 621
           ||||||||||||||||||||| ||||| ||||||| |  ||| |||||| ||||||| ||
Sbjct: 254 ctcctggccagcggtgtcccagatctgcgccttgatggtctt-gccgtccacctggatgc 196

                                        
Query: 622 tgcgggtggcgaactcgaccccgatggtg 650
           |||||||||||||||| || |||||||||
Sbjct: 195 tgcgggtggcgaactccacgccgatggtg 167

---

>gb|AF498947.1| Homo sapiens small GTP binding protein RAB11B (RAB11B) mRNA,
           complete cds
          Length = 657

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 79/89 (88%), Gaps = 1/89 (1%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggc 621
           ||||||||||||||||||||| ||||| ||||||| |  ||| |||||| ||||||| ||
Sbjct: 213 ctcctggccagcggtgtcccagatctgcgccttgatggtctt-gccgtccacctggatgc 155

                                        
Query: 622 tgcgggtggcgaactcgaccccgatggtg 650
           |||||||||||||||| || |||||||||
Sbjct: 154 tgcgggtggcgaactccacgccgatggtg 126

---

>emb|CR541691.1| Homo sapiens full open reading frame cDNA clone RZPDo834D1128D for
           gene RAB11B, RAB11B, member RAS oncogene family;
           complete cds, without stopcodon
          Length = 654

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 79/89 (88%), Gaps = 1/89 (1%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggc 621
           ||||||||||||||||||||| ||||| ||||||| |  ||| |||||| ||||||| ||
Sbjct: 213 ctcctggccagcggtgtcccagatctgcgccttgatggtctt-gccgtccacctggatgc 155

                                        
Query: 622 tgcgggtggcgaactcgaccccgatggtg 650
           |||||||||||||||| || |||||||||
Sbjct: 154 tgcgggtggcgaactccacgccgatggtg 126

---

>emb|CR536494.1| Homo sapiens full open reading frame cDNA clone RZPDo834G1017D for
           gene RAB11B, RAB11B, member RAS oncogene family;
           complete cds, incl. stopcodon
          Length = 657

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 79/89 (88%), Gaps = 1/89 (1%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggc 621
           ||||||||||||||||||||| ||||| ||||||| |  ||| |||||| ||||||| ||
Sbjct: 213 ctcctggccagcggtgtcccagatctgcgccttgatggtctt-gccgtccacctggatgc 155

                                        
Query: 622 tgcgggtggcgaactcgaccccgatggtg 650
           |||||||||||||||| || |||||||||
Sbjct: 154 tgcgggtggcgaactccacgccgatggtg 126

---

>gb|AC092300.2| Homo sapiens chromosome 19 clone LLNLF-176H4, complete sequence
          Length = 45303

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 79/89 (88%), Gaps = 1/89 (1%)
 Strand = Plus / Minus

                                                                         
Query: 562   ctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggc 621
             ||||||||||||||||||||| ||||| ||||||| |  ||| |||||| ||||||| ||
Sbjct: 34306 ctcctggccagcggtgtcccagatctgcgccttgatggtctt-gccgtccacctggatgc 34248

                                          
Query: 622   tgcgggtggcgaactcgaccccgatggtg 650
             |||||||||||||||| || |||||||||
Sbjct: 34247 tgcgggtggcgaactccacgccgatggtg 34219

---

>gb|AC010323.8| Homo sapiens chromosome 19 clone CTD-2550O8, complete sequence
          Length = 166618

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 79/89 (88%), Gaps = 1/89 (1%)
 Strand = Plus / Minus

                                                                          
Query: 562    ctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggc 621
              ||||||||||||||||||||| ||||| ||||||| |  ||| |||||| ||||||| ||
Sbjct: 150186 ctcctggccagcggtgtcccagatctgcgccttgatggtctt-gccgtccacctggatgc 150128

                                           
Query: 622    tgcgggtggcgaactcgaccccgatggtg 650
              |||||||||||||||| || |||||||||
Sbjct: 150127 tgcgggtggcgaactccacgccgatggtg 150099

---

>gb|AC136469.2| Homo sapiens chromosome 19 clone RP11-886P16, complete sequence
          Length = 147180

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 79/89 (88%), Gaps = 1/89 (1%)
 Strand = Plus / Plus

                                                                         
Query: 562   ctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggc 621
             ||||||||||||||||||||| ||||| ||||||| |  ||| |||||| ||||||| ||
Sbjct: 97513 ctcctggccagcggtgtcccagatctgcgccttgatggtctt-gccgtccacctggatgc 97571

                                          
Query: 622   tgcgggtggcgaactcgaccccgatggtg 650
             |||||||||||||||| || |||||||||
Sbjct: 97572 tgcgggtggcgaactccacgccgatggtg 97600

---

>gb|AY894025.1| Synthetic construct Homo sapiens clone FLH131057.01L RAB11B member
           RAS oncogene family (RAB11B) mRNA, partial cds
          Length = 657

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 79/89 (88%), Gaps = 1/89 (1%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggc 621
           ||||||||||||||||||||| ||||| ||||||| |  ||| |||||| ||||||| ||
Sbjct: 213 ctcctggccagcggtgtcccagatctgcgccttgatggtctt-gccgtccacctggatgc 155

                                        
Query: 622 tgcgggtggcgaactcgaccccgatggtg 650
           |||||||||||||||| || |||||||||
Sbjct: 154 tgcgggtggcgaactccacgccgatggtg 126

---

>gb|BC110081.1| Homo sapiens RAB11B, member RAS oncogene family, mRNA (cDNA clone
           MGC:133246 IMAGE:40035112), complete cds
          Length = 696

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 79/89 (88%), Gaps = 1/89 (1%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggc 621
           ||||||||||||||||||||| ||||| ||||||| |  ||| |||||| ||||||| ||
Sbjct: 215 ctcctggccagcggtgtcccagatctgcgccttgatggtctt-gccgtccacctggatgc 157

                                        
Query: 622 tgcgggtggcgaactcgaccccgatggtg 650
           |||||||||||||||| || |||||||||
Sbjct: 156 tgcgggtggcgaactccacgccgatggtg 128

---

>ref|NM_004218.1| Homo sapiens RAB11B, member RAS oncogene family (RAB11B), mRNA
          Length = 701

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 79/89 (88%), Gaps = 1/89 (1%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggc 621
           ||||||||||||||||||||| ||||| ||||||| |  ||| |||||| ||||||| ||
Sbjct: 219 ctcctggccagcggtgtcccagatctgcgccttgatggtctt-gccgtccacctggatgc 161

                                        
Query: 622 tgcgggtggcgaactcgaccccgatggtg 650
           |||||||||||||||| || |||||||||
Sbjct: 160 tgcgggtggcgaactccacgccgatggtg 132

---

>dbj|D38516.1|HUMRAB11B Human Rab11B mRNA
          Length = 698

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 79/89 (88%), Gaps = 1/89 (1%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggc 621
           ||||||||||||||||||||| ||||| ||||||| |  ||| |||||| ||||||| ||
Sbjct: 222 ctcctggccagcggtgtcccagatctgcgccttgatggtctt-gccgtccacctggatgc 164

                                        
Query: 622 tgcgggtggcgaactcgaccccgatggtg 650
           |||||||||||||||| || |||||||||
Sbjct: 163 tgcgggtggcgaactccacgccgatggtg 135

---

>ref|NM_185154.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1026

 Score = 87.7 bits (44), Expect = 5e-14
 Identities = 65/72 (90%)
 Strand = Plus / Minus

                                                                       
Query: 622 tgcgggtggcgaactcgaccccgatggtggacttggattcgaggcagaactcgttcttgg 681
           ||||||||||||||||||| || |||||||||||||| |||||||||||||||||   ||
Sbjct: 292 tgcgggtggcgaactcgacgccaatggtggacttggactcgaggcagaactcgttgcggg 233

                       
Query: 682 tgaagcgcgaga 693
           |||| |||||||
Sbjct: 232 tgaatcgcgaga 221

---

>dbj|AK061336.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-303-B12, full
           insert sequence
          Length = 1217

 Score = 87.7 bits (44), Expect = 5e-14
 Identities = 65/72 (90%)
 Strand = Plus / Minus

                                                                       
Query: 622 tgcgggtggcgaactcgaccccgatggtggacttggattcgaggcagaactcgttcttgg 681
           ||||||||||||||||||| || |||||||||||||| |||||||||||||||||   ||
Sbjct: 291 tgcgggtggcgaactcgacgccaatggtggacttggactcgaggcagaactcgttgcggg 232

                       
Query: 682 tgaagcgcgaga 693
           |||| |||||||
Sbjct: 231 tgaatcgcgaga 220

---

>dbj|D31905.1|MZEMGP1 Maize mRNA for mgp1 GTP-binding protein, complete cds
          Length = 941

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 139/171 (81%)
 Strand = Plus / Minus

                                                                       
Query: 433 gtcagtatgatctcttagctcttttagccagcgcgccacattgtcgaatgtagccgggcg 492
           ||||||||||||||| ||||| |||| ||| |   ||||| | ||||| || ||  | ||
Sbjct: 423 gtcagtatgatctctgagctcctttaaccaccttcccacagtctcgaaagtcgcatgacg 364

                                                                       
Query: 493 agtgacatcatacaccagcaacgcacctactgctcctctataataggcactcgtaatagc 552
           ||| || ||||| |||||||| |||||  | ||||||| ||| |||||||| || || ||
Sbjct: 363 agtcacgtcataaaccagcaatgcaccagcagctcctcgatagtaggcacttgtgattgc 304

                                                              
Query: 553 acggtatctctcctggccagcggtgtcccaaatctgggccttgacgacctt 603
           | | ||||| |||||||| ||||||||||||||||| ||||| ||||||||
Sbjct: 303 aagatatctttcctggccggcggtgtcccaaatctgagccttaacgacctt 253

---

>gb|BT019536.1| Homo sapiens RAB11B, member RAS oncogene family mRNA, complete cds
          Length = 657

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 78/89 (87%), Gaps = 1/89 (1%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggc 621
           ||||||||||||||||||||| ||||| ||||||| |  ||| |||||| ||||||| ||
Sbjct: 213 ctcctggccagcggtgtcccagatctgcgccttgatggtctt-gccgtccacctggatgc 155

                                        
Query: 622 tgcgggtggcgaactcgaccccgatggtg 650
           |||||||||| ||||| || |||||||||
Sbjct: 154 tgcgggtggcaaactccacgccgatggtg 126

---

>gb|AY192009.1| Bos taurus RAB11B gene, partial sequence
          Length = 193

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 78/89 (87%), Gaps = 1/89 (1%)
 Strand = Plus / Plus

                                                                       
Query: 562 ctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggc 621
           |||||||||||| |||||||| ||||| ||||||| |  ||| |||||| ||||||| ||
Sbjct: 21  ctcctggccagcagtgtcccagatctgcgccttgatggtctt-gccgtccacctggatgc 79

                                        
Query: 622 tgcgggtggcgaactcgaccccgatggtg 650
           ||||||||||||| ||||| |||||||||
Sbjct: 80  tgcgggtggcgaattcgacgccgatggtg 108

---

>dbj|AB169492.1| Macaca fascicularis brain cDNA, clone: QccE-10967, similar to human
           RAB11B, member RAS oncogene family (RAB11B), mRNA,
           RefSeq: NM_004218.1
          Length = 1642

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 78/89 (87%), Gaps = 1/89 (1%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggc 621
           ||||||||| ||||||||||| ||||| ||||||| |  ||| |||||| ||||||| ||
Sbjct: 279 ctcctggccggcggtgtcccagatctgcgccttgatggtctt-gccgtccacctggatgc 221

                                        
Query: 622 tgcgggtggcgaactcgaccccgatggtg 650
           |||||||||||||||| || |||||||||
Sbjct: 220 tgcgggtggcgaactccacgccgatggtg 192

---

>gb|AY888214.1| Synthetic construct Homo sapiens clone FLH010496.01X RAB11B member
           RAS oncogene family (RAB11B) mRNA, complete cds
          Length = 657

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 78/89 (87%), Gaps = 1/89 (1%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggc 621
           ||||||||||||||||||||| ||||| ||||||| |  ||| |||||| ||||||| ||
Sbjct: 213 ctcctggccagcggtgtcccagatctgcgccttgatggtctt-gccgtccacctggatgc 155

                                        
Query: 622 tgcgggtggcgaactcgaccccgatggtg 650
           |||||||||| ||||| || |||||||||
Sbjct: 154 tgcgggtggcaaactccacgccgatggtg 126

---

>dbj|AP000370.1| Arabidopsis thaliana genomic DNA, chromosome 3, TAC clone:K15M2
          Length = 79279

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 99/117 (84%), Gaps = 1/117 (0%)
 Strand = Plus / Minus

                                                                         
Query: 560   ctctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggag 619
             ||||| ||||| ||||||||||||||||| ||||||||||  ||| |  ||||| || | 
Sbjct: 65491 ctctcttggccggcggtgtcccaaatctgagccttgacgattttttca-tcgacatgaat 65433

                                                                      
Query: 620   gctgcgggtggcgaactcgaccccgatggtggacttggattcgaggcagaactcgtt 676
             ||| ||||||||||| ||||| ||||||||||| || || ||||||| |||||||||
Sbjct: 65432 gcttcgggtggcgaattcgacaccgatggtggatttagactcgaggctgaactcgtt 65376

---

>gb|BC105162.1| Bos taurus RAB11A, member RAS oncogene family, mRNA (cDNA clone
           MGC:127954 IMAGE:7955906), complete cds
          Length = 1455

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 78/89 (87%), Gaps = 1/89 (1%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggc 621
           |||||||||||| |||||||| ||||| ||||||| |  ||| |||||| ||||||| ||
Sbjct: 269 ctcctggccagcagtgtcccagatctgcgccttgatggtctt-gccgtccacctggatgc 211

                                        
Query: 622 tgcgggtggcgaactcgaccccgatggtg 650
           ||||||||||||| ||||| |||||||||
Sbjct: 210 tgcgggtggcgaattcgacgccgatggtg 182

---

>ref|NM_001035391.1| Bos taurus RAB11A, member RAS oncogene family (RAB11A), mRNA
          Length = 1455

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 78/89 (87%), Gaps = 1/89 (1%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggc 621
           |||||||||||| |||||||| ||||| ||||||| |  ||| |||||| ||||||| ||
Sbjct: 269 ctcctggccagcagtgtcccagatctgcgccttgatggtctt-gccgtccacctggatgc 211

                                        
Query: 622 tgcgggtggcgaactcgaccccgatggtg 650
           ||||||||||||| ||||| |||||||||
Sbjct: 210 tgcgggtggcgaattcgacgccgatggtg 182

---

>ref|XM_470373.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 910

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 83/96 (86%), Gaps = 1/96 (1%)
 Strand = Plus / Minus

                                                                       
Query: 575 gtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggctgcgggtggcgaa 634
           |||||||| ||||| ||||| || | |||| || || ||||||| | |||||||||||||
Sbjct: 408 gtgtcccatatctgtgcctttacaatcttt-ccttcaacctggatggtgcgggtggcgaa 350

                                               
Query: 635 ctcgaccccgatggtggacttggattcgaggcagaa 670
           |||||| ||||||||||||||||| |||||| ||||
Sbjct: 349 ctcgacgccgatggtggacttggagtcgagggagaa 314

---

>ref|XM_457123.1| Debaryomyces hansenii CBS767 hypothetical protein (DEHA0B03608g)
           partial mRNA
          Length = 663

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 518 cctactgctcctctataataggcactcgtaatagcacggtatctctcctggccagcggtg 577
           |||||||| ||||| || |||||||| ||||||||||||||||| || || || ||||| 
Sbjct: 269 cctactgcacctctgtagtaggcacttgtaatagcacggtatctttcttgacctgcggta 210

                               
Query: 578 tcccaaatctgggccttgac 597
           |||||||| |||||||||||
Sbjct: 209 tcccaaatttgggccttgac 190

---

>gb|AC092852.6| Oryza sativa chromosome 3 BAC OSJNBa0032G11 genomic sequence,
            complete sequence
          Length = 156606

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 55/60 (91%)
 Strand = Plus / Plus

                                                                        
Query: 611  gacctggaggctgcgggtggcgaactcgaccccgatggtggacttggattcgaggcagaa 670
            |||||||| | ||||||||||||||||||| ||||||||||||||||| |||||| ||||
Sbjct: 9091 gacctggatggtgcgggtggcgaactcgacgccgatggtggacttggagtcgagggagaa 9150

---

>emb|X96990.1|PHRB112 P.hybrida mRNA for GTP-binding protein, homologue to RB11-human
          Length = 273

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 79/92 (85%)
 Strand = Plus / Minus

                                                                       
Query: 491 cgagtgacatcatacaccagcaacgcacctactgctcctctataataggcactcgtaata 550
           |||||||||||||| |||||||| ||||| || ||||||| |||||||||||| ||||| 
Sbjct: 92  cgagtgacatcataaaccagcaatgcaccaacagctcctcgataataggcacttgtaatt 33

                                           
Query: 551 gcacggtatctctcctggccagcggtgtccca 582
           ||||| ||||  ||||| || || ||||||||
Sbjct: 32  gcacgatatcgttcctgacctgccgtgtccca 1

---

>emb|CR382134.1| Debaryomyces hansenii chromosome B of strain CBS767 of Debaryomyces
              hansenii
          Length = 1349926

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Plus

                                                                          
Query: 518    cctactgctcctctataataggcactcgtaatagcacggtatctctcctggccagcggtg 577
              |||||||| ||||| || |||||||| ||||||||||||||||| || || || ||||| 
Sbjct: 298260 cctactgcacctctgtagtaggcacttgtaatagcacggtatctttcttgacctgcggta 298319

                                  
Query: 578    tcccaaatctgggccttgac 597
              |||||||| |||||||||||
Sbjct: 298320 tcccaaatttgggccttgac 298339

---

>dbj|AP005681.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
              clone:OJ1439_F07
          Length = 153743

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 101/120 (84%), Gaps = 1/120 (0%)
 Strand = Plus / Minus

                                                                          
Query: 566    tggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggctgcg 625
              ||||| ||||||||||| |||||||||||||||  ||| || || ||    |||| ||||
Sbjct: 116002 tggccggcggtgtcccagatctgggccttgacgcgctt-gcggtggagggagagggtgcg 115944

                                                                          
Query: 626    ggtggcgaactcgaccccgatggtggacttggattcgaggcagaactcgttcttggtgaa 685
              |||   ||||||||| ||||||||||||||||| |||||| ||||||||| |||||||||
Sbjct: 115943 ggtctggaactcgacgccgatggtggacttggagtcgaggaagaactcgtccttggtgaa 115884

---

>dbj|AK111543.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013043E12, full
           insert sequence
          Length = 1090

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 101/120 (84%), Gaps = 1/120 (0%)
 Strand = Plus / Minus

                                                                       
Query: 566 tggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggctgcg 625
           ||||| ||||||||||| |||||||||||||||  ||| || || ||    |||| ||||
Sbjct: 445 tggccggcggtgtcccagatctgggccttgacgcgctt-gcggtggagggagagggtgcg 387

                                                                       
Query: 626 ggtggcgaactcgaccccgatggtggacttggattcgaggcagaactcgttcttggtgaa 685
           |||   ||||||||| ||||||||||||||||| |||||| ||||||||| |||||||||
Sbjct: 386 ggtctggaactcgacgccgatggtggacttggagtcgaggaagaactcgtccttggtgaa 327

---

>dbj|AK111499.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000K22, full
           insert sequence
          Length = 1146

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 83/96 (86%), Gaps = 1/96 (1%)
 Strand = Plus / Minus

                                                                       
Query: 575 gtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggctgcgggtggcgaa 634
           |||||||| ||||| ||||| || | |||| || || ||||||| | |||||||||||||
Sbjct: 409 gtgtcccatatctgtgcctttacaatcttt-ccttcaacctggatggtgcgggtggcgaa 351

                                               
Query: 635 ctcgaccccgatggtggacttggattcgaggcagaa 670
           |||||| ||||||||||||||||| |||||| ||||
Sbjct: 350 ctcgacgccgatggtggacttggagtcgagggagaa 315

---

>dbj|AK104527.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-304-A01, full
           insert sequence
          Length = 1074

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 83/96 (86%), Gaps = 1/96 (1%)
 Strand = Plus / Minus

                                                                       
Query: 575 gtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggctgcgggtggcgaa 634
           |||||||| ||||| ||||| || | |||| || || ||||||| | |||||||||||||
Sbjct: 334 gtgtcccatatctgtgcctttacaatcttt-ccttcaacctggatggtgcgggtggcgaa 276

                                               
Query: 635 ctcgaccccgatggtggacttggattcgaggcagaa 670
           |||||| ||||||||||||||||| |||||| ||||
Sbjct: 275 ctcgacgccgatggtggacttggagtcgagggagaa 240

---

>dbj|AK104362.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-035-C06, full
           insert sequence
          Length = 1074

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 83/96 (86%), Gaps = 1/96 (1%)
 Strand = Plus / Minus

                                                                       
Query: 575 gtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggctgcgggtggcgaa 634
           |||||||| ||||| ||||| || | |||| || || ||||||| | |||||||||||||
Sbjct: 334 gtgtcccatatctgtgcctttacaatcttt-ccttcaacctggatggtgcgggtggcgaa 276

                                               
Query: 635 ctcgaccccgatggtggacttggattcgaggcagaa 670
           |||||| ||||||||||||||||| |||||| ||||
Sbjct: 275 ctcgacgccgatggtggacttggagtcgagggagaa 240

---

>emb|Z73952.1|LJRAB11D L.japonicus mRNA for small GTP-binding protein, RAB11D
          Length = 1319

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 153/191 (80%)
 Strand = Plus / Minus

                                                                       
Query: 413 agcatgacaacaatgctagggtcagtatgatctcttagctcttttagccagcgcgccaca 472
           |||||||| |||||| | ||||| || |||||||| | |||||| | ||| |  ||  ||
Sbjct: 615 agcatgaccacaatgttggggtctgtgtgatctctcaactctttcaaccaccttgcagca 556

                                                                       
Query: 473 ttgtcgaatgtagccgggcgagtgacatcatacaccagcaacgcacctactgctcctcta 532
           || || ||||||||  |||| || |||||||| || || || ||||| || |||||||  
Sbjct: 555 ttctcaaatgtagctcggcgcgttacatcatagacaagtaaggcaccaacagctcctcgg 496

                                                                       
Query: 533 taataggcactcgtaatagcacggtatctctcctggccagcggtgtcccaaatctgggcc 592
           || || ||||| ||||| |||||||| || ||||| ||||| |||||||||||||| |||
Sbjct: 495 tagtaagcactagtaatggcacggtacctttcctgaccagcagtgtcccaaatctgagcc 436

                      
Query: 593 ttgacgacctt 603
           || ||||||||
Sbjct: 435 ttaacgacctt 425

---

>gb|AY107805.1| Zea mays PCO073002 mRNA sequence
          Length = 1206

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 82/95 (86%), Gaps = 1/95 (1%)
 Strand = Plus / Minus

                                                                       
Query: 612 acctggaggctgcgggtggcgaactcgaccccgatggtggacttggattcgaggcagaac 671
           ||||||||  |||| ||||||||||| || ||||||||||||||||| ||||||  ||| 
Sbjct: 323 acctggagtgtgcgcgtggcgaactcaacgccgatggtggacttggagtcgagggcgaag 264

                                              
Query: 672 tcgttcttggtgaagcgcgagangcaggttggact 706
             ||||||||||||||| |||| ||||||||||||
Sbjct: 263 gtgttcttggtgaagcgggaga-gcaggttggact 230

---

>dbj|AK111872.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033040K07, full
           insert sequence
          Length = 1205

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 126/154 (81%), Gaps = 1/154 (0%)
 Strand = Plus / Minus

                                                                       
Query: 523 tgctcctctataataggcactcgtaatagcacggtatctctcctggccagcggtgtccca 582
           ||||||||| || || |||||||| | ||| |  || ||||||||||| |||||||||||
Sbjct: 455 tgctcctctgtagtatgcactcgtgacagctctatacctctcctggccggcggtgtccca 396

                                                                       
Query: 583 aatctgggccttgacgacctttgccgtcgacctggaggctgcgggtggcgaactcgaccc 642
            |||||||||||||||  | |||  |||||   ||||| |||||||   ||||||||| |
Sbjct: 395 gatctgggccttgacggac-ttgtggtcgatgaggagggtgcgggtctggaactcgacgc 337

                                             
Query: 643 cgatggtggacttggattcgaggcagaactcgtt 676
           ||||||||| |||||| |||| | ||||||||||
Sbjct: 336 cgatggtggccttggagtcgatggagaactcgtt 303

---

>gb|BC085270.1| Mus musculus RAB11B, member RAS oncogene family, mRNA (cDNA clone
           MGC:103195 IMAGE:6478784), complete cds
          Length = 1789

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 89/105 (84%), Gaps = 1/105 (0%)
 Strand = Plus / Minus

                                                                       
Query: 545 gtaatagcacggtatctctcctggccagcggtgtcccaaatctgggccttgacgaccttt 604
           ||||| |||||||| | |||||||||||| |||||||| ||||| ||||||| |  | ||
Sbjct: 263 gtaatggcacggtagcgctcctggccagcagtgtcccagatctgagccttgatggtc-tt 205

                                                        
Query: 605 gccgtcgacctggaggctgcgggtggcgaactcgaccccgatggt 649
           |||||| ||||| | |||||| ||||||||||| || ||||||||
Sbjct: 204 gccgtccacctgaatgctgcgagtggcgaactccactccgatggt 160

---

>gb|BC054753.1| Mus musculus RAB11B, member RAS oncogene family, mRNA (cDNA clone
           MGC:65651 IMAGE:6411651), complete cds
          Length = 1788

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 89/105 (84%), Gaps = 1/105 (0%)
 Strand = Plus / Minus

                                                                       
Query: 545 gtaatagcacggtatctctcctggccagcggtgtcccaaatctgggccttgacgaccttt 604
           ||||| |||||||| | |||||||||||| |||||||| ||||| ||||||| |  | ||
Sbjct: 270 gtaatggcacggtagcgctcctggccagcagtgtcccagatctgagccttgatggtc-tt 212

                                                        
Query: 605 gccgtcgacctggaggctgcgggtggcgaactcgaccccgatggt 649
           |||||| ||||| | |||||| ||||||||||| || ||||||||
Sbjct: 211 gccgtccacctgaatgctgcgagtggcgaactccactccgatggt 167

---

>ref|NM_008997.1| Mus musculus RAB11B, member RAS oncogene family (Rab11b), mRNA
          Length = 1763

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 89/105 (84%), Gaps = 1/105 (0%)
 Strand = Plus / Minus

                                                                       
Query: 545 gtaatagcacggtatctctcctggccagcggtgtcccaaatctgggccttgacgaccttt 604
           ||||| |||||||| | |||||||||||| |||||||| ||||| ||||||| |  | ||
Sbjct: 265 gtaatggcacggtagcgctcctggccagcagtgtcccagatctgagccttgatggtc-tt 207

                                                        
Query: 605 gccgtcgacctggaggctgcgggtggcgaactcgaccccgatggt 649
           |||||| ||||| | |||||| ||||||||||| || ||||||||
Sbjct: 206 gccgtccacctgaatgctgcgagtggcgaactccactccgatggt 162

---

>emb|Z73957.1|LJRAB11I L.japonicus mRNA for small GTP-binding protein, RAB11I
          Length = 662

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 85/101 (84%)
 Strand = Plus / Minus

                                                                       
Query: 497 acatcatacaccagcaacgcacctactgctcctctataataggcactcgtaatagcacgg 556
           ||||||||||| | ||| ||||| || ||||||||||| || ||||| || || ||||||
Sbjct: 131 acatcatacacaatcaatgcaccaacagctcctctatagtaagcacttgtgattgcacgg 72

                                                    
Query: 557 tatctctcctggccagcggtgtcccaaatctgggccttgac 597
           ||||| || || |||||||||||||| || || ||||||||
Sbjct: 71  tatctttcttgaccagcggtgtcccagatttgcgccttgac 31

---

>gb|AC079935.3| Genomic sequence for Oryza sativa (japonica cultivar-group) cultivar
              Nipponbare clone OSJNBa0095C06, from Chromosome 10,
              complete sequence
          Length = 156159

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 98/117 (83%), Gaps = 1/117 (0%)
 Strand = Plus / Plus

                                                                          
Query: 560    ctctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggag 619
              ||||||||||| ||||||||||| |||||||||||||||  | |||  |||||   ||||
Sbjct: 120818 ctctcctggccggcggtgtcccagatctgggccttgacggac-ttgtggtcgatgaggag 120876

                                                                       
Query: 620    gctgcgggtggcgaactcgaccccgatggtggacttggattcgaggcagaactcgtt 676
              | |||||||   ||||||||| |||||||||| |||||| |||| | ||||||||||
Sbjct: 120877 ggtgcgggtctggaactcgacgccgatggtggccttggagtcgatggagaactcgtt 120933

---

>dbj|AK134125.1| Mus musculus adult male thymus cDNA, RIKEN full-length enriched
           library, clone:5830445A06 product:RAB11B, member RAS
           oncogene family, full insert sequence
          Length = 1545

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 89/105 (84%), Gaps = 1/105 (0%)
 Strand = Plus / Minus

                                                                       
Query: 545 gtaatagcacggtatctctcctggccagcggtgtcccaaatctgggccttgacgaccttt 604
           ||||| |||||||| | |||||||||||| |||||||| ||||| ||||||| |  | ||
Sbjct: 199 gtaatggcacggtagcgctcctggccagcagtgtcccagatctgagccttgatggtc-tt 141

                                                        
Query: 605 gccgtcgacctggaggctgcgggtggcgaactcgaccccgatggt 649
           |||||| ||||| | |||||| ||||||||||| || ||||||||
Sbjct: 140 gccgtccacctgaatgctgcgagtggcgaactccactccgatggt 96

---

>dbj|AK148106.1| Mus musculus B16 F10Y cells cDNA, RIKEN full-length enriched
           library, clone:G370018B13 product:RAB11B, member RAS
           oncogene family, full insert sequence
          Length = 1650

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 89/105 (84%), Gaps = 1/105 (0%)
 Strand = Plus / Minus

                                                                       
Query: 545 gtaatagcacggtatctctcctggccagcggtgtcccaaatctgggccttgacgaccttt 604
           ||||| |||||||| | |||||||||||| |||||||| ||||| ||||||| |  | ||
Sbjct: 253 gtaatggcacggtagcgctcctggccagcagtgtcccagatctgagccttgatggtc-tt 195

                                                        
Query: 605 gccgtcgacctggaggctgcgggtggcgaactcgaccccgatggt 649
           |||||| ||||| | |||||| ||||||||||| || ||||||||
Sbjct: 194 gccgtccacctgaatgctgcgagtggcgaactccactccgatggt 150

---

>dbj|AK147077.1| Mus musculus 17 days pregnant adult female amnion cDNA, RIKEN
           full-length enriched library, clone:I920098B22
           product:RAB11B, member RAS oncogene family, full insert
           sequence
          Length = 1782

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 89/105 (84%), Gaps = 1/105 (0%)
 Strand = Plus / Minus

                                                                       
Query: 545 gtaatagcacggtatctctcctggccagcggtgtcccaaatctgggccttgacgaccttt 604
           ||||| |||||||| | |||||||||||| |||||||| ||||| ||||||| |  | ||
Sbjct: 285 gtaatggcacggtagcgctcctggccagcagtgtcccagatctgagccttgatggtc-tt 227

                                                        
Query: 605 gccgtcgacctggaggctgcgggtggcgaactcgaccccgatggt 649
           |||||| ||||| | |||||| ||||||||||| || ||||||||
Sbjct: 226 gccgtccacctgaatgctgcgagtggcgaactccactccgatggt 182

---

>dbj|AK146978.1| Mus musculus 17 days embryo kidney cDNA, RIKEN full-length enriched
           library, clone:I920080M19 product:RAB11B, member RAS
           oncogene family, full insert sequence
          Length = 1653

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 89/105 (84%), Gaps = 1/105 (0%)
 Strand = Plus / Minus

                                                                       
Query: 545 gtaatagcacggtatctctcctggccagcggtgtcccaaatctgggccttgacgaccttt 604
           ||||| |||||||| | |||||||||||| |||||||| ||||| ||||||| |  | ||
Sbjct: 246 gtaatggcacggtagcgctcctggccagcagtgtcccagatctgagccttgatggtc-tt 188

                                                        
Query: 605 gccgtcgacctggaggctgcgggtggcgaactcgaccccgatggt 649
           |||||| ||||| | |||||| ||||||||||| || ||||||||
Sbjct: 187 gccgtccacctgaatgctgcgagtggcgaactccactccgatggt 143

---

>dbj|AK148022.1| Mus musculus melanocyte cDNA, RIKEN full-length enriched library,
           clone:G270142I04 product:RAB11B, member RAS oncogene
           family, full insert sequence
          Length = 1815

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 89/105 (84%), Gaps = 1/105 (0%)
 Strand = Plus / Minus

                                                                       
Query: 545 gtaatagcacggtatctctcctggccagcggtgtcccaaatctgggccttgacgaccttt 604
           ||||| |||||||| | |||||||||||| |||||||| ||||| ||||||| |  | ||
Sbjct: 327 gtaatggcacggtagcgctcctggccagcagtgtcccagatctgagccttgatggtc-tt 269

                                                        
Query: 605 gccgtcgacctggaggctgcgggtggcgaactcgaccccgatggt 649
           |||||| ||||| | |||||| ||||||||||| || ||||||||
Sbjct: 268 gccgtccacctgaatgctgcgagtggcgaactccactccgatggt 224

---

>dbj|AK146623.1| Mus musculus 17 days pregnant adult female amnion cDNA, RIKEN
           full-length enriched library, clone:I920035M11
           product:RAB11B, member RAS oncogene family, full insert
           sequence
          Length = 2411

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 89/105 (84%), Gaps = 1/105 (0%)
 Strand = Plus / Minus

                                                                       
Query: 545 gtaatagcacggtatctctcctggccagcggtgtcccaaatctgggccttgacgaccttt 604
           ||||| |||||||| | |||||||||||| |||||||| ||||| ||||||| |  | ||
Sbjct: 266 gtaatggcacggtagcgctcctggccagcagtgtcccagatctgagccttgatggtc-tt 208

                                                        
Query: 605 gccgtcgacctggaggctgcgggtggcgaactcgaccccgatggt 649
           |||||| ||||| | |||||| ||||||||||| || ||||||||
Sbjct: 207 gccgtccacctgaatgctgcgagtggcgaactccactccgatggt 163

---

>dbj|AK146460.1| Mus musculus 16 days embryo heart cDNA, RIKEN full-length enriched
           library, clone:I920006I23 product:RAB11B, member RAS
           oncogene family, full insert sequence
          Length = 1763

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 89/105 (84%), Gaps = 1/105 (0%)
 Strand = Plus / Minus

                                                                       
Query: 545 gtaatagcacggtatctctcctggccagcggtgtcccaaatctgggccttgacgaccttt 604
           ||||| |||||||| | |||||||||||| |||||||| ||||| ||||||| |  | ||
Sbjct: 266 gtaatggcacggtagcgctcctggccagcagtgtcccagatctgagccttgatggtc-tt 208

                                                        
Query: 605 gccgtcgacctggaggctgcgggtggcgaactcgaccccgatggt 649
           |||||| ||||| | |||||| ||||||||||| || ||||||||
Sbjct: 207 gccgtccacctgaatgctgcgagtggcgaactccactccgatggt 163

---

>dbj|AK146452.1| Mus musculus 17 days embryo kidney cDNA, RIKEN full-length enriched
           library, clone:I920003N23 product:RAB11B, member RAS
           oncogene family, full insert sequence
          Length = 1812

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 89/105 (84%), Gaps = 1/105 (0%)
 Strand = Plus / Minus

                                                                       
Query: 545 gtaatagcacggtatctctcctggccagcggtgtcccaaatctgggccttgacgaccttt 604
           ||||| |||||||| | |||||||||||| |||||||| ||||| ||||||| |  | ||
Sbjct: 315 gtaatggcacggtagcgctcctggccagcagtgtcccagatctgagccttgatggtc-tt 257

                                                        
Query: 605 gccgtcgacctggaggctgcgggtggcgaactcgaccccgatggt 649
           |||||| ||||| | |||||| ||||||||||| || ||||||||
Sbjct: 256 gccgtccacctgaatgctgcgagtggcgaactccactccgatggt 212

---

>ref|NG_001431.1| Mus musculus RAB11b, member RAS oncogene family, pseudogene 1
           (Rab11b-ps1) on chromosome 1
          Length = 655

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 89/105 (84%), Gaps = 1/105 (0%)
 Strand = Plus / Minus

                                                                       
Query: 545 gtaatagcacggtatctctcctggccagcggtgtcccaaatctgggccttgacgaccttt 604
           ||||| |||||||| | |||||||||||| |||||||| ||||| ||||||| |  | ||
Sbjct: 230 gtaatggcacggtagcgctcctggccagcagtgtcccagatctgagccttgatggtc-tt 172

                                                        
Query: 605 gccgtcgacctggaggctgcgggtggcgaactcgaccccgatggt 649
           |||||| ||||| | |||||| ||||||||||| || ||||||||
Sbjct: 171 gccgtccacctgaatgctgcgagtggcgaactccactccgatggt 127

---

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 98/117 (83%), Gaps = 1/117 (0%)
 Strand = Plus / Plus

                                                                            
Query: 560      ctctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggag 619
                ||||||||||| ||||||||||| |||||||||||||||  | |||  |||||   ||||
Sbjct: 11536825 ctctcctggccggcggtgtcccagatctgggccttgacggac-ttgtggtcgatgaggag 11536883

                                                                         
Query: 620      gctgcgggtggcgaactcgaccccgatggtggacttggattcgaggcagaactcgtt 676
                | |||||||   ||||||||| |||||||||| |||||| |||| | ||||||||||
Sbjct: 11536884 ggtgcgggtctggaactcgacgccgatggtggccttggagtcgatggagaactcgtt 11536940



 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 419      acaacaatgctagggtcagt 438
                ||||||||||||||||||||
Sbjct: 11041304 acaacaatgctagggtcagt 11041285

---

>dbj|AK195913.1| Mus musculus cDNA, clone:Y1G0120B01, strand:plus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000066020, based on BLAT search
          Length = 184

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 89/105 (84%), Gaps = 1/105 (0%)
 Strand = Plus / Minus

                                                                       
Query: 545 gtaatagcacggtatctctcctggccagcggtgtcccaaatctgggccttgacgaccttt 604
           ||||| |||||||| | |||||||||||| |||||||| ||||| ||||||| |  | ||
Sbjct: 110 gtaatggcacggtagcgctcctggccagcagtgtcccagatctgagccttgatggtc-tt 52

                                                        
Query: 605 gccgtcgacctggaggctgcgggtggcgaactcgaccccgatggt 649
           |||||| ||||| | |||||| ||||||||||| || ||||||||
Sbjct: 51  gccgtccacctgaatgctgcgagtggcgaactccactccgatggt 7

---

>dbj|AK186595.1| Mus musculus cDNA, clone:Y0G0137P06, strand:plus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000066020, based on BLAT search
          Length = 295

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 89/105 (84%), Gaps = 1/105 (0%)
 Strand = Plus / Minus

                                                                       
Query: 545 gtaatagcacggtatctctcctggccagcggtgtcccaaatctgggccttgacgaccttt 604
           ||||| |||||||| | |||||||||||| |||||||| ||||| ||||||| |  | ||
Sbjct: 221 gtaatggcacggtagcgctcctggccagcagtgtcccagatctgagccttgatggtc-tt 163

                                                        
Query: 605 gccgtcgacctggaggctgcgggtggcgaactcgaccccgatggt 649
           |||||| ||||| | |||||| ||||||||||| || ||||||||
Sbjct: 162 gccgtccacctgaatgctgcgagtggcgaactccactccgatggt 118

---

>gb|AY104562.1| Zea mays PCO063085 mRNA sequence
          Length = 1170

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 140/172 (81%), Gaps = 3/172 (1%)
 Strand = Plus / Minus

                                                                       
Query: 506 accagcaacgcacctactgctcctctataataggcactcgtaatagcacggtatctctcc 565
           |||||||| || || | ||| ||||||||||| ||||| || |  || | ||| ||||||
Sbjct: 529 accagcaaagctcccagtgcgcctctataataagcactagtcacggctctgtacctctcc 470

                                                                       
Query: 566 tggccagcggtgtcccaaatctgggccttgacg-acctttgccgtcgacctggaggctgc 624
           ||||| ||||||||||| |||||||||||||||  ||| ||  |||||    |||| |||
Sbjct: 469 tggccggcggtgtcccagatctgggccttgacgctcctgtg--gtcgatgacgagggtgc 412

                                                               
Query: 625 gggtggcgaactcgaccccgatggtggacttggattcgaggcagaactcgtt 676
           ||||   ||||||||| |||||||||| |||||| ||||||| |||||||||
Sbjct: 411 gggtctggaactcgacgccgatggtggccttggagtcgaggctgaactcgtt 360

---

>gb|AF127663.1|AF127663 Mus musculus Rab11b pseudogene, partial sequence
          Length = 655

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 89/105 (84%), Gaps = 1/105 (0%)
 Strand = Plus / Minus

                                                                       
Query: 545 gtaatagcacggtatctctcctggccagcggtgtcccaaatctgggccttgacgaccttt 604
           ||||| |||||||| | |||||||||||| |||||||| ||||| ||||||| |  | ||
Sbjct: 230 gtaatggcacggtagcgctcctggccagcagtgtcccagatctgagccttgatggtc-tt 172

                                                        
Query: 605 gccgtcgacctggaggctgcgggtggcgaactcgaccccgatggt 649
           |||||| ||||| | |||||| ||||||||||| || ||||||||
Sbjct: 171 gccgtccacctgaatgctgcgagtggcgaactccactccgatggt 127

---

>emb|CT030732.13| Mouse DNA sequence from clone RP23-27D5 on chromosome 17, complete
             sequence
          Length = 220163

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 89/105 (84%), Gaps = 1/105 (0%)
 Strand = Plus / Plus

                                                                         
Query: 545   gtaatagcacggtatctctcctggccagcggtgtcccaaatctgggccttgacgaccttt 604
             ||||| |||||||| | |||||||||||| |||||||| ||||| ||||||| |  | ||
Sbjct: 61123 gtaatggcacggtagcgctcctggccagcagtgtcccagatctgagccttgatggtc-tt 61181

                                                          
Query: 605   gccgtcgacctggaggctgcgggtggcgaactcgaccccgatggt 649
             |||||| ||||| | |||||| ||||||||||| || ||||||||
Sbjct: 61182 gccgtccacctgaatgctgcgagtggcgaactccactccgatggt 61226

---

>gb|L26528.1|MUSRAB11B Mus musculus Rab11b mRNA, complete cds
          Length = 1763

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 89/105 (84%), Gaps = 1/105 (0%)
 Strand = Plus / Minus

                                                                       
Query: 545 gtaatagcacggtatctctcctggccagcggtgtcccaaatctgggccttgacgaccttt 604
           ||||| |||||||| | |||||||||||| |||||||| ||||| ||||||| |  | ||
Sbjct: 265 gtaatggcacggtagcgctcctggccagcagtgtcccagatctgagccttgatggtc-tt 207

                                                        
Query: 605 gccgtcgacctggaggctgcgggtggcgaactcgaccccgatggt 649
           |||||| ||||| | |||||| ||||||||||| || ||||||||
Sbjct: 206 gccgtccacctgaatgctgcgagtggcgaactccactccgatggt 162

---

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 98/117 (83%), Gaps = 1/117 (0%)
 Strand = Plus / Plus

                                                                            
Query: 560      ctctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggag 619
                ||||||||||| ||||||||||| |||||||||||||||  | |||  |||||   ||||
Sbjct: 11543265 ctctcctggccggcggtgtcccagatctgggccttgacggac-ttgtggtcgatgaggag 11543323

                                                                         
Query: 620      gctgcgggtggcgaactcgaccccgatggtggacttggattcgaggcagaactcgtt 676
                | |||||||   ||||||||| |||||||||| |||||| |||| | ||||||||||
Sbjct: 11543324 ggtgcgggtctggaactcgacgccgatggtggccttggagtcgatggagaactcgtt 11543380



 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 419      acaacaatgctagggtcagt 438
                ||||||||||||||||||||
Sbjct: 11047744 acaacaatgctagggtcagt 11047725

---

>ref|NM_191928.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 675

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 115/140 (82%), Gaps = 1/140 (0%)
 Strand = Plus / Minus

                                                                       
Query: 536 taggcactcgtaatagcacggtatctctcctggccagcggtgtcccaaatctgggccttg 595
           ||||| ||||| || || ||||| ||||| ||||| ||||||||||| ||||||||||||
Sbjct: 263 taggcgctcgtgatggcgcggtacctctcttggccggcggtgtcccagatctgggccttg 204

                                                                       
Query: 596 acgacctttgccgtcgacctggaggctgcgggtggcgaactcgaccccgatggtggactt 655
           |||| |  || |||||||  ||| | |   ||||||||||||||| |||||||||||| |
Sbjct: 203 acgagc-ctgtcgtcgacgcggacggtcttggtggcgaactcgacgccgatggtggacct 145

                               
Query: 656 ggattcgaggcagaactcgt 675
           ||  || |||| ||||||||
Sbjct: 144 ggtctccaggctgaactcgt 125

---

>ref|XM_849306.1| PREDICTED: Canis familiaris similar to RAB11B, member RAS oncogene
           family (LOC611619), mRNA
          Length = 2137

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 85/100 (85%), Gaps = 1/100 (1%)
 Strand = Plus / Minus

                                                                       
Query: 551 gcacggtatctctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtc 610
           |||||||| | |||||| || ||||||||||| ||||| ||||||| |  ||| ||||||
Sbjct: 800 gcacggtagcgctcctgcccggcggtgtcccagatctgcgccttgatggtctt-gccgtc 742

                                                   
Query: 611 gacctggaggctgcgggtggcgaactcgaccccgatggtg 650
            ||||||| ||||||||||||||| || || |||||||||
Sbjct: 741 cacctggatgctgcgggtggcgaattccacgccgatggtg 702

---

>gb|AC166092.4| Glycine max clone gmw1-93l19, complete sequence
          Length = 51037

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 91/108 (84%), Gaps = 1/108 (0%)
 Strand = Plus / Plus

                                                                         
Query: 569   ccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggctgcgggt 628
             ||||| |||||||||||||| ||||||||||||||  |  |||||  | | ||| | |||
Sbjct: 43908 ccagcagtgtcccaaatctgagccttgacgaccttatca-tcgacgcgaatgcttctggt 43966

                                                             
Query: 629   ggcgaactcgaccccgatggtggacttggattcgaggcagaactcgtt 676
             ||||||||| || || ||||||||||| |||||||||| |||||||||
Sbjct: 43967 ggcgaactcaacgccaatggtggacttcgattcgaggctgaactcgtt 44014



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 96/119 (80%)
 Strand = Plus / Plus

                                                                         
Query: 440   tgatctcttagctcttttagccagcgcgccacattgtcgaatgtagccgggcgagtgaca 499
             |||||||| |||||||||||||| | | ||||||| || || ||| |  | || || |||
Sbjct: 40571 tgatctctcagctcttttagccatctctccacattttcaaaagtaacatgacgtgtaaca 40630

                                                                        
Query: 500   tcatacaccagcaacgcacctactgctcctctataataggcactcgtaatagcacggta 558
             ||||| || || || ||||| || ||||||| |||||| ||||| |||||||| |||||
Sbjct: 40631 tcatagactagtaaagcaccaacagctcctcgataatatgcacttgtaatagctcggta 40689

---

>dbj|AK111561.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013063J15, full
           insert sequence
          Length = 983

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 115/140 (82%), Gaps = 1/140 (0%)
 Strand = Plus / Minus

                                                                       
Query: 536 taggcactcgtaatagcacggtatctctcctggccagcggtgtcccaaatctgggccttg 595
           ||||| ||||| || || ||||| ||||| ||||| ||||||||||| ||||||||||||
Sbjct: 436 taggcgctcgtgatggcgcggtacctctcttggccggcggtgtcccagatctgggccttg 377

                                                                       
Query: 596 acgacctttgccgtcgacctggaggctgcgggtggcgaactcgaccccgatggtggactt 655
           |||| |  || |||||||  ||| | |   ||||||||||||||| |||||||||||| |
Sbjct: 376 acgagc-ctgtcgtcgacgcggacggtcttggtggcgaactcgacgccgatggtggacct 318

                               
Query: 656 ggattcgaggcagaactcgt 675
           ||  || |||| ||||||||
Sbjct: 317 ggtctccaggctgaactcgt 298

---

>gb|DQ099227.1| Arachis hypogaea clone Ah1TC6H03 microsatellite sequence
          Length = 264

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 35/35 (100%)
 Strand = Plus / Plus

                                              
Query: 569 ccagcggtgtcccaaatctgggccttgacgacctt 603
           |||||||||||||||||||||||||||||||||||
Sbjct: 106 ccagcggtgtcccaaatctgggccttgacgacctt 140

---

>gb|DQ099152.1| Arachis hypogaea clone AH2TC9F10 microsatellite sequence
          Length = 283

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 35/35 (100%)
 Strand = Plus / Plus

                                              
Query: 569 ccagcggtgtcccaaatctgggccttgacgacctt 603
           |||||||||||||||||||||||||||||||||||
Sbjct: 125 ccagcggtgtcccaaatctgggccttgacgacctt 159

---

>gb|L29269.1|TOBNTRAB Nicotiana tabacum SR1 Nt-rab11b mRNA, complete cds
          Length = 924

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 102/123 (82%), Gaps = 1/123 (0%)
 Strand = Plus / Minus

                                                                       
Query: 539 gcactcgtaatagcacggtatctctcctggccagcggtgtcccaaatctgggccttgacg 598
           ||||| ||||| |||||||| || || |||||||| |||||||||||||||||||| |||
Sbjct: 257 gcacttgtaattgcacggtacctttcttggccagcagtgtcccaaatctgggccttaacg 198

                                                                       
Query: 599 acctttgccgtcgacctggaggctgcgggtggcgaactcgaccccgatggtggacttgga 658
           | | ||  | |||||| | | ||| ||||| ||||| || || ||||| |||||||||||
Sbjct: 197 atc-ttatcatcgacccgaatgctacgggtagcgaattcaacgccgatagtggacttgga 139

              
Query: 659 ttc 661
           |||
Sbjct: 138 ttc 136

---

>ref|NM_100615.1| Arabidopsis thaliana GTP binding AT1G07410 mRNA, complete cds
          Length = 645

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 624 cgggtggcgaactcgaccccgatggtggacttggattcgaggcagaactcgttcttggtg 683
           ||||||||||| ||||| || |||||||| ||||||||||| |||||||||||  |||||
Sbjct: 155 cgggtggcgaattcgacgccaatggtggatttggattcgagacagaactcgtttctggtg 96

             
Query: 684 aa 685
           ||
Sbjct: 95  aa 94

---

>ref|XM_368165.1| Magnaporthe grisea 70-15 chromosome VI hypothetical protein
           (MG01079.4) partial mRNA
          Length = 636

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 49/54 (90%)
 Strand = Plus / Minus

                                                                 
Query: 623 gcgggtggcgaactcgaccccgatggtggacttggattcgaggcagaactcgtt 676
           |||||||||||||||||| |||||||| |||||||| ||||||  |||||||||
Sbjct: 147 gcgggtggcgaactcgacgccgatggtcgacttggagtcgaggttgaactcgtt 94

---

>emb|AJ245570.1|LES245570 Lycopersicon esculentum mRNA for Rab11 GTPase (Rab11a gene)
          Length = 1028

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 73/86 (84%)
 Strand = Plus / Minus

                                                                       
Query: 362 tcttcagttgaaacagccaccaagtggcgaaggtcagatttgttgccaactagcatgaca 421
           |||||||||||||||||||| |  || || || || ||||||||||| |  |||||||| 
Sbjct: 450 tcttcagttgaaacagccacgagatgtcggagatctgatttgttgcctaggagcatgact 391

                                     
Query: 422 acaatgctagggtcagtatgatctct 447
           |||||| ||||||||||||| |||||
Sbjct: 390 acaatgttagggtcagtatggtctct 365



 Score = 48.1 bits (24), Expect = 0.040
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 299 gtcgcgtctaatgcagatgtttccatgaagta 330
           ||||| ||||||||||| ||||||||||||||
Sbjct: 513 gtcgcttctaatgcagaagtttccatgaagta 482

---

>gb|AC022464.4|AC022464 Genomic sequence for Arabidopsis thaliana BAC F22G5 from chromosome I,
             complete sequence
          Length = 104830

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                         
Query: 624   cgggtggcgaactcgaccccgatggtggacttggattcgaggcagaactcgttcttggtg 683
             ||||||||||| ||||| || |||||||| ||||||||||| |||||||||||  |||||
Sbjct: 67637 cgggtggcgaattcgacgccaatggtggatttggattcgagacagaactcgtttctggtg 67696

               
Query: 684   aa 685
             ||
Sbjct: 67697 aa 67698

---

>dbj|AK188436.1| Mus musculus cDNA, clone:Y0G0145D08, strand:plus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000066020, based on BLAT search
          Length = 295

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 88/105 (83%), Gaps = 1/105 (0%)
 Strand = Plus / Minus

                                                                       
Query: 545 gtaatagcacggtatctctcctggccagcggtgtcccaaatctgggccttgacgaccttt 604
           ||||| |||||||| | ||||||||||||  ||||||| ||||| ||||||| |  | ||
Sbjct: 221 gtaatggcacggtagcgctcctggccagcantgtcccagatctgagccttgatggtc-tt 163

                                                        
Query: 605 gccgtcgacctggaggctgcgggtggcgaactcgaccccgatggt 649
           |||||| ||||| | |||||| ||||||||||| || ||||||||
Sbjct: 162 gccgtccacctgaatgctgcgagtggcgaactccactccgatggt 118

---

>dbj|AK177220.1| Mus musculus cDNA, clone:Y0G0102A22, strand:minus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000066020, based on BLAT search
          Length = 245

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 88/105 (83%), Gaps = 1/105 (0%)
 Strand = Plus / Minus

                                                                       
Query: 545 gtaatagcacggtatctctcctggccagcggtgtcccaaatctgggccttgacgaccttt 604
           ||||| |||||||| | |||||||||||| |||||||| ||||| ||||||| |  | ||
Sbjct: 171 gtaatggcacggtagcgctcctggccagcagtgtcccagatctgagccttgatggtc-tt 113

                                                        
Query: 605 gccgtcgacctggaggctgcgggtggcgaactcgaccccgatggt 649
           |||||| ||||| | |||||| |||| |||||| || ||||||||
Sbjct: 112 gccgtccacctgaatgctgcgagtggngaactccactccgatggt 68

---

>gb|AY974574.1| Mus musculus RAB11B member RAS oncogene family-like (Rab11b) mRNA,
           partial sequence
          Length = 532

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 88/105 (83%), Gaps = 1/105 (0%)
 Strand = Plus / Minus

                                                                       
Query: 545 gtaatagcacggtatctctcctggccagcggtgtcccaaatctgggccttgacgaccttt 604
           ||||| |||||||| | |||||||||||| |||||||| ||||| |||| || |  | ||
Sbjct: 230 gtaatggcacggtagcgctcctggccagcagtgtcccagatctgagcctngatggtc-tt 172

                                                        
Query: 605 gccgtcgacctggaggctgcgggtggcgaactcgaccccgatggt 649
           |||||| ||||| | |||||| ||||||||||| || ||||||||
Sbjct: 171 gccgtccacctgaatgctgcgagtggcgaactccactccgatggt 127

---

>dbj|AK104132.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-204-D05, full
           insert sequence
          Length = 1098

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 125/154 (81%), Gaps = 1/154 (0%)
 Strand = Plus / Minus

                                                                       
Query: 523 tgctcctctataataggcactcgtaatagcacggtatctctcctggccagcggtgtccca 582
           ||||||||| || || |||||||| | ||| |  || ||||||||||| |||||||||||
Sbjct: 387 tgctcctctgtagtatgcactcgtgacagctctatacctctcctggccggcggtgtccca 328

                                                                       
Query: 583 aatctgggccttgacgacctttgccgtcgacctggaggctgcgggtggcgaactcgaccc 642
            |||| ||||||||||  | |||  |||||   ||||| |||||||   ||||||||| |
Sbjct: 327 gatctaggccttgacggac-ttgtggtcgatgaggagggtgcgggtctggaactcgacgc 269

                                             
Query: 643 cgatggtggacttggattcgaggcagaactcgtt 676
           ||||||||| |||||| |||| | ||||||||||
Sbjct: 268 cgatggtggccttggagtcgatggagaactcgtt 235

---

>dbj|D12546.1|PEAGTPBP07 Pisum sativum mRNA for GTP-binding protein, complete cds,
           clone:pra7
          Length = 1067

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 145/182 (79%)
 Strand = Plus / Minus

                                                                       
Query: 413 agcatgacaacaatgctagggtcagtatgatctcttagctcttttagccagcgcgccaca 472
           |||||||| |||||| | ||||| || |||||||| | |||||| | ||| |  ||  ||
Sbjct: 431 agcatgaccacaatgttggggtctgtgtgatctctcaactctttcaaccacctggcagca 372

                                                                       
Query: 473 ttgtcgaatgtagccgggcgagtgacatcatacaccagcaacgcacctactgctcctcta 532
           || || ||||||||  |||| ||||||||||| || || || ||||| || |||||||  
Sbjct: 371 ttctcaaatgtagcacggcgtgtgacatcatagacaagtaaggcaccaacagctcctcgg 312

                                                                       
Query: 533 taataggcactcgtaatagcacggtatctctcctggccagcggtgtcccaaatctgggcc 592
           || || ||||| ||||| || |||||||| || || ||||| |||||||||||||| |||
Sbjct: 311 tagtaagcactagtaatggctcggtatctttcttgaccagcagtgtcccaaatctgagcc 252

             
Query: 593 tt 594
           ||
Sbjct: 251 tt 250

---

>ref|XM_476275.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 654

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 626 ggtggcgaactcgaccccgatggtggacttggattcgaggcagaa 670
           ||||||||||||||| ||||||||||||||||| |||||| ||||
Sbjct: 153 ggtggcgaactcgacgccgatggtggacttggagtcgagggagaa 109



 Score = 40.1 bits (20), Expect = 9.7
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 551 gcacggtatctctcctggccagcggtgtcccaaatctgggcctt 594
           ||||| ||||||||||| || || |||||||| ||||| |||||
Sbjct: 227 gcacgatatctctcctgtcctgctgtgtcccagatctgagcctt 184

---

>gb|BT017614.1| Zea mays clone EL01N0433D01.c mRNA sequence
          Length = 1229

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 626 ggtggcgaactcgaccccgatggtggacttggattcgaggcagaa 670
           ||||||||||||||| ||||||||||||||||| |||||| ||||
Sbjct: 395 ggtggcgaactcgacgccgatggtggacttggagtcgagggagaa 351

---

>gb|AC130609.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0048F12,
             complete sequence
          Length = 139627

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 42/45 (93%)
 Strand = Plus / Plus

                                                          
Query: 626   ggtggcgaactcgaccccgatggtggacttggattcgaggcagaa 670
             ||||||||||||||| ||||||||||||||||| |||||| ||||
Sbjct: 69545 ggtggcgaactcgacgccgatggtggacttggagtcgagggagaa 69589



 Score = 40.1 bits (20), Expect = 9.7
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                         
Query: 551   gcacggtatctctcctggccagcggtgtcccaaatctgggcctt 594
             ||||| ||||||||||| || || |||||||| ||||| |||||
Sbjct: 68437 gcacgatatctctcctgtcctgctgtgtcccagatctgagcctt 68480

---

>ref|XM_978657.1| PREDICTED: Mus musculus similar to Ras-related protein Rab-11B,
           transcript variant 2 (LOC669667), mRNA
          Length = 1618

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 88/105 (83%), Gaps = 1/105 (0%)
 Strand = Plus / Minus

                                                                       
Query: 545 gtaatagcacggtatctctcctggccagcggtgtcccaaatctgggccttgacgaccttt 604
           ||||| |||||||| | |||||||||||| |||||||| ||||| ||||||| |  | ||
Sbjct: 199 gtaatggcacggtagcgctcctggccagcagtgtcccagatctgagccttgatggtc-tt 141

                                                        
Query: 605 gccgtcgacctggaggctgcgggtggcgaactcgaccccgatggt 649
           |||||| ||||| | |||| | ||||||||||| || ||||||||
Sbjct: 140 gccgtccacctgaatgctgtgagtggcgaactccactccgatggt 96

---

>ref|XM_978704.1| PREDICTED: Mus musculus similar to Ras-related protein Rab-11B,
           transcript variant 3 (LOC669667), mRNA
          Length = 1750

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 88/105 (83%), Gaps = 1/105 (0%)
 Strand = Plus / Minus

                                                                       
Query: 545 gtaatagcacggtatctctcctggccagcggtgtcccaaatctgggccttgacgaccttt 604
           ||||| |||||||| | |||||||||||| |||||||| ||||| ||||||| |  | ||
Sbjct: 331 gtaatggcacggtagcgctcctggccagcagtgtcccagatctgagccttgatggtc-tt 273

                                                        
Query: 605 gccgtcgacctggaggctgcgggtggcgaactcgaccccgatggt 649
           |||||| ||||| | |||| | ||||||||||| || ||||||||
Sbjct: 272 gccgtccacctgaatgctgtgagtggcgaactccactccgatggt 228

---

>ref|XM_979126.1| PREDICTED: Mus musculus similar to Ras-related protein Rab-11B,
           transcript variant 2 (LOC665419), mRNA
          Length = 1618

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 88/105 (83%), Gaps = 1/105 (0%)
 Strand = Plus / Minus

                                                                       
Query: 545 gtaatagcacggtatctctcctggccagcggtgtcccaaatctgggccttgacgaccttt 604
           ||||| |||||||| | |||||||||||| |||||||| ||||| ||||||| |  | ||
Sbjct: 199 gtaatggcacggtagcgctcctggccagcagtgtcccagatctgagccttgatggtc-tt 141

                                                        
Query: 605 gccgtcgacctggaggctgcgggtggcgaactcgaccccgatggt 649
           |||||| ||||| | |||| | ||||||||||| || ||||||||
Sbjct: 140 gccgtccacctgaatgctgtgagtggcgaactccactccgatggt 96

---

>ref|XM_979168.1| PREDICTED: Mus musculus similar to Ras-related protein Rab-11B,
           transcript variant 3 (LOC665419), mRNA
          Length = 1750

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 88/105 (83%), Gaps = 1/105 (0%)
 Strand = Plus / Minus

                                                                       
Query: 545 gtaatagcacggtatctctcctggccagcggtgtcccaaatctgggccttgacgaccttt 604
           ||||| |||||||| | |||||||||||| |||||||| ||||| ||||||| |  | ||
Sbjct: 331 gtaatggcacggtagcgctcctggccagcagtgtcccagatctgagccttgatggtc-tt 273

                                                        
Query: 605 gccgtcgacctggaggctgcgggtggcgaactcgaccccgatggt 649
           |||||| ||||| | |||| | ||||||||||| || ||||||||
Sbjct: 272 gccgtccacctgaatgctgtgagtggcgaactccactccgatggt 228

---

>gb|AC129188.3| Mus musculus BAC clone RP23-446G23 from chromosome 19, complete sequence
          Length = 175245

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 88/105 (83%), Gaps = 1/105 (0%)
 Strand = Plus / Plus

                                                                          
Query: 545    gtaatagcacggtatctctcctggccagcggtgtcccaaatctgggccttgacgaccttt 604
              ||||| |||||||| | |||||||||||| |||||||| ||||| ||||||| |  | ||
Sbjct: 112336 gtaatggcacggtagcgctcctggccagcagtgtcccagatctgagccttgatggtc-tt 112394

                                                           
Query: 605    gccgtcgacctggaggctgcgggtggcgaactcgaccccgatggt 649
              |||||| ||||| | |||| | ||||||||||| || ||||||||
Sbjct: 112395 gccgtccacctgaatgctgtgagtggcgaactccactccgatggt 112439

---

>gb|AC163276.4| Mus musculus chromosome 19, clone RP24-316F20, complete sequence
          Length = 169300

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 88/105 (83%), Gaps = 1/105 (0%)
 Strand = Plus / Minus

                                                                          
Query: 545    gtaatagcacggtatctctcctggccagcggtgtcccaaatctgggccttgacgaccttt 604
              ||||| |||||||| | |||||||||||| |||||||| ||||| ||||||| |  | ||
Sbjct: 143701 gtaatggcacggtagcgctcctggccagcagtgtcccagatctgagccttgatggtc-tt 143643

                                                           
Query: 605    gccgtcgacctggaggctgcgggtggcgaactcgaccccgatggt 649
              |||||| ||||| | |||| | ||||||||||| || ||||||||
Sbjct: 143642 gccgtccacctgaatgctgtgagtggcgaactccactccgatggt 143598

---

>dbj|AP003760.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:OSJNBb0063G05
          Length = 182681

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 100/121 (82%), Gaps = 1/121 (0%)
 Strand = Plus / Minus

                                                                         
Query: 555   ggtatctctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacc 614
             |||| ||||| ||||| ||||||||||| |||||||||||||||| |  || ||||||| 
Sbjct: 75733 ggtacctctcttggccggcggtgtcccagatctgggccttgacgagc-ctgtcgtcgacg 75675

                                                                         
Query: 615   tggaggctgcgggtggcgaactcgaccccgatggtggacttggattcgaggcagaactcg 674
              ||| | |   ||||||||||||||| |||||||||||| |||  || |||| |||||||
Sbjct: 75674 cggacggtcttggtggcgaactcgacgccgatggtggacctggtctccaggctgaactcg 75615

              
Query: 675   t 675
             |
Sbjct: 75614 t 75614

---

>dbj|AK189626.1| Mus musculus cDNA, clone:Y0G0149M24, strand:plus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000066020, based on BLAT search
          Length = 296

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 88/105 (83%), Gaps = 1/105 (0%)
 Strand = Plus / Minus

                                                                       
Query: 545 gtaatagcacggtatctctcctggccagcggtgtcccaaatctgggccttgacgaccttt 604
           ||||| |||||||| | |||||||||||| |||||||| ||||| ||||||| |  | ||
Sbjct: 221 gtaatggcacggtagcgctcctggccagcagtgtcccagatctgagccttgatggtc-tt 163

                                                        
Query: 605 gccgtcgacctggaggctgcgggtggcgaactcgaccccgatggt 649
           |||||| ||||| | |||||| ||||||| ||| || ||||||||
Sbjct: 162 gccgtccacctgaatgctgcgagtggcgagctccactccgatggt 118

---

>dbj|AK120316.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013055N09, full
           insert sequence
          Length = 673

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 626 ggtggcgaactcgaccccgatggtggacttggattcgaggcagaa 670
           ||||||||||||||| ||||||||||||||||| |||||| ||||
Sbjct: 246 ggtggcgaactcgacgccgatggtggacttggagtcgagggagaa 202



 Score = 40.1 bits (20), Expect = 9.7
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 551 gcacggtatctctcctggccagcggtgtcccaaatctgggcctt 594
           ||||| ||||||||||| || || |||||||| ||||| |||||
Sbjct: 320 gcacgatatctctcctgtcctgctgtgtcccagatctgagcctt 277

---

>gb|AY105457.1| Zea mays PCO149506 mRNA sequence
          Length = 1074

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 626 ggtggcgaactcgaccccgatggtggacttggattcgaggcagaa 670
           ||||||||||||||| ||||||||||||||||| |||||| ||||
Sbjct: 309 ggtggcgaactcgacgccgatggtggacttggagtcgagggagaa 265

---

>dbj|D13152.1|RICRGP2 Oryza sativa (japonica cultivar-group) rgp2 mRNA for GTP binding
           protein, complete cds
          Length = 823

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 626 ggtggcgaactcgaccccgatggtggacttggattcgaggcagaa 670
           ||||||||||||||| ||||||||||||||||| |||||| ||||
Sbjct: 217 ggtggcgaactcgacgccgatggtggacttggagtcgagggagaa 173



 Score = 40.1 bits (20), Expect = 9.7
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 551 gcacggtatctctcctggccagcggtgtcccaaatctgggcctt 594
           ||||| ||||||||||| || || |||||||| ||||| |||||
Sbjct: 291 gcacgatatctctcctgtcctgctgtgtcccagatctgagcctt 248

---

>ref|NM_123942.1| Arabidopsis thaliana GTP binding AT5G45750 mRNA, complete cds
          Length = 1056

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 360 catcttcagttgaaacagccaccaagtggcgaaggtcagatttgttgccaactagcatga 419
           ||||||||||   ||||||||| |  ||||||||||||||||||||||| || |||||||
Sbjct: 623 catcttcagtctgaacagccacgagatggcgaaggtcagatttgttgcccacgagcatga 564

                   
Query: 420 caacaatg 427
           | ||||||
Sbjct: 563 ctacaatg 556



 Score = 48.1 bits (24), Expect = 0.040
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 630 gcgaactcgaccccgatggtggacttggattcgaggcagaactcgttcttggtgaa 685
           ||||||||||||||||| ||||| || || ||||| |  ||||||||||| |||||
Sbjct: 354 gcgaactcgaccccgatcgtggattttgactcgagactaaactcgttcttcgtgaa 299

---

>emb|Z73956.1|LJRAB11H L.japonicus mRNA for small GTP-binding protein, RAB11H
          Length = 1204

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                       
Query: 626 ggtggcgaactcgaccccgatggtggacttggattcgaggcagaactcgttcttggtgaa 685
           |||||| || || ||||| ||||||||||||||||| |||| |||||| |||||||||||
Sbjct: 372 ggtggcaaattcaaccccaatggtggacttggattcaaggctgaactcattcttggtgaa 313

---

>emb|CR732017.2|CNS0GRRQ Tetraodon nigroviridis full-length cDNA
          Length = 1248

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 603 ttgccgtcgacctggaggctgcgggtggcgaactcgaccccgatggtg 650
           |||||||||||||| | |||||| ||||||||||| ||||||||||||
Sbjct: 294 ttgccgtcgacctgaatgctgcgcgtggcgaactccaccccgatggtg 247

---

>emb|CR725844.2|CNS0GN0A Tetraodon nigroviridis full-length cDNA
          Length = 1287

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 603 ttgccgtcgacctggaggctgcgggtggcgaactcgaccccgatggtg 650
           |||||||||||||| | |||||| ||||||||||| ||||||||||||
Sbjct: 316 ttgccgtcgacctgaatgctgcgcgtggcgaactccaccccgatggtg 269

---

>emb|CR724419.1|CNS0GLWP Tetraodon nigroviridis full-length cDNA
          Length = 1272

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 603 ttgccgtcgacctggaggctgcgggtggcgaactcgaccccgatggtg 650
           |||||||||||||| | |||||| ||||||||||| ||||||||||||
Sbjct: 310 ttgccgtcgacctgaatgctgcgcgtggcgaactccaccccgatggtg 263

---

>gb|AY059111.1| Arabidopsis thaliana putative Rab-type small GTP-binding protein
           (At5g45750) mRNA, complete cds
          Length = 682

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 360 catcttcagttgaaacagccaccaagtggcgaaggtcagatttgttgccaactagcatga 419
           ||||||||||   ||||||||| |  ||||||||||||||||||||||| || |||||||
Sbjct: 421 catcttcagtctgaacagccacgagatggcgaaggtcagatttgttgcccacgagcatga 362

                   
Query: 420 caacaatg 427
           | ||||||
Sbjct: 361 ctacaatg 354



 Score = 48.1 bits (24), Expect = 0.040
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 630 gcgaactcgaccccgatggtggacttggattcgaggcagaactcgttcttggtgaa 685
           ||||||||||||||||| ||||| || || ||||| |  ||||||||||| |||||
Sbjct: 152 gcgaactcgaccccgatcgtggattttgactcgagactaaactcgttcttcgtgaa 97

---

>gb|AF370219.1| Arabidopsis thaliana putative Rab-type small GTP-binding protein
           (At5g45750) mRNA, complete cds
          Length = 1049

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 360 catcttcagttgaaacagccaccaagtggcgaaggtcagatttgttgccaactagcatga 419
           ||||||||||   ||||||||| |  ||||||||||||||||||||||| || |||||||
Sbjct: 616 catcttcagtctgaacagccacgagatggcgaaggtcagatttgttgcccacgagcatga 557

                   
Query: 420 caacaatg 427
           | ||||||
Sbjct: 556 ctacaatg 549



 Score = 48.1 bits (24), Expect = 0.040
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 630 gcgaactcgaccccgatggtggacttggattcgaggcagaactcgttcttggtgaa 685
           ||||||||||||||||| ||||| || || ||||| |  ||||||||||| |||||
Sbjct: 347 gcgaactcgaccccgatcgtggattttgactcgagactaaactcgttcttcgtgaa 292

---

>emb|BX833318.1|CNS09Z2Q Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL44ZE07 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 970

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 360 catcttcagttgaaacagccaccaagtggcgaaggtcagatttgttgccaactagcatga 419
           ||||||||||   ||||||||| |  ||||||||||||||||||||||| || |||||||
Sbjct: 595 catcttcagtctgaacagccacgagatggcgaaggtcagatttgttgcccacgagcatga 536

                   
Query: 420 caacaatg 427
           | ||||||
Sbjct: 535 ctacaatg 528



 Score = 48.1 bits (24), Expect = 0.040
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 630 gcgaactcgaccccgatggtggacttggattcgaggcagaactcgttcttggtgaa 685
           ||||||||||||||||| ||||| || || ||||| |  ||||||||||| |||||
Sbjct: 326 gcgaactcgaccccgatcgtggattttgactcgagactaaactcgttcttcgtgaa 271

---

>gb|AY084274.1| Arabidopsis thaliana clone 102017 mRNA, complete sequence
          Length = 1056

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 360 catcttcagttgaaacagccaccaagtggcgaaggtcagatttgttgccaactagcatga 419
           ||||||||||   ||||||||| |  ||||||||||||||||||||||| || |||||||
Sbjct: 623 catcttcagtctgaacagccacgagatggcgaaggtcagatttgttgcccacgagcatga 564

                   
Query: 420 caacaatg 427
           | ||||||
Sbjct: 563 ctacaatg 556



 Score = 48.1 bits (24), Expect = 0.040
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 630 gcgaactcgaccccgatggtggacttggattcgaggcagaactcgttcttggtgaa 685
           ||||||||||||||||| ||||| || || ||||| |  ||||||||||| |||||
Sbjct: 354 gcgaactcgaccccgatcgtggattttgactcgagactaaactcgttcttcgtgaa 299

---

>dbj|AB012245.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MRA19
          Length = 86722

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                         
Query: 360   catcttcagttgaaacagccaccaagtggcgaaggtcagatttgttgccaactagcatga 419
             ||||||||||   ||||||||| |  ||||||||||||||||||||||| || |||||||
Sbjct: 64455 catcttcagtctgaacagccacgagatggcgaaggtcagatttgttgcccacgagcatga 64396

                     
Query: 420   caacaatg 427
             | ||||||
Sbjct: 64395 ctacaatg 64388



 Score = 48.1 bits (24), Expect = 0.040
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                     
Query: 630   gcgaactcgaccccgatggtggacttggattcgaggcagaactcgttcttggtgaa 685
             ||||||||||||||||| ||||| || || ||||| |  ||||||||||| |||||
Sbjct: 63515 gcgaactcgaccccgatcgtggattttgactcgagactaaactcgttcttcgtgaa 63460

---

>emb|CR726838.2|CNS0GNRW Tetraodon nigroviridis full-length cDNA
          Length = 1202

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 77/90 (85%), Gaps = 3/90 (3%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcctggccagcggtgtcccaaatctgggccttga-cgacctttgccgtcgacctggagg 620
           |||||||||||| |||||||| |||||||| || | || |  |||||||| ||||||| |
Sbjct: 314 ctcctggccagccgtgtcccagatctgggcttttatcgtc--ttgccgtccacctggatg 257

                                         
Query: 621 ctgcgggtggcgaactcgaccccgatggtg 650
           ||||||||||| ||||| || |||||||||
Sbjct: 256 ctgcgggtggcaaactccacgccgatggtg 227

---

>emb|CR721379.2|CNS0GJK9 Tetraodon nigroviridis full-length cDNA
          Length = 912

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 77/90 (85%), Gaps = 3/90 (3%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcctggccagcggtgtcccaaatctgggccttga-cgacctttgccgtcgacctggagg 620
           |||||||||||| |||||||| |||||||| || | || |  |||||||| ||||||| |
Sbjct: 257 ctcctggccagccgtgtcccagatctgggcttttatcgtc--ttgccgtccacctggatg 200

                                         
Query: 621 ctgcgggtggcgaactcgaccccgatggtg 650
           ||||||||||| ||||| || |||||||||
Sbjct: 199 ctgcgggtggcaaactccacgccgatggtg 170

---

>emb|CR703337.2|CNS0G5N9 Tetraodon nigroviridis full-length cDNA
          Length = 1144

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 77/90 (85%), Gaps = 3/90 (3%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcctggccagcggtgtcccaaatctgggccttga-cgacctttgccgtcgacctggagg 620
           |||||||||||| |||||||||| |||||| || | || |  |||||||| ||||||| |
Sbjct: 296 ctcctggccagccgtgtcccaaaactgggcttttatcgtc--ttgccgtccacctggatg 239

                                         
Query: 621 ctgcgggtggcgaactcgaccccgatggtg 650
           ||||||||||| ||||| || |||||||||
Sbjct: 238 ctgcgggtggcaaactccacgccgatggtg 209

---

>emb|CR696136.2|CNS0G038 Tetraodon nigroviridis full-length cDNA
          Length = 1144

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 77/90 (85%), Gaps = 3/90 (3%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcctggccagcggtgtcccaaatctgggccttga-cgacctttgccgtcgacctggagg 620
           |||||||||||| |||||||| |||||||| || | || |  |||||||| ||||||| |
Sbjct: 289 ctcctggccagccgtgtcccagatctgggcttttatcgtc--ttgccgtccacctggatg 232

                                         
Query: 621 ctgcgggtggcgaactcgaccccgatggtg 650
           ||||||||||| ||||| || |||||||||
Sbjct: 231 ctgcgggtggcaaactccacgccgatggtg 202

---

>emb|CR693620.2|CNS0FY5C Tetraodon nigroviridis full-length cDNA
          Length = 1130

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 77/90 (85%), Gaps = 3/90 (3%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcctggccagcggtgtcccaaatctgggccttga-cgacctttgccgtcgacctggagg 620
           |||||||||||| |||||||| |||||||| || | || |  |||||||| ||||||| |
Sbjct: 284 ctcctggccagccgtgtcccagatctgggcttttatcgtc--ttgccgtccacctggatg 227

                                         
Query: 621 ctgcgggtggcgaactcgaccccgatggtg 650
           ||||||||||| ||||| || |||||||||
Sbjct: 226 ctgcgggtggcaaactccacgccgatggtg 197

---

>emb|CR691488.1|CNS0FWI4 Tetraodon nigroviridis full-length cDNA
          Length = 1820

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 77/90 (85%), Gaps = 3/90 (3%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcctggccagcggtgtcccaaatctgggccttga-cgacctttgccgtcgacctggagg 620
           |||||||||||| |||||||| |||||||| || | || |  |||||||| ||||||| |
Sbjct: 266 ctcctggccagccgtgtcccagatctgggcttttatcgtc--ttgccgtccacctggatg 209

                                         
Query: 621 ctgcgggtggcgaactcgaccccgatggtg 650
           ||||||||||| ||||| || |||||||||
Sbjct: 208 ctgcgggtggcaaactccacgccgatggtg 179

---

>emb|CR690348.1|CNS0FVMG Tetraodon nigroviridis full-length cDNA
          Length = 1708

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 77/90 (85%), Gaps = 3/90 (3%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcctggccagcggtgtcccaaatctgggccttga-cgacctttgccgtcgacctggagg 620
           |||||||||||| |||||||| |||||||| || | || |  |||||||| ||||||| |
Sbjct: 219 ctcctggccagccgtgtcccagatctgggcttttatcgtc--ttgccgtccacctggatg 162

                                         
Query: 621 ctgcgggtggcgaactcgaccccgatggtg 650
           ||||||||||| ||||| || |||||||||
Sbjct: 161 ctgcgggtggcaaactccacgccgatggtg 132

---

>emb|CR670562.2|CNS0FGDK Tetraodon nigroviridis full-length cDNA
          Length = 918

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 77/90 (85%), Gaps = 3/90 (3%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcctggccagcggtgtcccaaatctgggccttga-cgacctttgccgtcgacctggagg 620
           |||||||||||| |||||||| |||||||| || | || |  |||||||| ||||||| |
Sbjct: 257 ctcctggccagccgtgtcccagatctgggcttttatcgtc--ttgccgtccacctggatg 200

                                         
Query: 621 ctgcgggtggcgaactcgaccccgatggtg 650
           ||||||||||| ||||| || |||||||||
Sbjct: 199 ctgcgggtggcaaactccacgccgatggtg 170

---

>emb|CR670147.2|CNS0FG21 Tetraodon nigroviridis full-length cDNA
          Length = 1009

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 77/90 (85%), Gaps = 3/90 (3%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcctggccagcggtgtcccaaatctgggccttga-cgacctttgccgtcgacctggagg 620
           |||||||||||| |||||||| |||||||| || | || |  |||||||| ||||||| |
Sbjct: 303 ctcctggccagccgtgtcccagatctgggcttttatcgtc--ttgccgtccacctggatg 246

                                         
Query: 621 ctgcgggtggcgaactcgaccccgatggtg 650
           ||||||||||| ||||| || |||||||||
Sbjct: 245 ctgcgggtggcaaactccacgccgatggtg 216

---

>emb|CR657336.2|CNS0F666 Tetraodon nigroviridis full-length cDNA
          Length = 1013

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 77/90 (85%), Gaps = 3/90 (3%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcctggccagcggtgtcccaaatctgggccttga-cgacctttgccgtcgacctggagg 620
           |||||||||||| |||||||| |||||||| || | || |||  |||||| ||||||| |
Sbjct: 301 ctcctggccagccgtgtcccagatctgggcttttatcgtcct--gccgtccacctggatg 244

                                         
Query: 621 ctgcgggtggcgaactcgaccccgatggtg 650
           ||||||||||| ||||| || |||||||||
Sbjct: 243 ctgcgggtggcaaactccacgccgatggtg 214

---

>emb|CR640051.2|CNS0ESU1 Tetraodon nigroviridis full-length cDNA
          Length = 1154

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 77/90 (85%), Gaps = 3/90 (3%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcctggccagcggtgtcccaaatctgggccttga-cgacctttgccgtcgacctggagg 620
           |||||||||||| |||||||| |||||||| || | || |  |||||||| ||||||| |
Sbjct: 297 ctcctggccagccgtgtcccagatctgggcttttatcgtc--ttgccgtccacctggatg 240

                                         
Query: 621 ctgcgggtggcgaactcgaccccgatggtg 650
           ||||||||||| ||||| || |||||||||
Sbjct: 239 ctgcgggtggcaaactccacgccgatggtg 210

---

>emb|CR639739.2|CNS0ESLD Tetraodon nigroviridis full-length cDNA
          Length = 1125

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 77/90 (85%), Gaps = 3/90 (3%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcctggccagcggtgtcccaaatctgggccttga-cgacctttgccgtcgacctggagg 620
           |||||||||||| |||||||| |||||||| || | || |  |||||||| ||||||| |
Sbjct: 282 ctcctggccagccgtgtcccagatctgggcttttatcgtc--ttgccgtccacctggatg 225

                                         
Query: 621 ctgcgggtggcgaactcgaccccgatggtg 650
           ||||||||||| ||||| || |||||||||
Sbjct: 224 ctgcgggtggcaaactccacgccgatggtg 195

---

>emb|CR637627.2|CNS0EQYP Tetraodon nigroviridis full-length cDNA
          Length = 1169

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 77/90 (85%), Gaps = 3/90 (3%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcctggccagcggtgtcccaaatctgggccttga-cgacctttgccgtcgacctggagg 620
           |||||||||||| |||||||| |||||||| || | || |  |||||||| ||||||| |
Sbjct: 310 ctcctggccagccgtgtcccagatctgggcttttatcgtc--ttgccgtccacctggatg 253

                                         
Query: 621 ctgcgggtggcgaactcgaccccgatggtg 650
           ||||||||||| ||||| || |||||||||
Sbjct: 252 ctgcgggtggcaaactccacgccgatggtg 223

---

>gb|DQ242522.1| Gracilaria lemaneiformis small GTPase Rab11-D mRNA, complete cds.~~
          Length = 886

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 627 gtggcgaactcgaccccgatggtggacttggattcgaggcagaactcgtt 676
           ||||| |||||||| || |||||||||||||| ||||||| |||||||||
Sbjct: 380 gtggcaaactcgacgcctatggtggacttggactcgaggctgaactcgtt 331

---

>ref|XM_483418.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 984

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 562 ctcctggccagcggtgtcccaaatctgggccttgacgacctt 603
           ||||||||| ||||||||||| ||||||||||||||| ||||
Sbjct: 346 ctcctggccggcggtgtcccagatctgggccttgacgtcctt 305

---

>gb|DQ019225.2| Gracilaria lemaneiformis small GTPase Rab11 (GLRab) gene, complete
           cds
          Length = 1136

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 627 gtggcgaactcgaccccgatggtggacttggattcgaggcagaactcgtt 676
           ||||| |||||||| || |||||||||||||| ||||||| |||||||||
Sbjct: 353 gtggcaaactcgacgcctatggtggacttggactcgaggctgaactcgtt 304

---

>gb|BT013111.1| Lycopersicon esculentum clone 114398R, mRNA sequence
          Length = 946

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 90/110 (81%)
 Strand = Plus / Minus

                                                                       
Query: 494 gtgacatcatacaccagcaacgcacctactgctcctctataataggcactcgtaatagca 553
           ||||||||||| || ||||| || || || ||||||| ||| ||||||||||| || || 
Sbjct: 369 gtgacatcatagacaagcaatgctccaacagctcctcgatagtaggcactcgtgattgcg 310

                                                             
Query: 554 cggtatctctcctggccagcggtgtcccaaatctgggccttgacgacctt 603
           || ||||  ||||| || || || ||||||||||| |||||||| |||||
Sbjct: 309 cgatatcgttcctgaccggcagtatcccaaatctgagccttgacaacctt 260

---

>ref|XM_384503.1| Gibberella zeae PH-1 chromosome 2 hypothetical protein (FG04327.1)
           partial mRNA
          Length = 600

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 627 gtggcgaactcgaccccgatggtggacttggattcgaggcagaactcgtt 676
           |||||||||||||| |||||||| |||||||| ||||||  |||||||||
Sbjct: 104 gtggcgaactcgacgccgatggtcgacttggagtcgaggttgaactcgtt 55



 Score = 48.1 bits (24), Expect = 0.040
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 545 gtaatagcacggtatctctcctggccagcggtgtcccaaatctgggccttga 596
           ||||| || ||||||| ||| || |||||||| ||||| |||||||||||||
Sbjct: 185 gtaatggcgcggtatcgctcttgtccagcggtatcccagatctgggccttga 134

---

>emb|X63874.1|NPYPT3 N.plumbaginifolia mRNA Np-ypt3
          Length = 1044

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 81/98 (82%)
 Strand = Plus / Minus

                                                                       
Query: 491 cgagtgacatcatacaccagcaacgcacctactgctcctctataataggcactcgtaata 550
           ||||| |||||||| || ||||| || || || ||||| | |||||| ||||| ||||| 
Sbjct: 365 cgagttacatcatatacgagcaaagcgccaacagctccccgataataagcactagtaatg 306

                                                 
Query: 551 gcacggtatctctcctggccagcggtgtcccaaatctg 588
           ||||| ||||| || |||||||| || |||||||||||
Sbjct: 305 gcacgatatctttcttggccagcagtatcccaaatctg 268



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 68/83 (81%)
 Strand = Plus / Minus

                                                                       
Query: 365 tcagttgaaacagccaccaagtggcgaaggtcagatttgttgccaactagcatgacaaca 424
           |||||||||||||| || |  ||||| || || || |||||||| |  ||||| || |||
Sbjct: 491 tcagttgaaacagcaacgagatggcggagatctgacttgttgcctatgagcataactaca 432

                                  
Query: 425 atgctagggtcagtatgatctct 447
           ||| ||||||||||||| |||||
Sbjct: 431 atgttagggtcagtatggtctct 409

---

>gb|DQ062156.1| Gracilaria lemaneiformis small GTPase rab11-3 (rab11) mRNA,
           complete cds
          Length = 737

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 627 gtggcgaactcgaccccgatggtggacttggattcgaggcagaactcgtt 676
           ||||| |||||||| || |||||||||||||| ||||||| |||||||||
Sbjct: 232 gtggcaaactcgacgcctatggtggacttggactcgaggctgaactcgtt 183

---

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                          
Query: 562      ctcctggccagcggtgtcccaaatctgggccttgacgacctt 603
                ||||||||| ||||||||||| ||||||||||||||| ||||
Sbjct: 26115911 ctcctggccggcggtgtcccagatctgggccttgacgtcctt 26115952

---

>dbj|AP003888.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1191_A10
          Length = 140643

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                       
Query: 562   ctcctggccagcggtgtcccaaatctgggccttgacgacctt 603
             ||||||||| ||||||||||| ||||||||||||||| ||||
Sbjct: 59842 ctcctggccggcggtgtcccagatctgggccttgacgtcctt 59883

---

>dbj|AK103220.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033122O18, full
           insert sequence
          Length = 984

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 562 ctcctggccagcggtgtcccaaatctgggccttgacgacctt 603
           ||||||||| ||||||||||| ||||||||||||||| ||||
Sbjct: 346 ctcctggccggcggtgtcccagatctgggccttgacgtcctt 305

---

>gb|AY904354.1| Gracilariopsis lemaneiformis small GTPase (Rab) mRNA, complete cds
          Length = 1128

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 627 gtggcgaactcgaccccgatggtggacttggattcgaggcagaactcgtt 676
           ||||| |||||||| || |||||||||||||| ||||||| |||||||||
Sbjct: 329 gtggcaaactcgacgcctatggtggacttggactcgaggctgaactcgtt 280

---

>ref|NM_101553.2| Arabidopsis thaliana RAB11; GTP binding AT1G16920 (RAB11) mRNA,
           complete cds
          Length = 912

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 69/81 (85%), Gaps = 1/81 (1%)
 Strand = Plus / Minus

                                                                       
Query: 533 taataggcactcgtaatagcacggtatctctcctggccagcggtgtcccaaatctgggcc 592
           ||||| ||||| || || |||||||| |||||||| ||||| |||||||||||||| || 
Sbjct: 350 taatatgcactagtgatggcacggtacctctcctgaccagcagtgtcccaaatctgagct 291

                                
Query: 593 ttgacgacctttgccgtcgac 613
           || |||| ||||||| |||||
Sbjct: 290 ttaacga-ctttgccatcgac 271



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 373 aacagccaccaagtggcgaaggtcagatttgttgccaactagcatgacaacaatg 427
           |||||| | ||||||||| || ||||||||||| ||||| ||||| || ||||||
Sbjct: 510 aacagctagcaagtggcggagatcagatttgttaccaaccagcatcactacaatg 456

---

>ref|NM_100520.2| Arabidopsis thaliana ARA2; GTP binding AT1G06400 (ARA2) mRNA,
           complete cds
          Length = 937

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 141/177 (79%), Gaps = 1/177 (0%)
 Strand = Plus / Minus

                                                                       
Query: 509 agcaacgcacctactgctcctctataataggcactcgtaatagcacggtatctctcctgg 568
           ||||| ||||| || |||||||| ||||| || || || || || ||||||||||| || 
Sbjct: 313 agcaaagcaccaacagctcctctgtaataagcgcttgtgattgctcggtatctctcttga 254

                                                                       
Query: 569 ccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggctgcgggt 628
           ||||| || ||||||||||| || |||||||| |||||| ||||| |    | |   |||
Sbjct: 253 ccagcagtatcccaaatctgagctttgacgac-tttgccttcgactttagtggttttggt 195

                                                                    
Query: 629 ggcgaactcgaccccgatggtggacttggattcgaggcagaactcgttcttggtgaa 685
            |||||||| || || || || ||||||||||||||   ||||||||||||||||||
Sbjct: 194 agcgaactcaacaccaatagtagacttggattcgagattgaactcgttcttggtgaa 138

---

>emb|Z71276.1|MIRABX M.indica mRNA for small GTPase
          Length = 1109

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 92/113 (81%)
 Strand = Plus / Minus

                                                                       
Query: 491 cgagtgacatcatacaccagcaacgcacctactgctcctctataataggcactcgtaata 550
           ||||| |||||||||||||| |  ||||| || ||||| |  || || ||||| || || 
Sbjct: 498 cgagttacatcatacaccagaagggcaccaacagctccacggtagtaagcactggttatg 439

                                                                
Query: 551 gcacggtatctctcctggccagcggtgtcccaaatctgggccttgacgacctt 603
           |||||||| || || |||||||| || ||||||||||| ||||||| ||||||
Sbjct: 438 gcacggtacctttcttggccagcagtatcccaaatctgagccttgatgacctt 386

---

>gb|AF332428.1| Arabidopsis thaliana putative GTP-binding protein RAB11D
           (At1g06400) mRNA, complete cds
          Length = 651

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 141/177 (79%), Gaps = 1/177 (0%)
 Strand = Plus / Minus

                                                                       
Query: 509 agcaacgcacctactgctcctctataataggcactcgtaatagcacggtatctctcctgg 568
           ||||| ||||| || |||||||| ||||| || || || || || ||||||||||| || 
Sbjct: 272 agcaaagcaccaacagctcctctgtaataagcgcttgtgattgctcggtatctctcttga 213

                                                                       
Query: 569 ccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggctgcgggt 628
           ||||| || ||||||||||| || |||||||| |||||| ||||| |    | |   |||
Sbjct: 212 ccagcagtatcccaaatctgagctttgacgac-tttgccttcgactttagtggttttggt 154

                                                                    
Query: 629 ggcgaactcgaccccgatggtggacttggattcgaggcagaactcgttcttggtgaa 685
            |||||||| || || || || ||||||||||||||   ||||||||||||||||||
Sbjct: 153 agcgaactcaacaccaatagtagacttggattcgagattgaactcgttcttggtgaa 97

---

>gb|AY096439.1| Arabidopsis thaliana putative GTP-binding protein (At1g06400) mRNA,
           complete cds
          Length = 682

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 141/177 (79%), Gaps = 1/177 (0%)
 Strand = Plus / Minus

                                                                       
Query: 509 agcaacgcacctactgctcctctataataggcactcgtaatagcacggtatctctcctgg 568
           ||||| ||||| || |||||||| ||||| || || || || || ||||||||||| || 
Sbjct: 272 agcaaagcaccaacagctcctctgtaataagcgcttgtgattgctcggtatctctcttga 213

                                                                       
Query: 569 ccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggctgcgggt 628
           ||||| || ||||||||||| || |||||||| |||||| ||||| |    | |   |||
Sbjct: 212 ccagcagtatcccaaatctgagctttgacgac-tttgccttcgactttagtggttttggt 154

                                                                    
Query: 629 ggcgaactcgaccccgatggtggacttggattcgaggcagaactcgttcttggtgaa 685
            |||||||| || || || || ||||||||||||||   ||||||||||||||||||
Sbjct: 153 agcgaactcaacaccaatagtagacttggattcgagattgaactcgttcttggtgaa 97

---

>gb|AY065306.1| Arabidopsis thaliana putative GTP-binding protein RAB11D
           (At1g06400) mRNA, complete cds
          Length = 957

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 141/177 (79%), Gaps = 1/177 (0%)
 Strand = Plus / Minus

                                                                       
Query: 509 agcaacgcacctactgctcctctataataggcactcgtaatagcacggtatctctcctgg 568
           ||||| ||||| || |||||||| ||||| || || || || || ||||||||||| || 
Sbjct: 317 agcaaagcaccaacagctcctctgtaataagcgcttgtgattgctcggtatctctcttga 258

                                                                       
Query: 569 ccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggctgcgggt 628
           ||||| || ||||||||||| || |||||||| |||||| ||||| |    | |   |||
Sbjct: 257 ccagcagtatcccaaatctgagctttgacgac-tttgccttcgactttagtggttttggt 199

                                                                    
Query: 629 ggcgaactcgaccccgatggtggacttggattcgaggcagaactcgttcttggtgaa 685
            |||||||| || || || || ||||||||||||||   ||||||||||||||||||
Sbjct: 198 agcgaactcaacaccaatagtagacttggattcgagattgaactcgttcttggtgaa 142

---

>gb|BT006406.1| Arabidopsis thaliana At1g16920 gene, complete cds
          Length = 651

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 69/81 (85%), Gaps = 1/81 (1%)
 Strand = Plus / Minus

                                                                       
Query: 533 taataggcactcgtaatagcacggtatctctcctggccagcggtgtcccaaatctgggcc 592
           ||||| ||||| || || |||||||| |||||||| ||||| |||||||||||||| || 
Sbjct: 248 taatatgcactagtgatggcacggtacctctcctgaccagcagtgtcccaaatctgagct 189

                                
Query: 593 ttgacgacctttgccgtcgac 613
           || |||| ||||||| |||||
Sbjct: 188 ttaacga-ctttgccatcgac 169



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 373 aacagccaccaagtggcgaaggtcagatttgttgccaactagcatgacaacaatg 427
           |||||| | ||||||||| || ||||||||||| ||||| ||||| || ||||||
Sbjct: 408 aacagctagcaagtggcggagatcagatttgttaccaaccagcatcactacaatg 354

---

>emb|BX815056.1|CNS0ACVQ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS2ZC06 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 831

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 141/177 (79%), Gaps = 1/177 (0%)
 Strand = Plus / Minus

                                                                       
Query: 509 agcaacgcacctactgctcctctataataggcactcgtaatagcacggtatctctcctgg 568
           ||||| ||||| || |||||||| ||||| || || || || || ||||||||||| || 
Sbjct: 289 agcaaagcaccaacagctcctctgtaataagcgcttgtgattgctcggtatctctcttga 230

                                                                       
Query: 569 ccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggctgcgggt 628
           ||||| || ||||||||||| || |||||||| |||||| ||||| |    | |   |||
Sbjct: 229 ccagcagtatcccaaatctgagctttgacgac-tttgccttcgactttagtggttttggt 171

                                                                    
Query: 629 ggcgaactcgaccccgatggtggacttggattcgaggcagaactcgttcttggtgaa 685
            |||||||| || || || || ||||||||||||||   ||||||||||||||||||
Sbjct: 170 agcgaactcaacaccaatagtagacttggattcgagattgaactcgttcttggtgaa 114

---

>gb|AY086881.1| Arabidopsis thaliana clone 2904 mRNA, complete sequence
          Length = 895

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 69/81 (85%), Gaps = 1/81 (1%)
 Strand = Plus / Minus

                                                                       
Query: 533 taataggcactcgtaatagcacggtatctctcctggccagcggtgtcccaaatctgggcc 592
           ||||| ||||| || || |||||||| |||||||| ||||| |||||||||||||| || 
Sbjct: 351 taatatgcactagtgatggcacggtacctctcctgaccagcagtgtcccaaatctgagct 292

                                
Query: 593 ttgacgacctttgccgtcgac 613
           || |||| ||||||| |||||
Sbjct: 291 ttaacga-ctttgccatcgac 272



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 373 aacagccaccaagtggcgaaggtcagatttgttgccaactagcatgacaacaatg 427
           |||||| | ||||||||| || ||||||||||| ||||| ||||| || ||||||
Sbjct: 511 aacagctagcaagtggcggagatcagatttgttaccaaccagcatcactacaatg 457

---

>dbj|D01024.1|ATHARA2 Arabidopsis thaliana mRNA for small GTP-binding protein (ara-2),
           complete cds
          Length = 844

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 141/177 (79%), Gaps = 1/177 (0%)
 Strand = Plus / Minus

                                                                       
Query: 509 agcaacgcacctactgctcctctataataggcactcgtaatagcacggtatctctcctgg 568
           ||||| ||||| || |||||||| ||||| || || || || || ||||||||||| || 
Sbjct: 305 agcaaagcaccaacagctcctctgtaataagcgcttgtgattgctcggtatctctcttga 246

                                                                       
Query: 569 ccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggctgcgggt 628
           ||||| || ||||||||||| || |||||||| |||||| ||||| |    | |   |||
Sbjct: 245 ccagcagtatcccaaatctgagctttgacgac-tttgccttcgactttagtggttttggt 187

                                                                    
Query: 629 ggcgaactcgaccccgatggtggacttggattcgaggcagaactcgttcttggtgaa 685
            |||||||| || || || || ||||||||||||||   ||||||||||||||||||
Sbjct: 186 agcgaactcaacaccaatagtagacttggattcgagattgaactcgttcttggtgaa 130

---

>gb|L18883.1|ATHSGBP Arabidopsis thaliana small GTP-binding protein (Rab11) mRNA,
           complete cds
          Length = 854

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 69/81 (85%), Gaps = 1/81 (1%)
 Strand = Plus / Minus

                                                                       
Query: 533 taataggcactcgtaatagcacggtatctctcctggccagcggtgtcccaaatctgggcc 592
           ||||| ||||| || || |||||||| |||||||| ||||| |||||||||||||| || 
Sbjct: 302 taatatgcactagtgatggcacggtacctctcctgaccagcagtgtcccaaatctgagct 243

                                
Query: 593 ttgacgacctttgccgtcgac 613
           || |||| ||||||| |||||
Sbjct: 242 ttaacga-ctttgccatcgac 223



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 373 aacagccaccaagtggcgaaggtcagatttgttgccaactagcatgacaacaatg 427
           |||||| | ||||||||| || ||||||||||| ||||| ||||| || ||||||
Sbjct: 462 aacagctagcaagtggcggagatcagatttgttaccaaccagcatcactacaatg 408

---

>ref|NM_117956.2| Arabidopsis thaliana GTP binding AT4G18430 mRNA, complete cds
          Length = 897

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 134/168 (79%), Gaps = 1/168 (0%)
 Strand = Plus / Minus

                                                                       
Query: 521 actgctcctctataataggcactcgtaatagcacggtatctctcctggccagcggtgtcc 580
           ||||||||||| || || |||||||| || || | |||||| || || ||||||||||||
Sbjct: 317 actgctcctctgtagtatgcactcgtgattgctctgtatctttcttgaccagcggtgtcc 258

                                                                       
Query: 581 caaatctgggccttgacgacctttgccgtcgacctggaggctgcgggtggcgaactcgac 640
           |||| ||| || |||| ||  ||| | |||||| || |  || |  ||||||||||||||
Sbjct: 257 caaagctgagctttgatgattttttc-gtcgacatgaacacttcttgtggcgaactcgac 199

                                                           
Query: 641 cccgatggtggacttggattcgaggcagaactcgttcttggtgaagcg 688
            |||||||| ||||| || |||| || ||| |||||  ||||||||||
Sbjct: 198 accgatggttgactttgactcgatgctgaattcgtttctggtgaagcg 151

---

>ref|XM_951879.1| Neurospora crassa OR74A hypothetical protein ( (NM_017382) RAB11a,
           member RAS oncogene family [Mus musculus]
           sp|Q9JLX1|R11A_MOUSE RAS-RELATED PROTEIN R> (NCU01523.1)
           partial mRNA
          Length = 645

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 633 aactcgaccccgatggtggacttggattcgaggcagaactcgtt 676
           |||||||| ||||||||||||||||| ||||||  |||||||||
Sbjct: 137 aactcgacgccgatggtggacttggagtcgaggttgaactcgtt 94



 Score = 44.1 bits (22), Expect = 0.62
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 563 tcctggccagcggtgtcccaaatctgggccttga 596
           ||||||||||| || ||||||||||| |||||||
Sbjct: 206 tcctggccagcagtatcccaaatctgtgccttga 173

---

>ref|XM_327961.1| Neurospora crassa OR74A hypothetical protein ( (NM_017382) RAB11a,
           member RAS oncogene family [Mus musculus]
           sp|Q9JLX1|R11A_MOUSE RAS-RELATED PROTEIN R> (NCU01523.1)
           partial mRNA
          Length = 645

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 633 aactcgaccccgatggtggacttggattcgaggcagaactcgtt 676
           |||||||| ||||||||||||||||| ||||||  |||||||||
Sbjct: 137 aactcgacgccgatggtggacttggagtcgaggttgaactcgtt 94



 Score = 44.1 bits (22), Expect = 0.62
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 563 tcctggccagcggtgtcccaaatctgggccttga 596
           ||||||||||| || ||||||||||| |||||||
Sbjct: 206 tcctggccagcagtatcccaaatctgtgccttga 173

---

>gb|AY550123.1| Saussurea medusa GTP binding-protein-like mRNA, partial sequence
          Length = 667

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 539 gcactcgtaatagcacggtatctctcctggccagcggtgtcccaaatctgggcctt 594
           ||||| ||||| |||||||| |  ||||||||||| |||||||||||||| |||||
Sbjct: 287 gcacttgtaattgcacggtaccgttcctggccagcagtgtcccaaatctgcgcctt 232

---

>gb|BT012784.1| Lycopersicon esculentum clone 113774R, mRNA sequence
          Length = 1002

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 515 gcacctactgctcctctataataggcactcgtaatagcacggtatctctcctggccagcg 574
           ||||| |||||||||| |||||| ||||| ||||| || ||||| || || || || || 
Sbjct: 390 gcaccaactgctcctcgataataagcactggtaatggctcggtacctttcttgccctgca 331

                               
Query: 575 gtgtcccaaatctgggcctt 594
           |||||||| |||||||||||
Sbjct: 330 gtgtcccatatctgggcctt 311

---

>gb|BT011645.1| Arabidopsis thaliana At4g18430 mRNA, complete cds
          Length = 654

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 134/168 (79%), Gaps = 1/168 (0%)
 Strand = Plus / Minus

                                                                       
Query: 521 actgctcctctataataggcactcgtaatagcacggtatctctcctggccagcggtgtcc 580
           ||||||||||| || || |||||||| || || | |||||| || || ||||||||||||
Sbjct: 260 actgctcctctgtagtatgcactcgtgattgctctgtatctttcttgaccagcggtgtcc 201

                                                                       
Query: 581 caaatctgggccttgacgacctttgccgtcgacctggaggctgcgggtggcgaactcgac 640
           |||| ||| || |||| ||  ||| | |||||| || |  || |  ||||||||||||||
Sbjct: 200 caaagctgagctttgatgattttttc-gtcgacatgaacacttcttgtggcgaactcgac 142

                                                           
Query: 641 cccgatggtggacttggattcgaggcagaactcgttcttggtgaagcg 688
            |||||||| ||||| || |||| || ||| |||||  ||||||||||
Sbjct: 141 accgatggttgactttgactcgatgctgaattcgtttctggtgaagcg 94

---

>emb|CR933463.1| Paramecium tetraurelia, Small GTPase rab, putative, complete gene
          Length = 3001

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 61/72 (84%)
 Strand = Plus / Plus

                                                                        
Query: 514  cgcacctactgctcctctataataggcactcgtaatagcacggtatctctcctggccagc 573
            |||||| |||||||||| |||||| ||    || ||||| | ||||||||||||||||||
Sbjct: 1515 cgcaccaactgctcctcgataataagctgatgttatagccctgtatctctcctggccagc 1574

                        
Query: 574  ggtgtcccaaat 585
             |||||||||||
Sbjct: 1575 tgtgtcccaaat 1586

---

>gb|BT010933.1| Arabidopsis thaliana At4g18430 gene, complete cds
          Length = 885

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 134/168 (79%), Gaps = 1/168 (0%)
 Strand = Plus / Minus

                                                                       
Query: 521 actgctcctctataataggcactcgtaatagcacggtatctctcctggccagcggtgtcc 580
           ||||||||||| || || |||||||| || || | |||||| || || ||||||||||||
Sbjct: 317 actgctcctctgtagtatgcactcgtgattgctctgtatctttcttgaccagcggtgtcc 258

                                                                       
Query: 581 caaatctgggccttgacgacctttgccgtcgacctggaggctgcgggtggcgaactcgac 640
           |||| ||| || |||| ||  ||| | |||||| || |  || |  ||||||||||||||
Sbjct: 257 caaagctgagctttgatgattttttc-gtcgacatgaacacttcttgtggcgaactcgac 199

                                                           
Query: 641 cccgatggtggacttggattcgaggcagaactcgttcttggtgaagcg 688
            |||||||| ||||| || |||| || ||| |||||  ||||||||||
Sbjct: 198 accgatggttgactttgactcgatgctgaattcgtttctggtgaagcg 151

---

>emb|CR719388.2|CNS0GI0Y Tetraodon nigroviridis full-length cDNA
          Length = 1204

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 603 ttgccgtcgacctggaggctgcgggtggcgaactcgaccccgatggtg 650
           |||||||| ||||||| |||||||||||| ||||| || |||||||||
Sbjct: 275 ttgccgtccacctggatgctgcgggtggcaaactccacgccgatggtg 228

---

>emb|AL670003.1|NCB9G16 Neurospora crassa DNA linkage group II BAC clone B9G16
          Length = 69187

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                         
Query: 633   aactcgaccccgatggtggacttggattcgaggcagaactcgtt 676
             |||||||| ||||||||||||||||| ||||||  |||||||||
Sbjct: 31262 aactcgacgccgatggtggacttggagtcgaggttgaactcgtt 31219



 Score = 44.1 bits (22), Expect = 0.62
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                               
Query: 563   tcctggccagcggtgtcccaaatctgggccttga 596
             ||||||||||| || ||||||||||| |||||||
Sbjct: 31331 tcctggccagcagtatcccaaatctgtgccttga 31298

---

>gb|AC090054.2|AC090054 Oryza sativa chromosome 9 clone PAC0645D04, complete sequence
          Length = 139050

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                                 
Query: 563   tcctggccagcggtgtcccaaatctgggccttgacg 598
             |||||||| ||||||||||| |||||||||||||||
Sbjct: 75624 tcctggccggcggtgtcccagatctgggccttgacg 75589

---

>dbj|AP006727.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0645D04
          Length = 142890

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                                 
Query: 563   tcctggccagcggtgtcccaaatctgggccttgacg 598
             |||||||| ||||||||||| |||||||||||||||
Sbjct: 79395 tcctggccggcggtgtcccagatctgggccttgacg 79360

---

>gb|AY106908.1| Zea mays PCO095284 mRNA sequence
          Length = 620

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 562 ctcctggccagcggtgtcccaaatctgggccttgac 597
           ||||||||| ||||||||||| ||||||||||||||
Sbjct: 472 ctcctggccggcggtgtcccagatctgggccttgac 437

---

>dbj|AP004977.1| Lotus japonicus genomic DNA, chromosome 3, clone:LjT12A10, TM0160,
             complete sequence
          Length = 74313

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 73/87 (83%), Gaps = 1/87 (1%)
 Strand = Plus / Plus

                                                                         
Query: 620   gctgcgggtggcgaactcgaccccgatggtggacttggattcgaggcagaactcgttctt 679
             ||||||||||||||| || || ||||||||||||||||| || | |  ||||||||||  
Sbjct: 11655 gctgcgggtggcgaattcaacgccgatggtggacttggactccaagttgaactcgttccg 11714

                                        
Query: 680   ggtgaagcgcgagangcaggttggact 706
             |||||| || || | ||||||||||||
Sbjct: 11715 ggtgaatcgaga-aagcaggttggact 11740



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                         
Query: 497   acatcatacaccagcaacgcacctactgctcctctataataggcactcgtaatagcacgg 556
             ||||||||||| | ||| ||||| || ||||||||||| || ||||| || || ||||||
Sbjct: 10440 acatcatacacaatcaatgcaccaacagctcctctatagtaagcacttgtgattgcacgg 10499

                  
Query: 557   tatct 561
             |||||
Sbjct: 10500 tatct 10504

---

>gb|AC155338.1| Brassica rapa subsp. pekinensis chromosome Cytogenetic chromosome 1 clone
              KBrH138P04, complete sequence
          Length = 137697

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                          
Query: 642    ccgatggtggacttggattcgaggcagaactcgttcttggtgaa 685
              ||||||||||| ||||||||||| |||||||||||  |||||||
Sbjct: 106618 ccgatggtggatttggattcgagacagaactcgtttctggtgaa 106575

---

>ref|NM_102623.1| Arabidopsis thaliana GTP binding AT1G28550 mRNA, complete cds
          Length = 657

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 165/211 (78%)
 Strand = Plus / Minus

                                                                       
Query: 389 cgaaggtcagatttgttgccaactagcatgacaacaatgctagggtcagtatgatctctt 448
           ||||| |||| |||||||||||| |||||||  |||||| | | ||| || || || || 
Sbjct: 392 cgaagatcagctttgttgccaacgagcatgatcacaatgtttgcgtccgtgtggtcccta 333

                                                                       
Query: 449 agctcttttagccagcgcgccacattgtcgaatgtagccgggcgagtgacatcatacacc 508
           ||||| |||||||| | | | ||||| ||||||||  |  |||| || || ||||| || 
Sbjct: 332 agctcctttagccatctctcaacattctcgaatgtcacgtggcgcgtcacgtcataaaca 273

                                                                       
Query: 509 agcaacgcacctactgctcctctataataggcactcgtaatagcacggtatctctcctgg 568
           ||||| ||||| || |||||||  ||||| || ||||| || || ||||| || || |||
Sbjct: 272 agcaatgcaccaacagctcctcggtaataagcgctcgtgatggctcggtacctttcttgg 213

                                          
Query: 569 ccagcggtgtcccaaatctgggccttgacga 599
           || ||||| ||||| || || ||||||||||
Sbjct: 212 ccggcggtatcccatatttgagccttgacga 182

---

>ref|XM_429101.1| PREDICTED: Gallus gallus similar to RAB11a, member RAS oncogene
           family (LOC431549), partial mRNA
          Length = 323

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 612 acctggaggctgcgggtggcgaactcgaccccgatggtg 650
           ||||||| ||| |||||||||||||| ||||||||||||
Sbjct: 124 acctggatgctccgggtggcgaactccaccccgatggtg 86

---

>ref|XM_978616.1| PREDICTED: Mus musculus similar to Ras-related protein Rab-11B,
           transcript variant 1 (LOC669667), mRNA
          Length = 1618

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 545 gtaatagcacggtatctctcctggccagcggtgtcccaaatctgggccttg 595
           ||||| |||||||| | |||||||||||| |||||||| ||||| ||||||
Sbjct: 199 gtaatggcacggtagcgctcctggccagcagtgtcccagatctgagccttg 149

---

>ref|XM_979097.1| PREDICTED: Mus musculus similar to Ras-related protein Rab-11B,
           transcript variant 1 (LOC665419), mRNA
          Length = 1618

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 545 gtaatagcacggtatctctcctggccagcggtgtcccaaatctgggccttg 595
           ||||| |||||||| | |||||||||||| |||||||| ||||| ||||||
Sbjct: 199 gtaatggcacggtagcgctcctggccagcagtgtcccagatctgagccttg 149

---

>emb|Z29592.1|VFGNRPR3 V.faba mRNA for guanine nucleotide regulatory protein (807bp)
          Length = 807

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 87/107 (81%)
 Strand = Plus / Minus

                                                                       
Query: 317 gtttccatgaagtacagtgactccgcctcagcatattcctgcccatcttcagttgaaaca 376
           |||||||| ||||| ||||| ||   |||||||||   || ||||||||||||||| |||
Sbjct: 515 gtttccataaagtaaagtgattctttctcagcataagacttcccatcttcagttgataca 456

                                                          
Query: 377 gccaccaagtggcgaaggtcagatttgttgccaactagcatgacaac 423
           || || | ||||||||| || | ||||||||| || ||||| |||||
Sbjct: 455 gcaacaaggtggcgaagatctgctttgttgcccacaagcatcacaac 409



 Score = 48.1 bits (24), Expect = 0.040
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 630 gcgaactcgaccccgatggtggacttggattcgaggcagaactcgttcttggtgaa 685
           ||||| ||||| || |||||||| ||||| ||||||  |||||||||||| |||||
Sbjct: 203 gcgaattcgacgccaatggtggatttggactcgaggttgaactcgttcttcgtgaa 148

---

>gb|DQ056467.1| Arabidopsis thaliana putative Ras-related GTP-binding protein
           (At1g28550) mRNA, complete cds
          Length = 657

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 165/211 (78%)
 Strand = Plus / Minus

                                                                       
Query: 389 cgaaggtcagatttgttgccaactagcatgacaacaatgctagggtcagtatgatctctt 448
           ||||| |||| |||||||||||| |||||||  |||||| | | ||| || || || || 
Sbjct: 392 cgaagatcagctttgttgccaacgagcatgatcacaatgtttgcgtccgtgtggtcccta 333

                                                                       
Query: 449 agctcttttagccagcgcgccacattgtcgaatgtagccgggcgagtgacatcatacacc 508
           ||||| |||||||| | | | ||||| ||||||||  |  |||| || || ||||| || 
Sbjct: 332 agctcctttagccatctctcaacattctcgaatgtcacgtggcgcgtcacgtcataaaca 273

                                                                       
Query: 509 agcaacgcacctactgctcctctataataggcactcgtaatagcacggtatctctcctgg 568
           ||||| ||||| || |||||||  ||||| || ||||| || || ||||| || || |||
Sbjct: 272 agcaatgcaccaacagctcctcggtaataagcgctcgtgatggctcggtacctttcttgg 213

                                          
Query: 569 ccagcggtgtcccaaatctgggccttgacga 599
           || ||||| ||||| || || ||||||||||
Sbjct: 212 ccggcggtatcccatatttgagccttgacga 182

---

>emb|BX934641.1| Gallus gallus finished cDNA, clone ChEST386e2
          Length = 885

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 612 acctggaggctgcgggtggcgaactcgaccccgatggtg 650
           ||||||| ||| |||||||||||||| ||||||||||||
Sbjct: 181 acctggatgctccgggtggcgaactccaccccgatggtg 143

---

>dbj|AB015472.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MAE1
          Length = 54632

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 91/111 (81%), Gaps = 1/111 (0%)
 Strand = Plus / Minus

                                                                         
Query: 566   tggccagcggtgtcccaaatctgggccttgacgacctttgccgtcgacctggaggctgcg 625
             ||||||||||| ||||||||||| || ||||||| | ||  | ||||| |||| ||| ||
Sbjct: 50167 tggccagcggtatcccaaatctgagctttgacgatc-ttatcatcgacatggatgctacg 50109

                                                                
Query: 626   ggtggcgaactcgaccccgatggtggacttggattcgaggcagaactcgtt 676
              |||||||| || || ||||| ||||| || |||||||| | |||||||||
Sbjct: 50108 agtggcgaattctacaccgatcgtggatttagattcgagactgaactcgtt 50058

---

>gb|BC062041.1| Rattus norvegicus RAB11B, member RAS oncogene family, mRNA (cDNA
           clone MGC:72373 IMAGE:5598168), complete cds
          Length = 1521

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 87/106 (82%), Gaps = 1/106 (0%)
 Strand = Plus / Minus

                                                                       
Query: 545 gtaatagcacggtatctctcctggccagcggtgtcccaaatctgggccttgacgaccttt 604
           ||||| |||||||| | |||||||||||| || ||||| ||||| ||||||| |  | ||
Sbjct: 280 gtaatggcacggtagcgctcctggccagcagtatcccagatctgagccttgatggtc-tt 222

                                                         
Query: 605 gccgtcgacctggaggctgcgggtggcgaactcgaccccgatggtg 650
           |||||| ||||| | |||||| ||||| ||||| || || ||||||
Sbjct: 221 gccgtccacctgaatgctgcgagtggcaaactccactccaatggtg 176

---

>ref|XM_752705.1| Ustilago maydis 521 hypothetical protein (UM01651.1) partial mRNA
          Length = 642

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 102/126 (80%), Gaps = 1/126 (0%)
 Strand = Plus / Minus

                                                                       
Query: 551 gcacggtatctctcctggccagcggtgtcccaaatctgggccttgacgacctttgccgtc 610
           ||||||||||  ||||| || ||||| ||||| ||||||||||||||   |||| |||||
Sbjct: 221 gcacggtatcgttcctgtccggcggtatcccagatctgggccttgaccgtcttt-ccgtc 163

                                                                       
Query: 611 gacctggaggctgcgggtggcgaactcgaccccgatggtggacttggattcgaggcagaa 670
           |||    | ||| ||||| || ||||| || |||||||| |||||||| ||||| | |||
Sbjct: 162 gacggaaatgcttcgggtagcaaactcaactccgatggttgacttggactcgagactgaa 103

                 
Query: 671 ctcgtt 676
           ||||||
Sbjct: 102 ctcgtt 97

---

>ref|XM_647684.1| Entamoeba histolytica HM-1:IMSS Rab family GTPase (105.t00020)
           partial mRNA
          Length = 636

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                       
Query: 524 gctcctctataataggcactcgtaatagcacggtatctctcctggccagcggtgtcccaa 583
           |||||||||||||| ||| | ||||||||||| ||||| || || ||||| || ||||||
Sbjct: 248 gctcctctataataagcattagtaatagcacgatatctttcttgtccagcagtatcccaa 189

             
Query: 584 at 585
           ||
Sbjct: 188 at 187

---

>emb|AL161548.2|ATCHRIV48 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 48
          Length = 194143

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 53/62 (85%)
 Strand = Plus / Plus

                                                                          
Query: 627    gtggcgaactcgaccccgatggtggacttggattcgaggcagaactcgttcttggtgaag 686
              |||||||||||||| |||||||| ||||| || |||| || ||| |||||  ||||||||
Sbjct: 152350 gtggcgaactcgacaccgatggttgactttgactcgatgctgaattcgtttctggtgaag 152409

                
Query: 687    cg 688
              ||
Sbjct: 152410 cg 152411

---

>emb|AL021710.1|ATF28J12 Arabidopsis thaliana DNA chromosome 4, BAC clone F28J12 (ESSAII
             project)
          Length = 110102

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 53/62 (85%)
 Strand = Plus / Plus

                                                                         
Query: 627   gtggcgaactcgaccccgatggtggacttggattcgaggcagaactcgttcttggtgaag 686
             |||||||||||||| |||||||| ||||| || |||| || ||| |||||  ||||||||
Sbjct: 44385 gtggcgaactcgacaccgatggttgactttgactcgatgctgaattcgtttctggtgaag 44444

               
Query: 687   cg 688
             ||
Sbjct: 44445 cg 44446

---

>gb|DQ062155.1| Gracilaria lemaneiformis small GTPase Rab11-2 (rab11) mRNA,
           complete cds
          Length = 697

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 627 gtggcgaactcgaccccgatggtggacttggattcgaggcagaactcgtt 676
           ||||| |||||| | || |||||||||||||| ||||||| |||||||||
Sbjct: 191 gtggcaaactcggcgcctatggtggacttggactcgaggctgaactcgtt 142

---

>dbj|AB054587.1| Entamoeba histolytica EhRab11B mRNA for small GTPase Rab11B,
           complete cds
          Length = 703

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                       
Query: 524 gctcctctataataggcactcgtaatagcacggtatctctcctggccagcggtgtcccaa 583
           |||||||||||||| ||| | ||||||||||| ||||| || || ||||| || ||||||
Sbjct: 248 gctcctctataataagcattagtaatagcacgatatctttcttgtccagcagtatcccaa 189

             
Query: 584 at 585
           ||
Sbjct: 188 at 187

---

>ref|NM_032617.2| Rattus norvegicus RAB11B, member RAS oncogene family (Rab11b), mRNA
          Length = 1521

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 87/106 (82%), Gaps = 1/106 (0%)
 Strand = Plus / Minus

                                                                       
Query: 545 gtaatagcacggtatctctcctggccagcggtgtcccaaatctgggccttgacgaccttt 604
           ||||| |||||||| | |||||||||||| || ||||| ||||| ||||||| |  | ||
Sbjct: 280 gtaatggcacggtagcgctcctggccagcagtatcccagatctgagccttgatggtc-tt 222

                                                         
Query: 605 gccgtcgacctggaggctgcgggtggcgaactcgaccccgatggtg 650
           |||||| ||||| | |||||| ||||| ||||| || || ||||||
Sbjct: 221 gccgtccacctgaatgctgcgagtggcaaactccactccaatggtg 176

---

>gb|AF286534.1|AF286534 Rattus norvegicus GTP-binding protein RAB11B (Rab11b) mRNA,
           complete cds
          Length = 1010

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 87/106 (82%), Gaps = 1/106 (0%)
 Strand = Plus / Minus

                                                                       
Query: 545 gtaatagcacggtatctctcctggccagcggtgtcccaaatctgggccttgacgaccttt 604
           ||||| |||||||| | |||||||||||| || ||||| ||||| ||||||| |  | ||
Sbjct: 286 gtaatggcacggtagcgctcctggccagcagtatcccagatctgagccttgatggtc-tt 228

                                                         
Query: 605 gccgtcgacctggaggctgcgggtggcgaactcgaccccgatggtg 650
           |||||| ||||| | |||||| ||||| ||||| || || ||||||
Sbjct: 227 gccgtccacctgaatgctgcgagtggcaaactccactccaatggtg 182

---

>gb|L03303.1|RABGTPBP Oryctolagus cuniculus GTP-binding protein (Rab25) mRNA, complete
           cds
          Length = 977

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 622 tgcgggtggcgaactcgaccccgatggtgg 651
           ||||||||| ||||||||||||||||||||
Sbjct: 296 tgcgggtggagaactcgaccccgatggtgg 267

---

>dbj|D01046.1| Rattus norvegicus mRNA for GTP binding protein, complete cds
          Length = 719

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 87/106 (82%), Gaps = 1/106 (0%)
 Strand = Plus / Minus

                                                                       
Query: 545 gtaatagcacggtatctctcctggccagcggtgtcccaaatctgggccttgacgaccttt 604
           ||||| |||||||| | |||||||||||| || ||||| ||||| ||||||| |  | ||
Sbjct: 266 gtaatggcacggtagcgctcctggccagcagtatcccagatctgagccttgatggtc-tt 208

                                                         
Query: 605 gccgtcgacctggaggctgcgggtggcgaactcgaccccgatggtg 650
           |||||| ||||| | |||||| ||||| ||||| || || ||||||
Sbjct: 207 gccgtccacctgaatgctgcgagtggcaaactccactccaatggtg 162

---

>ref|NM_117996.2| Arabidopsis thaliana GTP binding AT4G18800 mRNA, complete cds
          Length = 1151

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 61/73 (83%)
 Strand = Plus / Minus

                                                                       
Query: 524 gctcctctataataggcactcgtaatagcacggtatctctcctggccagcggtgtcccaa 583
           ||||||| ||| || ||||| || || || |||||||| || || ||||| |||||||||
Sbjct: 469 gctcctcgatagtaagcactagtgattgctcggtatctttcttgaccagcagtgtcccaa 410

                        
Query: 584 atctgggccttga 596
           |||||||| ||||
Sbjct: 409 atctgggctttga 397



 Score = 40.1 bits (20), Expect = 9.7
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 630 gcgaactcgaccccgatggtggacttggattcgaggcagaactcgttcttggtgaa 685
           ||||||||||||||||| || || || || ||||| |  ||||||||| |||||||
Sbjct: 364 gcgaactcgaccccgatcgttgatttagactcgagactaaactcgttcctggtgaa 309

---

>emb|Z73953.1|LJRAB11E L.japonicus mRNA for small GTP-binding protein, RAB11E
          Length = 901

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 539 gcactcgtaatagcacggtatctctcctggccagcggtgtcccaaatctgggccttgacg 598
           ||||| ||||| |||||||| || || || ||||| || ||||||||||| ||||||| |
Sbjct: 254 gcactggtaatggcacggtacctttcttgtccagcagtatcccaaatctgagccttgatg 195

                
Query: 599 acctt 603
           |||||
Sbjct: 194 acctt 190



 Score = 44.1 bits (22), Expect = 0.62
 Identities = 70/86 (81%)
 Strand = Plus / Minus

                                                                       
Query: 254 cggtatatctgagtcaaaacttctgagaaagcgttgtctacatttgtcgcgtctaatgca 313
           |||||||||||||| | ||| || ||||| ||||| || ||||| || || || |  |||
Sbjct: 539 cggtatatctgagtaagaacctcagagaatgcgttttcgacattggttgcttccagagca 480

                                     
Query: 314 gatgtttccatgaagtacagtgactc 339
           || |||||||||||||| || |||||
Sbjct: 479 gaagtttccatgaagtagagggactc 454

---

>emb|X59276.1|OSRGP1 Rice rgp1 mRNA for a ras-related GTP-binding protein
          Length = 1303

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 554 cggtatctctcctggccagcggtgtcccaaatctgggccttgacg 598
           ||||| || |||||||| |||||||||| | ||||||||||||||
Sbjct: 682 cggtacctttcctggccggcggtgtcccgagtctgggccttgacg 638

---

>gb|BT004936.1| Arabidopsis thaliana clone U20645 putative ras-related GTP binding
           protein (At4g18800) mRNA, complete cds
          Length = 676

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 61/73 (83%)
 Strand = Plus / Minus

                                                                       
Query: 524 gctcctctataataggcactcgtaatagcacggtatctctcctggccagcggtgtcccaa 583
           ||||||| ||| || ||||| || || || |||||||| || || ||||| |||||||||
Sbjct: 257 gctcctcgatagtaagcactagtgattgctcggtatctttcttgaccagcagtgtcccaa 198

                        
Query: 584 atctgggccttga 596
           |||||||| ||||
Sbjct: 197 atctgggctttga 185



 Score = 40.1 bits (20), Expect = 9.7
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 630 gcgaactcgaccccgatggtggacttggattcgaggcagaactcgttcttggtgaa 685
           ||||||||||||||||| || || || || ||||| |  ||||||||| |||||||
Sbjct: 152 gcgaactcgaccccgatcgttgatttagactcgagactaaactcgttcctggtgaa 97

---

>gb|BT003901.1| Arabidopsis thaliana clone RAFL15-17-A17 (R20645) putative
           ras-related GTP binding protein (At4g18800) mRNA,
           complete cds
          Length = 1167

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 61/73 (83%)
 Strand = Plus / Minus

                                                                       
Query: 524 gctcctctataataggcactcgtaatagcacggtatctctcctggccagcggtgtcccaa 583
           ||||||| ||| || ||||| || || || |||||||| || || ||||| |||||||||
Sbjct: 469 gctcctcgatagtaagcactagtgattgctcggtatctttcttgaccagcagtgtcccaa 410

                        
Query: 584 atctgggccttga 596
           |||||||| ||||
Sbjct: 409 atctgggctttga 397



 Score = 40.1 bits (20), Expect = 9.7
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 630 gcgaactcgaccccgatggtggacttggattcgaggcagaactcgttcttggtgaa 685
           ||||||||||||||||| || || || || ||||| |  ||||||||| |||||||
Sbjct: 364 gcgaactcgaccccgatcgttgatttagactcgagactaaactcgttcctggtgaa 309

---

>dbj|AP003614.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0481E08
          Length = 171965

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                      
Query: 554   cggtatctctcctggccagcggtgtcccaaatctgggcctt 594
             ||||| |||||||| || ||||||||||| |||||||||||
Sbjct: 16340 cggtacctctcctgccccgcggtgtcccagatctgggcctt 16380


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,357,165
Number of Sequences: 3902068
Number of extensions: 5357165
Number of successful extensions: 94251
Number of sequences better than 10.0: 506
Number of HSP's better than 10.0 without gapping: 506
Number of HSP's successfully gapped in prelim test: 8
Number of HSP's that attempted gapping in prelim test: 92833
Number of HSP's gapped (non-prelim): 1300
length of query: 706
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 683
effective length of database: 17,143,297,704
effective search space: 11708872331832
effective search space used: 11708872331832
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---