ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbasd17k23 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AY123418.1| Triticum aestivum putative ribosomal protein S18 mRNA, complete cds Length = 868 Score = 182 bits (92), Expect = 9e-43 Identities = 143/160 (89%) Strand = Plus / Minus Query: 398 ggctcgggcttgggctccggcttcggcggcactggcttcttgtggtggaagtgctccatg 457 |||| |||||||||||||||||| |||||||| |||| |||||||||||| ||||| ||| Sbjct: 161 ggctggggcttgggctccggcttgggcggcacgggctgcttgtggtggaaatgctcgatg 102 Query: 458 atgtgtttcttgatgggcccgcacagggtcatggacgcgcactccggcgacgctgcagac 517 ||||| |||||||| |||||||||| |||||||||||||||||| ||||||||||||||| Sbjct: 101 atgtgcttcttgatcggcccgcacaaggtcatggacgcgcactctggcgacgctgcagac 42 Query: 518 ggcatgacaacgttgtcgccggcgacaatgccgaaagtgg 557 || || ||| | ||||||||||||| |||||||| |||| Sbjct: 41 cgcgtggcaatgctgtcgccggcgacgatgccgaaggtgg 2 Score = 48.1 bits (24), Expect = 0.036 Identities = 42/48 (87%) Strand = Plus / Minus Query: 328 acggggtggtagtccgggtggggttgcggcttgggctcgggcttgggc 375 |||||||| ||||| || ||||| || ||||||||||| ||||||||| Sbjct: 182 acggggtgatagtcaggatggggctggggcttgggctccggcttgggc 135
>ref|NM_194864.1| Oryza sativa (japonica cultivar-group) putative proline-rich protein (OSJNBa0031A07.12), mRNA Length = 675 Score = 60.0 bits (30), Expect = 9e-06 Identities = 86/104 (82%), Gaps = 3/104 (2%) Strand = Plus / Minus Query: 396 gtggctcgggcttgggctccggcttcggcggcactggcttcttgtggtggaagtgctcca 455 ||||||| ||||| ||||||||||| || ||||| |||||||| ||||||||| || | Sbjct: 502 gtggctccggctttggctccggcttgggtggcaccggcttctt---gtggaagtggtcta 446 Query: 456 tgatgtgtttcttgatgggcccgcacagggtcatggacgcgcac 499 |||| | |||||||| || ||||| | ||||| |||||||||| Sbjct: 445 tgatcttcttcttgattgggccgcagatggtcacggacgcgcac 402 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 398 ggctcgggcttgggctccggcttcggcggcactggcttcttgtgg 442 ||||||||||| ||||| ||||| || ||||| |||||||||||| Sbjct: 623 ggctcgggcttaggctcaggcttgggtggcacgggcttcttgtgg 579 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 352 tgcggcttgggctcgggctt 371 |||||||||||||||||||| Sbjct: 632 tgcggcttgggctcgggctt 613
>gb|AC084884.2| Oryza sativa chromosome 10 clone OSJNBa0031A07, complete sequence Length = 134553 Score = 60.0 bits (30), Expect = 9e-06 Identities = 86/104 (82%), Gaps = 3/104 (2%) Strand = Plus / Plus Query: 396 gtggctcgggcttgggctccggcttcggcggcactggcttcttgtggtggaagtgctcca 455 ||||||| ||||| ||||||||||| || ||||| |||||||| ||||||||| || | Sbjct: 80702 gtggctccggctttggctccggcttgggtggcaccggcttctt---gtggaagtggtcta 80758 Query: 456 tgatgtgtttcttgatgggcccgcacagggtcatggacgcgcac 499 |||| | |||||||| || ||||| | ||||| |||||||||| Sbjct: 80759 tgatcttcttcttgattgggccgcagatggtcacggacgcgcac 80802 Score = 58.0 bits (29), Expect = 4e-05 Identities = 41/45 (91%) Strand = Plus / Minus Query: 398 ggctcgggcttgggctccggcttcggcggcactggcttcttgtgg 442 ||||| ||||||||||| ||||| |||||||| |||||||||||| Sbjct: 99844 ggctccggcttgggctctggcttgggcggcacgggcttcttgtgg 99800 Score = 54.0 bits (27), Expect = 6e-04 Identities = 71/85 (83%), Gaps = 3/85 (3%) Strand = Plus / Minus Query: 396 gtggctcgggcttgggctccggcttcggcggcactggcttcttgtggtggaagtgctcca 455 ||||||| ||||| ||||||||||| || ||||| |||||||||||| ||||| || | Sbjct: 89050 gtggctccggcttcggctccggcttgggtggcaccggcttcttgtgg---aagtggtcta 88994 Query: 456 tgatgtgtttcttgatgggcccgca 480 |||| | ||||||||||| ||||| Sbjct: 88993 tgatcttcttcttgatgggaccgca 88969 Score = 52.0 bits (26), Expect = 0.002 Identities = 65/78 (83%) Strand = Plus / Plus Query: 431 ggcttcttgtggtggaagtgctccatgatgtgtttcttgatgggcccgcacagggtcatg 490 ||||| |||||||||||||| || | || ||| |||||||||||| |||| | |||| Sbjct: 67173 ggcttgttgtggtggaagtggtcgaagaagtgcttcttgatgggctcgcagatggtcgcc 67232 Query: 491 gacgcgcactccggcgac 508 ||||||||| |||||||| Sbjct: 67233 gacgcgcacaccggcgac 67250 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 398 ggctcgggcttgggctccggcttcggcggcactggcttcttgtgg 442 ||||| ||||| ||||| ||||| || |||||||||||||||||| Sbjct: 89171 ggctctggcttcggctctggcttaggtggcactggcttcttgtgg 89127 Score = 50.1 bits (25), Expect = 0.009 Identities = 69/83 (83%), Gaps = 3/83 (3%) Strand = Plus / Minus Query: 398 ggctcgggcttgggctccggcttcggcggcactggcttcttgtggtggaagtgctccatg 457 ||||| |||||||| ||||||||||| ||||| |||||||| ||| ||||| || ||| Sbjct: 85015 ggctctggcttgggatccggcttcggtggcaccggcttcttatgg---aagtggtcgatg 84959 Query: 458 atgtgtttcttgatgggcccgca 480 || | ||||||||||| ||||| Sbjct: 84958 atcttcttcttgatggggccgca 84936 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 398 ggctcgggcttgggctccggcttcggcggcactggcttcttgtgg 442 ||||||||||| ||||| ||||| || ||||| |||||||||||| Sbjct: 80581 ggctcgggcttaggctcaggcttgggtggcacgggcttcttgtgg 80625 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 352 tgcggcttgggctcgggcttgggc 375 |||||||||||||| ||||||||| Sbjct: 99865 tgcggcttgggctctggcttgggc 99842 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 352 tgcggcttgggctcgggcttgggc 375 |||||||||||||| ||||||||| Sbjct: 89192 tgcggcttgggctctggcttgggc 89169 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 352 tgcggcttgggctcgggctt 371 |||||||||||||||||||| Sbjct: 80572 tgcggcttgggctcgggctt 80591
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 60.0 bits (30), Expect = 9e-06 Identities = 86/104 (82%), Gaps = 3/104 (2%) Strand = Plus / Plus Query: 396 gtggctcgggcttgggctccggcttcggcggcactggcttcttgtggtggaagtgctcca 455 ||||||| ||||| ||||||||||| || ||||| |||||||| ||||||||| || | Sbjct: 2992280 gtggctccggctttggctccggcttgggtggcaccggcttctt---gtggaagtggtcta 2992336 Query: 456 tgatgtgtttcttgatgggcccgcacagggtcatggacgcgcac 499 |||| | |||||||| || ||||| | ||||| |||||||||| Sbjct: 2992337 tgatcttcttcttgattgggccgcagatggtcacggacgcgcac 2992380 Score = 58.0 bits (29), Expect = 4e-05 Identities = 41/45 (91%) Strand = Plus / Minus Query: 398 ggctcgggcttgggctccggcttcggcggcactggcttcttgtgg 442 ||||| ||||||||||| ||||| |||||||| |||||||||||| Sbjct: 3011422 ggctccggcttgggctctggcttgggcggcacgggcttcttgtgg 3011378 Score = 54.0 bits (27), Expect = 6e-04 Identities = 71/85 (83%), Gaps = 3/85 (3%) Strand = Plus / Minus Query: 396 gtggctcgggcttgggctccggcttcggcggcactggcttcttgtggtggaagtgctcca 455 ||||||| ||||| ||||||||||| || ||||| |||||||||||| ||||| || | Sbjct: 3000628 gtggctccggcttcggctccggcttgggtggcaccggcttcttgtgg---aagtggtcta 3000572 Query: 456 tgatgtgtttcttgatgggcccgca 480 |||| | ||||||||||| ||||| Sbjct: 3000571 tgatcttcttcttgatgggaccgca 3000547 Score = 52.0 bits (26), Expect = 0.002 Identities = 65/78 (83%) Strand = Plus / Plus Query: 431 ggcttcttgtggtggaagtgctccatgatgtgtttcttgatgggcccgcacagggtcatg 490 ||||| |||||||||||||| || | || ||| |||||||||||| |||| | |||| Sbjct: 2978751 ggcttgttgtggtggaagtggtcgaagaagtgcttcttgatgggctcgcagatggtcgcc 2978810 Query: 491 gacgcgcactccggcgac 508 ||||||||| |||||||| Sbjct: 2978811 gacgcgcacaccggcgac 2978828 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 398 ggctcgggcttgggctccggcttcggcggcactggcttcttgtgg 442 ||||| ||||| ||||| ||||| || |||||||||||||||||| Sbjct: 3000749 ggctctggcttcggctctggcttaggtggcactggcttcttgtgg 3000705 Score = 50.1 bits (25), Expect = 0.009 Identities = 69/83 (83%), Gaps = 3/83 (3%) Strand = Plus / Minus Query: 398 ggctcgggcttgggctccggcttcggcggcactggcttcttgtggtggaagtgctccatg 457 ||||| |||||||| ||||||||||| ||||| |||||||| ||| ||||| || ||| Sbjct: 2996593 ggctctggcttgggatccggcttcggtggcaccggcttcttatgg---aagtggtcgatg 2996537 Query: 458 atgtgtttcttgatgggcccgca 480 || | ||||||||||| ||||| Sbjct: 2996536 atcttcttcttgatggggccgca 2996514 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 398 ggctcgggcttgggctccggcttcggcggcactggcttcttgtgg 442 ||||||||||| ||||| ||||| || ||||| |||||||||||| Sbjct: 2992159 ggctcgggcttaggctcaggcttgggtggcacgggcttcttgtgg 2992203 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 352 tgcggcttgggctcgggcttgggc 375 |||||||||||||| ||||||||| Sbjct: 3011443 tgcggcttgggctctggcttgggc 3011420 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 352 tgcggcttgggctcgggcttgggc 375 |||||||||||||| ||||||||| Sbjct: 3000770 tgcggcttgggctctggcttgggc 3000747 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 352 tgcggcttgggctcgggctt 371 |||||||||||||||||||| Sbjct: 2992150 tgcggcttgggctcgggctt 2992169
>dbj|AK104236.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-307-G04, full insert sequence Length = 963 Score = 60.0 bits (30), Expect = 9e-06 Identities = 86/104 (82%), Gaps = 3/104 (2%) Strand = Plus / Minus Query: 396 gtggctcgggcttgggctccggcttcggcggcactggcttcttgtggtggaagtgctcca 455 ||||||| ||||| ||||||||||| || ||||| |||||||| ||||||||| || | Sbjct: 565 gtggctccggctttggctccggcttgggtggcaccggcttctt---gtggaagtggtcta 509 Query: 456 tgatgtgtttcttgatgggcccgcacagggtcatggacgcgcac 499 |||| | |||||||| || ||||| | ||||| |||||||||| Sbjct: 508 tgatcttcttcttgattgggccgcagatggtcacggacgcgcac 465 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 398 ggctcgggcttgggctccggcttcggcggcactggcttcttgtgg 442 ||||||||||| ||||| ||||| || ||||| |||||||||||| Sbjct: 686 ggctcgggcttaggctcaggcttgggtggcacgggcttcttgtgg 642 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 352 tgcggcttgggctcgggctt 371 |||||||||||||||||||| Sbjct: 695 tgcggcttgggctcgggctt 676
>dbj|AK061529.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-310-E01, full insert sequence Length = 976 Score = 60.0 bits (30), Expect = 9e-06 Identities = 86/104 (82%), Gaps = 3/104 (2%) Strand = Plus / Minus Query: 396 gtggctcgggcttgggctccggcttcggcggcactggcttcttgtggtggaagtgctcca 455 ||||||| ||||| ||||||||||| || ||||| |||||||| ||||||||| || | Sbjct: 565 gtggctccggctttggctccggcttgggtggcaccggcttctt---gtggaagtggtcta 509 Query: 456 tgatgtgtttcttgatgggcccgcacagggtcatggacgcgcac 499 |||| | |||||||| || ||||| | ||||| |||||||||| Sbjct: 508 tgatcttcttcttgattgggccgcagatggtcacggacgcgcac 465 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 398 ggctcgggcttgggctccggcttcggcggcactggcttcttgtgg 442 ||||||||||| ||||| ||||| || ||||| |||||||||||| Sbjct: 686 ggctcgggcttaggctcaggcttgggtggcacgggcttcttgtgg 642 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 352 tgcggcttgggctcgggctt 371 |||||||||||||||||||| Sbjct: 695 tgcggcttgggctcgggctt 676
>dbj|AK059999.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-G07, full insert sequence Length = 963 Score = 60.0 bits (30), Expect = 9e-06 Identities = 86/104 (82%), Gaps = 3/104 (2%) Strand = Plus / Minus Query: 396 gtggctcgggcttgggctccggcttcggcggcactggcttcttgtggtggaagtgctcca 455 ||||||| ||||| ||||||||||| || ||||| |||||||| ||||||||| || | Sbjct: 565 gtggctccggctttggctccggcttgggtggcaccggcttctt---gtggaagtggtcta 509 Query: 456 tgatgtgtttcttgatgggcccgcacagggtcatggacgcgcac 499 |||| | |||||||| || ||||| | ||||| |||||||||| Sbjct: 508 tgatcttcttcttgattgggccgcagatggtcacggacgcgcac 465 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 398 ggctcgggcttgggctccggcttcggcggcactggcttcttgtgg 442 ||||||||||| ||||| ||||| || ||||| |||||||||||| Sbjct: 686 ggctcgggcttaggctcaggcttgggtggcacgggcttcttgtgg 642 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 352 tgcggcttgggctcgggctt 371 |||||||||||||||||||| Sbjct: 695 tgcggcttgggctcgggctt 676
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 60.0 bits (30), Expect = 9e-06 Identities = 86/104 (82%), Gaps = 3/104 (2%) Strand = Plus / Plus Query: 396 gtggctcgggcttgggctccggcttcggcggcactggcttcttgtggtggaagtgctcca 455 ||||||| ||||| ||||||||||| || ||||| |||||||| ||||||||| || | Sbjct: 2992201 gtggctccggctttggctccggcttgggtggcaccggcttctt---gtggaagtggtcta 2992257 Query: 456 tgatgtgtttcttgatgggcccgcacagggtcatggacgcgcac 499 |||| | |||||||| || ||||| | ||||| |||||||||| Sbjct: 2992258 tgatcttcttcttgattgggccgcagatggtcacggacgcgcac 2992301 Score = 58.0 bits (29), Expect = 4e-05 Identities = 41/45 (91%) Strand = Plus / Minus Query: 398 ggctcgggcttgggctccggcttcggcggcactggcttcttgtgg 442 ||||| ||||||||||| ||||| |||||||| |||||||||||| Sbjct: 3011343 ggctccggcttgggctctggcttgggcggcacgggcttcttgtgg 3011299 Score = 54.0 bits (27), Expect = 6e-04 Identities = 71/85 (83%), Gaps = 3/85 (3%) Strand = Plus / Minus Query: 396 gtggctcgggcttgggctccggcttcggcggcactggcttcttgtggtggaagtgctcca 455 ||||||| ||||| ||||||||||| || ||||| |||||||||||| ||||| || | Sbjct: 3000549 gtggctccggcttcggctccggcttgggtggcaccggcttcttgtgg---aagtggtcta 3000493 Query: 456 tgatgtgtttcttgatgggcccgca 480 |||| | ||||||||||| ||||| Sbjct: 3000492 tgatcttcttcttgatgggaccgca 3000468 Score = 52.0 bits (26), Expect = 0.002 Identities = 65/78 (83%) Strand = Plus / Plus Query: 431 ggcttcttgtggtggaagtgctccatgatgtgtttcttgatgggcccgcacagggtcatg 490 ||||| |||||||||||||| || | || ||| |||||||||||| |||| | |||| Sbjct: 2978672 ggcttgttgtggtggaagtggtcgaagaagtgcttcttgatgggctcgcagatggtcgcc 2978731 Query: 491 gacgcgcactccggcgac 508 ||||||||| |||||||| Sbjct: 2978732 gacgcgcacaccggcgac 2978749 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 398 ggctcgggcttgggctccggcttcggcggcactggcttcttgtgg 442 ||||| ||||| ||||| ||||| || |||||||||||||||||| Sbjct: 3000670 ggctctggcttcggctctggcttaggtggcactggcttcttgtgg 3000626 Score = 50.1 bits (25), Expect = 0.009 Identities = 69/83 (83%), Gaps = 3/83 (3%) Strand = Plus / Minus Query: 398 ggctcgggcttgggctccggcttcggcggcactggcttcttgtggtggaagtgctccatg 457 ||||| |||||||| ||||||||||| ||||| |||||||| ||| ||||| || ||| Sbjct: 2996514 ggctctggcttgggatccggcttcggtggcaccggcttcttatgg---aagtggtcgatg 2996458 Query: 458 atgtgtttcttgatgggcccgca 480 || | ||||||||||| ||||| Sbjct: 2996457 atcttcttcttgatggggccgca 2996435 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 398 ggctcgggcttgggctccggcttcggcggcactggcttcttgtgg 442 ||||||||||| ||||| ||||| || ||||| |||||||||||| Sbjct: 2992080 ggctcgggcttaggctcaggcttgggtggcacgggcttcttgtgg 2992124 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 352 tgcggcttgggctcgggcttgggc 375 |||||||||||||| ||||||||| Sbjct: 3011364 tgcggcttgggctctggcttgggc 3011341 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 352 tgcggcttgggctcgggcttgggc 375 |||||||||||||| ||||||||| Sbjct: 3000691 tgcggcttgggctctggcttgggc 3000668 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 352 tgcggcttgggctcgggctt 371 |||||||||||||||||||| Sbjct: 2992071 tgcggcttgggctcgggctt 2992090
>ref|NM_194867.1| Oryza sativa (japonica cultivar-group) putative proline-rich protein (OSJNBa0031A07.15), mRNA Length = 690 Score = 58.0 bits (29), Expect = 4e-05 Identities = 41/45 (91%) Strand = Plus / Minus Query: 398 ggctcgggcttgggctccggcttcggcggcactggcttcttgtgg 442 ||||| ||||||||||| ||||| |||||||| |||||||||||| Sbjct: 623 ggctccggcttgggctctggcttgggcggcacgggcttcttgtgg 579 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 352 tgcggcttgggctcgggcttgggc 375 |||||||||||||| ||||||||| Sbjct: 644 tgcggcttgggctctggcttgggc 621
>dbj|AK062795.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-107-C07, full insert sequence Length = 862 Score = 58.0 bits (29), Expect = 4e-05 Identities = 41/45 (91%) Strand = Plus / Minus Query: 398 ggctcgggcttgggctccggcttcggcggcactggcttcttgtgg 442 ||||| ||||||||||| ||||| |||||||| |||||||||||| Sbjct: 666 ggctccggcttgggctctggcttgggcggcacgggcttcttgtgg 622 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 352 tgcggcttgggctcgggcttgggc 375 |||||||||||||| ||||||||| Sbjct: 687 tgcggcttgggctctggcttgggc 664
>dbj|AK061299.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-E05, full insert sequence Length = 928 Score = 58.0 bits (29), Expect = 4e-05 Identities = 41/45 (91%) Strand = Plus / Minus Query: 398 ggctcgggcttgggctccggcttcggcggcactggcttcttgtgg 442 ||||| ||||||||||| ||||| |||||||| |||||||||||| Sbjct: 680 ggctccggcttgggctctggcttgggcggcacgggcttcttgtgg 636 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 352 tgcggcttgggctcgggcttgggc 375 |||||||||||||| ||||||||| Sbjct: 701 tgcggcttgggctctggcttgggc 678
>ref|NM_194866.1| Oryza sativa (japonica cultivar-group) putative proline-rich protein (OSJNBa0031A07.14), mRNA Length = 690 Score = 54.0 bits (27), Expect = 6e-04 Identities = 71/85 (83%), Gaps = 3/85 (3%) Strand = Plus / Minus Query: 396 gtggctcgggcttgggctccggcttcggcggcactggcttcttgtggtggaagtgctcca 455 ||||||| ||||| ||||||||||| || ||||| |||||||||||| ||||| || | Sbjct: 502 gtggctccggcttcggctccggcttgggtggcaccggcttcttgtgg---aagtggtcta 446 Query: 456 tgatgtgtttcttgatgggcccgca 480 |||| | ||||||||||| ||||| Sbjct: 445 tgatcttcttcttgatgggaccgca 421 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 398 ggctcgggcttgggctccggcttcggcggcactggcttcttgtgg 442 ||||| ||||| ||||| ||||| || |||||||||||||||||| Sbjct: 623 ggctctggcttcggctctggcttaggtggcactggcttcttgtgg 579 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 352 tgcggcttgggctcgggcttgggc 375 |||||||||||||| ||||||||| Sbjct: 644 tgcggcttgggctctggcttgggc 621
>dbj|AK104765.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-038-H08, full insert sequence Length = 1080 Score = 54.0 bits (27), Expect = 6e-04 Identities = 71/85 (83%), Gaps = 3/85 (3%) Strand = Plus / Minus Query: 396 gtggctcgggcttgggctccggcttcggcggcactggcttcttgtggtggaagtgctcca 455 ||||||| ||||| ||||||||||| || ||||| |||||||||||| ||||| || | Sbjct: 562 gtggctccggcttcggctccggcttgggtggcaccggcttcttgtgg---aagtggtcta 506 Query: 456 tgatgtgtttcttgatgggcccgca 480 |||| | ||||||||||| ||||| Sbjct: 505 tgatcttcttcttgatgggaccgca 481 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 398 ggctcgggcttgggctccggcttcggcggcactggcttcttgtgg 442 ||||| ||||| ||||| ||||| || |||||||||||||||||| Sbjct: 683 ggctctggcttcggctctggcttaggtggcactggcttcttgtgg 639 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 352 tgcggcttgggctcgggcttgggc 375 |||||||||||||| ||||||||| Sbjct: 704 tgcggcttgggctctggcttgggc 681
>dbj|AK104622.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-H10, full insert sequence Length = 1032 Score = 54.0 bits (27), Expect = 6e-04 Identities = 71/85 (83%), Gaps = 3/85 (3%) Strand = Plus / Minus Query: 396 gtggctcgggcttgggctccggcttcggcggcactggcttcttgtggtggaagtgctcca 455 ||||||| ||||| ||||||||||| || ||||| |||||||||||| ||||| || | Sbjct: 562 gtggctccggcttcggctccggcttgggtggcaccggcttcttgtgg---aagtggtcta 506 Query: 456 tgatgtgtttcttgatgggcccgca 480 |||| | ||||||||||| ||||| Sbjct: 505 tgatcttcttcttgatgggaccgca 481 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 398 ggctcgggcttgggctccggcttcggcggcactggcttcttgtgg 442 ||||| ||||| ||||| ||||| || |||||||||||||||||| Sbjct: 683 ggctctggcttcggctctggcttaggtggcactggcttcttgtgg 639 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 352 tgcggcttgggctcgggcttgggc 375 |||||||||||||| ||||||||| Sbjct: 704 tgcggcttgggctctggcttgggc 681
>dbj|AK104398.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-202-D05, full insert sequence Length = 1032 Score = 54.0 bits (27), Expect = 6e-04 Identities = 71/85 (83%), Gaps = 3/85 (3%) Strand = Plus / Minus Query: 396 gtggctcgggcttgggctccggcttcggcggcactggcttcttgtggtggaagtgctcca 455 ||||||| ||||| ||||||||||| || ||||| |||||||||||| ||||| || | Sbjct: 562 gtggctccggcttcggctccggcttgggtggcaccggcttcttgtgg---aagtggtcta 506 Query: 456 tgatgtgtttcttgatgggcccgca 480 |||| | ||||||||||| ||||| Sbjct: 505 tgatcttcttcttgatgggaccgca 481 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 398 ggctcgggcttgggctccggcttcggcggcactggcttcttgtgg 442 ||||| ||||| ||||| ||||| || |||||||||||||||||| Sbjct: 683 ggctctggcttcggctctggcttaggtggcactggcttcttgtgg 639 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 352 tgcggcttgggctcgggcttgggc 375 |||||||||||||| ||||||||| Sbjct: 704 tgcggcttgggctctggcttgggc 681
>dbj|AK104262.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-310-C07, full insert sequence Length = 1030 Score = 54.0 bits (27), Expect = 6e-04 Identities = 71/85 (83%), Gaps = 3/85 (3%) Strand = Plus / Minus Query: 396 gtggctcgggcttgggctccggcttcggcggcactggcttcttgtggtggaagtgctcca 455 ||||||| ||||| ||||||||||| || ||||| |||||||||||| ||||| || | Sbjct: 562 gtggctccggcttcggctccggcttgggtggcaccggcttcttgtgg---aagtggtcta 506 Query: 456 tgatgtgtttcttgatgggcccgca 480 |||| | ||||||||||| ||||| Sbjct: 505 tgatcttcttcttgatgggaccgca 481 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 398 ggctcgggcttgggctccggcttcggcggcactggcttcttgtgg 442 ||||| ||||| ||||| ||||| || |||||||||||||||||| Sbjct: 683 ggctctggcttcggctctggcttaggtggcactggcttcttgtgg 639 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 352 tgcggcttgggctcgggcttgggc 375 |||||||||||||| ||||||||| Sbjct: 704 tgcggcttgggctctggcttgggc 681
>dbj|AK104235.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-307-F12, full insert sequence Length = 972 Score = 54.0 bits (27), Expect = 6e-04 Identities = 71/85 (83%), Gaps = 3/85 (3%) Strand = Plus / Minus Query: 396 gtggctcgggcttgggctccggcttcggcggcactggcttcttgtggtggaagtgctcca 455 ||||||| ||||| ||||||||||| || ||||| |||||||||||| ||||| || | Sbjct: 565 gtggctccggcttcggctccggcttgggtggcaccggcttcttgtgg---aagtggtcta 509 Query: 456 tgatgtgtttcttgatgggcccgca 480 |||| | ||||||||||| ||||| Sbjct: 508 tgatcttcttcttgatgggaccgca 484 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 398 ggctcgggcttgggctccggcttcggcggcactggcttcttgtgg 442 ||||| ||||| ||||| ||||| || |||||||||||||||||| Sbjct: 686 ggctctggcttcggctctggcttaggtggcactggcttcttgtgg 642 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 352 tgcggcttgggctcgggcttgggc 375 |||||||||||||| ||||||||| Sbjct: 707 tgcggcttgggctctggcttgggc 684
>dbj|AK067147.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013098B06, full insert sequence Length = 1032 Score = 54.0 bits (27), Expect = 6e-04 Identities = 71/85 (83%), Gaps = 3/85 (3%) Strand = Plus / Minus Query: 396 gtggctcgggcttgggctccggcttcggcggcactggcttcttgtggtggaagtgctcca 455 ||||||| ||||| ||||||||||| || ||||| |||||||||||| ||||| || | Sbjct: 564 gtggctccggcttcggctccggcttgggtggcaccggcttcttgtgg---aagtggtcta 508 Query: 456 tgatgtgtttcttgatgggcccgca 480 |||| | ||||||||||| ||||| Sbjct: 507 tgatcttcttcttgatgggaccgca 483 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 398 ggctcgggcttgggctccggcttcggcggcactggcttcttgtgg 442 ||||| ||||| ||||| ||||| || |||||||||||||||||| Sbjct: 685 ggctctggcttcggctctggcttaggtggcactggcttcttgtgg 641 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 352 tgcggcttgggctcgggcttgggc 375 |||||||||||||| ||||||||| Sbjct: 706 tgcggcttgggctctggcttgggc 683
>dbj|AK061567.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-F04, full insert sequence Length = 1080 Score = 54.0 bits (27), Expect = 6e-04 Identities = 71/85 (83%), Gaps = 3/85 (3%) Strand = Plus / Minus Query: 396 gtggctcgggcttgggctccggcttcggcggcactggcttcttgtggtggaagtgctcca 455 ||||||| ||||| ||||||||||| || ||||| |||||||||||| ||||| || | Sbjct: 562 gtggctccggcttcggctccggcttgggtggcaccggcttcttgtgg---aagtggtcta 506 Query: 456 tgatgtgtttcttgatgggcccgca 480 |||| | ||||||||||| ||||| Sbjct: 505 tgatcttcttcttgatgggaccgca 481 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 398 ggctcgggcttgggctccggcttcggcggcactggcttcttgtgg 442 ||||| ||||| ||||| ||||| || |||||||||||||||||| Sbjct: 683 ggctctggcttcggctctggcttaggtggcactggcttcttgtgg 639 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 352 tgcggcttgggctcgggcttgggc 375 |||||||||||||| ||||||||| Sbjct: 704 tgcggcttgggctctggcttgggc 681
>dbj|AK059996.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-F05, full insert sequence Length = 989 Score = 54.0 bits (27), Expect = 6e-04 Identities = 71/85 (83%), Gaps = 3/85 (3%) Strand = Plus / Minus Query: 396 gtggctcgggcttgggctccggcttcggcggcactggcttcttgtggtggaagtgctcca 455 ||||||| ||||| ||||||||||| || ||||| |||||||||||| ||||| || | Sbjct: 562 gtggctccggcttcggctccggcttgggtggcaccggcttcttgtgg---aagtggtcta 506 Query: 456 tgatgtgtttcttgatgggcccgca 480 |||| | ||||||||||| ||||| Sbjct: 505 tgatcttcttcttgatgggaccgca 481 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 398 ggctcgggcttgggctccggcttcggcggcactggcttcttgtgg 442 ||||| ||||| ||||| ||||| || |||||||||||||||||| Sbjct: 683 ggctctggcttcggctctggcttaggtggcactggcttcttgtgg 639 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 352 tgcggcttgggctcgggcttgggc 375 |||||||||||||| ||||||||| Sbjct: 704 tgcggcttgggctctggcttgggc 681
>dbj|AB055842.1| Oryza sativa OsPRP1 mRNA for proline-rich protein, complete cds Length = 980 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 396 gtggctcgggcttgggctccggcttcggcggcactggcttcttgtgg 442 ||||||| ||||| ||||||||||| || ||||| |||||||||||| Sbjct: 559 gtggctccggctttggctccggcttgggtggcaccggcttcttgtgg 513 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 398 ggctcgggcttgggctccggcttcggcggcactggcttcttgtgg 442 ||||||||||| ||||| ||||| || ||||| |||||||||||| Sbjct: 680 ggctcgggcttaggctcaggcttgggtggcacgggcttcttgtgg 636 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 352 tgcggcttgggctcgggctt 371 |||||||||||||||||||| Sbjct: 689 tgcggcttgggctcgggctt 670
>ref|NM_194863.1| Oryza sativa (japonica cultivar-group) putative proline-rich protein (OSJNBa0031A07.11), mRNA Length = 591 Score = 52.0 bits (26), Expect = 0.002 Identities = 65/78 (83%) Strand = Plus / Minus Query: 431 ggcttcttgtggtggaagtgctccatgatgtgtttcttgatgggcccgcacagggtcatg 490 ||||| |||||||||||||| || | || ||| |||||||||||| |||| | |||| Sbjct: 470 ggcttgttgtggtggaagtggtcgaagaagtgcttcttgatgggctcgcagatggtcgcc 411 Query: 491 gacgcgcactccggcgac 508 ||||||||| |||||||| Sbjct: 410 gacgcgcacaccggcgac 393
>ref|NM_194865.1| Oryza sativa (japonica cultivar-group) putative proline-rich protein (OSJNBa0031A07.13), mRNA Length = 690 Score = 50.1 bits (25), Expect = 0.009 Identities = 69/83 (83%), Gaps = 3/83 (3%) Strand = Plus / Minus Query: 398 ggctcgggcttgggctccggcttcggcggcactggcttcttgtggtggaagtgctccatg 457 ||||| |||||||| ||||||||||| ||||| |||||||| ||| ||||| || ||| Sbjct: 500 ggctctggcttgggatccggcttcggtggcaccggcttcttatgg---aagtggtcgatg 444 Query: 458 atgtgtttcttgatgggcccgca 480 || | ||||||||||| ||||| Sbjct: 443 atcttcttcttgatggggccgca 421
>dbj|AK104542.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-305-B03, full insert sequence Length = 1008 Score = 50.1 bits (25), Expect = 0.009 Identities = 69/83 (83%), Gaps = 3/83 (3%) Strand = Plus / Minus Query: 398 ggctcgggcttgggctccggcttcggcggcactggcttcttgtggtggaagtgctccatg 457 ||||| |||||||| ||||||||||| ||||| |||||||| ||| ||||| || ||| Sbjct: 545 ggctctggcttgggatccggcttcggtggcaccggcttcttatgg---aagtggtcgatg 489 Query: 458 atgtgtttcttgatgggcccgca 480 || | ||||||||||| ||||| Sbjct: 488 atcttcttcttgatggggccgca 466
>dbj|AK104257.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-F02, full insert sequence Length = 1010 Score = 50.1 bits (25), Expect = 0.009 Identities = 69/83 (83%), Gaps = 3/83 (3%) Strand = Plus / Minus Query: 398 ggctcgggcttgggctccggcttcggcggcactggcttcttgtggtggaagtgctccatg 457 ||||| |||||||| ||||||||||| ||||| |||||||| ||| ||||| || ||| Sbjct: 548 ggctctggcttgggatccggcttcggtggcaccggcttcttatgg---aagtggtcgatg 492 Query: 458 atgtgtttcttgatgggcccgca 480 || | ||||||||||| ||||| Sbjct: 491 atcttcttcttgatggggccgca 469
>dbj|AK072923.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023146D17, full insert sequence Length = 1015 Score = 50.1 bits (25), Expect = 0.009 Identities = 69/83 (83%), Gaps = 3/83 (3%) Strand = Plus / Minus Query: 398 ggctcgggcttgggctccggcttcggcggcactggcttcttgtggtggaagtgctccatg 457 ||||| |||||||| ||||||||||| ||||| |||||||| ||| ||||| || ||| Sbjct: 552 ggctctggcttgggatccggcttcggtggcaccggcttcttatgg---aagtggtcgatg 496 Query: 458 atgtgtttcttgatgggcccgca 480 || | ||||||||||| ||||| Sbjct: 495 atcttcttcttgatggggccgca 473
>dbj|AK061576.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-G10, full insert sequence Length = 1011 Score = 50.1 bits (25), Expect = 0.009 Identities = 69/83 (83%), Gaps = 3/83 (3%) Strand = Plus / Minus Query: 398 ggctcgggcttgggctccggcttcggcggcactggcttcttgtggtggaagtgctccatg 457 ||||| |||||||| ||||||||||| ||||| |||||||| ||| ||||| || ||| Sbjct: 548 ggctctggcttgggatccggcttcggtggcaccggcttcttatgg---aagtggtcgatg 492 Query: 458 atgtgtttcttgatgggcccgca 480 || | ||||||||||| ||||| Sbjct: 491 atcttcttcttgatggggccgca 469
>dbj|AK058887.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-C09, full insert sequence Length = 1011 Score = 50.1 bits (25), Expect = 0.009 Identities = 69/83 (83%), Gaps = 3/83 (3%) Strand = Plus / Minus Query: 398 ggctcgggcttgggctccggcttcggcggcactggcttcttgtggtggaagtgctccatg 457 ||||| |||||||| ||||||||||| ||||| |||||||| ||| ||||| || ||| Sbjct: 548 ggctctggcttgggatccggcttcggtggcaccggcttcttatgg---aagtggtcgatg 492 Query: 458 atgtgtttcttgatgggcccgca 480 || | ||||||||||| ||||| Sbjct: 491 atcttcttcttgatggggccgca 469
>dbj|AB071178.1| Oryza sativa (japonica cultivar-group) OsPRP2 mRNA for proline-rich protein 2, complete cds Length = 828 Score = 50.1 bits (25), Expect = 0.009 Identities = 69/83 (83%), Gaps = 3/83 (3%) Strand = Plus / Minus Query: 398 ggctcgggcttgggctccggcttcggcggcactggcttcttgtggtggaagtgctccatg 457 ||||| |||||||| ||||||||||| ||||| |||||||| ||| ||||| || ||| Sbjct: 500 ggctctggcttgggatccggcttcggtggcaccggcttcttatgg---aagtggtcgatg 444 Query: 458 atgtgtttcttgatgggcccgca 480 || | ||||||||||| ||||| Sbjct: 443 atcttcttcttgatggggccgca 421
>gb|DQ397615.1| Cenarchaeum symbiosum clone C20B09, complete sequence Length = 39122 Score = 46.1 bits (23), Expect = 0.14 Identities = 26/27 (96%) Strand = Plus / Plus Query: 395 tgtggctcgggcttgggctccggcttc 421 ||||| ||||||||||||||||||||| Sbjct: 22879 tgtggttcgggcttgggctccggcttc 22905 Score = 44.1 bits (22), Expect = 0.56 Identities = 25/26 (96%) Strand = Plus / Plus Query: 395 tgtggctcgggcttgggctccggctt 420 ||||| |||||||||||||||||||| Sbjct: 22966 tgtggttcgggcttgggctccggctt 22991 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 402 cgggcttgggctccggcttc 421 |||||||||||||||||||| Sbjct: 22073 cgggcttgggctccggcttc 22092
>gb|DQ397547.1| Cenarchaeum symbiosum clone C04F04, complete sequence Length = 39000 Score = 46.1 bits (23), Expect = 0.14 Identities = 26/27 (96%) Strand = Plus / Plus Query: 395 tgtggctcgggcttgggctccggcttc 421 ||||| ||||||||||||||||||||| Sbjct: 10333 tgtggttcgggcttgggctccggcttc 10359 Score = 46.1 bits (23), Expect = 0.14 Identities = 26/27 (96%) Strand = Plus / Plus Query: 395 tgtggctcgggcttgggctccggcttc 421 ||||| ||||||||||||||||||||| Sbjct: 10246 tgtggttcgggcttgggctccggcttc 10272 Score = 46.1 bits (23), Expect = 0.14 Identities = 26/27 (96%) Strand = Plus / Plus Query: 395 tgtggctcgggcttgggctccggcttc 421 ||||| ||||||||||||||||||||| Sbjct: 10159 tgtggttcgggcttgggctccggcttc 10185 Score = 44.1 bits (22), Expect = 0.56 Identities = 25/26 (96%) Strand = Plus / Plus Query: 395 tgtggctcgggcttgggctccggctt 420 ||||| |||||||||||||||||||| Sbjct: 10420 tgtggttcgggcttgggctccggctt 10445
>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome Length = 4967148 Score = 46.1 bits (23), Expect = 0.14 Identities = 26/27 (96%) Strand = Plus / Plus Query: 354 cggcttgggctcgggcttgggcacggg 380 |||||||||||||||||||||| |||| Sbjct: 3480492 cggcttgggctcgggcttgggctcggg 3480518 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 355 ggcttgggctcgggcttggg 374 |||||||||||||||||||| Sbjct: 3480505 ggcttgggctcgggcttggg 3480524
>emb|BX572098.1| Prochlorococcus marinus MIT9313 complete genome; segment 4/7 Length = 346683 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Plus Query: 290 tgccgccaccgccaccgccgtag 312 ||||||||||||||||||||||| Sbjct: 119605 tgccgccaccgccaccgccgtag 119627 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 292 ccgccaccgccaccgccgtag 312 ||||||||||||||||||||| Sbjct: 119637 ccgccaccgccaccgccgtag 119657
>gb|CP000148.1| Geobacter metallireducens GS-15, complete genome Length = 3997420 Score = 44.1 bits (22), Expect = 0.56 Identities = 25/26 (96%) Strand = Plus / Minus Query: 398 ggctcgggcttgggctccggcttcgg 423 ||||||||||||||||| |||||||| Sbjct: 381383 ggctcgggcttgggctcgggcttcgg 381358
>emb|BX248354.1| Corynebacterium diphtheriae gravis NCTC13129, complete genome; segment 1/8 Length = 348517 Score = 44.1 bits (22), Expect = 0.56 Identities = 25/26 (96%) Strand = Plus / Minus Query: 349 ggttgcggcttgggctcgggcttggg 374 |||| ||||||||||||||||||||| Sbjct: 223026 ggttccggcttgggctcgggcttggg 223001
>gb|AF496725.1| Zea mays cultivar Mo17 glycine-rich RNA binding protein gene, 3'UTR and partial cds Length = 736 Score = 44.1 bits (22), Expect = 0.56 Identities = 22/22 (100%) Strand = Plus / Minus Query: 291 gccgccaccgccaccgccgtag 312 |||||||||||||||||||||| Sbjct: 445 gccgccaccgccaccgccgtag 424
>gb|AF496723.1| Zea mays cultivar TX601 glycine-rich RNA binding protein gene, 3'UTR and partial cds Length = 752 Score = 44.1 bits (22), Expect = 0.56 Identities = 22/22 (100%) Strand = Plus / Minus Query: 291 gccgccaccgccaccgccgtag 312 |||||||||||||||||||||| Sbjct: 461 gccgccaccgccaccgccgtag 440
>gb|AF496721.1| Zea mays cultivar H60 glycine-rich RNA binding protein gene, 3'UTR and partial cds Length = 717 Score = 44.1 bits (22), Expect = 0.56 Identities = 22/22 (100%) Strand = Plus / Minus Query: 291 gccgccaccgccaccgccgtag 312 |||||||||||||||||||||| Sbjct: 462 gccgccaccgccaccgccgtag 441
>gb|AF496718.1| Zea mays cultivar CO109 glycine-rich RNA binding protein gene, 3'UTR and partial cds Length = 753 Score = 44.1 bits (22), Expect = 0.56 Identities = 22/22 (100%) Strand = Plus / Minus Query: 291 gccgccaccgccaccgccgtag 312 |||||||||||||||||||||| Sbjct: 462 gccgccaccgccaccgccgtag 441
>gb|AF496715.1| Zea mays cultivar F_2 glycine-rich RNA binding protein gene, 3'UTR and partial cds Length = 748 Score = 44.1 bits (22), Expect = 0.56 Identities = 22/22 (100%) Strand = Plus / Minus Query: 291 gccgccaccgccaccgccgtag 312 |||||||||||||||||||||| Sbjct: 457 gccgccaccgccaccgccgtag 436
>gb|AF496714.1| Zea mays cultivar G_1 glycine-rich RNA binding protein gene, 3'UTR and partial cds Length = 753 Score = 44.1 bits (22), Expect = 0.56 Identities = 22/22 (100%) Strand = Plus / Minus Query: 291 gccgccaccgccaccgccgtag 312 |||||||||||||||||||||| Sbjct: 462 gccgccaccgccaccgccgtag 441
>gb|AF496712.1| Zea mays cultivar H_4 glycine-rich RNA binding protein gene, 3'UTR and partial cds Length = 734 Score = 44.1 bits (22), Expect = 0.56 Identities = 22/22 (100%) Strand = Plus / Minus Query: 291 gccgccaccgccaccgccgtag 312 |||||||||||||||||||||| Sbjct: 443 gccgccaccgccaccgccgtag 422
>gb|AF496710.1| Zea mays cultivar F_5 glycine-rich RNA binding protein gene, 3'UTR and partial cds Length = 753 Score = 44.1 bits (22), Expect = 0.56 Identities = 22/22 (100%) Strand = Plus / Minus Query: 291 gccgccaccgccaccgccgtag 312 |||||||||||||||||||||| Sbjct: 462 gccgccaccgccaccgccgtag 441
>gb|AF496706.1| Zea mays cultivar 647 glycine-rich RNA binding protein gene, 3'UTR and partial cds Length = 723 Score = 44.1 bits (22), Expect = 0.56 Identities = 22/22 (100%) Strand = Plus / Minus Query: 291 gccgccaccgccaccgccgtag 312 |||||||||||||||||||||| Sbjct: 466 gccgccaccgccaccgccgtag 445
>gb|AY129335.1| Mycobacteriophage Corndog, complete genome Length = 69777 Score = 44.1 bits (22), Expect = 0.56 Identities = 25/26 (96%) Strand = Plus / Minus Query: 355 ggcttgggctcgggcttgggcacggg 380 ||||||||||||||||||||| |||| Sbjct: 21903 ggcttgggctcgggcttgggctcggg 21878 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 398 ggctcgggcttgggctccggcttcg 422 ||||||||||||||||| ||||||| Sbjct: 21897 ggctcgggcttgggctcgggcttcg 21873
>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome Length = 5331656 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 398 ggctcgggcttgggctccggcttcggcggc 427 ||||| ||||| |||||||||||||||||| Sbjct: 1337062 ggctccggcttcggctccggcttcggcggc 1337033
>gb|AC084043.4|AC084043 Mus musculus 1 BAC RP23-265D16 (Roswell Park Cancer Institute Mouse BAC Library) complete sequence Length = 63324 Score = 44.1 bits (22), Expect = 0.56 Identities = 22/22 (100%) Strand = Plus / Plus Query: 291 gccgccaccgccaccgccgtag 312 |||||||||||||||||||||| Sbjct: 39640 gccgccaccgccaccgccgtag 39661
>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome Length = 5013479 Score = 44.1 bits (22), Expect = 0.56 Identities = 22/22 (100%) Strand = Plus / Minus Query: 604 cgggcgcgttggaggcggccgc 625 |||||||||||||||||||||| Sbjct: 3069840 cgggcgcgttggaggcggccgc 3069819
>gb|AC124989.7| Mus musculus chromosome 1, clone RP24-404O8, complete sequence Length = 184453 Score = 44.1 bits (22), Expect = 0.56 Identities = 22/22 (100%) Strand = Plus / Minus Query: 291 gccgccaccgccaccgccgtag 312 |||||||||||||||||||||| Sbjct: 121887 gccgccaccgccaccgccgtag 121866
>emb|AJ234401.1|HVU234401 Hordeum vulgare partial mRNA; clone cMWG0646 Length = 694 Score = 44.1 bits (22), Expect = 0.56 Identities = 25/26 (96%) Strand = Plus / Minus Query: 398 ggctcgggcttgggctccggcttcgg 423 ||||||||||||||||| |||||||| Sbjct: 602 ggctcgggcttgggctctggcttcgg 577
>emb|X52472.1|TAPRP T.aestivum mRNA for a proline-rich protein Length = 1487 Score = 44.1 bits (22), Expect = 0.56 Identities = 25/26 (96%) Strand = Plus / Minus Query: 398 ggctcgggcttgggctccggcttcgg 423 ||||||||||||||||| |||||||| Sbjct: 634 ggctcgggcttgggctctggcttcgg 609 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 355 ggcttgggctcgggcttgggc 375 ||||||||||||||||||||| Sbjct: 817 ggcttgggctcgggcttgggc 797 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 397 tggctcgggcttgggctccggctt 420 |||||||||||||||||| ||||| Sbjct: 1046 tggctcgggcttgggctcgggctt 1023 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 398 ggctcgggcttgggctccgg 417 |||||||||||||||||||| Sbjct: 811 ggctcgggcttgggctccgg 792
>gb|AC115893.10| Mus musculus chromosome 1, clone RP24-442I13, complete sequence Length = 153053 Score = 44.1 bits (22), Expect = 0.56 Identities = 22/22 (100%) Strand = Plus / Minus Query: 291 gccgccaccgccaccgccgtag 312 |||||||||||||||||||||| Sbjct: 19075 gccgccaccgccaccgccgtag 19054
>gb|AC121510.10| Mus musculus chromosome 19, clone RP24-371N19, complete sequence Length = 168677 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 288 tctgccgccaccgccaccgcc 308 ||||||||||||||||||||| Sbjct: 118239 tctgccgccaccgccaccgcc 118219
>gb|AC137853.21| Mus musculus chromosome 19, clone RP24-276L14, complete sequence Length = 173430 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 288 tctgccgccaccgccaccgcc 308 ||||||||||||||||||||| Sbjct: 158251 tctgccgccaccgccaccgcc 158271
>gb|AC120527.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0011J22 map R10571S, complete sequence Length = 154441 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 288 tctgccgccaccgccaccgcc 308 ||||||||||||||||||||| Sbjct: 20421 tctgccgccaccgccaccgcc 20401
>gb|AC147812.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0073K23 map near R10571S, complete sequence Length = 161073 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 288 tctgccgccaccgccaccgcc 308 ||||||||||||||||||||| Sbjct: 119722 tctgccgccaccgccaccgcc 119702
>ref|XM_423354.1| PREDICTED: Gallus gallus similar to Olfactory receptor 5BF1 (LOC425614), partial mRNA Length = 1083 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 554 gtggtgccctgggacaccggg 574 ||||||||||||||||||||| Sbjct: 1043 gtggtgccctgggacaccggg 1063
>ref|XM_362553.1| Magnaporthe grisea 70-15 hypothetical protein (MG08136.4) partial mRNA Length = 1239 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 290 tgccgccaccgccaccgccgt 310 ||||||||||||||||||||| Sbjct: 940 tgccgccaccgccaccgccgt 920
>gb|AC131781.3| Mus musculus BAC clone RP24-344J9 from chromosome 15, complete sequence Length = 139338 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ctgccgccaccgccaccgccg 309 ||||||||||||||||||||| Sbjct: 13870 ctgccgccaccgccaccgccg 13850
>ref|XM_983584.1| PREDICTED: Mus musculus RIKEN cDNA 1110018J23 gene (1110018J23Rik), mRNA Length = 5480 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 288 tctgccgccaccgccaccgcc 308 ||||||||||||||||||||| Sbjct: 486 tctgccgccaccgccaccgcc 506
>ref|XM_905034.2| PREDICTED: Mus musculus similar to Matrin-3 (LOC433254), mRNA Length = 5480 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 288 tctgccgccaccgccaccgcc 308 ||||||||||||||||||||| Sbjct: 486 tctgccgccaccgccaccgcc 506
>ref|XM_001002314.1| PREDICTED: Mus musculus RIKEN cDNA 1110018J23 gene (1110018J23Rik), mRNA Length = 5480 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 288 tctgccgccaccgccaccgcc 308 ||||||||||||||||||||| Sbjct: 486 tctgccgccaccgccaccgcc 506
>emb|AL117207.1|CEY60A3A Caenorhabditis elegans YAC Y60A3A, complete sequence Length = 122592 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 355 ggcttgggctcgggcttgggc 375 ||||||||||||||||||||| Sbjct: 98883 ggcttgggctcgggcttgggc 98903
>emb|AL513284.12| Human DNA sequence from clone RP11-518D3 on chromosome 1 Contains the 3' end of a novel gene (FLJ42034, FLJ38762), the gene for a putative NFkB activating protein 373, a C-terminal binding protein 2 (CTBP2) pseudogene, a ribosomal protein S7 (RPS7) pseudogene and a CpG island, complete sequence Length = 169972 Score = 42.1 bits (21), Expect = 2.2 Identities = 36/41 (87%) Strand = Plus / Minus Query: 292 ccgccaccgccaccgccgtaggtgggcgtgggagggacggg 332 |||||||||||||||||| ||| || ||||||||| |||| Sbjct: 51563 ccgccaccgccaccgccgcagggtggggtgggaggggcggg 51523
>emb|CR555306.1| Azoarcus sp. EbN1 complete genome Length = 4296230 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 528 cgttgtcgccggcgacaatgc 548 ||||||||||||||||||||| Sbjct: 4225639 cgttgtcgccggcgacaatgc 4225619
>emb|BX569695.1| Synechococcus sp. WH8102 complete genome; segment 7/7 Length = 344615 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 291 gccgccaccgccaccgccgta 311 ||||||||||||||||||||| Sbjct: 306358 gccgccaccgccaccgccgta 306378
>emb|AL663054.9| Mouse DNA sequence from clone RP23-480G5 on chromosome 11 Contains the 5' end of the Myo1d gene for myosin ID, a novel gene and a mitochondrial ribosomal protein L27 (Mrpl27) pseudogene, complete sequence Length = 82452 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ctgccgccaccgccaccgccg 309 ||||||||||||||||||||| Sbjct: 44314 ctgccgccaccgccaccgccg 44334
>gb|AC100776.2| Homo sapiens chromosome 18, clone CTD-2009D8, complete sequence Length = 67543 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 56 aatctttgaaaagcaatacaa 76 ||||||||||||||||||||| Sbjct: 51935 aatctttgaaaagcaatacaa 51955
>gb|AC091135.9| Homo sapiens chromosome 18, clone RP11-289E15, complete sequence Length = 166207 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 56 aatctttgaaaagcaatacaa 76 ||||||||||||||||||||| Sbjct: 151083 aatctttgaaaagcaatacaa 151063
>gb|AC008378.6| Homo sapiens chromosome 5 clone CTC-209H22, complete sequence Length = 161267 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 70 aatacaagcacactgatcccc 90 ||||||||||||||||||||| Sbjct: 42203 aatacaagcacactgatcccc 42223
>dbj|AK142175.1| Mus musculus 13 days embryo heart cDNA, RIKEN full-length enriched library, clone:D330005I06 product:hypothetical RNA-binding region RNP-1 (RNA recognition motif)/Proline-rich region profile/Eukaryotic RNA Recognition Motif (RRM) profile/Zn-finger, C2H2 type containing protein, full insert sequence Length = 2530 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 288 tctgccgccaccgccaccgcc 308 ||||||||||||||||||||| Sbjct: 232 tctgccgccaccgccaccgcc 252
>gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome Length = 4352825 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 354 cggcttgggctcgggcttggg 374 ||||||||||||||||||||| Sbjct: 1281891 cggcttgggctcgggcttggg 1281871 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 354 cggcttgggctcgggcttgg 373 |||||||||||||||||||| Sbjct: 1399198 cggcttgggctcgggcttgg 1399217
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 287 atctgccgccaccgccaccgc 307 ||||||||||||||||||||| Sbjct: 25521851 atctgccgccaccgccaccgc 25521871 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 291 gccgccaccgccaccgccgt 310 |||||||||||||||||||| Sbjct: 23668873 gccgccaccgccaccgccgt 23668892
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 288 tctgccgccaccgccaccgcc 308 ||||||||||||||||||||| Sbjct: 3294564 tctgccgccaccgccaccgcc 3294584 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 291 gccgccaccgccaccgccgt 310 |||||||||||||||||||| Sbjct: 18816775 gccgccaccgccaccgccgt 18816756
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ctgccgccaccgccaccgccg 309 ||||||||||||||||||||| Sbjct: 19955688 ctgccgccaccgccaccgccg 19955708 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 289 ctgccgccaccgccaccgcc 308 |||||||||||||||||||| Sbjct: 25823089 ctgccgccaccgccaccgcc 25823070 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 289 ctgccgccaccgccaccgcc 308 |||||||||||||||||||| Sbjct: 22595556 ctgccgccaccgccaccgcc 22595575 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 289 ctgccgccaccgccaccgcc 308 |||||||||||||||||||| Sbjct: 10522553 ctgccgccaccgccaccgcc 10522534
>gb|AY116586.1| Sus scrofa diacylglycerol acyltransferase (DGAT1) gene, complete cds Length = 9303 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ctgccgccaccgccaccgccg 309 ||||||||||||||||||||| Sbjct: 7940 ctgccgccaccgccaccgccg 7920
>dbj|AP004753.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0508B05 Length = 166165 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ctgccgccaccgccaccgccg 309 ||||||||||||||||||||| Sbjct: 133289 ctgccgccaccgccaccgccg 133309
>dbj|AP005609.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJNBa0014M17 Length = 156778 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ctgccgccaccgccaccgccg 309 ||||||||||||||||||||| Sbjct: 59809 ctgccgccaccgccaccgccg 59829
>emb|CR354589.19| Zebrafish DNA sequence from clone CH211-93L13 in linkage group 17, complete sequence Length = 114273 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ctgccgccaccgccaccgccg 309 ||||||||||||||||||||| Sbjct: 95357 ctgccgccaccgccaccgccg 95377
>gb|AC161198.5| Mus musculus chromosome 15, clone RP23-34E23, complete sequence Length = 237801 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ctgccgccaccgccaccgccg 309 ||||||||||||||||||||| Sbjct: 41974 ctgccgccaccgccaccgccg 41994
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 288 tctgccgccaccgccaccgcc 308 ||||||||||||||||||||| Sbjct: 3303277 tctgccgccaccgccaccgcc 3303297 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 291 gccgccaccgccaccgccgt 310 |||||||||||||||||||| Sbjct: 18977475 gccgccaccgccaccgccgt 18977456
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 287 atctgccgccaccgccaccgc 307 ||||||||||||||||||||| Sbjct: 25450027 atctgccgccaccgccaccgc 25450047 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 291 gccgccaccgccaccgccgt 310 |||||||||||||||||||| Sbjct: 23597060 gccgccaccgccaccgccgt 23597079
>emb|AL928781.4|CNS08CCB Oryza sativa chromosome 12, . BAC OSJNBa0070E09 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 144084 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 287 atctgccgccaccgccaccgc 307 ||||||||||||||||||||| Sbjct: 91233 atctgccgccaccgccaccgc 91253
>dbj|AB066265.2| Triticum aestivum WCSP1 mRNA for cold shock protein-1, complete cds Length = 1029 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 291 gccgccaccgccaccgccgta 311 ||||||||||||||||||||| Sbjct: 427 gccgccaccgccaccgccgta 407 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 292 ccgccaccgccaccgccgtag 312 ||||||||||||||||||||| Sbjct: 378 ccgccaccgccaccgccgtag 358
>dbj|AP006627.1| Bacillus clausii KSM-K16 DNA, complete genome Length = 4303871 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 157 aatggcacaagaccaaaacaa 177 ||||||||||||||||||||| Sbjct: 2231517 aatggcacaagaccaaaacaa 2231537
>gb|AC154043.1| Drosophila melanogaster clone BACR39O11, complete sequence Length = 182468 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 35 aaaacacacaccaaaattac 54 |||||||||||||||||||| Sbjct: 64679 aaaacacacaccaaaattac 64698
>ref|NM_115030.1| Arabidopsis thaliana sugar binding AT3G51710 mRNA, complete cds Length = 1431 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 289 ctgccgccaccgccaccgcc 308 |||||||||||||||||||| Sbjct: 1369 ctgccgccaccgccaccgcc 1388
>ref|XM_493890.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 828 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 289 ctgccgccaccgccaccgccgtag 312 |||||||| ||||||||||||||| Sbjct: 751 ctgccgccgccgccaccgccgtag 728
>ref|XM_466998.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1266 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 289 ctgccgccaccgccaccgcc 308 |||||||||||||||||||| Sbjct: 184 ctgccgccaccgccaccgcc 203
>ref|XM_466424.1| Oryza sativa (japonica cultivar-group), mRNA Length = 333 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 289 ctgccgccaccgccaccgcc 308 |||||||||||||||||||| Sbjct: 85 ctgccgccaccgccaccgcc 66
>ref|NM_184794.1| Oryza sativa (japonica cultivar-group), mRNA Length = 879 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 290 tgccgccaccgccaccgccg 309 |||||||||||||||||||| Sbjct: 277 tgccgccaccgccaccgccg 258
>ref|XM_517483.1| PREDICTED: Pan troglodytes similar to hypothetical protein (LOC461543), mRNA Length = 1461 Score = 40.1 bits (20), Expect = 8.7 Identities = 26/28 (92%) Strand = Plus / Plus Query: 398 ggctcgggcttgggctccggcttcggcg 425 |||||||||| ||||||||||| ||||| Sbjct: 867 ggctcgggctcgggctccggctccggcg 894
>ref|XM_526064.1| PREDICTED: Pan troglodytes similar to EF-hand domain-containing protein 1 (Swiprosin 2) (PP3051) (LOC470681), mRNA Length = 2190 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 398 ggctcgggcttgggctccgg 417 |||||||||||||||||||| Sbjct: 629 ggctcgggcttgggctccgg 610
>ref|NM_014034.1| Homo sapiens ASF1 anti-silencing function 1 homolog A (S. cerevisiae) (ASF1A), mRNA Length = 2367 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 53 acaaatctttgaaaagcaat 72 |||||||||||||||||||| Sbjct: 1849 acaaatctttgaaaagcaat 1868
>gb|BC002449.2| Homo sapiens EF-hand domain family, member D1, mRNA (cDNA clone MGC:3052 IMAGE:3343900), complete cds Length = 1889 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 398 ggctcgggcttgggctccgg 417 |||||||||||||||||||| Sbjct: 210 ggctcgggcttgggctccgg 191
>gb|AC078977.6| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0496H07, complete sequence Length = 164477 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 289 ctgccgccaccgccaccgccgtag 312 |||||||| ||||||||||||||| Sbjct: 151754 ctgccgccgccgccaccgccgtag 151731
>ref|NM_017369.1| Mus musculus gamma-aminobutyric acid (GABA-A) receptor, subunit epsilon (Gabre), mRNA Length = 2779 Score = 40.1 bits (20), Expect = 8.7 Identities = 32/36 (88%) Strand = Plus / Minus Query: 340 tccgggtggggttgcggcttgggctcgggcttgggc 375 ||||| ||||| | ||||||||||||||||| |||| Sbjct: 1084 tccggctggggctccggcttgggctcgggctcgggc 1049
>gb|AC102136.6| Mus musculus chromosome 3, clone RP23-269G19, complete sequence Length = 186659 Score = 40.1 bits (20), Expect = 8.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 398 ggctcgggcttgggctccggcttcggcg 425 ||||| |||| ||||||||||||||||| Sbjct: 12516 ggctccggctggggctccggcttcggcg 12489
>gb|BC101932.1| Rattus norvegicus nucleosome assembly protein 1-like 3, mRNA (cDNA clone MGC:124570 IMAGE:7938895), complete cds Length = 2824 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 289 ctgccgccaccgccaccgcc 308 |||||||||||||||||||| Sbjct: 199 ctgccgccaccgccaccgcc 218
>gb|AC133248.4| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0080I08, complete sequence Length = 197156 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 291 gccgccaccgccaccgccgt 310 |||||||||||||||||||| Sbjct: 82669 gccgccaccgccaccgccgt 82650
>gb|AC092076.7| Oryza sativa chromosome 3 BAC OSJNBb0021G19 genomic sequence, complete sequence Length = 141582 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 291 gccgccaccgccaccgccgt 310 |||||||||||||||||||| Sbjct: 109511 gccgccaccgccaccgccgt 109492
>ref|NM_033041.2| Mus musculus hairy and enhancer of split 7 (Drosophila) (Hes7), mRNA Length = 965 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 289 ctgccgccaccgccaccgcc 308 |||||||||||||||||||| Sbjct: 611 ctgccgccaccgccaccgcc 630
>gb|AF131866.2| Mus musculus chromosome X clone CT7-271B7 map qA7.1, complete sequence Length = 110310 Score = 40.1 bits (20), Expect = 8.7 Identities = 32/36 (88%) Strand = Plus / Plus Query: 340 tccgggtggggttgcggcttgggctcgggcttgggc 375 ||||| ||||| | ||||||||||||||||| |||| Sbjct: 17519 tccggctggggctccggcttgggctcgggctcgggc 17554
>gb|AC124212.2| Mus musculus chromosome X clone CT7-532E7 map qA7.1, complete sequence Length = 109783 Score = 40.1 bits (20), Expect = 8.7 Identities = 32/36 (88%) Strand = Plus / Plus Query: 340 tccgggtggggttgcggcttgggctcgggcttgggc 375 ||||| ||||| | ||||||||||||||||| |||| Sbjct: 101480 tccggctggggctccggcttgggctcgggctcgggc 101515
>gb|BT013842.1| Lycopersicon esculentum clone 132799F, mRNA sequence Length = 1978 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 530 ttgtcgccggcgacaatgccgaaa 553 ||||||||||||||||||| |||| Sbjct: 203 ttgtcgccggcgacaatgcagaaa 180
>gb|AC158583.3| Mus musculus chromosome 3, clone RP24-318B11, complete sequence Length = 168986 Score = 40.1 bits (20), Expect = 8.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 398 ggctcgggcttgggctccggcttcggcg 425 ||||| |||| ||||||||||||||||| Sbjct: 30440 ggctccggctggggctccggcttcggcg 30413
>ref|NM_025202.2| Homo sapiens EF-hand domain family, member D1 (EFHD1), mRNA Length = 1889 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 398 ggctcgggcttgggctccgg 417 |||||||||||||||||||| Sbjct: 210 ggctcgggcttgggctccgg 191
>gb|AF377565.1| Tripsacum dactyloides clone T. anonymous genomic RFLP marker Csu1138 Length = 369 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 397 tggctcgggcttgggctccggctt 420 ||||| |||||||||||||||||| Sbjct: 133 tggcttgggcttgggctccggctt 110
>ref|NM_133402.2| Rattus norvegicus nucleosome assembly protein 1-like 3 (Nap1l3), mRNA Length = 2824 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 289 ctgccgccaccgccaccgcc 308 |||||||||||||||||||| Sbjct: 199 ctgccgccaccgccaccgcc 218
>gb|CP000117.1| Anabaena variabilis ATCC 29413 chromosome, complete sequence Length = 6365727 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 295 ccaccgccaccgccgtaggt 314 |||||||||||||||||||| Sbjct: 6169565 ccaccgccaccgccgtaggt 6169546
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 291 gccgccaccgccaccgccgt 310 |||||||||||||||||||| Sbjct: 32770030 gccgccaccgccaccgccgt 32770049 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 290 tgccgccaccgccaccgccg 309 |||||||||||||||||||| Sbjct: 22107727 tgccgccaccgccaccgccg 22107746 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 291 gccgccaccgccaccgccgt 310 |||||||||||||||||||| Sbjct: 5273280 gccgccaccgccaccgccgt 5273299
>gb|AY190956.1| Drosophila virilis clone DVIF01_06_H02 (D1438) genomic sequence Length = 46427 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 289 ctgccgccaccgccaccgcc 308 |||||||||||||||||||| Sbjct: 7939 ctgccgccaccgccaccgcc 7958
>ref|XM_542058.2| PREDICTED: Canis familiaris similar to RalGDS-like protein 3 (LOC484942), mRNA Length = 2139 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 289 ctgccgccaccgccaccgcc 308 |||||||||||||||||||| Sbjct: 328 ctgccgccaccgccaccgcc 347
>emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete genome Length = 5178466 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 290 tgccgccaccgccaccgccg 309 |||||||||||||||||||| Sbjct: 2420417 tgccgccaccgccaccgccg 2420436
>gb|AC091519.16| Mus musculus strain 129/SvJ chromosome 2 clone mgs1-452h5, complete sequence Length = 229220 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 289 ctgccgccaccgccaccgcc 308 |||||||||||||||||||| Sbjct: 119679 ctgccgccaccgccaccgcc 119698
>ref|XM_806801.1| Trypanosoma cruzi strain CL Brener dual specificity protein phosphatase (Tc00.1047053508385.40) partial mRNA Length = 2463 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 289 ctgccgccaccgccaccgcc 308 |||||||||||||||||||| Sbjct: 1457 ctgccgccaccgccaccgcc 1438
>emb|Z81135.1|CEW01G7 Caenorhabditis elegans Cosmid W01G7, complete sequence Length = 32965 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 289 ctgccgccaccgccaccgcc 308 |||||||||||||||||||| Sbjct: 3828 ctgccgccaccgccaccgcc 3809
>ref|XM_844408.1| PREDICTED: Canis familiaris hypothetical protein LOC608537 (LOC608537), mRNA Length = 551 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 387 agtccgggtgtggctcgggc 406 |||||||||||||||||||| Sbjct: 310 agtccgggtgtggctcgggc 329
>gb|AC124765.2| Mus musculus BAC clone RP23-197D9 from 2, complete sequence Length = 191781 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 290 tgccgccaccgccaccgccg 309 |||||||||||||||||||| Sbjct: 140800 tgccgccaccgccaccgccg 140819
>ref|XM_805412.1| Trypanosoma cruzi strain CL Brener dispersed gene family protein 1 (DGF-1) (Tc00.1047053511475.24) partial mRNA Length = 6931 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 291 gccgccaccgccaccgccgt 310 |||||||||||||||||||| Sbjct: 4929 gccgccaccgccaccgccgt 4948
>ref|XM_723599.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY07735) partial mRNA Length = 651 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 410 ggctccggcttcggcggcac 429 |||||||||||||||||||| Sbjct: 365 ggctccggcttcggcggcac 346
>gb|AC146581.1| Oryza sativa (japonica cultivar-group) Nipponbare strain chromosome 3 clone OSJNBa0021H20, complete sequence Length = 133079 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 291 gccgccaccgccaccgccgt 310 |||||||||||||||||||| Sbjct: 96682 gccgccaccgccaccgccgt 96701
>emb|AL390965.15| Human DNA sequence from clone RP11-640E11 on chromosome 13 Contains a solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 5 (SLC25A5) pseudogene, complete sequence Length = 92179 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 65 aaagcaatacaagcacactg 84 |||||||||||||||||||| Sbjct: 67971 aaagcaatacaagcacactg 67990
>gb|AC104390.6| Homo sapiens chromosome 15, clone CTD-2643K12, complete sequence Length = 201225 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 161 gcacaagaccaaaacaatac 180 |||||||||||||||||||| Sbjct: 116667 gcacaagaccaaaacaatac 116648
>emb|AL132874.30|HSJ329L24 Human DNA sequence from clone RP3-329L24 on chromosome 6q22.1-22.33 Contains three novel genes (FLJ20170, FLJ22085), the 3' end of a novel gene containing FLJ13942 and a CpG island, complete sequence Length = 112638 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 53 acaaatctttgaaaagcaat 72 |||||||||||||||||||| Sbjct: 46114 acaaatctttgaaaagcaat 46133
>ref|XM_970601.1| PREDICTED: Tribolium castaneum similar to Protein C20orf112 (LOC664605), mRNA Length = 4272 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 289 ctgccgccaccgccaccgcc 308 |||||||||||||||||||| Sbjct: 1268 ctgccgccaccgccaccgcc 1287
>gb|BC071886.1| Homo sapiens EF-hand domain family, member D1, mRNA (cDNA clone IMAGE:4634162) Length = 1350 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 398 ggctcgggcttgggctccgg 417 |||||||||||||||||||| Sbjct: 132 ggctcgggcttgggctccgg 113
>gb|BC004128.2| Homo sapiens EF-hand domain family, member D1, mRNA (cDNA clone MGC:11244 IMAGE:3940060), complete cds Length = 1877 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 398 ggctcgggcttgggctccgg 417 |||||||||||||||||||| Sbjct: 198 ggctcgggcttgggctccgg 179
>emb|AL645527.20| Mouse DNA sequence from clone RP23-26L6 on chromosome 11 Contains the Vamp2 gene for vesicle-associated membrane 2, the Per1 gene for period homolog 1 (Drosophila), the Hes7 gene for hairy and enhancer of split 7 (Drosophila), the Aloxe3 gene for arachidonate lipoxygenase 3, the Alox12b gene for arachidonate 12-lipoxygenase 12R type, the Alox15b gene for arachidonate 15-lipoxygenase second type, the Gucy2e gene for guanylate cyclase 2e, a novel gene, the gene for LYST-interacting protein LIP8 (Lip8-pending), the gene for the likely ortholog of H. sapiens trafficking protein particle complex 1 (TRAPPC1)), the Kcnab3 gene for potassium voltage-gated channel shaker-related subfamily beta member 3, a novel gene, the 3' end of the Chd3 gene for chromodomain helicase DNA binding protein 3 and six CpG islands, complete sequence Length = 261224 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 289 ctgccgccaccgccaccgcc 308 |||||||||||||||||||| Sbjct: 39468 ctgccgccaccgccaccgcc 39487
>emb|BX640444.1| Bordetella bronchiseptica strain RB50, complete genome; segment 8/16 Length = 349008 Score = 40.1 bits (20), Expect = 8.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 348 gggttgcggcttgggctcgggcttgggc 375 ||||| |||||||| ||||||||||||| Sbjct: 324613 gggttccggcttggcctcgggcttgggc 324586
>emb|BX640427.1| Bordetella parapertussis strain 12822, complete genome; segment 5/14 Length = 348997 Score = 40.1 bits (20), Expect = 8.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 348 gggttgcggcttgggctcgggcttgggc 375 ||||| |||||||| ||||||||||||| Sbjct: 232452 gggttccggcttggcctcgggcttgggc 232425
>emb|BX640415.1| Bordetella pertussis strain Tohama I, complete genome; segment 5/12 Length = 347071 Score = 40.1 bits (20), Expect = 8.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 348 gggttgcggcttgggctcgggcttgggc 375 ||||| |||||||| ||||||||||||| Sbjct: 99722 gggttccggcttggcctcgggcttgggc 99695
>emb|AL161504.2|ATCHRIV16 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 16 Length = 196766 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 54 caaatctttgaaaagcaata 73 |||||||||||||||||||| Sbjct: 183268 caaatctttgaaaagcaata 183287
>emb|AL132968.1|ATT18N14 Arabidopsis thaliana DNA chromosome 3, BAC clone T18N14 Length = 79867 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 289 ctgccgccaccgccaccgcc 308 |||||||||||||||||||| Sbjct: 65134 ctgccgccaccgccaccgcc 65153
>emb|AL050261.1|HSM800262 Homo sapiens mRNA; cDNA DKFZp564E2182 (from clone DKFZp564E2182) Length = 2367 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 53 acaaatctttgaaaagcaat 72 |||||||||||||||||||| Sbjct: 1849 acaaatctttgaaaagcaat 1868
>emb|AL845258.5| Mouse DNA sequence from clone RP23-315H12 on chromosome 2, complete sequence Length = 164324 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 289 ctgccgccaccgccaccgcc 308 |||||||||||||||||||| Sbjct: 20196 ctgccgccaccgccaccgcc 20177
>emb|BX323799.14| Zebrafish DNA sequence from clone CH211-159B19 in linkage group 13, complete sequence Length = 188145 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 46 caaaattacaaatctttgaa 65 |||||||||||||||||||| Sbjct: 159020 caaaattacaaatctttgaa 159039
>gb|AC140930.3| Mus musculus BAC clone RP23-116P20 from chromosome 12, complete sequence Length = 201455 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 89 cctgtgttcctcacaactgt 108 |||||||||||||||||||| Sbjct: 45255 cctgtgttcctcacaactgt 45236
>gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome Length = 7074893 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 289 ctgccgccaccgccaccgcc 308 |||||||||||||||||||| Sbjct: 2156121 ctgccgccaccgccaccgcc 2156102
>gb|AC011448.5| Homo sapiens chromosome 19 clone CTC-260F20, complete sequence Length = 165122 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 289 ctgccgccaccgccaccgcc 308 |||||||||||||||||||| Sbjct: 91004 ctgccgccaccgccaccgcc 90985
>dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, complete genome Length = 4940217 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 290 tgccgccaccgccaccgccg 309 |||||||||||||||||||| Sbjct: 2498834 tgccgccaccgccaccgccg 2498815
>emb|CR624361.1| full-length cDNA clone CS0DI042YH07 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1778 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 398 ggctcgggcttgggctccgg 417 |||||||||||||||||||| Sbjct: 148 ggctcgggcttgggctccgg 129
>emb|CR620373.1| full-length cDNA clone CS0DI027YD08 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1894 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 398 ggctcgggcttgggctccgg 417 |||||||||||||||||||| Sbjct: 250 ggctcgggcttgggctccgg 231
>emb|CR610395.1| full-length cDNA clone CS0DN003YJ01 of Adult brain of Homo sapiens (human) Length = 1232 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 53 acaaatctttgaaaagcaat 72 |||||||||||||||||||| Sbjct: 752 acaaatctttgaaaagcaat 771
>emb|CR603402.1| full-length cDNA clone CS0DI004YK11 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1834 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 398 ggctcgggcttgggctccgg 417 |||||||||||||||||||| Sbjct: 211 ggctcgggcttgggctccgg 192
>emb|CR599516.1| full-length cDNA clone CS0DI030YB23 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1831 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 398 ggctcgggcttgggctccgg 417 |||||||||||||||||||| Sbjct: 202 ggctcgggcttgggctccgg 183
>emb|CR599551.1| full-length cDNA clone CS0DN005YA21 of Adult brain of Homo sapiens (human) Length = 2227 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 398 ggctcgggcttgggctccgg 417 |||||||||||||||||||| Sbjct: 596 ggctcgggcttgggctccgg 577
>emb|CR597707.1| full-length cDNA clone CS0DI060YB16 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1833 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 398 ggctcgggcttgggctccgg 417 |||||||||||||||||||| Sbjct: 205 ggctcgggcttgggctccgg 186
>gb|AE011850.1| Xanthomonas axonopodis pv. citri str. 306, section 228 of 469 of the complete genome Length = 11292 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 290 tgccgccaccgccaccgccg 309 |||||||||||||||||||| Sbjct: 534 tgccgccaccgccaccgccg 515
>dbj|AK023674.1| Homo sapiens cDNA FLJ13612 fis, clone PLACE1010833, weakly similar to CALTRACTIN Length = 1876 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 398 ggctcgggcttgggctccgg 417 |||||||||||||||||||| Sbjct: 219 ggctcgggcttgggctccgg 200
>dbj|AK158066.1| Mus musculus adult inner ear cDNA, RIKEN full-length enriched library, clone:F930025B07 product:TBC1 domain family, member 13, full insert sequence Length = 3546 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 289 ctgccgccaccgccaccgcc 308 |||||||||||||||||||| Sbjct: 58 ctgccgccaccgccaccgcc 39
>gb|AF206633.1|AF206633 Streptomyces peucetius chitinase C precursor, gene, complete cds; and unknown gene Length = 2699 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 409 gggctccggcttcggcggca 428 |||||||||||||||||||| Sbjct: 528 gggctccggcttcggcggca 547
>gb|AF119697.1|AF119697 Mesocestoides sp. LC9708 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 539 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 291 gccgccaccgccaccgccgt 310 |||||||||||||||||||| Sbjct: 188 gccgccaccgccaccgccgt 169
>gb|AF119696.1|AF119696 Mesocestoides corti isolate SO2-MC1 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 546 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 291 gccgccaccgccaccgccgt 310 |||||||||||||||||||| Sbjct: 188 gccgccaccgccaccgccgt 169
>gb|AF119695.1|AF119695 Mesocestoides corti isolate SO1-MC1 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 546 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 291 gccgccaccgccaccgccgt 310 |||||||||||||||||||| Sbjct: 188 gccgccaccgccaccgccgt 169
>gb|AF119694.1|AF119694 Mesocestoides corti isolate MeCo2 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 546 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 291 gccgccaccgccaccgccgt 310 |||||||||||||||||||| Sbjct: 188 gccgccaccgccaccgccgt 169
>gb|DQ096556.1| Mesocestoides sp. B KP-2005 isolate KAP711 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence Length = 497 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 291 gccgccaccgccaccgccgt 310 |||||||||||||||||||| Sbjct: 169 gccgccaccgccaccgccgt 150
>gb|DQ096555.1| Mesocestoides sp. B KP-2005 isolate KAP299 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence Length = 481 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 291 gccgccaccgccaccgccgt 310 |||||||||||||||||||| Sbjct: 169 gccgccaccgccaccgccgt 150
>gb|DQ096554.1| Mesocestoides sp. B KP-2005 isolate KAP106B 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence Length = 497 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 291 gccgccaccgccaccgccgt 310 |||||||||||||||||||| Sbjct: 169 gccgccaccgccaccgccgt 150
>gb|DQ096553.1| Mesocestoides sp. B KP-2005 isolate KAP300B 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence Length = 481 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 291 gccgccaccgccaccgccgt 310 |||||||||||||||||||| Sbjct: 169 gccgccaccgccaccgccgt 150
>gb|DQ096552.1| Mesocestoides sp. B KP-2005 isolate KAP302B 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence Length = 482 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 291 gccgccaccgccaccgccgt 310 |||||||||||||||||||| Sbjct: 169 gccgccaccgccaccgccgt 150
>dbj|AK050791.1| Mus musculus 9 days embryo whole body cDNA, RIKEN full-length enriched library, clone:D030020D08 product:BHLH FACTOR HES7, full insert sequence Length = 965 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 289 ctgccgccaccgccaccgcc 308 |||||||||||||||||||| Sbjct: 611 ctgccgccaccgccaccgcc 630
>dbj|AK079258.1| Mus musculus adult male urinary bladder cDNA, RIKEN full-length enriched library, clone:9530062C16 product:GABA-A RECEPTOR EPSILON-LIKE SUBUNIT homolog [Mus musculus], full insert sequence Length = 1939 Score = 40.1 bits (20), Expect = 8.7 Identities = 32/36 (88%) Strand = Plus / Minus Query: 340 tccgggtggggttgcggcttgggctcgggcttgggc 375 ||||| ||||| | ||||||||||||||||| |||| Sbjct: 1171 tccggctggggctccggcttgggctcgggctcgggc 1136
>ref|NM_064540.2| Caenorhabditis elegans abnormal DAuer Formation family member (daf-5) (daf-5) mRNA, complete cds Length = 2512 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 289 ctgccgccaccgccaccgcc 308 |||||||||||||||||||| Sbjct: 1556 ctgccgccaccgccaccgcc 1575
>ref|NG_003051.1| Mus musculus heat shock protein 1 (chaperonin 10), pseudogene 5 (Hspe1-ps5) on chromosome 2 Length = 419 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 290 tgccgccaccgccaccgccg 309 |||||||||||||||||||| Sbjct: 87 tgccgccaccgccaccgccg 68
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 289 ctgccgccaccgccaccgcc 308 |||||||||||||||||||| Sbjct: 14643206 ctgccgccaccgccaccgcc 14643225
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 291 gccgccaccgccaccgccgt 310 |||||||||||||||||||| Sbjct: 10783781 gccgccaccgccaccgccgt 10783800
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 289 ctgccgccaccgccaccgccgtag 312 |||||||| ||||||||||||||| Sbjct: 918275 ctgccgccgccgccaccgccgtag 918252
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 291 gccgccaccgccaccgccgt 310 |||||||||||||||||||| Sbjct: 32860540 gccgccaccgccaccgccgt 32860559 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 290 tgccgccaccgccaccgccg 309 |||||||||||||||||||| Sbjct: 22100756 tgccgccaccgccaccgccg 22100775 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 291 gccgccaccgccaccgccgt 310 |||||||||||||||||||| Sbjct: 5272495 gccgccaccgccaccgccgt 5272514
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 291 gccgccaccgccaccgccgt 310 |||||||||||||||||||| Sbjct: 13343755 gccgccaccgccaccgccgt 13343774
>gb|AF247844.1|AF247844 Mus musculus Cpn10-rs6 pseudogene, complete sequence Length = 419 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 290 tgccgccaccgccaccgccg 309 |||||||||||||||||||| Sbjct: 87 tgccgccaccgccaccgccg 68
>gb|AC092376.3| Homo sapiens chromosome 16 clone RP11-679B19, complete sequence Length = 168083 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 47 aaaattacaaatctttgaaa 66 |||||||||||||||||||| Sbjct: 108737 aaaattacaaatctttgaaa 108718
>gb|AC109602.6| Oryza sativa chromosome 3 BAC OSJNBa0087M10 genomic sequence, complete sequence Length = 167397 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 290 tgccgccaccgccaccgccg 309 |||||||||||||||||||| Sbjct: 40555 tgccgccaccgccaccgccg 40536
>gb|AC084592.1|CBRG42D24 Caenorhabditis briggsae cosmid G42D24, complete sequence Length = 24534 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 291 gccgccaccgccaccgccgt 310 |||||||||||||||||||| Sbjct: 5217 gccgccaccgccaccgccgt 5198
>gb|AC090874.9| Oryza sativa chromosome 3 BAC OJ1523_A02 genomic sequence, complete sequence Length = 132987 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 290 tgccgccaccgccaccgccg 309 |||||||||||||||||||| Sbjct: 117135 tgccgccaccgccaccgccg 117116
>gb|AC073254.6| Homo sapiens BAC clone RP11-176L22 from 2, complete sequence Length = 83528 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 398 ggctcgggcttgggctccgg 417 |||||||||||||||||||| Sbjct: 62876 ggctcgggcttgggctccgg 62857
>gb|AF218006.1|AF218006 Homo sapiens clone PP3051 unknown mRNA Length = 1923 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 398 ggctcgggcttgggctccgg 417 |||||||||||||||||||| Sbjct: 203 ggctcgggcttgggctccgg 184
>emb|BX005307.12| Zebrafish DNA sequence from clone DKEY-235F19 in linkage group 6, complete sequence Length = 200462 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 52 tacaaatctttgaaaagcaa 71 |||||||||||||||||||| Sbjct: 105427 tacaaatctttgaaaagcaa 105446
>gb|AF189265.1|AF189264S2 Mus musculus GABA-A receptor epsilon-like subunit (Epsilon) gene, exons 2 and 3 Length = 1935 Score = 40.1 bits (20), Expect = 8.7 Identities = 32/36 (88%) Strand = Plus / Minus Query: 340 tccgggtggggttgcggcttgggctcgggcttgggc 375 ||||| ||||| | ||||||||||||||||| |||| Sbjct: 1028 tccggctggggctccggcttgggctcgggctcgggc 993
>gb|AF189263.1|AF189263 Mus musculus GABA-A receptor epsilon-like subunit (Epsilon) mRNA, complete cds Length = 2773 Score = 40.1 bits (20), Expect = 8.7 Identities = 32/36 (88%) Strand = Plus / Minus Query: 340 tccgggtggggttgcggcttgggctcgggcttgggc 375 ||||| ||||| | ||||||||||||||||| |||| Sbjct: 1084 tccggctggggctccggcttgggctcgggctcgggc 1049
>dbj|BA000019.2| Nostoc sp. PCC 7120 DNA, complete genome Length = 6413771 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 295 ccaccgccaccgccgtaggt 314 |||||||||||||||||||| Sbjct: 3919952 ccaccgccaccgccgtaggt 3919933 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 292 ccgccaccgccaccgccgta 311 |||||||||||||||||||| Sbjct: 2785629 ccgccaccgccaccgccgta 2785610
>emb|BX649381.5| Mouse DNA sequence from clone RP23-245K23 on chromosome 2, complete sequence Length = 195508 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 438 tgtggtggaagtgctccatg 457 |||||||||||||||||||| Sbjct: 188113 tgtggtggaagtgctccatg 188132
>dbj|AP006620.1| Nocardia farcinica IFM 10152 plasmid pNF2 DNA, complete sequence Length = 87093 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 529 gttgtcgccggcgacaatgc 548 |||||||||||||||||||| Sbjct: 49448 gttgtcgccggcgacaatgc 49429
>dbj|AP003331.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B1088D01 Length = 146144 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 291 gccgccaccgccaccgccgt 310 |||||||||||||||||||| Sbjct: 84113 gccgccaccgccaccgccgt 84132
>dbj|AP005260.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0557D09 Length = 135315 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 291 gccgccaccgccaccgccgt 310 |||||||||||||||||||| Sbjct: 113227 gccgccaccgccaccgccgt 113246
>dbj|AP005397.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0643D11 Length = 137525 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 289 ctgccgccaccgccaccgcc 308 |||||||||||||||||||| Sbjct: 64873 ctgccgccaccgccaccgcc 64892
>dbj|AP004133.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1112_G03 Length = 106401 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 289 ctgccgccaccgccaccgcc 308 |||||||||||||||||||| Sbjct: 69695 ctgccgccaccgccaccgcc 69676
>dbj|AP005694.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJNBa0063E14 Length = 174415 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 289 ctgccgccaccgccaccgcc 308 |||||||||||||||||||| Sbjct: 103721 ctgccgccaccgccaccgcc 103702
>dbj|AP005644.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJNBb0056I22 Length = 147728 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 289 ctgccgccaccgccaccgcc 308 |||||||||||||||||||| Sbjct: 43367 ctgccgccaccgccaccgcc 43386
>dbj|AK121943.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033107F03, full insert sequence Length = 2924 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 291 gccgccaccgccaccgccgt 310 |||||||||||||||||||| Sbjct: 565 gccgccaccgccaccgccgt 584
>dbj|AK111522.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002M11, full insert sequence Length = 2776 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 291 gccgccaccgccaccgccgt 310 |||||||||||||||||||| Sbjct: 558 gccgccaccgccaccgccgt 577
>dbj|AK025738.1| Homo sapiens cDNA: FLJ22085 fis, clone HEP14921 Length = 2403 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 53 acaaatctttgaaaagcaat 72 |||||||||||||||||||| Sbjct: 1852 acaaatctttgaaaagcaat 1871
>dbj|AK101497.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033043G02, full insert sequence Length = 2672 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 291 gccgccaccgccaccgccgt 310 |||||||||||||||||||| Sbjct: 59 gccgccaccgccaccgccgt 78
>dbj|AK069995.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023037B09, full insert sequence Length = 1917 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 291 gccgccaccgccaccgccgt 310 |||||||||||||||||||| Sbjct: 233 gccgccaccgccaccgccgt 252
>dbj|AK068731.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013158I01, full insert sequence Length = 1237 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 291 gccgccaccgccaccgccgt 310 |||||||||||||||||||| Sbjct: 592 gccgccaccgccaccgccgt 573
>dbj|AK065194.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002E13, full insert sequence Length = 4021 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 289 ctgccgccaccgccaccgcc 308 |||||||||||||||||||| Sbjct: 1119 ctgccgccaccgccaccgcc 1100
>emb|Z99281.1|CEY57G11C Caenorhabditis elegans YAC Y57G11C, complete sequence Length = 313573 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 49 aattacaaatctttgaaaagcaat 72 |||||||||| ||||||||||||| Sbjct: 94595 aattacaaatatttgaaaagcaat 94572
>emb|CT573072.1| Kuenenia stuttgartiensis genome fragment KUST_D (4 of 5) Length = 896449 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 288 tctgccgccaccgccaccgc 307 |||||||||||||||||||| Sbjct: 166948 tctgccgccaccgccaccgc 166967
>gb|AF147261.1|F21I2 Arabidopsis thaliana BAC F21I2 Length = 94905 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 54 caaatctttgaaaagcaata 73 |||||||||||||||||||| Sbjct: 13499 caaatctttgaaaagcaata 13480
>gb|AE003480.4| Drosophila melanogaster chromosome 3L, section 14 of 83 of the complete sequence Length = 311933 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 35 aaaacacacaccaaaattac 54 |||||||||||||||||||| Sbjct: 307309 aaaacacacaccaaaattac 307290
>gb|AY438643.1| Caenorhabditis elegans abnormal DAuer Formation DAF-5, a Ski oncogene homolog involved in a neuronal TGF beta pathway (71.0 kD) (daf-5) alternative variant a, complete mRNA Length = 2512 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 289 ctgccgccaccgccaccgcc 308 |||||||||||||||||||| Sbjct: 1556 ctgccgccaccgccaccgcc 1575
>gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete genome Length = 4941439 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 290 tgccgccaccgccaccgccg 309 |||||||||||||||||||| Sbjct: 2519144 tgccgccaccgccaccgccg 2519125
>dbj|AP001111.1| Oryza sativa genomic DNA, chromosome 5, clone:P0699E04 Length = 175439 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 289 ctgccgccaccgccaccgccgtag 312 |||||||| ||||||||||||||| Sbjct: 8694 ctgccgccgccgccaccgccgtag 8671
>emb|AL844840.8| Mouse DNA sequence from clone RP23-337P9 on chromosome 2, complete sequence Length = 219568 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 290 tgccgccaccgccaccgccg 309 |||||||||||||||||||| Sbjct: 162210 tgccgccaccgccaccgccg 162191
>emb|AL772425.7|CNS08CA3 Oryza sativa chromosome 12, . BAC OJ1396_C02 of library Monsanto from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 157690 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 291 gccgccaccgccaccgccgt 310 |||||||||||||||||||| Sbjct: 37537 gccgccaccgccaccgccgt 37518
>emb|AL807747.10| Mouse DNA sequence from clone RP23-300N21 on chromosome 4, complete sequence Length = 228003 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 289 ctgccgccaccgccaccgcc 308 |||||||||||||||||||| Sbjct: 160446 ctgccgccaccgccaccgcc 160465
>emb|AL844878.4|CNS08CB1 Oryza sativa chromosome 12, . BAC OSJNBb0036A19 of library OSJNBb from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 128795 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 291 gccgccaccgccaccgccgt 310 |||||||||||||||||||| Sbjct: 86749 gccgccaccgccaccgccgt 86730
>gb|AC148879.2| Chlamydomonas reinhardtii clone cr-36D8, complete sequence Length = 53591 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 291 gccgccaccgccaccgccgt 310 |||||||||||||||||||| Sbjct: 42504 gccgccaccgccaccgccgt 42485
>gb|BC035476.1| Homo sapiens EF-hand domain family, member D1, mRNA (cDNA clone IMAGE:5192690) Length = 1998 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 398 ggctcgggcttgggctccgg 417 |||||||||||||||||||| Sbjct: 266 ggctcgggcttgggctccgg 247
>dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, complete genome Length = 3566135 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 600 ggcacgggcgcgttggaggc 619 |||||||||||||||||||| Sbjct: 1104839 ggcacgggcgcgttggaggc 1104820
>dbj|AB209715.1| Homo sapiens mRNA for EF hand domain family, member D1 variant protein Length = 934 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 398 ggctcgggcttgggctccgg 417 |||||||||||||||||||| Sbjct: 198 ggctcgggcttgggctccgg 179
>emb|AL807816.7| Mouse DNA sequence from clone RP23-13H12 on chromosome X, complete sequence Length = 193219 Score = 40.1 bits (20), Expect = 8.7 Identities = 32/36 (88%) Strand = Plus / Plus Query: 340 tccgggtggggttgcggcttgggctcgggcttgggc 375 ||||| ||||| | ||||||||||||||||| |||| Sbjct: 36764 tccggctggggctccggcttgggctcgggctcgggc 36799
>dbj|AB067678.1| Rattus norvegicus nap1l3 mRNA for nucleosome assembly protein 1-like 3, complete cds Length = 2646 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 289 ctgccgccaccgccaccgcc 308 |||||||||||||||||||| Sbjct: 111 ctgccgccaccgccaccgcc 130
>gb|M59711.1|MBOPILINA M.lacunata pilin gene inverting protein (pivml) gene, 3' end, pilin (tfpI) pseudogene, 3' end, and tfpB gene, complete cds Length = 3328 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 290 tgccgccaccgccaccgccg 309 |||||||||||||||||||| Sbjct: 3028 tgccgccaccgccaccgccg 3009
>dbj|AB050104.1| Mus musculus gene for bHLH factor Hes7, complete cds Length = 3591 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 289 ctgccgccaccgccaccgcc 308 |||||||||||||||||||| Sbjct: 3064 ctgccgccaccgccaccgcc 3083
>dbj|AB049065.1| Mus musculus mRNA for bHLH factor Hes7, complete cds Length = 678 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 289 ctgccgccaccgccaccgcc 308 |||||||||||||||||||| Sbjct: 589 ctgccgccaccgccaccgcc 608
>dbj|AB034704.1| Rubrivivax gelatinosus photosynthetic gene cluster, complete cds, stain:IL144 Length = 58996 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 533 tcgccggcgacaatgccgaa 552 |||||||||||||||||||| Sbjct: 16536 tcgccggcgacaatgccgaa 16517
>dbj|AB003332.1| Anabaena variabilis rbpF gene for RNA binding protein, complete cds Length = 1424 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 292 ccgccaccgccaccgccgta 311 |||||||||||||||||||| Sbjct: 931 ccgccaccgccaccgccgta 912
>emb|AL683806.14| Mouse DNA sequence from clone RP23-47K11 on chromosome 11, complete sequence Length = 10060 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 91 tgtgttcctcacaactgtta 110 |||||||||||||||||||| Sbjct: 4759 tgtgttcctcacaactgtta 4778 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,689,363 Number of Sequences: 3902068 Number of extensions: 4689363 Number of successful extensions: 111720 Number of sequences better than 10.0: 219 Number of HSP's better than 10.0 without gapping: 230 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 108231 Number of HSP's gapped (non-prelim): 3477 length of query: 641 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 618 effective length of database: 17,143,297,704 effective search space: 10594557981072 effective search space used: 10594557981072 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
