ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd14f20
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 214 2e-52
2gb|AY466108.1| Oryza sativa (japonica cultivar-group) lipid tran... 214 2e-52
3gb|AC118673.2| Genomic sequence for Oryza sativa, Nipponbare str... 214 2e-52
4gb|AC125411.1| Genomic sequence for Oryza sativa, Nipponbare str... 214 2e-52
5dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 214 2e-52
6gb|AF485811.1| Oryza sativa BAC OSJNa0049F05, complete sequence 214 2e-52
7dbj|AK103618.1| Oryza sativa (japonica cultivar-group) cDNA clon... 214 2e-52
8dbj|AK062654.1| Oryza sativa (japonica cultivar-group) cDNA clon... 210 4e-51
9gb|AY108363.1| Zea mays PCO069442 mRNA sequence 165 2e-37
10ref|XM_467170.1| Oryza sativa (japonica cultivar-group), mRNA 141 3e-30
11dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 141 3e-30
12dbj|AP004037.3| Oryza sativa (japonica cultivar-group) genomic D... 141 3e-30
13dbj|AP004883.3| Oryza sativa (japonica cultivar-group) genomic D... 141 3e-30
14dbj|AK109149.1| Oryza sativa (japonica cultivar-group) cDNA clon... 141 3e-30
15gb|L27208.1|RICRCC3 Oryza sativa root-specific RCc3 mRNA, comple... 141 3e-30
16ref|NM_197681.1| Oryza sativa (japonica cultivar-group) putative... 125 2e-25
17gb|AC026758.8| Oryza sativa chromosome 10 BAC OSJNBa0015J15 geno... 125 2e-25
18dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 125 2e-25
19dbj|AK062381.1| Oryza sativa (japonica cultivar-group) cDNA clon... 125 2e-25
20gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 125 2e-25
21ref|NM_197676.1| Oryza sativa (japonica cultivar-group) putative... 123 7e-25
22ref|XM_473448.1| Oryza sativa (japonica cultivar-group), predic... 123 7e-25
23gb|AY466109.1| Oryza sativa (japonica cultivar-group) lipid tran... 123 7e-25
24emb|AL606633.3|OSJN00060 Oryza sativa genomic DNA, chromosome 4,... 123 7e-25
25dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 123 7e-25
26ref|NM_197679.1| Oryza sativa (japonica cultivar-group) putative... 119 1e-23
27dbj|AK062911.1| Oryza sativa (japonica cultivar-group) cDNA clon... 117 4e-23
28ref|XM_473449.1| Oryza sativa (japonica cultivar-group), predic... 115 2e-22
29ref|NM_197680.1| Oryza sativa (japonica cultivar-group) putative... 109 1e-20
30dbj|AK063090.1| Oryza sativa (japonica cultivar-group) cDNA clon... 109 1e-20
31ref|NM_197675.1| Oryza sativa (japonica cultivar-group) putative... 107 4e-20
32gb|AY108411.1| Zea mays PCO134698 mRNA sequence 105 2e-19
33ref|NM_197671.1| Oryza sativa (japonica cultivar-group) putative... 101 2e-18
34gb|L27210.1|RICRCG2 Oryza sativa root-specific protein (RCg2) ge... 101 2e-18
35gb|L27209.1|RICRCC2 Oryza sativa root-specific RCc2 mRNA, comple... 101 2e-18
36ref|NM_197674.1| Oryza sativa (japonica cultivar-group) putative... 94 6e-16
37gb|AY105972.1| Zea mays PCO122221 mRNA sequence 94 6e-16
38ref|XM_469576.1| Oryza sativa (japonica cultivar-group), mRNA 84 6e-13
39gb|AC147426.2| Oryza sativa chromosome 3 B1377B10 genomic seque... 84 6e-13
40gb|AC091532.13| Oryza sativa chromosome 3 BAC OSJNBa0078A17 geno... 84 6e-13
41ref|NM_197672.1| Oryza sativa (japonica cultivar-group) putative... 82 2e-12
42emb|Z12103.1|ZMDELINM Z.mays mRNA that delineates a novel subset... 82 2e-12
43dbj|AK102086.1| Oryza sativa (japonica cultivar-group) cDNA clon... 82 2e-12
44gb|AY104687.1| Zea mays PCO121733 mRNA sequence 82 2e-12
45gb|AF001634.1|AF001634 Zea mays physical impedance induced prote... 82 2e-12
46ref|XM_467171.1| Oryza sativa (japonica cultivar-group), mRNA 78 4e-11
47dbj|AK063037.1| Oryza sativa (japonica cultivar-group) cDNA clon... 78 4e-11
48dbj|AK058218.1| Oryza sativa (japonica cultivar-group) cDNA clon... 78 4e-11
49ref|XM_473450.1| Oryza sativa (japonica cultivar-group), predic... 74 6e-10
50gb|AY105236.1| Zea mays PCO121732 mRNA sequence 74 6e-10
51ref|NM_185320.1| Oryza sativa (japonica cultivar-group), mRNA 72 2e-09
52gb|AF149815.1| Oryza sativa unknown gene 72 2e-09
53dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 72 2e-09
54dbj|AP001129.1| Oryza sativa (japonica cultivar-group) genomic D... 72 2e-09
55gb|AY106116.1| Zea mays PCO091367 mRNA sequence 70 9e-09
56ref|NM_195931.1| Oryza sativa (japonica cultivar-group) putative... 66 1e-07
57ref|XM_473863.1| Oryza sativa (japonica cultivar-group), predic... 66 1e-07
58ref|XM_473862.1| Oryza sativa (japonica cultivar-group), predic... 66 1e-07
59emb|AL731610.4|OSJN00255 Oryza sativa genomic DNA, chromosome 4,... 66 1e-07
60gb|AC123594.1| Oryza sativa (japonica cultivar-group) chromosome... 66 1e-07
61dbj|AK062781.1| Oryza sativa (japonica cultivar-group) cDNA clon... 66 1e-07
62dbj|AK062848.1| Oryza sativa (japonica cultivar-group) cDNA clon... 66 1e-07
63dbj|AK062295.1| Oryza sativa (japonica cultivar-group) cDNA clon... 66 1e-07
64gb|AF369906.1| Sorghum bicolor clone BAC10J22 Sbb3766 sequence 64 5e-07
65ref|NM_197670.1| Oryza sativa (japonica cultivar-group) putative... 62 2e-06
66dbj|AK107851.1| Oryza sativa (japonica cultivar-group) cDNA clon... 62 2e-06
67gb|AY105149.1| Zea mays PCO087109 mRNA sequence 60 8e-06
68ref|NM_195926.1| Oryza sativa (japonica cultivar-group) putative... 56 1e-04
69dbj|AP003523.3| Oryza sativa (japonica cultivar-group) genomic D... 52 0.002
70dbj|AK103715.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.002
71gb|AF026382.1| Fragaria x ananassa HyPRP mRNA, complete cds 52 0.002
72gb|AY530533.1| Fragaria x ananassa cultivar Chandler HyPRP gene,... 52 0.002
73dbj|AB018588.1| Zea mays ZmGR1b mRNA, complete cds 52 0.002
74dbj|AB018587.1| Zea mays ZmGR1a mRNA, complete cds 52 0.002
75ref|NM_195927.1| Oryza sativa (japonica cultivar-group) putative... 50 0.008
76ref|XM_474092.1| Oryza sativa (japonica cultivar-group), predic... 48 0.032
77ref|NM_185028.1| Oryza sativa (japonica cultivar-group), mRNA 48 0.032
78dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 48 0.032
79gb|AC108906.9| Oryza sativa chromosome 3 BAC OSJNBa0087C10 genom... 48 0.032
80gb|AC104321.7| Oryza sativa chromosome 3 BAC OSJNBa0052F07 genom... 48 0.032
81dbj|AP004557.3| Oryza sativa (japonica cultivar-group) genomic D... 48 0.032
82dbj|AK108560.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.032
83dbj|AK105903.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.032
84dbj|AK105778.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.032
85dbj|AK104623.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.032
86dbj|AK071989.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.032
87dbj|AK061322.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.032
88emb|AL732331.2| Oryza sativa genomic DNA, chromosome 4, BAC clon... 48 0.032
89emb|AL606454.3|OSJN00009 Oryza sativa genomic DNA, chromosome 4,... 48 0.032
90dbj|AK034359.1| Mus musculus adult male diencephalon cDNA, RIKEN... 46 0.13
91gb|AC132394.3| Mus musculus BAC clone RP23-391F16 from chromosom... 46 0.13
92ref|NM_195930.1| Oryza sativa (japonica cultivar-group) putative... 44 0.49
93gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome 44 0.49
94gb|CP000319.1| Nitrobacter hamburgensis X14, complete genome 44 0.49
95emb|BX569781.7| Zebrafish DNA sequence from clone DKEY-72L18 in ... 44 0.49
96gb|AE004524.1| Pseudomonas aeruginosa PAO1, section 85 of 529 of... 44 0.49
97emb|Z93108.1|MAZ93108 M.acuminata mRNA; clone pBAN UU70 44 0.49
98emb|BX255913.8| Zebrafish DNA sequence from clone DKEY-85N7 in l... 44 0.49
99gb|AF011922.1|AF011922 Pseudomonas aeruginosa aru gene cluster, ... 44 0.49
100gb|AC150432.2| Branchiostoma floridae clone CH302-9D15, complete... 42 2.0
101gb|AC154761.2| Mus musculus BAC clone RP24-416E4 from chromosome... 42 2.0
102ref|XM_746730.1| Aspergillus fumigatus Af293 hypothetical protei... 42 2.0
103ref|XM_776757.1| PREDICTED: Strongylocentrotus purpuratus hypoth... 42 2.0
104emb|AL939128.1|SCO939128 Streptomyces coelicolor A3(2) complete ... 42 2.0
105emb|AL627097.6| Mouse DNA sequence from clone RP23-59B16 on chro... 42 2.0
106emb|BX510349.5| Zebrafish DNA sequence from clone CH211-69E13 in... 42 2.0
107gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome 42 2.0
108emb|BX324224.11| Zebrafish DNA sequence from clone CH211-168H21 ... 42 2.0
109emb|BX537260.8| Zebrafish DNA sequence from clone DKEY-234J21 in... 42 2.0
110emb|BX539325.9| Zebrafish DNA sequence from clone CH211-253B18 i... 42 2.0
111gb|AY105889.1| Zea mays PCO106909 mRNA sequence 42 2.0
112gb|AE000782.1| Archaeoglobus fulgidus DSM 4304, complete genome 42 2.0
113emb|BX284664.8| Zebrafish DNA sequence from clone DKEY-7I23 in l... 42 2.0
114gb|U73214.1|TAU73214 Triticum aestivum cold acclimation protein ... 42 2.0
115gb|AC102318.8| Mus musculus chromosome 7, clone RP24-447C20, com... 40 7.7
116gb|CP000148.1| Geobacter metallireducens GS-15, complete genome 40 7.7
117gb|CP000108.1| Chlorobium chlorochromatii CaD3, complete genome 40 7.7
118ref|XM_483067.1| Oryza sativa (japonica cultivar-group), mRNA 40 7.7
119ref|NM_194119.1| Oryza sativa (japonica cultivar-group), mRNA 40 7.7
120gb|AC137922.3| Oryza sativa (japonica cultivar-group) chromosome... 40 7.7
121gb|AC135558.6| Oryza sativa (japonica cultivar-group) chromosome... 40 7.7
122gb|AC102152.12| Mus musculus chromosome 7, clone RP23-314H9, com... 40 7.7
123gb|AE017283.1| Propionibacterium acnes KPA171202, complete genome 40 7.7
124gb|AC146277.2| Pan troglodytes BAC clone CH251-17J20 from X, com... 40 7.7
125gb|AC146276.2| Pan troglodytes BAC clone CH251-149B14 from X, co... 40 7.7
126gb|AC127690.4| Mus musculus BAC clone RP24-215A3 from chromosome... 40 7.7
127gb|AC129326.3| Mus musculus BAC clone RP23-326H12 from chromosom... 40 7.7
128gb|AC116451.7| Mus musculus chromosome 19, clone RP24-273P9, com... 40 7.7
129gb|AC147428.6| Medicago truncatula clone mth2-34i10, complete se... 40 7.7
130emb|Z70689.2|HSU19D8 Human DNA sequence from clone LL0XNC01-19D8... 40 7.7
131emb|AL590069.5| Human DNA sequence from clone RP11-353J17 on chr... 40 7.7
132emb|CR391991.7| Zebrafish DNA sequence from clone DKEY-150E11 in... 40 7.7
133emb|CR555306.1| Azoarcus sp. EbN1 complete genome 40 7.7
134emb|CR456683.7| Zebrafish DNA sequence from clone CH211-39I13 in... 40 7.7
135gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome 40 7.7
136emb|BX890614.10| Zebrafish DNA sequence from clone DKEY-46N5, co... 40 7.7
137emb|BX927071.12| Zebrafish DNA sequence from clone DKEY-286O23 i... 40 7.7
138gb|AC108043.3| Homo sapiens BAC clone RP11-270L13 from 4, comple... 40 7.7
139emb|AL928929.11| Zebrafish DNA sequence from clone CH211-218M9 i... 40 7.7
140gb|AY168646.1| Deltfia acidovorans tdn operon, partial sequence ... 40 7.7
141emb|BX247877.13| Zebrafish DNA sequence from clone DKEY-16J24, c... 40 7.7
142dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 40 7.7
143dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 40 7.7
144dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 40 7.7
145dbj|AP003268.4| Oryza sativa (japonica cultivar-group) genomic D... 40 7.7
146dbj|AP003309.3| Oryza sativa (japonica cultivar-group) genomic D... 40 7.7
147dbj|AP003560.2| Oryza sativa (japonica cultivar-group) genomic D... 40 7.7
148dbj|AB177545.1| Delftia acidovorans ORF7NA, ORF7NB, ORF7NC, ORF7... 40 7.7
149gb|AF235504.1|AF235504 Streptomyces hygroscopicus var. ascomycet... 40 7.7
150gb|AF263912.1|AF263912 Streptomyces noursei ATCC 11455 nystatin ... 40 7.7
151dbj|AP003874.5| Oryza sativa (japonica cultivar-group) genomic D... 40 7.7
152dbj|BA000045.2| Gloeobacter violaceus PCC 7421 DNA, complete genome 40 7.7
153emb|AL935272.17| Zebrafish DNA sequence from clone CH211-266K22,... 40 7.7
154dbj|AP005244.3| Oryza sativa (japonica cultivar-group) genomic D... 40 7.7
155emb|CR356233.12| Zebrafish DNA sequence from clone CH211-262N1, ... 40 7.7
156emb|BX936328.7| Zebrafish DNA sequence from clone CH211-11F20 in... 40 7.7
157emb|CT025920.8| Zebrafish DNA sequence from clone CH73-64P10 in ... 40 7.7
158dbj|AP003503.2| Homo sapiens genomic DNA, chromosome 11q, clone:... 40 7.7
159dbj|AP003462.2| Homo sapiens genomic DNA, chromosome 11q clone:R... 40 7.7
160gb|U34333.1|PVU34333 Phaseolus vulgaris proline-rich 14 kDa prot... 40 7.7
161gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 40 7.7
162emb|BX890608.15| Zebrafish DNA sequence from clone CH211-195J11 ... 40 7.7
163emb|BX000530.10| Mouse DNA sequence from clone RP24-500B8 on chr... 40 7.7
164gb|AY504541.1| Macroderma gigas isolate Rnew NADH dehydrogenase ... 40 7.7

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  214 bits (108), Expect = 2e-52
 Identities = 201/232 (86%)
 Strand = Plus / Minus

                                                                          
Query: 233    gggcaggtgaagttggcggggcacttcttgccgcactggttgaggaggagggtcaggtcg 292
              ||||||||||||| || ||||||  |||||  ||| | |||||| ||||| |  || |||
Sbjct: 187236 gggcaggtgaagtcggaggggcaggtcttgtggcagtagttgagaaggagagagagatcg 187177

                                                                          
Query: 293    atggggacattgagcttgatgccgaggatgttggccctgatggcggtgcagaggcacacg 352
              | |||||  ||||| ||||||||||||||||||||| ||||||||||||||||||| |||
Sbjct: 187176 acggggatgttgagattgatgccgaggatgttggccttgatggcggtgcagaggcagacg 187117

                                                                          
Query: 353    gcggcgtcgaggtcggcgagcccgcctaggagtgggcagcactgctcgttcgccggcacg 412
              ||||||||||||||| |||| || || || |  ||||||||||||||| || ||||||||
Sbjct: 187116 gcggcgtcgaggtcgacgaggccacccagcaacgggcagcactgctcgctctccggcacg 187057

                                                                  
Query: 413    ccgatcttgagcttcagcaggttcagcacgttggcgcacacgcccagcttca 464
              |||||||| |||||||||||||| ||||||||||||||||||| ||||||||
Sbjct: 187056 ccgatcttcagcttcagcaggttgagcacgttggcgcacacgctcagcttca 187005



 Score =  210 bits (106), Expect = 4e-51
 Identities = 172/194 (88%)
 Strand = Plus / Minus

                                                                          
Query: 271    gttgaggaggagggtcaggtcgatggggacattgagcttgatgccgaggatgttggccct 330
              |||||||||||||   ||||||| |||||| ||||  ||||||||||||| ||||||| |
Sbjct: 189902 gttgaggaggaggacgaggtcgacggggacgttgatgttgatgccgaggacgttggcctt 189843

                                                                          
Query: 331    gatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcctaggagtgggca 390
              |||||||||||||||||| |||||||||||||||||| ||||||| || || || |||||
Sbjct: 189842 gatggcggtgcagaggcagacggcggcgtcgaggtcgacgagcccccccagcagcgggca 189783

                                                                          
Query: 391    gcactgctcgttcgccggcacgccgatcttgagcttcagcaggttcagcacgttggcgca 450
              ||||| |||| |||||||||| || | ||||||||| |||||||| ||||||||||||||
Sbjct: 189782 gcactcctcgctcgccggcacccccaccttgagcttgagcaggttgagcacgttggcgca 189723

                            
Query: 451    cacgcccagcttca 464
              ||||||||||||||
Sbjct: 189722 cacgcccagcttca 189709



 Score =  101 bits (51), Expect = 2e-18
 Identities = 96/111 (86%)
 Strand = Plus / Minus

                                                                          
Query: 262    gccgcactggttgaggaggagggtcaggtcgatggggacattgagcttgatgccgaggat 321
              |||||| | ||||| ||||||| | |||| ||||||||  ||||| |||||||| |||||
Sbjct: 198932 gccgcagtagttgacgaggaggctgaggttgatggggaggttgaggttgatgccaaggat 198873

                                                                 
Query: 322    gttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 372
              |||||| | || |||||||||||||||||||||||| || |||||||||||
Sbjct: 198872 gttggcgcggagggcggtgcagaggcacacggcggcctcaaggtcggcgag 198822



 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 105/126 (83%)
 Strand = Plus / Minus

                                                                            
Query: 328      cctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcctaggagtgg 387
                ||||||||||| |||||||||| | |||||||||||||   |||| |  || || || ||
Sbjct: 28817161 cctgatggcggcgcagaggcacgccgcggcgtcgaggttcacgaggctccccagcagcgg 28817102

                                                                            
Query: 388      gcagcactgctcgttcgccggcacgccgatcttgagcttcagcaggttcagcacgttggc 447
                ||||||||||| | |||||||||||  |||||| |||||||||||   |||||||| |||
Sbjct: 28817101 gcagcactgctggctcgccggcacgttgatcttcagcttcagcagcaccagcacgtcggc 28817042

                      
Query: 448      gcacac 453
                ||||||
Sbjct: 28817041 gcacac 28817036



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                         
Query: 434    ttcagcacgttggcgcacacgcccagcttcaacgtgttgatcg 476
              ||||||||||| |||||||| |||||||||| ||||| |||||
Sbjct: 198757 ttcagcacgttcgcgcacacccccagcttcagcgtgtcgatcg 198715



 Score = 48.1 bits (24), Expect = 0.032
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                    
Query: 337      ggtgcagaggcacacggcggcgtcgaggtcggcgag 372
                |||||||||||| ||| |||||||||||||| ||||
Sbjct: 33114069 ggtgcagaggcagacgacggcgtcgaggtcgacgag 33114104



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                            
Query: 437      agcacgttggcgcacacgcccagcttca 464
                ||||||||||||||||| | ||||||||
Sbjct: 33114172 agcacgttggcgcacacacgcagcttca 33114199



to top

>gb|AY466108.1| Oryza sativa (japonica cultivar-group) lipid transfer protein-like
           protein (LTP1) mRNA, complete cds
          Length = 772

 Score =  214 bits (108), Expect = 2e-52
 Identities = 201/232 (86%)
 Strand = Plus / Minus

                                                                       
Query: 233 gggcaggtgaagttggcggggcacttcttgccgcactggttgaggaggagggtcaggtcg 292
           ||||||||||||| || ||||||  |||||  ||| | |||||| ||||| |  || |||
Sbjct: 530 gggcaggtgaagtcggaggggcaggtcttgtggcagtagttgagaaggagagagagatcg 471

                                                                       
Query: 293 atggggacattgagcttgatgccgaggatgttggccctgatggcggtgcagaggcacacg 352
           | |||||  ||||| ||||||||||||||||||||| ||||||||||||||||||| |||
Sbjct: 470 acggggatgttgagattgatgccgaggatgttggccttgatggcggtgcagaggcagacg 411

                                                                       
Query: 353 gcggcgtcgaggtcggcgagcccgcctaggagtgggcagcactgctcgttcgccggcacg 412
           ||||||||||||||| |||| || || || |  ||||||||||||||| || ||||||||
Sbjct: 410 gcggcgtcgaggtcgacgaggccacccagcaacgggcagcactgctcgctctccggcacg 351

                                                               
Query: 413 ccgatcttgagcttcagcaggttcagcacgttggcgcacacgcccagcttca 464
           |||||||| |||||||||||||| ||||||||||||||||||| ||||||||
Sbjct: 350 ccgatcttcagcttcagcaggttgagcacgttggcgcacacgctcagcttca 299



to top

>gb|AC118673.2| Genomic sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBb0080O10, from chromosome 3, complete sequence
          Length = 127917

 Score =  214 bits (108), Expect = 2e-52
 Identities = 201/232 (86%)
 Strand = Plus / Minus

                                                                         
Query: 233   gggcaggtgaagttggcggggcacttcttgccgcactggttgaggaggagggtcaggtcg 292
             ||||||||||||| || ||||||  |||||  ||| | |||||| ||||| |  || |||
Sbjct: 24303 gggcaggtgaagtcggaggggcaggtcttgtggcagtagttgagaaggagagagagatcg 24244

                                                                         
Query: 293   atggggacattgagcttgatgccgaggatgttggccctgatggcggtgcagaggcacacg 352
             | |||||  ||||| ||||||||||||||||||||| ||||||||||||||||||| |||
Sbjct: 24243 acggggatgttgagattgatgccgaggatgttggccttgatggcggtgcagaggcagacg 24184

                                                                         
Query: 353   gcggcgtcgaggtcggcgagcccgcctaggagtgggcagcactgctcgttcgccggcacg 412
             ||||||||||||||| |||| || || || |  ||||||||||||||| || ||||||||
Sbjct: 24183 gcggcgtcgaggtcgacgaggccacccagcaacgggcagcactgctcgctctccggcacg 24124

                                                                 
Query: 413   ccgatcttgagcttcagcaggttcagcacgttggcgcacacgcccagcttca 464
             |||||||| |||||||||||||| ||||||||||||||||||| ||||||||
Sbjct: 24123 ccgatcttcagcttcagcaggttgagcacgttggcgcacacgctcagcttca 24072



 Score =  210 bits (106), Expect = 4e-51
 Identities = 172/194 (88%)
 Strand = Plus / Minus

                                                                         
Query: 271   gttgaggaggagggtcaggtcgatggggacattgagcttgatgccgaggatgttggccct 330
             |||||||||||||   ||||||| |||||| ||||  ||||||||||||| ||||||| |
Sbjct: 26969 gttgaggaggaggacgaggtcgacggggacgttgatgttgatgccgaggacgttggcctt 26910

                                                                         
Query: 331   gatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcctaggagtgggca 390
             |||||||||||||||||| |||||||||||||||||| ||||||| || || || |||||
Sbjct: 26909 gatggcggtgcagaggcagacggcggcgtcgaggtcgacgagcccccccagcagcgggca 26850

                                                                         
Query: 391   gcactgctcgttcgccggcacgccgatcttgagcttcagcaggttcagcacgttggcgca 450
             ||||| |||| |||||||||| || | ||||||||| |||||||| ||||||||||||||
Sbjct: 26849 gcactcctcgctcgccggcacccccaccttgagcttgagcaggttgagcacgttggcgca 26790

                           
Query: 451   cacgcccagcttca 464
             ||||||||||||||
Sbjct: 26789 cacgcccagcttca 26776



 Score =  101 bits (51), Expect = 2e-18
 Identities = 96/111 (86%)
 Strand = Plus / Minus

                                                                         
Query: 262   gccgcactggttgaggaggagggtcaggtcgatggggacattgagcttgatgccgaggat 321
             |||||| | ||||| ||||||| | |||| ||||||||  ||||| |||||||| |||||
Sbjct: 35999 gccgcagtagttgacgaggaggctgaggttgatggggaggttgaggttgatgccaaggat 35940

                                                                
Query: 322   gttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 372
             |||||| | || |||||||||||||||||||||||| || |||||||||||
Sbjct: 35939 gttggcgcggagggcggtgcagaggcacacggcggcctcaaggtcggcgag 35889



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                        
Query: 434   ttcagcacgttggcgcacacgcccagcttcaacgtgttgatcg 476
             ||||||||||| |||||||| |||||||||| ||||| |||||
Sbjct: 35824 ttcagcacgttcgcgcacacccccagcttcagcgtgtcgatcg 35782



to top

>gb|AC125411.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone
              OSJNAb0079B22, from chromosome 3, complete sequence
          Length = 156933

 Score =  214 bits (108), Expect = 2e-52
 Identities = 201/232 (86%)
 Strand = Plus / Minus

                                                                          
Query: 233    gggcaggtgaagttggcggggcacttcttgccgcactggttgaggaggagggtcaggtcg 292
              ||||||||||||| || ||||||  |||||  ||| | |||||| ||||| |  || |||
Sbjct: 121236 gggcaggtgaagtcggaggggcaggtcttgtggcagtagttgagaaggagagagagatcg 121177

                                                                          
Query: 293    atggggacattgagcttgatgccgaggatgttggccctgatggcggtgcagaggcacacg 352
              | |||||  ||||| ||||||||||||||||||||| ||||||||||||||||||| |||
Sbjct: 121176 acggggatgttgagattgatgccgaggatgttggccttgatggcggtgcagaggcagacg 121117

                                                                          
Query: 353    gcggcgtcgaggtcggcgagcccgcctaggagtgggcagcactgctcgttcgccggcacg 412
              ||||||||||||||| |||| || || || |  ||||||||||||||| || ||||||||
Sbjct: 121116 gcggcgtcgaggtcgacgaggccacccagcaacgggcagcactgctcgctctccggcacg 121057

                                                                  
Query: 413    ccgatcttgagcttcagcaggttcagcacgttggcgcacacgcccagcttca 464
              |||||||| |||||||||||||| ||||||||||||||||||| ||||||||
Sbjct: 121056 ccgatcttcagcttcagcaggttgagcacgttggcgcacacgctcagcttca 121005



 Score =  210 bits (106), Expect = 4e-51
 Identities = 172/194 (88%)
 Strand = Plus / Minus

                                                                          
Query: 271    gttgaggaggagggtcaggtcgatggggacattgagcttgatgccgaggatgttggccct 330
              |||||||||||||   ||||||| |||||| ||||  ||||||||||||| ||||||| |
Sbjct: 123902 gttgaggaggaggacgaggtcgacggggacgttgatgttgatgccgaggacgttggcctt 123843

                                                                          
Query: 331    gatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcctaggagtgggca 390
              |||||||||||||||||| |||||||||||||||||| ||||||| || || || |||||
Sbjct: 123842 gatggcggtgcagaggcagacggcggcgtcgaggtcgacgagcccccccagcagcgggca 123783

                                                                          
Query: 391    gcactgctcgttcgccggcacgccgatcttgagcttcagcaggttcagcacgttggcgca 450
              ||||| |||| |||||||||| || | ||||||||| |||||||| ||||||||||||||
Sbjct: 123782 gcactcctcgctcgccggcacccccaccttgagcttgagcaggttgagcacgttggcgca 123723

                            
Query: 451    cacgcccagcttca 464
              ||||||||||||||
Sbjct: 123722 cacgcccagcttca 123709



 Score =  101 bits (51), Expect = 2e-18
 Identities = 96/111 (86%)
 Strand = Plus / Minus

                                                                          
Query: 262    gccgcactggttgaggaggagggtcaggtcgatggggacattgagcttgatgccgaggat 321
              |||||| | ||||| ||||||| | |||| ||||||||  ||||| |||||||| |||||
Sbjct: 132932 gccgcagtagttgacgaggaggctgaggttgatggggaggttgaggttgatgccaaggat 132873

                                                                 
Query: 322    gttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 372
              |||||| | || |||||||||||||||||||||||| || |||||||||||
Sbjct: 132872 gttggcgcggagggcggtgcagaggcacacggcggcctcaaggtcggcgag 132822



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                         
Query: 434    ttcagcacgttggcgcacacgcccagcttcaacgtgttgatcg 476
              ||||||||||| |||||||| |||||||||| ||||| |||||
Sbjct: 132757 ttcagcacgttcgcgcacacccccagcttcagcgtgtcgatcg 132715



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3,
              complete sequence
          Length = 36192742

 Score =  214 bits (108), Expect = 2e-52
 Identities = 201/232 (86%)
 Strand = Plus / Minus

                                                                          
Query: 233    gggcaggtgaagttggcggggcacttcttgccgcactggttgaggaggagggtcaggtcg 292
              ||||||||||||| || ||||||  |||||  ||| | |||||| ||||| |  || |||
Sbjct: 187236 gggcaggtgaagtcggaggggcaggtcttgtggcagtagttgagaaggagagagagatcg 187177

                                                                          
Query: 293    atggggacattgagcttgatgccgaggatgttggccctgatggcggtgcagaggcacacg 352
              | |||||  ||||| ||||||||||||||||||||| ||||||||||||||||||| |||
Sbjct: 187176 acggggatgttgagattgatgccgaggatgttggccttgatggcggtgcagaggcagacg 187117

                                                                          
Query: 353    gcggcgtcgaggtcggcgagcccgcctaggagtgggcagcactgctcgttcgccggcacg 412
              ||||||||||||||| |||| || || || |  ||||||||||||||| || ||||||||
Sbjct: 187116 gcggcgtcgaggtcgacgaggccacccagcaacgggcagcactgctcgctctccggcacg 187057

                                                                  
Query: 413    ccgatcttgagcttcagcaggttcagcacgttggcgcacacgcccagcttca 464
              |||||||| |||||||||||||| ||||||||||||||||||| ||||||||
Sbjct: 187056 ccgatcttcagcttcagcaggttgagcacgttggcgcacacgctcagcttca 187005



 Score =  210 bits (106), Expect = 4e-51
 Identities = 172/194 (88%)
 Strand = Plus / Minus

                                                                          
Query: 271    gttgaggaggagggtcaggtcgatggggacattgagcttgatgccgaggatgttggccct 330
              |||||||||||||   ||||||| |||||| ||||  ||||||||||||| ||||||| |
Sbjct: 189902 gttgaggaggaggacgaggtcgacggggacgttgatgttgatgccgaggacgttggcctt 189843

                                                                          
Query: 331    gatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcctaggagtgggca 390
              |||||||||||||||||| |||||||||||||||||| ||||||| || || || |||||
Sbjct: 189842 gatggcggtgcagaggcagacggcggcgtcgaggtcgacgagcccccccagcagcgggca 189783

                                                                          
Query: 391    gcactgctcgttcgccggcacgccgatcttgagcttcagcaggttcagcacgttggcgca 450
              ||||| |||| |||||||||| || | ||||||||| |||||||| ||||||||||||||
Sbjct: 189782 gcactcctcgctcgccggcacccccaccttgagcttgagcaggttgagcacgttggcgca 189723

                            
Query: 451    cacgcccagcttca 464
              ||||||||||||||
Sbjct: 189722 cacgcccagcttca 189709



 Score =  101 bits (51), Expect = 2e-18
 Identities = 96/111 (86%)
 Strand = Plus / Minus

                                                                          
Query: 262    gccgcactggttgaggaggagggtcaggtcgatggggacattgagcttgatgccgaggat 321
              |||||| | ||||| ||||||| | |||| ||||||||  ||||| |||||||| |||||
Sbjct: 198932 gccgcagtagttgacgaggaggctgaggttgatggggaggttgaggttgatgccaaggat 198873

                                                                 
Query: 322    gttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 372
              |||||| | || |||||||||||||||||||||||| || |||||||||||
Sbjct: 198872 gttggcgcggagggcggtgcagaggcacacggcggcctcaaggtcggcgag 198822



 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 105/126 (83%)
 Strand = Plus / Minus

                                                                            
Query: 328      cctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcctaggagtgg 387
                ||||||||||| |||||||||| | |||||||||||||   |||| |  || || || ||
Sbjct: 28908485 cctgatggcggcgcagaggcacgccgcggcgtcgaggttcacgaggctccccagcagcgg 28908426

                                                                            
Query: 388      gcagcactgctcgttcgccggcacgccgatcttgagcttcagcaggttcagcacgttggc 447
                ||||||||||| | |||||||||||  |||||| |||||||||||   |||||||| |||
Sbjct: 28908425 gcagcactgctggctcgccggcacgttgatcttcagcttcagcagcaccagcacgtcggc 28908366

                      
Query: 448      gcacac 453
                ||||||
Sbjct: 28908365 gcacac 28908360



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                         
Query: 434    ttcagcacgttggcgcacacgcccagcttcaacgtgttgatcg 476
              ||||||||||| |||||||| |||||||||| ||||| |||||
Sbjct: 198757 ttcagcacgttcgcgcacacccccagcttcagcgtgtcgatcg 198715



 Score = 48.1 bits (24), Expect = 0.032
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                    
Query: 337      ggtgcagaggcacacggcggcgtcgaggtcggcgag 372
                |||||||||||| ||| |||||||||||||| ||||
Sbjct: 33204579 ggtgcagaggcagacgacggcgtcgaggtcgacgag 33204614



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                            
Query: 437      agcacgttggcgcacacgcccagcttca 464
                ||||||||||||||||| | ||||||||
Sbjct: 33204682 agcacgttggcgcacacacgcagcttca 33204709



to top

>gb|AF485811.1| Oryza sativa BAC OSJNa0049F05, complete sequence
          Length = 162241

 Score =  214 bits (108), Expect = 2e-52
 Identities = 201/232 (86%)
 Strand = Plus / Plus

                                                                         
Query: 233   gggcaggtgaagttggcggggcacttcttgccgcactggttgaggaggagggtcaggtcg 292
             ||||||||||||| || ||||||  |||||  ||| | |||||| ||||| |  || |||
Sbjct: 75418 gggcaggtgaagtcggaggggcaggtcttgtggcagtagttgagaaggagagagagatcg 75477

                                                                         
Query: 293   atggggacattgagcttgatgccgaggatgttggccctgatggcggtgcagaggcacacg 352
             | |||||  ||||| ||||||||||||||||||||| ||||||||||||||||||| |||
Sbjct: 75478 acggggatgttgagattgatgccgaggatgttggccttgatggcggtgcagaggcagacg 75537

                                                                         
Query: 353   gcggcgtcgaggtcggcgagcccgcctaggagtgggcagcactgctcgttcgccggcacg 412
             ||||||||||||||| |||| || || || |  ||||||||||||||| || ||||||||
Sbjct: 75538 gcggcgtcgaggtcgacgaggccacccagcaacgggcagcactgctcgctctccggcacg 75597

                                                                 
Query: 413   ccgatcttgagcttcagcaggttcagcacgttggcgcacacgcccagcttca 464
             |||||||| |||||||||||||| ||||||||||||||||||| ||||||||
Sbjct: 75598 ccgatcttcagcttcagcaggttgagcacgttggcgcacacgctcagcttca 75649



 Score =  210 bits (106), Expect = 4e-51
 Identities = 172/194 (88%)
 Strand = Plus / Plus

                                                                         
Query: 271   gttgaggaggagggtcaggtcgatggggacattgagcttgatgccgaggatgttggccct 330
             |||||||||||||   ||||||| |||||| ||||  ||||||||||||| ||||||| |
Sbjct: 72752 gttgaggaggaggacgaggtcgacggggacgttgatgttgatgccgaggacgttggcctt 72811

                                                                         
Query: 331   gatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcctaggagtgggca 390
             |||||||||||||||||| |||||||||||||||||| ||||||| || || || |||||
Sbjct: 72812 gatggcggtgcagaggcagacggcggcgtcgaggtcgacgagcccccccagcagcgggca 72871

                                                                         
Query: 391   gcactgctcgttcgccggcacgccgatcttgagcttcagcaggttcagcacgttggcgca 450
             ||||| |||| |||||||||| || | ||||||||| |||||||| ||||||||||||||
Sbjct: 72872 gcactcctcgctcgccggcacccccaccttgagcttgagcaggttgagcacgttggcgca 72931

                           
Query: 451   cacgcccagcttca 464
             ||||||||||||||
Sbjct: 72932 cacgcccagcttca 72945



 Score =  101 bits (51), Expect = 2e-18
 Identities = 96/111 (86%)
 Strand = Plus / Plus

                                                                         
Query: 262   gccgcactggttgaggaggagggtcaggtcgatggggacattgagcttgatgccgaggat 321
             |||||| | ||||| ||||||| | |||| ||||||||  ||||| |||||||| |||||
Sbjct: 63724 gccgcagtagttgacgaggaggctgaggttgatggggaggttgaggttgatgccaaggat 63783

                                                                
Query: 322   gttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 372
             |||||| | || |||||||||||||||||||||||| || |||||||||||
Sbjct: 63784 gttggcgcggagggcggtgcagaggcacacggcggcctcaaggtcggcgag 63834



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                        
Query: 434   ttcagcacgttggcgcacacgcccagcttcaacgtgttgatcg 476
             ||||||||||| |||||||| |||||||||| ||||| |||||
Sbjct: 63899 ttcagcacgttcgcgcacacccccagcttcagcgtgtcgatcg 63941



to top

>dbj|AK103618.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033133L09, full
           insert sequence
          Length = 780

 Score =  214 bits (108), Expect = 2e-52
 Identities = 201/232 (86%)
 Strand = Plus / Minus

                                                                       
Query: 233 gggcaggtgaagttggcggggcacttcttgccgcactggttgaggaggagggtcaggtcg 292
           ||||||||||||| || ||||||  |||||  ||| | |||||| ||||| |  || |||
Sbjct: 551 gggcaggtgaagtcggaggggcaggtcttgtggcagtagttgagaaggagagagagatcg 492

                                                                       
Query: 293 atggggacattgagcttgatgccgaggatgttggccctgatggcggtgcagaggcacacg 352
           | |||||  ||||| ||||||||||||||||||||| ||||||||||||||||||| |||
Sbjct: 491 acggggatgttgagattgatgccgaggatgttggccttgatggcggtgcagaggcagacg 432

                                                                       
Query: 353 gcggcgtcgaggtcggcgagcccgcctaggagtgggcagcactgctcgttcgccggcacg 412
           ||||||||||||||| |||| || || || |  ||||||||||||||| || ||||||||
Sbjct: 431 gcggcgtcgaggtcgacgaggccacccagcaacgggcagcactgctcgctctccggcacg 372

                                                               
Query: 413 ccgatcttgagcttcagcaggttcagcacgttggcgcacacgcccagcttca 464
           |||||||| |||||||||||||| ||||||||||||||||||| ||||||||
Sbjct: 371 ccgatcttcagcttcagcaggttgagcacgttggcgcacacgctcagcttca 320



to top

>dbj|AK062654.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-105-E10, full
           insert sequence
          Length = 736

 Score =  210 bits (106), Expect = 4e-51
 Identities = 172/194 (88%)
 Strand = Plus / Minus

                                                                       
Query: 271 gttgaggaggagggtcaggtcgatggggacattgagcttgatgccgaggatgttggccct 330
           |||||||||||||   ||||||| |||||| ||||  ||||||||||||| ||||||| |
Sbjct: 474 gttgaggaggaggacgaggtcgacggggacgttgatgttgatgccgaggacgttggcctt 415

                                                                       
Query: 331 gatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcctaggagtgggca 390
           |||||||||||||||||| |||||||||||||||||| ||||||| || || || |||||
Sbjct: 414 gatggcggtgcagaggcagacggcggcgtcgaggtcgacgagcccccccagcagcgggca 355

                                                                       
Query: 391 gcactgctcgttcgccggcacgccgatcttgagcttcagcaggttcagcacgttggcgca 450
           ||||| |||| |||||||||| || | ||||||||| |||||||| ||||||||||||||
Sbjct: 354 gcactcctcgctcgccggcacccccaccttgagcttgagcaggttgagcacgttggcgca 295

                         
Query: 451 cacgcccagcttca 464
           ||||||||||||||
Sbjct: 294 cacgcccagcttca 281



to top

>gb|AY108363.1| Zea mays PCO069442 mRNA sequence
          Length = 837

 Score =  165 bits (83), Expect = 2e-37
 Identities = 182/215 (84%)
 Strand = Plus / Minus

                                                                       
Query: 250 ggggcacttcttgccgcactggttgaggaggagggtcaggtcgatggggacattgagctt 309
           |||||| ||||||||||| | |||||||| |||| | |||||||||||||  || || ||
Sbjct: 448 ggggcagttcttgccgcagttgttgaggatgaggctgaggtcgatggggaggttaaggtt 389

                                                                       
Query: 310 gatgccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggc 369
           ||||||||||||||||||| ||| ||||||||||||||| |||||||| || |||||| |
Sbjct: 388 gatgccgaggatgttggccttgacggcggtgcagaggcagacggcggcctccaggtcgac 329

                                                                       
Query: 370 gagcccgcctaggagtgggcagcactgctcgttcgccggcacgccgatcttgagcttcag 429
           ||||||| | || || | ||||||| |||||| || ||||  ||| | ||||  ||||| 
Sbjct: 328 gagcccgtccagcagcgagcagcacggctcgtacggcggcgagcctaccttggccttcac 269

                                              
Query: 430 caggttcagcacgttggcgcacacgcccagcttca 464
           ||||  |||||||||||||||||||||||||||||
Sbjct: 268 caggcccagcacgttggcgcacacgcccagcttca 234



to top

>ref|XM_467170.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 833

 Score =  141 bits (71), Expect = 3e-30
 Identities = 173/207 (83%)
 Strand = Plus / Minus

                                                                       
Query: 258 tcttgccgcactggttgaggaggagggtcaggtcgatggggacattgagcttgatgccga 317
           |||||||||| | |||||||| |||| | |||||||||||||  ||||| ||||| ||||
Sbjct: 475 tcttgccgcagtagttgaggatgaggctgaggtcgatggggaggttgaggttgattccga 416

                                                                       
Query: 318 ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgc 377
           |||||||| |||||||||| |||||||||||||| || || ||||||||| |||||||  
Sbjct: 415 ggatgttgcccctgatggccgtgcagaggcacaccgccgcctcgaggtcgacgagcccct 356

                                                                       
Query: 378 ctaggagtgggcagcactgctcgttcgccggcacgccgatcttgagcttcagcaggttca 437
           | || || ||||||||| ||||   ||  |||||||| | ||||  ||| | ||||  ||
Sbjct: 355 ccagcagcgggcagcacggctccgccggaggcacgcccaccttggccttgatcaggccca 296

                                      
Query: 438 gcacgttggcgcacacgcccagcttca 464
           |||||||||||||||||||||||||||
Sbjct: 295 gcacgttggcgcacacgcccagcttca 269



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  141 bits (71), Expect = 3e-30
 Identities = 173/207 (83%)
 Strand = Plus / Minus

                                                                            
Query: 258      tcttgccgcactggttgaggaggagggtcaggtcgatggggacattgagcttgatgccga 317
                |||||||||| | |||||||| |||| | |||||||||||||  ||||| ||||| ||||
Sbjct: 26823955 tcttgccgcagtagttgaggatgaggctgaggtcgatggggaggttgaggttgattccga 26823896

                                                                            
Query: 318      ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgc 377
                |||||||| |||||||||| |||||||||||||| || || ||||||||| |||||||  
Sbjct: 26823895 ggatgttgcccctgatggccgtgcagaggcacaccgccgcctcgaggtcgacgagcccct 26823836

                                                                            
Query: 378      ctaggagtgggcagcactgctcgttcgccggcacgccgatcttgagcttcagcaggttca 437
                | || || ||||||||| ||||   ||  |||||||| | ||||  ||| | ||||  ||
Sbjct: 26823835 ccagcagcgggcagcacggctccgccggaggcacgcccaccttggccttgatcaggccca 26823776

                                           
Query: 438      gcacgttggcgcacacgcccagcttca 464
                |||||||||||||||||||||||||||
Sbjct: 26823775 gcacgttggcgcacacgcccagcttca 26823749



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 105/127 (82%)
 Strand = Plus / Minus

                                                                            
Query: 257      ttcttgccgcactggttgaggaggagggtcaggtcgatggggacattgagcttgatgccg 316
                ||||||||||| | ||||| ||||||| | || | || |||||  | |||  ||||||||
Sbjct: 26833571 ttcttgccgcagtagttgacgaggaggctgagcttgacggggatgtcgagggtgatgccg 26833512

                                                                            
Query: 317      aggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccg 376
                || | ||||||| |||||||||||||||| || |||||||| || ||||||||||| |||
Sbjct: 26833511 agcacgttggccttgatggcggtgcagagacagacggcggcctcaaggtcggcgaggccg 26833452

                       
Query: 377      cctagga 383
                || ||||
Sbjct: 26833451 ccgagga 26833445



to top

>dbj|AP004037.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
            clone:OJ1001_D02
          Length = 129081

 Score =  141 bits (71), Expect = 3e-30
 Identities = 173/207 (83%)
 Strand = Plus / Minus

                                                                        
Query: 258  tcttgccgcactggttgaggaggagggtcaggtcgatggggacattgagcttgatgccga 317
            |||||||||| | |||||||| |||| | |||||||||||||  ||||| ||||| ||||
Sbjct: 2498 tcttgccgcagtagttgaggatgaggctgaggtcgatggggaggttgaggttgattccga 2439

                                                                        
Query: 318  ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgc 377
            |||||||| |||||||||| |||||||||||||| || || ||||||||| |||||||  
Sbjct: 2438 ggatgttgcccctgatggccgtgcagaggcacaccgccgcctcgaggtcgacgagcccct 2379

                                                                        
Query: 378  ctaggagtgggcagcactgctcgttcgccggcacgccgatcttgagcttcagcaggttca 437
            | || || ||||||||| ||||   ||  |||||||| | ||||  ||| | ||||  ||
Sbjct: 2378 ccagcagcgggcagcacggctccgccggaggcacgcccaccttggccttgatcaggccca 2319

                                       
Query: 438  gcacgttggcgcacacgcccagcttca 464
            |||||||||||||||||||||||||||
Sbjct: 2318 gcacgttggcgcacacgcccagcttca 2292



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 105/127 (82%)
 Strand = Plus / Minus

                                                                         
Query: 257   ttcttgccgcactggttgaggaggagggtcaggtcgatggggacattgagcttgatgccg 316
             ||||||||||| | ||||| ||||||| | || | || |||||  | |||  ||||||||
Sbjct: 12114 ttcttgccgcagtagttgacgaggaggctgagcttgacggggatgtcgagggtgatgccg 12055

                                                                         
Query: 317   aggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccg 376
             || | ||||||| |||||||||||||||| || |||||||| || ||||||||||| |||
Sbjct: 12054 agcacgttggccttgatggcggtgcagagacagacggcggcctcaaggtcggcgaggccg 11995

                    
Query: 377   cctagga 383
             || ||||
Sbjct: 11994 ccgagga 11988



to top

>dbj|AP004883.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0516F12
          Length = 146364

 Score =  141 bits (71), Expect = 3e-30
 Identities = 173/207 (83%)
 Strand = Plus / Minus

                                                                         
Query: 258   tcttgccgcactggttgaggaggagggtcaggtcgatggggacattgagcttgatgccga 317
             |||||||||| | |||||||| |||| | |||||||||||||  ||||| ||||| ||||
Sbjct: 90008 tcttgccgcagtagttgaggatgaggctgaggtcgatggggaggttgaggttgattccga 89949

                                                                         
Query: 318   ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgc 377
             |||||||| |||||||||| |||||||||||||| || || ||||||||| |||||||  
Sbjct: 89948 ggatgttgcccctgatggccgtgcagaggcacaccgccgcctcgaggtcgacgagcccct 89889

                                                                         
Query: 378   ctaggagtgggcagcactgctcgttcgccggcacgccgatcttgagcttcagcaggttca 437
             | || || ||||||||| ||||   ||  |||||||| | ||||  ||| | ||||  ||
Sbjct: 89888 ccagcagcgggcagcacggctccgccggaggcacgcccaccttggccttgatcaggccca 89829

                                        
Query: 438   gcacgttggcgcacacgcccagcttca 464
             |||||||||||||||||||||||||||
Sbjct: 89828 gcacgttggcgcacacgcccagcttca 89802



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 105/127 (82%)
 Strand = Plus / Minus

                                                                         
Query: 257   ttcttgccgcactggttgaggaggagggtcaggtcgatggggacattgagcttgatgccg 316
             ||||||||||| | ||||| ||||||| | || | || |||||  | |||  ||||||||
Sbjct: 99624 ttcttgccgcagtagttgacgaggaggctgagcttgacggggatgtcgagggtgatgccg 99565

                                                                         
Query: 317   aggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccg 376
             || | ||||||| |||||||||||||||| || |||||||| || ||||||||||| |||
Sbjct: 99564 agcacgttggccttgatggcggtgcagagacagacggcggcctcaaggtcggcgaggccg 99505

                    
Query: 377   cctagga 383
             || ||||
Sbjct: 99504 ccgagga 99498



to top

>dbj|AK109149.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-155-F07, full
           insert sequence
          Length = 833

 Score =  141 bits (71), Expect = 3e-30
 Identities = 173/207 (83%)
 Strand = Plus / Minus

                                                                       
Query: 258 tcttgccgcactggttgaggaggagggtcaggtcgatggggacattgagcttgatgccga 317
           |||||||||| | |||||||| |||| | |||||||||||||  ||||| ||||| ||||
Sbjct: 475 tcttgccgcagtagttgaggatgaggctgaggtcgatggggaggttgaggttgattccga 416

                                                                       
Query: 318 ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgc 377
           |||||||| |||||||||| |||||||||||||| || || ||||||||| |||||||  
Sbjct: 415 ggatgttgcccctgatggccgtgcagaggcacaccgccgcctcgaggtcgacgagcccct 356

                                                                       
Query: 378 ctaggagtgggcagcactgctcgttcgccggcacgccgatcttgagcttcagcaggttca 437
           | || || ||||||||| ||||   ||  |||||||| | ||||  ||| | ||||  ||
Sbjct: 355 ccagcagcgggcagcacggctccgccggaggcacgcccaccttggccttgatcaggccca 296

                                      
Query: 438 gcacgttggcgcacacgcccagcttca 464
           |||||||||||||||||||||||||||
Sbjct: 295 gcacgttggcgcacacgcccagcttca 269



to top

>gb|L27208.1|RICRCC3 Oryza sativa root-specific RCc3 mRNA, complete cds
          Length = 715

 Score =  141 bits (71), Expect = 3e-30
 Identities = 173/207 (83%)
 Strand = Plus / Minus

                                                                       
Query: 258 tcttgccgcactggttgaggaggagggtcaggtcgatggggacattgagcttgatgccga 317
           |||||||||| | |||||||| |||| | |||||||||||||  ||||| ||||| ||||
Sbjct: 400 tcttgccgcagtagttgaggatgaggctgaggtcgatggggaggttgaggttgattccga 341

                                                                       
Query: 318 ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgc 377
           |||||||| |||||||||| |||||||||||||| || || ||||||||| |||||||  
Sbjct: 340 ggatgttgcccctgatggccgtgcagaggcacaccgccgcctcgaggtcgacgagcccct 281

                                                                       
Query: 378 ctaggagtgggcagcactgctcgttcgccggcacgccgatcttgagcttcagcaggttca 437
           | || || ||||||||| ||||   ||  |||||||| | ||||  ||| | ||||  ||
Sbjct: 280 ccagcagcgggcagcacggctccgccggaggcacgcccaccttggccttgatcaggccca 221

                                      
Query: 438 gcacgttggcgcacacgcccagcttca 464
           |||||||||||||||||||||||||||
Sbjct: 220 gcacgttggcgcacacgcccagcttca 194



to top

>ref|NM_197681.1| Oryza sativa (japonica cultivar-group) putative lipid transfer
           protein (OSJNBa0015J15.6), mRNA
          Length = 399

 Score =  125 bits (63), Expect = 2e-25
 Identities = 102/115 (88%)
 Strand = Plus / Minus

                                                                       
Query: 258 tcttgccgcactggttgaggaggagggtcaggtcgatggggacattgagcttgatgccga 317
           |||||||||| | |||||||| |||| | |||||||||||||  |||||||||||||| |
Sbjct: 367 tcttgccgcagttgttgaggatgaggctgaggtcgatggggaggttgagcttgatgccca 308

                                                                  
Query: 318 ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 372
           | | ||||||| ||||||||||||||||||| |||||||||||||||||| ||||
Sbjct: 307 gcacgttggccttgatggcggtgcagaggcagacggcggcgtcgaggtcgacgag 253



to top

>gb|AC026758.8| Oryza sativa chromosome 10 BAC OSJNBa0015J15 genomic sequence, complete
             sequence
          Length = 144798

 Score =  125 bits (63), Expect = 2e-25
 Identities = 102/115 (88%)
 Strand = Plus / Minus

                                                                         
Query: 258   tcttgccgcactggttgaggaggagggtcaggtcgatggggacattgagcttgatgccga 317
             |||||||||| | |||||||| |||| | |||||||||||||  |||||||||||||| |
Sbjct: 27538 tcttgccgcagttgttgaggatgaggctgaggtcgatggggaggttgagcttgatgccca 27479

                                                                    
Query: 318   ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 372
             | | ||||||| ||||||||||||||||||| |||||||||||||||||| ||||
Sbjct: 27478 gcacgttggccttgatggcggtgcagaggcagacggcggcgtcgaggtcgacgag 27424



 Score =  123 bits (62), Expect = 7e-25
 Identities = 122/142 (85%)
 Strand = Plus / Minus

                                                                         
Query: 235   gcaggtgaagttggcggggcacttcttgccgcactggttgaggaggagggtcaggtcgat 294
             ||||||||||| || ||||||  |||||||||||| |||||||| |||| | || |||| 
Sbjct: 50006 gcaggtgaagtcggaggggcagatcttgccgcacttgttgaggatgaggcttagatcgac 49947

                                                                         
Query: 295   ggggacattgagcttgatgccgaggatgttggccctgatggcggtgcagaggcacacggc 354
             || ||  ||||| || |||||||| | ||||||| ||| ||||||||||||||| |||||
Sbjct: 49946 ggcgaggttgagtttcatgccgagcacgttggccttgacggcggtgcagaggcagacggc 49887

                                   
Query: 355   ggcgtcgaggtcggcgagcccg 376
             ||||||||||||||||||||||
Sbjct: 49886 ggcgtcgaggtcggcgagcccg 49865



 Score =  119 bits (60), Expect = 1e-23
 Identities = 173/210 (82%), Gaps = 3/210 (1%)
 Strand = Plus / Minus

                                                                         
Query: 258   tcttgccgcactggttgaggaggagggtcaggtcgatggggacattgagcttgatgccga 317
             |||||||||| | |||||||| |||| | |||||||||||||  ||||| |||| |||||
Sbjct: 34252 tcttgccgcagttgttgaggatgaggctgaggtcgatggggatgttgaggttgaggccga 34193

                                                                         
Query: 318   ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgc 377
             | | ||||||| ||||||||||||||||||| |||||||||||||||||| |||| ||| 
Sbjct: 34192 gcacgttggccttgatggcggtgcagaggcagacggcggcgtcgaggtcgacgaggccgt 34133

                                                                         
Query: 378   ctaggagtgggcagcactgctcgttcgccggca---cgccgatcttgagcttcagcaggt 434
             | || || | ||||||  |||||| || || ||   |||||||||||  |||||  ||| 
Sbjct: 34132 cgagcagcgagcagcagggctcgtacggcgccaccgcgccgatcttggccttcacgaggc 34073

                                           
Query: 435   tcagcacgttggcgcacacgcccagcttca 464
               ||||||||||||||||||  ||||||||
Sbjct: 34072 cgagcacgttggcgcacacgtgcagcttca 34043



 Score =  109 bits (55), Expect = 1e-20
 Identities = 100/115 (86%)
 Strand = Plus / Minus

                                                                         
Query: 258   tcttgccgcactggttgaggaggagggtcaggtcgatggggacattgagcttgatgccga 317
             |||||||||| | |||||||| |||| | ||||||| |||||  | ||||||||||||||
Sbjct: 30806 tcttgccgcagttgttgaggatgaggctgaggtcgacggggaggtcgagcttgatgccga 30747

                                                                    
Query: 318   ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 372
             | | ||||||| ||| ||||||||||||||| |||||||||||||||||| ||||
Sbjct: 30746 gcacgttggccttgacggcggtgcagaggcagacggcggcgtcgaggtcgacgag 30692



 Score =  107 bits (54), Expect = 4e-20
 Identities = 99/114 (86%)
 Strand = Plus / Minus

                                                                         
Query: 258   tcttgccgcactggttgaggaggagggtcaggtcgatggggacattgagcttgatgccga 317
             |||||| ||||| |||||||| |||| |||| |||| ||||| ||| || |||||||| |
Sbjct: 54098 tcttgctgcacttgttgaggatgaggctcagatcgacggggagattcaggttgatgccca 54039

                                                                   
Query: 318   ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcga 371
             | | ||||||| ||| ||||||||||||||| ||||||||||||||||||||||
Sbjct: 54038 gcacgttggccttgacggcggtgcagaggcagacggcggcgtcgaggtcggcga 53985



 Score =  101 bits (51), Expect = 2e-18
 Identities = 132/159 (83%)
 Strand = Plus / Minus

                                                                         
Query: 235   gcaggtgaagttggcggggcacttcttgccgcactggttgaggaggagggtcaggtcgat 294
             ||||||||||| || ||||||  |||||||||||| |||||||| |||  | || |||| 
Sbjct: 66530 gcaggtgaagtcggaggggcaggtcttgccgcacttgttgaggatgagcttgagctcgac 66471

                                                                         
Query: 295   ggggacattgagcttgatgccgaggatgttggccctgatggcggtgcagaggcacacggc 354
             |||||| ||||| |||| |||||| | ||||||| | | ||||||||||||||| |||||
Sbjct: 66470 ggggacgttgaggttgacgccgagcacgttggccttcacggcggtgcagaggcagacggc 66411

                                                    
Query: 355   ggcgtcgaggtcggcgagcccgcctaggagtgggcagca 393
             |||||||  ||||||||| ||| | || || ||||||||
Sbjct: 66410 ggcgtcggcgtcggcgaggccggcgagcagcgggcagca 66372



 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 92/107 (85%)
 Strand = Plus / Minus

                                                                         
Query: 265   gcactggttgaggaggagggtcaggtcgatggggacattgagcttgatgccgaggatgtt 324
             ||||| |||||||| |||| |||| |||| |||||  ||||| |||||||| || |  ||
Sbjct: 57384 gcacttgttgaggatgaggctcagatcgacggggaggttgaggttgatgcccagcacatt 57325

                                                            
Query: 325   ggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcga 371
             |||| ||| ||||||||||||||| ||||||||||||||||||||||
Sbjct: 57324 ggccttgacggcggtgcagaggcagacggcggcgtcgaggtcggcga 57278



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 97/115 (84%), Gaps = 3/115 (2%)
 Strand = Plus / Minus

                                                                         
Query: 258   tcttgccgcactggttgaggaggagggtcaggtcgatggggacattgagcttgatg---c 314
             |||||||||| | |||||||| |||| | || |||| |||||  ||||| ||||||   |
Sbjct: 62140 tcttgccgcagttgttgaggatgaggctgagatcgacggggatgttgaggttgatgatcc 62081

                                                                    
Query: 315   cgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggc 369
             | || | ||||||| ||||||||||||||||||| ||||||||||||||||||||
Sbjct: 62080 caagaacgttggccttgatggcggtgcagaggcagacggcggcgtcgaggtcggc 62026



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 55/63 (87%)
 Strand = Plus / Minus

                                                                         
Query: 338   gtgcagaggcacacggcggcgtcgaggtcggcgagcccgcctaggagtgggcagcactgc 397
             ||||||||||||||||||||||| | ||||||||| ||| | |||||   ||||||||||
Sbjct: 69079 gtgcagaggcacacggcggcgtccacgtcggcgaggccggcgaggagcccgcagcactgc 69020

                
Query: 398   tcg 400
             |||
Sbjct: 69019 tcg 69017



 Score = 48.1 bits (24), Expect = 0.032
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                             
Query: 436   cagcacgttggcgcacacgcccagcttcaacg 467
             |||||||||||||||||| | |||||||||||
Sbjct: 30625 cagcacgttggcgcacacccgcagcttcaacg 30594



 Score = 44.1 bits (22), Expect = 0.49
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                           
Query: 437   agcacgttggcgcacacgcccagcttcaacgtgttgatcgagcagc 482
             ||||||||||||||||| | |||||||| || || ||||| |||||
Sbjct: 66328 agcacgttggcgcacacccgcagcttcagcgcgtcgatcgggcagc 66283



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 437   agcacgttggcgcacacgcccagcttca 464
             ||||||||||||||||| | ||||||||
Sbjct: 57212 agcacgttggcgcacaccctcagcttca 57185



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 437   agcacgttggcgcacacgcccagcttca 464
             ||||||||||||||||| | ||||||||
Sbjct: 53919 agcacgttggcgcacaccctcagcttca 53892



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score =  125 bits (63), Expect = 2e-25
 Identities = 102/115 (88%)
 Strand = Plus / Plus

                                                                            
Query: 258      tcttgccgcactggttgaggaggagggtcaggtcgatggggacattgagcttgatgccga 317
                |||||||||| | |||||||| |||| | |||||||||||||  |||||||||||||| |
Sbjct: 21178168 tcttgccgcagttgttgaggatgaggctgaggtcgatggggaggttgagcttgatgccca 21178227

                                                                       
Query: 318      ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 372
                | | ||||||| ||||||||||||||||||| |||||||||||||||||| ||||
Sbjct: 21178228 gcacgttggccttgatggcggtgcagaggcagacggcggcgtcgaggtcgacgag 21178282



 Score =  123 bits (62), Expect = 7e-25
 Identities = 122/142 (85%)
 Strand = Plus / Plus

                                                                            
Query: 235      gcaggtgaagttggcggggcacttcttgccgcactggttgaggaggagggtcaggtcgat 294
                ||||||||||| || ||||||  |||||||||||| |||||||| |||| | || |||| 
Sbjct: 21155700 gcaggtgaagtcggaggggcagatcttgccgcacttgttgaggatgaggcttagatcgac 21155759

                                                                            
Query: 295      ggggacattgagcttgatgccgaggatgttggccctgatggcggtgcagaggcacacggc 354
                || ||  ||||| || |||||||| | ||||||| ||| ||||||||||||||| |||||
Sbjct: 21155760 ggcgaggttgagtttcatgccgagcacgttggccttgacggcggtgcagaggcagacggc 21155819

                                      
Query: 355      ggcgtcgaggtcggcgagcccg 376
                ||||||||||||||||||||||
Sbjct: 21155820 ggcgtcgaggtcggcgagcccg 21155841



 Score =  119 bits (60), Expect = 1e-23
 Identities = 173/210 (82%), Gaps = 3/210 (1%)
 Strand = Plus / Plus

                                                                            
Query: 258      tcttgccgcactggttgaggaggagggtcaggtcgatggggacattgagcttgatgccga 317
                |||||||||| | |||||||| |||| | |||||||||||||  ||||| |||| |||||
Sbjct: 21171454 tcttgccgcagttgttgaggatgaggctgaggtcgatggggatgttgaggttgaggccga 21171513

                                                                            
Query: 318      ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgc 377
                | | ||||||| ||||||||||||||||||| |||||||||||||||||| |||| ||| 
Sbjct: 21171514 gcacgttggccttgatggcggtgcagaggcagacggcggcgtcgaggtcgacgaggccgt 21171573

                                                                            
Query: 378      ctaggagtgggcagcactgctcgttcgccggca---cgccgatcttgagcttcagcaggt 434
                | || || | ||||||  |||||| || || ||   |||||||||||  |||||  ||| 
Sbjct: 21171574 cgagcagcgagcagcagggctcgtacggcgccaccgcgccgatcttggccttcacgaggc 21171633

                                              
Query: 435      tcagcacgttggcgcacacgcccagcttca 464
                  ||||||||||||||||||  ||||||||
Sbjct: 21171634 cgagcacgttggcgcacacgtgcagcttca 21171663



 Score =  109 bits (55), Expect = 1e-20
 Identities = 100/115 (86%)
 Strand = Plus / Plus

                                                                            
Query: 258      tcttgccgcactggttgaggaggagggtcaggtcgatggggacattgagcttgatgccga 317
                |||||||||| | |||||||| |||| | ||||||| |||||  | ||||||||||||||
Sbjct: 21174900 tcttgccgcagttgttgaggatgaggctgaggtcgacggggaggtcgagcttgatgccga 21174959

                                                                       
Query: 318      ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 372
                | | ||||||| ||| ||||||||||||||| |||||||||||||||||| ||||
Sbjct: 21174960 gcacgttggccttgacggcggtgcagaggcagacggcggcgtcgaggtcgacgag 21175014



 Score =  107 bits (54), Expect = 4e-20
 Identities = 99/114 (86%)
 Strand = Plus / Plus

                                                                            
Query: 258      tcttgccgcactggttgaggaggagggtcaggtcgatggggacattgagcttgatgccga 317
                |||||| ||||| |||||||| |||| |||| |||| ||||| ||| || |||||||| |
Sbjct: 21151608 tcttgctgcacttgttgaggatgaggctcagatcgacggggagattcaggttgatgccca 21151667

                                                                      
Query: 318      ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcga 371
                | | ||||||| ||| ||||||||||||||| ||||||||||||||||||||||
Sbjct: 21151668 gcacgttggccttgacggcggtgcagaggcagacggcggcgtcgaggtcggcga 21151721



 Score =  101 bits (51), Expect = 2e-18
 Identities = 132/159 (83%)
 Strand = Plus / Plus

                                                                            
Query: 235      gcaggtgaagttggcggggcacttcttgccgcactggttgaggaggagggtcaggtcgat 294
                ||||||||||| || ||||||  |||||||||||| |||||||| |||  | || |||| 
Sbjct: 21139176 gcaggtgaagtcggaggggcaggtcttgccgcacttgttgaggatgagcttgagctcgac 21139235

                                                                            
Query: 295      ggggacattgagcttgatgccgaggatgttggccctgatggcggtgcagaggcacacggc 354
                |||||| ||||| |||| |||||| | ||||||| | | ||||||||||||||| |||||
Sbjct: 21139236 ggggacgttgaggttgacgccgagcacgttggccttcacggcggtgcagaggcagacggc 21139295

                                                       
Query: 355      ggcgtcgaggtcggcgagcccgcctaggagtgggcagca 393
                |||||||  ||||||||| ||| | || || ||||||||
Sbjct: 21139296 ggcgtcggcgtcggcgaggccggcgagcagcgggcagca 21139334



 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 92/107 (85%)
 Strand = Plus / Plus

                                                                            
Query: 265      gcactggttgaggaggagggtcaggtcgatggggacattgagcttgatgccgaggatgtt 324
                ||||| |||||||| |||| |||| |||| |||||  ||||| |||||||| || |  ||
Sbjct: 21148322 gcacttgttgaggatgaggctcagatcgacggggaggttgaggttgatgcccagcacatt 21148381

                                                               
Query: 325      ggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcga 371
                |||| ||| ||||||||||||||| ||||||||||||||||||||||
Sbjct: 21148382 ggccttgacggcggtgcagaggcagacggcggcgtcgaggtcggcga 21148428



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 97/115 (84%), Gaps = 3/115 (2%)
 Strand = Plus / Plus

                                                                            
Query: 258      tcttgccgcactggttgaggaggagggtcaggtcgatggggacattgagcttgatg---c 314
                |||||||||| | |||||||| |||| | || |||| |||||  ||||| ||||||   |
Sbjct: 21143566 tcttgccgcagttgttgaggatgaggctgagatcgacggggatgttgaggttgatgatcc 21143625

                                                                       
Query: 315      cgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggc 369
                | || | ||||||| ||||||||||||||||||| ||||||||||||||||||||
Sbjct: 21143626 caagaacgttggccttgatggcggtgcagaggcagacggcggcgtcgaggtcggc 21143680



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 36/37 (97%)
 Strand = Plus / Plus

                                                     
Query: 335      gcggtgcagaggcacacggcggcgtcgaggtcggcga 371
                |||||||||||||| ||||||||||||||||||||||
Sbjct: 10072332 gcggtgcagaggcagacggcggcgtcgaggtcggcga 10072368



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 55/63 (87%)
 Strand = Plus / Plus

                                                                            
Query: 338      gtgcagaggcacacggcggcgtcgaggtcggcgagcccgcctaggagtgggcagcactgc 397
                ||||||||||||||||||||||| | ||||||||| ||| | |||||   ||||||||||
Sbjct: 21136627 gtgcagaggcacacggcggcgtccacgtcggcgaggccggcgaggagcccgcagcactgc 21136686

                   
Query: 398      tcg 400
                |||
Sbjct: 21136687 tcg 21136689



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                        
Query: 437      agcacgttggcgcacacgcccagcttcaacgtgttgatcg 476
                ||||||||||||||||| | ||||||||| ||||||||||
Sbjct: 10048261 agcacgttggcgcacactctcagcttcaaggtgttgatcg 10048300



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                            
Query: 311      atgccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcg 370
                ||||| |||| ||||||| | | ||| ||||||||||| |||||||| ||||| ||||||
Sbjct: 10051276 atgccaaggacgttggccttcacggcagtgcagaggcagacggcggcatcgagatcggcg 10051335

                 
Query: 371      a 371
                |
Sbjct: 10051336 a 10051336



 Score = 48.1 bits (24), Expect = 0.032
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                                
Query: 436      cagcacgttggcgcacacgcccagcttcaacg 467
                |||||||||||||||||| | |||||||||||
Sbjct: 21175081 cagcacgttggcgcacacccgcagcttcaacg 21175112



 Score = 44.1 bits (22), Expect = 0.49
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                              
Query: 437      agcacgttggcgcacacgcccagcttcaacgtgttgatcgagcagc 482
                ||||||||||||||||| | |||||||| || || ||||| |||||
Sbjct: 21139378 agcacgttggcgcacacccgcagcttcagcgcgtcgatcgggcagc 21139423



 Score = 44.1 bits (22), Expect = 0.49
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                      
Query: 334      ggcggtgcagaggcacacggcggcgtcgaggtcggcga 371
                ||||||||||||||| ||||| |||||||  |||||||
Sbjct: 10063375 ggcggtgcagaggcagacggcagcgtcgatatcggcga 10063412



 Score = 44.1 bits (22), Expect = 0.49
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                                  
Query: 338      gtgcagaggcacacggcggcgtcgaggtcggcga 371
                ||||||||||| ||||| |||||||| |||||||
Sbjct: 10048162 gtgcagaggcagacggcagcgtcgagatcggcga 10048195



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                             
Query: 437      agcacgttggcgcacacgcccagcttcaa 465
                ||||||||||||||||| | |||||||||
Sbjct: 10063478 agcacgttggcgcacactctcagcttcaa 10063506



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                            
Query: 437      agcacgttggcgcacacgcccagcttca 464
                ||||||||||||||||| | ||||||||
Sbjct: 21151787 agcacgttggcgcacaccctcagcttca 21151814



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                            
Query: 437      agcacgttggcgcacacgcccagcttca 464
                ||||||||||||||||| | ||||||||
Sbjct: 21148494 agcacgttggcgcacaccctcagcttca 21148521



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                            
Query: 437      agcacgttggcgcacacgcccagcttca 464
                ||||||||||||||||| | ||||||||
Sbjct: 10055789 agcacgttggcgcacactctcagcttca 10055816



to top

>dbj|AK062381.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-102-B09, full
           insert sequence
          Length = 702

 Score =  125 bits (63), Expect = 2e-25
 Identities = 102/115 (88%)
 Strand = Plus / Minus

                                                                       
Query: 258 tcttgccgcactggttgaggaggagggtcaggtcgatggggacattgagcttgatgccga 317
           |||||||||| | |||||||| |||| | |||||||||||||  |||||||||||||| |
Sbjct: 436 tcttgccgcagttgttgaggatgaggctgaggtcgatggggaggttgagcttgatgccca 377

                                                                  
Query: 318 ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 372
           | | ||||||| ||||||||||||||||||| |||||||||||||||||| ||||
Sbjct: 376 gcacgttggccttgatggcggtgcagaggcagacggcggcgtcgaggtcgacgag 322



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score =  125 bits (63), Expect = 2e-25
 Identities = 102/115 (88%)
 Strand = Plus / Plus

                                                                            
Query: 258      tcttgccgcactggttgaggaggagggtcaggtcgatggggacattgagcttgatgccga 317
                |||||||||| | |||||||| |||| | |||||||||||||  |||||||||||||| |
Sbjct: 21189432 tcttgccgcagttgttgaggatgaggctgaggtcgatggggaggttgagcttgatgccca 21189491

                                                                       
Query: 318      ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 372
                | | ||||||| ||||||||||||||||||| |||||||||||||||||| ||||
Sbjct: 21189492 gcacgttggccttgatggcggtgcagaggcagacggcggcgtcgaggtcgacgag 21189546



 Score =  123 bits (62), Expect = 7e-25
 Identities = 122/142 (85%)
 Strand = Plus / Plus

                                                                            
Query: 235      gcaggtgaagttggcggggcacttcttgccgcactggttgaggaggagggtcaggtcgat 294
                ||||||||||| || ||||||  |||||||||||| |||||||| |||| | || |||| 
Sbjct: 21166964 gcaggtgaagtcggaggggcagatcttgccgcacttgttgaggatgaggcttagatcgac 21167023

                                                                            
Query: 295      ggggacattgagcttgatgccgaggatgttggccctgatggcggtgcagaggcacacggc 354
                || ||  ||||| || |||||||| | ||||||| ||| ||||||||||||||| |||||
Sbjct: 21167024 ggcgaggttgagtttcatgccgagcacgttggccttgacggcggtgcagaggcagacggc 21167083

                                      
Query: 355      ggcgtcgaggtcggcgagcccg 376
                ||||||||||||||||||||||
Sbjct: 21167084 ggcgtcgaggtcggcgagcccg 21167105



 Score =  119 bits (60), Expect = 1e-23
 Identities = 173/210 (82%), Gaps = 3/210 (1%)
 Strand = Plus / Plus

                                                                            
Query: 258      tcttgccgcactggttgaggaggagggtcaggtcgatggggacattgagcttgatgccga 317
                |||||||||| | |||||||| |||| | |||||||||||||  ||||| |||| |||||
Sbjct: 21182718 tcttgccgcagttgttgaggatgaggctgaggtcgatggggatgttgaggttgaggccga 21182777

                                                                            
Query: 318      ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgc 377
                | | ||||||| ||||||||||||||||||| |||||||||||||||||| |||| ||| 
Sbjct: 21182778 gcacgttggccttgatggcggtgcagaggcagacggcggcgtcgaggtcgacgaggccgt 21182837

                                                                            
Query: 378      ctaggagtgggcagcactgctcgttcgccggca---cgccgatcttgagcttcagcaggt 434
                | || || | ||||||  |||||| || || ||   |||||||||||  |||||  ||| 
Sbjct: 21182838 cgagcagcgagcagcagggctcgtacggcgccaccgcgccgatcttggccttcacgaggc 21182897

                                              
Query: 435      tcagcacgttggcgcacacgcccagcttca 464
                  ||||||||||||||||||  ||||||||
Sbjct: 21182898 cgagcacgttggcgcacacgtgcagcttca 21182927



 Score =  109 bits (55), Expect = 1e-20
 Identities = 100/115 (86%)
 Strand = Plus / Plus

                                                                            
Query: 258      tcttgccgcactggttgaggaggagggtcaggtcgatggggacattgagcttgatgccga 317
                |||||||||| | |||||||| |||| | ||||||| |||||  | ||||||||||||||
Sbjct: 21186164 tcttgccgcagttgttgaggatgaggctgaggtcgacggggaggtcgagcttgatgccga 21186223

                                                                       
Query: 318      ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 372
                | | ||||||| ||| ||||||||||||||| |||||||||||||||||| ||||
Sbjct: 21186224 gcacgttggccttgacggcggtgcagaggcagacggcggcgtcgaggtcgacgag 21186278



 Score =  107 bits (54), Expect = 4e-20
 Identities = 99/114 (86%)
 Strand = Plus / Plus

                                                                            
Query: 258      tcttgccgcactggttgaggaggagggtcaggtcgatggggacattgagcttgatgccga 317
                |||||| ||||| |||||||| |||| |||| |||| ||||| ||| || |||||||| |
Sbjct: 21162872 tcttgctgcacttgttgaggatgaggctcagatcgacggggagattcaggttgatgccca 21162931

                                                                      
Query: 318      ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcga 371
                | | ||||||| ||| ||||||||||||||| ||||||||||||||||||||||
Sbjct: 21162932 gcacgttggccttgacggcggtgcagaggcagacggcggcgtcgaggtcggcga 21162985



 Score =  101 bits (51), Expect = 2e-18
 Identities = 132/159 (83%)
 Strand = Plus / Plus

                                                                            
Query: 235      gcaggtgaagttggcggggcacttcttgccgcactggttgaggaggagggtcaggtcgat 294
                ||||||||||| || ||||||  |||||||||||| |||||||| |||  | || |||| 
Sbjct: 21150440 gcaggtgaagtcggaggggcaggtcttgccgcacttgttgaggatgagcttgagctcgac 21150499

                                                                            
Query: 295      ggggacattgagcttgatgccgaggatgttggccctgatggcggtgcagaggcacacggc 354
                |||||| ||||| |||| |||||| | ||||||| | | ||||||||||||||| |||||
Sbjct: 21150500 ggggacgttgaggttgacgccgagcacgttggccttcacggcggtgcagaggcagacggc 21150559

                                                       
Query: 355      ggcgtcgaggtcggcgagcccgcctaggagtgggcagca 393
                |||||||  ||||||||| ||| | || || ||||||||
Sbjct: 21150560 ggcgtcggcgtcggcgaggccggcgagcagcgggcagca 21150598



 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 92/107 (85%)
 Strand = Plus / Plus

                                                                            
Query: 265      gcactggttgaggaggagggtcaggtcgatggggacattgagcttgatgccgaggatgtt 324
                ||||| |||||||| |||| |||| |||| |||||  ||||| |||||||| || |  ||
Sbjct: 21159586 gcacttgttgaggatgaggctcagatcgacggggaggttgaggttgatgcccagcacatt 21159645

                                                               
Query: 325      ggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcga 371
                |||| ||| ||||||||||||||| ||||||||||||||||||||||
Sbjct: 21159646 ggccttgacggcggtgcagaggcagacggcggcgtcgaggtcggcga 21159692



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 97/115 (84%), Gaps = 3/115 (2%)
 Strand = Plus / Plus

                                                                            
Query: 258      tcttgccgcactggttgaggaggagggtcaggtcgatggggacattgagcttgatg---c 314
                |||||||||| | |||||||| |||| | || |||| |||||  ||||| ||||||   |
Sbjct: 21154830 tcttgccgcagttgttgaggatgaggctgagatcgacggggatgttgaggttgatgatcc 21154889

                                                                       
Query: 315      cgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggc 369
                | || | ||||||| ||||||||||||||||||| ||||||||||||||||||||
Sbjct: 21154890 caagaacgttggccttgatggcggtgcagaggcagacggcggcgtcgaggtcggc 21154944



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 36/37 (97%)
 Strand = Plus / Plus

                                                     
Query: 335      gcggtgcagaggcacacggcggcgtcgaggtcggcga 371
                |||||||||||||| ||||||||||||||||||||||
Sbjct: 10078371 gcggtgcagaggcagacggcggcgtcgaggtcggcga 10078407



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 55/63 (87%)
 Strand = Plus / Plus

                                                                            
Query: 338      gtgcagaggcacacggcggcgtcgaggtcggcgagcccgcctaggagtgggcagcactgc 397
                ||||||||||||||||||||||| | ||||||||| ||| | |||||   ||||||||||
Sbjct: 21147891 gtgcagaggcacacggcggcgtccacgtcggcgaggccggcgaggagcccgcagcactgc 21147950

                   
Query: 398      tcg 400
                |||
Sbjct: 21147951 tcg 21147953



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                        
Query: 437      agcacgttggcgcacacgcccagcttcaacgtgttgatcg 476
                ||||||||||||||||| | ||||||||| ||||||||||
Sbjct: 10054300 agcacgttggcgcacactctcagcttcaaggtgttgatcg 10054339



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                            
Query: 311      atgccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcg 370
                ||||| |||| ||||||| | | ||| ||||||||||| |||||||| ||||| ||||||
Sbjct: 10057315 atgccaaggacgttggccttcacggcagtgcagaggcagacggcggcatcgagatcggcg 10057374

                 
Query: 371      a 371
                |
Sbjct: 10057375 a 10057375



 Score = 48.1 bits (24), Expect = 0.032
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                                
Query: 436      cagcacgttggcgcacacgcccagcttcaacg 467
                |||||||||||||||||| | |||||||||||
Sbjct: 21186345 cagcacgttggcgcacacccgcagcttcaacg 21186376



 Score = 44.1 bits (22), Expect = 0.49
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                              
Query: 437      agcacgttggcgcacacgcccagcttcaacgtgttgatcgagcagc 482
                ||||||||||||||||| | |||||||| || || ||||| |||||
Sbjct: 21150642 agcacgttggcgcacacccgcagcttcagcgcgtcgatcgggcagc 21150687



 Score = 44.1 bits (22), Expect = 0.49
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                      
Query: 334      ggcggtgcagaggcacacggcggcgtcgaggtcggcga 371
                ||||||||||||||| ||||| |||||||  |||||||
Sbjct: 10069414 ggcggtgcagaggcagacggcagcgtcgatatcggcga 10069451



 Score = 44.1 bits (22), Expect = 0.49
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                                  
Query: 338      gtgcagaggcacacggcggcgtcgaggtcggcga 371
                ||||||||||| ||||| |||||||| |||||||
Sbjct: 10054201 gtgcagaggcagacggcagcgtcgagatcggcga 10054234



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                             
Query: 437      agcacgttggcgcacacgcccagcttcaa 465
                ||||||||||||||||| | |||||||||
Sbjct: 10069517 agcacgttggcgcacactctcagcttcaa 10069545



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                            
Query: 437      agcacgttggcgcacacgcccagcttca 464
                ||||||||||||||||| | ||||||||
Sbjct: 21163051 agcacgttggcgcacaccctcagcttca 21163078



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                            
Query: 437      agcacgttggcgcacacgcccagcttca 464
                ||||||||||||||||| | ||||||||
Sbjct: 21159758 agcacgttggcgcacaccctcagcttca 21159785



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                            
Query: 437      agcacgttggcgcacacgcccagcttca 464
                ||||||||||||||||| | ||||||||
Sbjct: 10061828 agcacgttggcgcacactctcagcttca 10061855



to top

>ref|NM_197676.1| Oryza sativa (japonica cultivar-group) putative lipid transfer
           protein (OSJNBa0015J15.11), mRNA
          Length = 411

 Score =  123 bits (62), Expect = 7e-25
 Identities = 122/142 (85%)
 Strand = Plus / Minus

                                                                       
Query: 235 gcaggtgaagttggcggggcacttcttgccgcactggttgaggaggagggtcaggtcgat 294
           ||||||||||| || ||||||  |||||||||||| |||||||| |||| | || |||| 
Sbjct: 408 gcaggtgaagtcggaggggcagatcttgccgcacttgttgaggatgaggcttagatcgac 349

                                                                       
Query: 295 ggggacattgagcttgatgccgaggatgttggccctgatggcggtgcagaggcacacggc 354
           || ||  ||||| || |||||||| | ||||||| ||| ||||||||||||||| |||||
Sbjct: 348 ggcgaggttgagtttcatgccgagcacgttggccttgacggcggtgcagaggcagacggc 289

                                 
Query: 355 ggcgtcgaggtcggcgagcccg 376
           ||||||||||||||||||||||
Sbjct: 288 ggcgtcgaggtcggcgagcccg 267



to top

>ref|XM_473448.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 393

 Score =  123 bits (62), Expect = 7e-25
 Identities = 170/206 (82%)
 Strand = Plus / Minus

                                                                       
Query: 259 cttgccgcactggttgaggaggagggtcaggtcgatggggacattgagcttgatgccgag 318
           ||||||||| | |||||||| |||| | ||||||| |||||  ||||| |||||||||||
Sbjct: 366 cttgccgcagtagttgaggatgaggctgaggtcgacggggaggttgaggttgatgccgag 307

                                                                       
Query: 319 gatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcc 378
           ||||||| | |||||||| ||||||||||| || || || ||||||||| |||||||  |
Sbjct: 306 gatgttgcctctgatggccgtgcagaggcataccgccgcctcgaggtcgacgagcccctc 247

                                                                       
Query: 379 taggagtgggcagcactgctcgttcgccggcacgccgatcttgagcttcagcaggttcag 438
            || || ||||||||| ||||   || ||||||||| | ||||  ||| |  |||  |||
Sbjct: 246 cagcagcgggcagcacggctccgccggcggcacgcccaccttggccttgatgaggcccag 187

                                     
Query: 439 cacgttggcgcacacgcccagcttca 464
           ||||||||||||||||||||||||||
Sbjct: 186 cacgttggcgcacacgcccagcttca 161



to top

>gb|AY466109.1| Oryza sativa (japonica cultivar-group) lipid transfer protein-like
           protein (LTP2) mRNA, complete cds
          Length = 758

 Score =  123 bits (62), Expect = 7e-25
 Identities = 170/206 (82%)
 Strand = Plus / Minus

                                                                       
Query: 259 cttgccgcactggttgaggaggagggtcaggtcgatggggacattgagcttgatgccgag 318
           ||||||||| | |||||||| |||| | ||||||| |||||  ||||| |||||||||||
Sbjct: 441 cttgccgcagtagttgaggatgaggctgaggtcgacggggaggttgaggttgatgccgag 382

                                                                       
Query: 319 gatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcc 378
           ||||||| | |||||||| ||||||||||| || || || ||||||||| |||||||  |
Sbjct: 381 gatgttgcctctgatggccgtgcagaggcataccgccgcctcgaggtcgacgagcccctc 322

                                                                       
Query: 379 taggagtgggcagcactgctcgttcgccggcacgccgatcttgagcttcagcaggttcag 438
            || || ||||||||| ||||   || ||||||||| | ||||  ||| |  |||  |||
Sbjct: 321 cagcagcgggcagcacggctccgccggcggcacgcccaccttggccttgatgaggcccag 262

                                     
Query: 439 cacgttggcgcacacgcccagcttca 464
           ||||||||||||||||||||||||||
Sbjct: 261 cacgttggcgcacacgcccagcttca 236



to top

>emb|AL606633.3|OSJN00060 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0010H02,
              complete sequence
          Length = 173522

 Score =  123 bits (62), Expect = 7e-25
 Identities = 170/206 (82%)
 Strand = Plus / Minus

                                                                          
Query: 259    cttgccgcactggttgaggaggagggtcaggtcgatggggacattgagcttgatgccgag 318
              ||||||||| | |||||||| |||| | ||||||| |||||  ||||| |||||||||||
Sbjct: 144413 cttgccgcagtagttgaggatgaggctgaggtcgacggggaggttgaggttgatgccgag 144354

                                                                          
Query: 319    gatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcc 378
              ||||||| | |||||||| ||||||||||| || || || ||||||||| |||||||  |
Sbjct: 144353 gatgttgcctctgatggccgtgcagaggcataccgccgcctcgaggtcgacgagcccctc 144294

                                                                          
Query: 379    taggagtgggcagcactgctcgttcgccggcacgccgatcttgagcttcagcaggttcag 438
               || || ||||||||| ||||   || ||||||||| | ||||  ||| |  |||  |||
Sbjct: 144293 cagcagcgggcagcacggctccgccggcggcacgcccaccttggccttgatgaggcccag 144234

                                        
Query: 439    cacgttggcgcacacgcccagcttca 464
              ||||||||||||||||||||||||||
Sbjct: 144233 cacgttggcgcacacgcccagcttca 144208



 Score =  115 bits (58), Expect = 2e-22
 Identities = 169/206 (82%)
 Strand = Plus / Minus

                                                                          
Query: 259    cttgccgcactggttgaggaggagggtcaggtcgatggggacattgagcttgatgccgag 318
              ||||||||| | |||||||| |||| | ||||||| |||||  || || |||||||||||
Sbjct: 147613 cttgccgcagtagttgaggatgaggctgaggtcgacggggaggttaaggttgatgccgag 147554

                                                                          
Query: 319    gatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcc 378
               |||||| || ||||||| |||||||||||||| || || ||||||||| |||||||  |
Sbjct: 147553 aatgttgcccttgatggccgtgcagaggcacaccgccgcctcgaggtcgacgagcccctc 147494

                                                                          
Query: 379    taggagtgggcagcactgctcgttcgccggcacgccgatcttgagcttcagcaggttcag 438
               || || ||||||||| ||||   || ||||||||| | ||||  ||| |  |||  |||
Sbjct: 147493 cagcagcgggcagcacggctccgccggcggcacgcccaccttggccttgatgaggcccag 147434

                                        
Query: 439    cacgttggcgcacacgcccagcttca 464
              ||||||||||||||||||||||||||
Sbjct: 147433 cacgttggcgcacacgcccagcttca 147408



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 58/65 (89%)
 Strand = Plus / Minus

                                                                          
Query: 313    gccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 372
              |||||| | ||||||| ||||||| ||||||||||| |||||||| ||||||||||||||
Sbjct: 157691 gccgagcacgttggccttgatggccgtgcagaggcagacggcggcctcgaggtcggcgag 157632

                   
Query: 373    cccgc 377
               ||||
Sbjct: 157631 gccgc 157627



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  123 bits (62), Expect = 7e-25
 Identities = 170/206 (82%)
 Strand = Plus / Minus

                                                                            
Query: 259      cttgccgcactggttgaggaggagggtcaggtcgatggggacattgagcttgatgccgag 318
                ||||||||| | |||||||| |||| | ||||||| |||||  ||||| |||||||||||
Sbjct: 27713787 cttgccgcagtagttgaggatgaggctgaggtcgacggggaggttgaggttgatgccgag 27713728

                                                                            
Query: 319      gatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcc 378
                ||||||| | |||||||| ||||||||||| || || || ||||||||| |||||||  |
Sbjct: 27713727 gatgttgcctctgatggccgtgcagaggcataccgccgcctcgaggtcgacgagcccctc 27713668

                                                                            
Query: 379      taggagtgggcagcactgctcgttcgccggcacgccgatcttgagcttcagcaggttcag 438
                 || || ||||||||| ||||   || ||||||||| | ||||  ||| |  |||  |||
Sbjct: 27713667 cagcagcgggcagcacggctccgccggcggcacgcccaccttggccttgatgaggcccag 27713608

                                          
Query: 439      cacgttggcgcacacgcccagcttca 464
                ||||||||||||||||||||||||||
Sbjct: 27713607 cacgttggcgcacacgcccagcttca 27713582



 Score =  115 bits (58), Expect = 2e-22
 Identities = 169/206 (82%)
 Strand = Plus / Minus

                                                                            
Query: 259      cttgccgcactggttgaggaggagggtcaggtcgatggggacattgagcttgatgccgag 318
                ||||||||| | |||||||| |||| | ||||||| |||||  || || |||||||||||
Sbjct: 27716987 cttgccgcagtagttgaggatgaggctgaggtcgacggggaggttaaggttgatgccgag 27716928

                                                                            
Query: 319      gatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcc 378
                 |||||| || ||||||| |||||||||||||| || || ||||||||| |||||||  |
Sbjct: 27716927 aatgttgcccttgatggccgtgcagaggcacaccgccgcctcgaggtcgacgagcccctc 27716868

                                                                            
Query: 379      taggagtgggcagcactgctcgttcgccggcacgccgatcttgagcttcagcaggttcag 438
                 || || ||||||||| ||||   || ||||||||| | ||||  ||| |  |||  |||
Sbjct: 27716867 cagcagcgggcagcacggctccgccggcggcacgcccaccttggccttgatgaggcccag 27716808

                                          
Query: 439      cacgttggcgcacacgcccagcttca 464
                ||||||||||||||||||||||||||
Sbjct: 27716807 cacgttggcgcacacgcccagcttca 27716782



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 58/65 (89%)
 Strand = Plus / Minus

                                                                            
Query: 313      gccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 372
                |||||| | ||||||| ||||||| ||||||||||| |||||||| ||||||||||||||
Sbjct: 27727065 gccgagcacgttggccttgatggccgtgcagaggcagacggcggcctcgaggtcggcgag 27727006

                     
Query: 373      cccgc 377
                 ||||
Sbjct: 27727005 gccgc 27727001



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                                 
Query: 323      ttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcga 371
                |||||| ||||||||||||||||||| |  |||||||||||||||||||
Sbjct: 31096018 ttggccttgatggcggtgcagaggcagagcgcggcgtcgaggtcggcga 31095970



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                                 
Query: 323      ttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcga 371
                |||||| ||||||||||||||||||| |  |||||||||||||||||||
Sbjct: 31085599 ttggccttgatggcggtgcagaggcagagcgcggcgtcgaggtcggcga 31085551



 Score = 48.1 bits (24), Expect = 0.032
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                    
Query: 323      ttggccctgatggcggtgcagaggcacacggcggcg 358
                |||||| |||||||||||||||||||  ||||||||
Sbjct: 32827227 ttggccttgatggcggtgcagaggcaggcggcggcg 32827262



to top

>ref|NM_197679.1| Oryza sativa (japonica cultivar-group) putative lipid transfer
           protein (OSJNBa0015J15.8), mRNA
          Length = 402

 Score =  119 bits (60), Expect = 1e-23
 Identities = 173/210 (82%), Gaps = 3/210 (1%)
 Strand = Plus / Minus

                                                                       
Query: 258 tcttgccgcactggttgaggaggagggtcaggtcgatggggacattgagcttgatgccga 317
           |||||||||| | |||||||| |||| | |||||||||||||  ||||| |||| |||||
Sbjct: 373 tcttgccgcagttgttgaggatgaggctgaggtcgatggggatgttgaggttgaggccga 314

                                                                       
Query: 318 ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgc 377
           | | ||||||| ||||||||||||||||||| |||||||||||||||||| |||| ||| 
Sbjct: 313 gcacgttggccttgatggcggtgcagaggcagacggcggcgtcgaggtcgacgaggccgt 254

                                                                       
Query: 378 ctaggagtgggcagcactgctcgttcgccggca---cgccgatcttgagcttcagcaggt 434
           | || || | ||||||  |||||| || || ||   |||||||||||  |||||  ||| 
Sbjct: 253 cgagcagcgagcagcagggctcgtacggcgccaccgcgccgatcttggccttcacgaggc 194

                                         
Query: 435 tcagcacgttggcgcacacgcccagcttca 464
             ||||||||||||||||||  ||||||||
Sbjct: 193 cgagcacgttggcgcacacgtgcagcttca 164



to top

>dbj|AK062911.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-108-G07, full
           insert sequence
          Length = 757

 Score =  117 bits (59), Expect = 4e-23
 Identities = 101/115 (87%)
 Strand = Plus / Minus

                                                                       
Query: 258 tcttgccgcactggttgaggaggagggtcaggtcgatggggacattgagcttgatgccga 317
           |||||||||| | |||||||| |||| | |||||||||||||  ||||| |||| |||||
Sbjct: 460 tcttgccgcagttgttgaggatgaggctgaggtcgatggggatgttgaggttgaggccga 401

                                                                  
Query: 318 ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 372
           | | ||||||| ||||||||||||||||||| |||||||||||||||||| ||||
Sbjct: 400 gcacgttggccttgatggcggtgcagaggcagacggcggcgtcgaggtcgacgag 346



to top

>ref|XM_473449.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 396

 Score =  115 bits (58), Expect = 2e-22
 Identities = 169/206 (82%)
 Strand = Plus / Minus

                                                                       
Query: 259 cttgccgcactggttgaggaggagggtcaggtcgatggggacattgagcttgatgccgag 318
           ||||||||| | |||||||| |||| | ||||||| |||||  || || |||||||||||
Sbjct: 366 cttgccgcagtagttgaggatgaggctgaggtcgacggggaggttaaggttgatgccgag 307

                                                                       
Query: 319 gatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcc 378
            |||||| || ||||||| |||||||||||||| || || ||||||||| |||||||  |
Sbjct: 306 aatgttgcccttgatggccgtgcagaggcacaccgccgcctcgaggtcgacgagcccctc 247

                                                                       
Query: 379 taggagtgggcagcactgctcgttcgccggcacgccgatcttgagcttcagcaggttcag 438
            || || ||||||||| ||||   || ||||||||| | ||||  ||| |  |||  |||
Sbjct: 246 cagcagcgggcagcacggctccgccggcggcacgcccaccttggccttgatgaggcccag 187

                                     
Query: 439 cacgttggcgcacacgcccagcttca 464
           ||||||||||||||||||||||||||
Sbjct: 186 cacgttggcgcacacgcccagcttca 161



to top

>ref|NM_197680.1| Oryza sativa (japonica cultivar-group) putative lipid transfer
           protein (OSJNBa0015J15.7), mRNA
          Length = 375

 Score =  109 bits (55), Expect = 1e-20
 Identities = 100/115 (86%)
 Strand = Plus / Minus

                                                                       
Query: 258 tcttgccgcactggttgaggaggagggtcaggtcgatggggacattgagcttgatgccga 317
           |||||||||| | |||||||| |||| | ||||||| |||||  | ||||||||||||||
Sbjct: 343 tcttgccgcagttgttgaggatgaggctgaggtcgacggggaggtcgagcttgatgccga 284

                                                                  
Query: 318 ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 372
           | | ||||||| ||| ||||||||||||||| |||||||||||||||||| ||||
Sbjct: 283 gcacgttggccttgacggcggtgcagaggcagacggcggcgtcgaggtcgacgag 229



 Score = 48.1 bits (24), Expect = 0.032
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 436 cagcacgttggcgcacacgcccagcttcaacg 467
           |||||||||||||||||| | |||||||||||
Sbjct: 162 cagcacgttggcgcacacccgcagcttcaacg 131



to top

>dbj|AK063090.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-111-A12, full
           insert sequence
          Length = 627

 Score =  109 bits (55), Expect = 1e-20
 Identities = 100/115 (86%)
 Strand = Plus / Minus

                                                                       
Query: 258 tcttgccgcactggttgaggaggagggtcaggtcgatggggacattgagcttgatgccga 317
           |||||||||| | |||||||| |||| | ||||||| |||||  | ||||||||||||||
Sbjct: 428 tcttgccgcagttgttgaggatgaggctgaggtcgacggggaggtcgagcttgatgccga 369

                                                                  
Query: 318 ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 372
           | | ||||||| ||| ||||||||||||||| |||||||||||||||||| ||||
Sbjct: 368 gcacgttggccttgacggcggtgcagaggcagacggcggcgtcgaggtcgacgag 314



 Score = 48.1 bits (24), Expect = 0.032
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 436 cagcacgttggcgcacacgcccagcttcaacg 467
           |||||||||||||||||| | |||||||||||
Sbjct: 247 cagcacgttggcgcacacccgcagcttcaacg 216



to top

>ref|NM_197675.1| Oryza sativa (japonica cultivar-group) putative lipid transfer
           protein (OSJNBa0015J15.12), mRNA
          Length = 396

 Score =  107 bits (54), Expect = 4e-20
 Identities = 99/114 (86%)
 Strand = Plus / Minus

                                                                       
Query: 258 tcttgccgcactggttgaggaggagggtcaggtcgatggggacattgagcttgatgccga 317
           |||||| ||||| |||||||| |||| |||| |||| ||||| ||| || |||||||| |
Sbjct: 370 tcttgctgcacttgttgaggatgaggctcagatcgacggggagattcaggttgatgccca 311

                                                                 
Query: 318 ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcga 371
           | | ||||||| ||| ||||||||||||||| ||||||||||||||||||||||
Sbjct: 310 gcacgttggccttgacggcggtgcagaggcagacggcggcgtcgaggtcggcga 257



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 437 agcacgttggcgcacacgcccagcttca 464
           ||||||||||||||||| | ||||||||
Sbjct: 191 agcacgttggcgcacaccctcagcttca 164



to top

>gb|AY108411.1| Zea mays PCO134698 mRNA sequence
          Length = 667

 Score =  105 bits (53), Expect = 2e-19
 Identities = 116/137 (84%)
 Strand = Plus / Minus

                                                                       
Query: 258 tcttgccgcactggttgaggaggagggtcaggtcgatggggacattgagcttgatgccga 317
           |||||||||| | ||||||||| ||||| || | || |||||| | ||| ||||||||||
Sbjct: 483 tcttgccgcagtagttgaggagcagggtgagcttgacggggacgtcgaggttgatgccga 424

                                                                       
Query: 318 ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgc 377
           | | ||||||| |||  |||||||||||||| |||||||| || ||||||||||||||| 
Sbjct: 423 gcacgttggccttgagcgcggtgcagaggcagacggcggcctctaggtcggcgagcccgt 364

                            
Query: 378 ctaggagtgggcagcac 394
           | || ||||||||||||
Sbjct: 363 ccagcagtgggcagcac 347



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 436 cagcacgttggcgcacacgcccagcttca 464
           |||||||||||||||||||||||| ||||
Sbjct: 305 cagcacgttggcgcacacgcccagtttca 277



to top

>ref|NM_197671.1| Oryza sativa (japonica cultivar-group) putative lipid transfer
           protein (OSJNBa0015J15.16), mRNA
          Length = 441

 Score =  101 bits (51), Expect = 2e-18
 Identities = 132/159 (83%)
 Strand = Plus / Minus

                                                                       
Query: 235 gcaggtgaagttggcggggcacttcttgccgcactggttgaggaggagggtcaggtcgat 294
           ||||||||||| || ||||||  |||||||||||| |||||||| |||  | || |||| 
Sbjct: 438 gcaggtgaagtcggaggggcaggtcttgccgcacttgttgaggatgagcttgagctcgac 379

                                                                       
Query: 295 ggggacattgagcttgatgccgaggatgttggccctgatggcggtgcagaggcacacggc 354
           |||||| ||||| |||| |||||| | ||||||| | | ||||||||||||||| |||||
Sbjct: 378 ggggacgttgaggttgacgccgagcacgttggccttcacggcggtgcagaggcagacggc 319

                                                  
Query: 355 ggcgtcgaggtcggcgagcccgcctaggagtgggcagca 393
           |||||||  ||||||||| ||| | || || ||||||||
Sbjct: 318 ggcgtcggcgtcggcgaggccggcgagcagcgggcagca 280



 Score = 44.1 bits (22), Expect = 0.49
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 437 agcacgttggcgcacacgcccagcttcaacgtgttgatcgagcagc 482
           ||||||||||||||||| | |||||||| || || ||||| |||||
Sbjct: 236 agcacgttggcgcacacccgcagcttcagcgcgtcgatcgggcagc 191



to top

>gb|L27210.1|RICRCG2 Oryza sativa root-specific protein (RCg2) gene, complete cds
          Length = 2252

 Score =  101 bits (51), Expect = 2e-18
 Identities = 132/159 (83%)
 Strand = Plus / Minus

                                                                        
Query: 235  gcaggtgaagttggcggggcacttcttgccgcactggttgaggaggagggtcaggtcgat 294
            ||||||||||| || ||||||  |||||||||||| |||||||| |||  | || |||| 
Sbjct: 2094 gcaggtgaagtcggaggggcaggtcttgccgcacttgttgaggatgagcttgagctcgac 2035

                                                                        
Query: 295  ggggacattgagcttgatgccgaggatgttggccctgatggcggtgcagaggcacacggc 354
            |||||| ||||| |||| |||||| | ||||||| | | ||||||||||||||| |||||
Sbjct: 2034 ggggacgttgaggttgacgccgagcacgttggccttcacggcggtgcagaggcagacggc 1975

                                                   
Query: 355  ggcgtcgaggtcggcgagcccgcctaggagtgggcagca 393
            |||||||  ||||||||| ||| | || || ||||||||
Sbjct: 1974 ggcgtcggcgtcggcgaggccggcgagcagcgggcagca 1936



 Score = 44.1 bits (22), Expect = 0.49
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                          
Query: 437  agcacgttggcgcacacgcccagcttcaacgtgttgatcgagcagc 482
            ||||||||||||||||| | |||||||| || || ||||| |||||
Sbjct: 1892 agcacgttggcgcacacccgcagcttcagcgcgtcgatcgggcagc 1847



to top

>gb|L27209.1|RICRCC2 Oryza sativa root-specific RCc2 mRNA, complete cds
          Length = 654

 Score =  101 bits (51), Expect = 2e-18
 Identities = 132/159 (83%)
 Strand = Plus / Minus

                                                                       
Query: 235 gcaggtgaagttggcggggcacttcttgccgcactggttgaggaggagggtcaggtcgat 294
           ||||||||||| || ||||||  |||||||||||| |||||||| |||  | || |||| 
Sbjct: 482 gcaggtgaagtcggaggggcaggtcttgccgcacttgttgaggatgagcttgagctcgac 423

                                                                       
Query: 295 ggggacattgagcttgatgccgaggatgttggccctgatggcggtgcagaggcacacggc 354
           |||||| ||||| |||| |||||| | ||||||| | | ||||||||||||||| |||||
Sbjct: 422 ggggacgttgaggttgacgccgagcacgttggccttcacggcggtgcagaggcagacggc 363

                                                  
Query: 355 ggcgtcgaggtcggcgagcccgcctaggagtgggcagca 393
           |||||||  ||||||||| ||| | || || ||||||||
Sbjct: 362 ggcgtcggcgtcggcgaggccggcgagcagcgggcagca 324



 Score = 44.1 bits (22), Expect = 0.49
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 437 agcacgttggcgcacacgcccagcttcaacgtgttgatcgagcagc 482
           ||||||||||||||||| | |||||||| || || ||||| |||||
Sbjct: 280 agcacgttggcgcacacccgcagcttcagcgcgtcgatcgggcagc 235



to top

>ref|NM_197674.1| Oryza sativa (japonica cultivar-group) putative lipid transfer
           protein (OSJNBa0015J15.13), mRNA
          Length = 396

 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 92/107 (85%)
 Strand = Plus / Minus

                                                                       
Query: 265 gcactggttgaggaggagggtcaggtcgatggggacattgagcttgatgccgaggatgtt 324
           ||||| |||||||| |||| |||| |||| |||||  ||||| |||||||| || |  ||
Sbjct: 363 gcacttgttgaggatgaggctcagatcgacggggaggttgaggttgatgcccagcacatt 304

                                                          
Query: 325 ggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcga 371
           |||| ||| ||||||||||||||| ||||||||||||||||||||||
Sbjct: 303 ggccttgacggcggtgcagaggcagacggcggcgtcgaggtcggcga 257



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 437 agcacgttggcgcacacgcccagcttca 464
           ||||||||||||||||| | ||||||||
Sbjct: 191 agcacgttggcgcacaccctcagcttca 164



to top

>gb|AY105972.1| Zea mays PCO122221 mRNA sequence
          Length = 768

 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 98/115 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 tcttgccgcactggttgaggaggagggtcaggtcgatggggacattgagcttgatgccga 317
           |||||||||| |||||||||| |||| | ||||||| ||| |  ||||||||||| ||||
Sbjct: 445 tcttgccgcagtggttgaggatgaggctgaggtcgacgggcaggttgagcttgattccga 386

                                                                  
Query: 318 ggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 372
           |||  |   || |||||||||||||||||||||||||||| ||||||||| ||||
Sbjct: 385 ggacctctcccttgatggcggtgcagaggcacacggcggcctcgaggtcgacgag 331



to top

>ref|XM_469576.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 445

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 105/126 (83%)
 Strand = Plus / Minus

                                                                       
Query: 328 cctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcctaggagtgg 387
           ||||||||||| |||||||||| | |||||||||||||   |||| |  || || || ||
Sbjct: 343 cctgatggcggcgcagaggcacgccgcggcgtcgaggttcacgaggctccccagcagcgg 284

                                                                       
Query: 388 gcagcactgctcgttcgccggcacgccgatcttgagcttcagcaggttcagcacgttggc 447
           ||||||||||| | |||||||||||  |||||| |||||||||||   |||||||| |||
Sbjct: 283 gcagcactgctggctcgccggcacgttgatcttcagcttcagcagcaccagcacgtcggc 224

                 
Query: 448 gcacac 453
           ||||||
Sbjct: 223 gcacac 218



to top

>gb|AC147426.2| Oryza sativa chromosome 3  B1377B10 genomic sequence, complete
           sequence
          Length = 184366

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 105/126 (83%)
 Strand = Plus / Minus

                                                                       
Query: 328 cctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcctaggagtgg 387
           ||||||||||| |||||||||| | |||||||||||||   |||| |  || || || ||
Sbjct: 456 cctgatggcggcgcagaggcacgccgcggcgtcgaggttcacgaggctccccagcagcgg 397

                                                                       
Query: 388 gcagcactgctcgttcgccggcacgccgatcttgagcttcagcaggttcagcacgttggc 447
           ||||||||||| | |||||||||||  |||||| |||||||||||   |||||||| |||
Sbjct: 396 gcagcactgctggctcgccggcacgttgatcttcagcttcagcagcaccagcacgtcggc 337

                 
Query: 448 gcacac 453
           ||||||
Sbjct: 336 gcacac 331



to top

>gb|AC091532.13| Oryza sativa chromosome 3 BAC OSJNBa0078A17 genomic sequence, complete
              sequence
          Length = 147344

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 105/126 (83%)
 Strand = Plus / Minus

                                                                          
Query: 328    cctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccgcctaggagtgg 387
              ||||||||||| |||||||||| | |||||||||||||   |||| |  || || || ||
Sbjct: 124142 cctgatggcggcgcagaggcacgccgcggcgtcgaggttcacgaggctccccagcagcgg 124083

                                                                          
Query: 388    gcagcactgctcgttcgccggcacgccgatcttgagcttcagcaggttcagcacgttggc 447
              ||||||||||| | |||||||||||  |||||| |||||||||||   |||||||| |||
Sbjct: 124082 gcagcactgctggctcgccggcacgttgatcttcagcttcagcagcaccagcacgtcggc 124023

                    
Query: 448    gcacac 453
              ||||||
Sbjct: 124022 gcacac 124017



to top

>ref|NM_197672.1| Oryza sativa (japonica cultivar-group) putative lipid transfer
           protein (OSJNBa0015J15.15), mRNA
          Length = 429

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 97/115 (84%), Gaps = 3/115 (2%)
 Strand = Plus / Minus

                                                                       
Query: 258 tcttgccgcactggttgaggaggagggtcaggtcgatggggacattgagcttgatg---c 314
           |||||||||| | |||||||| |||| | || |||| |||||  ||||| ||||||   |
Sbjct: 403 tcttgccgcagttgttgaggatgaggctgagatcgacggggatgttgaggttgatgatcc 344

                                                                  
Query: 315 cgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggc 369
           | || | ||||||| ||||||||||||||||||| ||||||||||||||||||||
Sbjct: 343 caagaacgttggccttgatggcggtgcagaggcagacggcggcgtcgaggtcggc 289



to top

>emb|Z12103.1|ZMDELINM Z.mays mRNA that delineates a novel subset of cortical cells
          Length = 594

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 53/57 (92%)
 Strand = Plus / Minus

                                                                    
Query: 310 gatgccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtc 366
           ||||||||||| ||||||| |||||||||||||||||||||  ||||||||||||||
Sbjct: 326 gatgccgaggacgttggccttgatggcggtgcagaggcacaatgcggcgtcgaggtc 270



to top

>dbj|AK102086.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033082M21, full
           insert sequence
          Length = 769

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 97/115 (84%), Gaps = 3/115 (2%)
 Strand = Plus / Minus

                                                                       
Query: 258 tcttgccgcactggttgaggaggagggtcaggtcgatggggacattgagcttgatg---c 314
           |||||||||| | |||||||| |||| | || |||| |||||  ||||| ||||||   |
Sbjct: 482 tcttgccgcagttgttgaggatgaggctgagatcgacggggatgttgaggttgatgatcc 423

                                                                  
Query: 315 cgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggc 369
           | || | ||||||| ||||||||||||||||||| ||||||||||||||||||||
Sbjct: 422 caagaacgttggccttgatggcggtgcagaggcagacggcggcgtcgaggtcggc 368



to top

>gb|AY104687.1| Zea mays PCO121733 mRNA sequence
          Length = 680

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 53/57 (92%)
 Strand = Plus / Minus

                                                                    
Query: 310 gatgccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtc 366
           ||||||||||| ||||||| |||||||||||||||||||||  ||||||||||||||
Sbjct: 388 gatgccgaggacgttggccttgatggcggtgcagaggcacaatgcggcgtcgaggtc 332



to top

>gb|AF001634.1|AF001634 Zea mays physical impedance induced protein (IIG1) mRNA, complete
           cds
          Length = 677

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 53/57 (92%)
 Strand = Plus / Minus

                                                                    
Query: 310 gatgccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtc 366
           ||||||||||| ||||||| |||||||||||||||||||||  ||||||||||||||
Sbjct: 401 gatgccgaggacgttggccttgatggcggtgcagaggcacaatgcggcgtcgaggtc 345



to top

>ref|XM_467171.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 757

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 105/127 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 ttcttgccgcactggttgaggaggagggtcaggtcgatggggacattgagcttgatgccg 316
           ||||||||||| | ||||| ||||||| | || | || |||||  | |||  ||||||||
Sbjct: 442 ttcttgccgcagtagttgacgaggaggctgagcttgacggggatgtcgagggtgatgccg 383

                                                                       
Query: 317 aggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccg 376
           || | ||||||| |||||||||||||||| || |||||||| || ||||||||||| |||
Sbjct: 382 agcacgttggccttgatggcggtgcagagacagacggcggcctcaaggtcggcgaggccg 323

                  
Query: 377 cctagga 383
           || ||||
Sbjct: 322 ccgagga 316



to top

>dbj|AK063037.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-110-D01, full
           insert sequence
          Length = 498

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 45/47 (95%)
 Strand = Plus / Minus

                                                          
Query: 418 cttgagcttcagcaggttcagcacgttggcgcacacgcccagcttca 464
           ||||||||| |||||||| ||||||||||||||||||||||||||||
Sbjct: 179 cttgagcttgagcaggttgagcacgttggcgcacacgcccagcttca 133



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 50/58 (86%)
 Strand = Plus / Minus

                                                                     
Query: 271 gttgaggaggagggtcaggtcgatggggacattgagcttgatgccgaggatgttggcc 328
           |||||||||||||   ||||||| |||||| ||||  ||||||||||||| |||||||
Sbjct: 236 gttgaggaggaggacgaggtcgacggggacgttgatgttgatgccgaggacgttggcc 179



to top

>dbj|AK058218.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-010-F04, full
           insert sequence
          Length = 757

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 105/127 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 ttcttgccgcactggttgaggaggagggtcaggtcgatggggacattgagcttgatgccg 316
           ||||||||||| | ||||| ||||||| | || | || |||||  | |||  ||||||||
Sbjct: 442 ttcttgccgcagtagttgacgaggaggctgagcttgacggggatgtcgagggtgatgccg 383

                                                                       
Query: 317 aggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgagcccg 376
           || | ||||||| |||||||||||||||| || |||||||| || ||||||||||| |||
Sbjct: 382 agcacgttggccttgatggcggtgcagagacagacggcggcctcaaggtcggcgaggccg 323

                  
Query: 377 cctagga 383
           || ||||
Sbjct: 322 ccgagga 316



to top

>ref|XM_473450.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 414

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 58/65 (89%)
 Strand = Plus / Minus

                                                                       
Query: 313 gccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 372
           |||||| | ||||||| ||||||| ||||||||||| |||||||| ||||||||||||||
Sbjct: 330 gccgagcacgttggccttgatggccgtgcagaggcagacggcggcctcgaggtcggcgag 271

                
Query: 373 cccgc 377
            ||||
Sbjct: 270 gccgc 266



to top

>gb|AY105236.1| Zea mays PCO121732 mRNA sequence
          Length = 763

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 85/101 (84%)
 Strand = Plus / Minus

                                                                       
Query: 301 attgagcttgatgccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtc 360
           |||||| | ||||||||||| ||||||| |||||||||||||||||||||  ||| | ||
Sbjct: 403 attgaggtggatgccgaggacgttggccttgatggcggtgcagaggcacagtgcgacatc 344

                                                    
Query: 361 gaggtcggcgagcccgcctaggagtgggcagcactgctcgt 401
           ||||||  | |||||  | || ||||||||||| |||||||
Sbjct: 343 gaggtccaccagcccctccagcagtgggcagcattgctcgt 303



to top

>ref|NM_185320.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 903

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 90/108 (83%)
 Strand = Plus / Minus

                                                                       
Query: 262 gccgcactggttgaggaggagggtcaggtcgatggggacattgagcttgatgccgaggat 321
           |||||| | ||||||||||||||  ||||||| |||||| | ||| |||| |||||| | 
Sbjct: 318 gccgcagtagttgaggaggagggagaggtcgacggggacgtcgaggttgaggccgagaag 259

                                                           
Query: 322 gttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggc 369
           ||||||  ||||||||  ||||| ||| ||||||||||| ||||||||
Sbjct: 258 gttggcgttgatggcgaggcagacgcagacggcggcgtccaggtcggc 211



to top

>gb|AF149815.1| Oryza sativa unknown gene
          Length = 1293

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 90/108 (83%)
 Strand = Plus / Minus

                                                                       
Query: 262 gccgcactggttgaggaggagggtcaggtcgatggggacattgagcttgatgccgaggat 321
           |||||| | ||||||||||||||  ||||||| |||||| | ||| |||| |||||| | 
Sbjct: 160 gccgcagtagttgaggaggagggagaggtcgacggggacgtcgaggttgaggccgagaag 101

                                                           
Query: 322 gttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggc 369
           ||||||  ||||||||  ||||| ||| ||||||||||| ||||||||
Sbjct: 100 gttggcgttgatggcgaggcagacgcagacggcggcgtccaggtcggc 53



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6,
              complete sequence
          Length = 30731886

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 90/108 (83%)
 Strand = Plus / Minus

                                                                          
Query: 262    gccgcactggttgaggaggagggtcaggtcgatggggacattgagcttgatgccgaggat 321
              |||||| | ||||||||||||||  ||||||| |||||| | ||| |||| |||||| | 
Sbjct: 343474 gccgcagtagttgaggaggagggagaggtcgacggggacgtcgaggttgaggccgagaag 343415

                                                              
Query: 322    gttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggc 369
              ||||||  ||||||||  ||||| ||| ||||||||||| ||||||||
Sbjct: 343414 gttggcgttgatggcgaggcagacgcagacggcggcgtccaggtcggc 343367



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                              
Query: 328      cctgatggcggtgcagaggcacacggcggc 357
                |||||||| |||||||||||||||||||||
Sbjct: 25844215 cctgatggtggtgcagaggcacacggcggc 25844186



to top

>dbj|AP001129.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0644B06
          Length = 194509

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 90/108 (83%)
 Strand = Plus / Minus

                                                                         
Query: 262   gccgcactggttgaggaggagggtcaggtcgatggggacattgagcttgatgccgaggat 321
             |||||| | ||||||||||||||  ||||||| |||||| | ||| |||| |||||| | 
Sbjct: 53427 gccgcagtagttgaggaggagggagaggtcgacggggacgtcgaggttgaggccgagaag 53368

                                                             
Query: 322   gttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggc 369
             ||||||  ||||||||  ||||| ||| ||||||||||| ||||||||
Sbjct: 53367 gttggcgttgatggcgaggcagacgcagacggcggcgtccaggtcggc 53320



to top

>gb|AY106116.1| Zea mays PCO091367 mRNA sequence
          Length = 842

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 77/91 (84%)
 Strand = Plus / Minus

                                                                       
Query: 261 tgccgcactggttgaggaggagggtcaggtcgatggggacattgagcttgatgccgagga 320
           ||||||| | ||||| ||||||| | |||| |||||| |  ||||| |||||||| ||||
Sbjct: 539 tgccgcagtagttgacgaggaggctgaggttgatgggcaggttgaggttgatgcccagga 480

                                          
Query: 321 tgttggccctgatggcggtgcagaggcacac 351
            ||||||||||| | ||||||||||||||||
Sbjct: 479 cgttggccctgaggacggtgcagaggcacac 449



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 433 gttcagcacgttggcgcacacgcccagcttca 464
           |||||||| |||||||||||||||||||||||
Sbjct: 364 gttcagcaagttggcgcacacgcccagcttca 333



to top

>ref|NM_195931.1| Oryza sativa (japonica cultivar-group) putative lipid tranfer
           protein (OSJNAb0078C13.15), mRNA
          Length = 381

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 36/37 (97%)
 Strand = Plus / Minus

                                                
Query: 335 gcggtgcagaggcacacggcggcgtcgaggtcggcga 371
           |||||||||||||| ||||||||||||||||||||||
Sbjct: 275 gcggtgcagaggcagacggcggcgtcgaggtcggcga 239



to top

>ref|XM_473863.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 465

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                            
Query: 323 ttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcga 371
           |||||| ||||||||||||||||||| |  |||||||||||||||||||
Sbjct: 368 ttggccttgatggcggtgcagaggcagagcgcggcgtcgaggtcggcga 320



to top

>ref|XM_473862.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 609

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                            
Query: 323 ttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcga 371
           |||||| ||||||||||||||||||| |  |||||||||||||||||||
Sbjct: 494 ttggccttgatggcggtgcagaggcagagcgcggcgtcgaggtcggcga 446



to top

>emb|AL731610.4|OSJN00255 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0070C17,
             complete sequence
          Length = 160484

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                              
Query: 323   ttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcga 371
             |||||| ||||||||||||||||||| |  |||||||||||||||||||
Sbjct: 78099 ttggccttgatggcggtgcagaggcagagcgcggcgtcgaggtcggcga 78051



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                              
Query: 323   ttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcga 371
             |||||| ||||||||||||||||||| |  |||||||||||||||||||
Sbjct: 67680 ttggccttgatggcggtgcagaggcagagcgcggcgtcgaggtcggcga 67632



to top

>gb|AC123594.1| Oryza sativa (japonica cultivar-group) chromosome 10 clone
             OSJNAb0078C13, complete sequence
          Length = 146538

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 36/37 (97%)
 Strand = Plus / Plus

                                                  
Query: 335   gcggtgcagaggcacacggcggcgtcgaggtcggcga 371
             |||||||||||||| ||||||||||||||||||||||
Sbjct: 89091 gcggtgcagaggcagacggcggcgtcgaggtcggcga 89127



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                     
Query: 437   agcacgttggcgcacacgcccagcttcaacgtgttgatcg 476
             ||||||||||||||||| | ||||||||| ||||||||||
Sbjct: 65020 agcacgttggcgcacactctcagcttcaaggtgttgatcg 65059



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                         
Query: 311   atgccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcg 370
             ||||| |||| ||||||| | | ||| ||||||||||| |||||||| ||||| ||||||
Sbjct: 68035 atgccaaggacgttggccttcacggcagtgcagaggcagacggcggcatcgagatcggcg 68094

              
Query: 371   a 371
             |
Sbjct: 68095 a 68095



 Score = 44.1 bits (22), Expect = 0.49
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                   
Query: 334   ggcggtgcagaggcacacggcggcgtcgaggtcggcga 371
             ||||||||||||||| ||||| |||||||  |||||||
Sbjct: 80134 ggcggtgcagaggcagacggcagcgtcgatatcggcga 80171



 Score = 44.1 bits (22), Expect = 0.49
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                               
Query: 338   gtgcagaggcacacggcggcgtcgaggtcggcga 371
             ||||||||||| ||||| |||||||| |||||||
Sbjct: 64921 gtgcagaggcagacggcagcgtcgagatcggcga 64954



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 437   agcacgttggcgcacacgcccagcttcaa 465
             ||||||||||||||||| | |||||||||
Sbjct: 80237 agcacgttggcgcacactctcagcttcaa 80265



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 437   agcacgttggcgcacacgcccagcttca 464
             ||||||||||||||||| | ||||||||
Sbjct: 72548 agcacgttggcgcacactctcagcttca 72575



to top

>dbj|AK062781.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-107-B03, full
           insert sequence
          Length = 713

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                            
Query: 323 ttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcga 371
           |||||| ||||||||||||||||||| |  |||||||||||||||||||
Sbjct: 228 ttggccttgatggcggtgcagaggcagagcgcggcgtcgaggtcggcga 180



to top

>dbj|AK062848.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-107-H12, full
           insert sequence
          Length = 662

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 36/37 (97%)
 Strand = Plus / Minus

                                                
Query: 335 gcggtgcagaggcacacggcggcgtcgaggtcggcga 371
           |||||||||||||| ||||||||||||||||||||||
Sbjct: 337 gcggtgcagaggcagacggcggcgtcgaggtcggcga 301



to top

>dbj|AK062295.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-100-F05, full
           insert sequence
          Length = 570

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                            
Query: 323 ttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcga 371
           |||||| ||||||||||||||||||| |  |||||||||||||||||||
Sbjct: 144 ttggccttgatggcggtgcagaggcagagcgcggcgtcgaggtcggcga 96



to top

>gb|AF369906.1| Sorghum bicolor clone BAC10J22 Sbb3766 sequence
          Length = 152439

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                         
Query: 386   gggcagcactgctcgttcgccggcacgccgatcttgagcttcagcaggttcagcacgttg 445
             ||||||||||||| ||||  |||||||  |||||||||||| ||||||  |||||||| |
Sbjct: 69209 gggcagcactgctggttctgcggcacgttgatcttgagcttgagcaggaccagcacgtcg 69150

                     
Query: 446   gcgcacac 453
             ||||||||
Sbjct: 69149 gcgcacac 69142



to top

>ref|NM_197670.1| Oryza sativa (japonica cultivar-group) putative lipid transfer
           protein (OSJNBa0015J15.17), mRNA
          Length = 489

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 55/63 (87%)
 Strand = Plus / Minus

                                                                       
Query: 338 gtgcagaggcacacggcggcgtcgaggtcggcgagcccgcctaggagtgggcagcactgc 397
           ||||||||||||||||||||||| | ||||||||| ||| | |||||   ||||||||||
Sbjct: 371 gtgcagaggcacacggcggcgtccacgtcggcgaggccggcgaggagcccgcagcactgc 312

              
Query: 398 tcg 400
           |||
Sbjct: 311 tcg 309



to top

>dbj|AK107851.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-134-A09, full
           insert sequence
          Length = 764

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 55/63 (87%)
 Strand = Plus / Minus

                                                                       
Query: 338 gtgcagaggcacacggcggcgtcgaggtcggcgagcccgcctaggagtgggcagcactgc 397
           ||||||||||||||||||||||| | ||||||||| ||| | |||||   ||||||||||
Sbjct: 450 gtgcagaggcacacggcggcgtccacgtcggcgaggccggcgaggagcccgcagcactgc 391

              
Query: 398 tcg 400
           |||
Sbjct: 390 tcg 388



to top

>gb|AY105149.1| Zea mays PCO087109 mRNA sequence
          Length = 966

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 313 gccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcga 362
           |||||||| ||||||| ||||||| ||||||||||| |||||||| ||||
Sbjct: 494 gccgaggacgttggccttgatggccgtgcagaggcagacggcggcctcga 445



to top

>ref|NM_195926.1| Oryza sativa (japonica cultivar-group) putative lipid transfer
           protein (OSJNAb0078C13.10), mRNA
          Length = 414

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 437 agcacgttggcgcacacgcccagcttcaacgtgttgatcg 476
           ||||||||||||||||| | ||||||||| ||||||||||
Sbjct: 209 agcacgttggcgcacactctcagcttcaaggtgttgatcg 170



 Score = 44.1 bits (22), Expect = 0.49
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 338 gtgcagaggcacacggcggcgtcgaggtcggcga 371
           ||||||||||| ||||| |||||||| |||||||
Sbjct: 308 gtgcagaggcagacggcagcgtcgagatcggcga 275



to top

>dbj|AP003523.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0416A11
          Length = 171519

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                            
Query: 328    cctgatggcggtgcagaggcacacggcggc 357
              |||||||| |||||||||||||||||||||
Sbjct: 126419 cctgatggtggtgcagaggcacacggcggc 126390



to top

>dbj|AK103715.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033137N14, full
           insert sequence
          Length = 1338

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 328 cctgatggcggtgcagaggcacacggcggc 357
           |||||||| |||||||||||||||||||||
Sbjct: 760 cctgatggtggtgcagaggcacacggcggc 731



to top

>gb|AF026382.1| Fragaria x ananassa HyPRP mRNA, complete cds
          Length = 798

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                       
Query: 308 ttgatgccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcg 367
           ||||||||||| ||| |||| |||||||| ||||||||||| || || || ||||| |||
Sbjct: 463 ttgatgccgagaatgctggctctgatggcagtgcagaggcatacagcagcttcgagatcg 404

             
Query: 368 gc 369
           ||
Sbjct: 403 gc 402



to top

>gb|AY530533.1| Fragaria x ananassa cultivar Chandler HyPRP gene, complete cds
          Length = 2071

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                        
Query: 308  ttgatgccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcg 367
            ||||||||||| ||| |||| |||||||| ||||||||||| || || || ||||| |||
Sbjct: 1294 ttgatgccgagaatgctggctctgatggcagtgcagaggcatacagcagcttcgagatcg 1235

              
Query: 368  gc 369
            ||
Sbjct: 1234 gc 1233



to top

>dbj|AB018588.1| Zea mays ZmGR1b mRNA, complete cds
          Length = 813

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 313 gccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcga 362
           |||||| | ||||||| ||||||| ||||||||||| |||||||| ||||
Sbjct: 361 gccgagcacgttggccttgatggccgtgcagaggcagacggcggcctcga 312



to top

>dbj|AB018587.1| Zea mays ZmGR1a mRNA, complete cds
          Length = 833

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 313 gccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcga 362
           |||||| | ||||||| ||||||| ||||||||||| |||||||| ||||
Sbjct: 364 gccgagcacgttggccttgatggccgtgcagaggcagacggcggcctcga 315



to top

>ref|NM_195927.1| Oryza sativa (japonica cultivar-group) putative lipid tranfer
           protein (OSJNAb0078C13.11), mRNA
          Length = 414

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 52/61 (85%)
 Strand = Plus / Minus

                                                                       
Query: 311 atgccgaggatgttggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcg 370
           ||||| |||| ||||||| | | ||| ||||||||||| |||||||| ||||| ||||||
Sbjct: 335 atgccaaggacgttggccttcacggcagtgcagaggcagacggcggcatcgagatcggcg 276

            
Query: 371 a 371
           |
Sbjct: 275 a 275



to top

>ref|XM_474092.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 783

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 323 ttggccctgatggcggtgcagaggcacacggcggcg 358
           |||||| |||||||||||||||||||  ||||||||
Sbjct: 692 ttggccttgatggcggtgcagaggcaggcggcggcg 657



to top

>ref|NM_185028.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 459

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 337 ggtgcagaggcacacggcggcgtcgaggtcggcgag 372
           |||||||||||| ||| |||||||||||||| ||||
Sbjct: 225 ggtgcagaggcagacgacggcgtcgaggtcgacgag 190



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 437 agcacgttggcgcacacgcccagcttca 464
           ||||||||||||||||| | ||||||||
Sbjct: 122 agcacgttggcgcacacacgcagcttca 95



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                            
Query: 437      agcacgttggcgcacacgcccagcttca 464
                ||||||||||||||||||| ||||||||
Sbjct: 24131165 agcacgttggcgcacacgcgcagcttca 24131138



to top

>gb|AC108906.9| Oryza sativa chromosome 3 BAC OSJNBa0087C10 genomic sequence, complete
              sequence
          Length = 144487

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                  
Query: 337    ggtgcagaggcacacggcggcgtcgaggtcggcgag 372
              |||||||||||| ||| |||||||||||||| ||||
Sbjct: 130486 ggtgcagaggcagacgacggcgtcgaggtcgacgag 130451



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 437    agcacgttggcgcacacgcccagcttca 464
              ||||||||||||||||| | ||||||||
Sbjct: 130383 agcacgttggcgcacacacgcagcttca 130356



to top

>gb|AC104321.7| Oryza sativa chromosome 3 BAC OSJNBa0052F07 genomic sequence,
            complete sequence
          Length = 139823

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                
Query: 337  ggtgcagaggcacacggcggcgtcgaggtcggcgag 372
            |||||||||||| ||| |||||||||||||| ||||
Sbjct: 9239 ggtgcagaggcagacgacggcgtcgaggtcgacgag 9204



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 437  agcacgttggcgcacacgcccagcttca 464
            ||||||||||||||||| | ||||||||
Sbjct: 9136 agcacgttggcgcacacacgcagcttca 9109



to top

>dbj|AP004557.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
             clone:P0028A08
          Length = 150818

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 437   agcacgttggcgcacacgcccagcttca 464
             ||||||||||||||||||| ||||||||
Sbjct: 84651 agcacgttggcgcacacgcgcagcttca 84624



to top

>dbj|AK108560.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-145-A10, full
           insert sequence
          Length = 719

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 437 agcacgttggcgcacacgcccagcttcaacgtgttgatcg 476
           ||||||||||||||||| |  |||||||| ||||||||||
Sbjct: 290 agcacgttggcgcacactctaagcttcaaggtgttgatcg 251



 Score = 44.1 bits (22), Expect = 0.49
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 338 gtgcagaggcacacggcggcgtcgaggtcggcga 371
           ||||||||||| ||||| |||||||| |||||||
Sbjct: 389 gtgcagaggcagacggcagcgtcgagatcggcga 356



to top

>dbj|AK105903.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-204-F11, full
           insert sequence
          Length = 1255

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 323 ttggccctgatggcggtgcagaggcacacggcggcg 358
           |||||| |||||||||||||||||||  ||||||||
Sbjct: 842 ttggccttgatggcggtgcagaggcaggcggcggcg 807



to top

>dbj|AK105778.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-202-F10, full
           insert sequence
          Length = 1242

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 323 ttggccctgatggcggtgcagaggcacacggcggcg 358
           |||||| |||||||||||||||||||  ||||||||
Sbjct: 842 ttggccttgatggcggtgcagaggcaggcggcggcg 807



to top

>dbj|AK104623.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-H11, full
           insert sequence
          Length = 1251

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 323 ttggccctgatggcggtgcagaggcacacggcggcg 358
           |||||| |||||||||||||||||||  ||||||||
Sbjct: 838 ttggccttgatggcggtgcagaggcaggcggcggcg 803



to top

>dbj|AK071989.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013094H13, full
           insert sequence
          Length = 1272

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 323 ttggccctgatggcggtgcagaggcacacggcggcg 358
           |||||| |||||||||||||||||||  ||||||||
Sbjct: 846 ttggccttgatggcggtgcagaggcaggcggcggcg 811



to top

>dbj|AK061322.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-302-F03, full
           insert sequence
          Length = 1257

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 323 ttggccctgatggcggtgcagaggcacacggcggcg 358
           |||||| |||||||||||||||||||  ||||||||
Sbjct: 844 ttggccttgatggcggtgcagaggcaggcggcggcg 809



to top

>emb|AL732331.2| Oryza sativa genomic DNA, chromosome 4, BAC clone: H0413E07, complete
             sequence
          Length = 76546

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                 
Query: 323   ttggccctgatggcggtgcagaggcacacggcggcg 358
             |||||| |||||||||||||||||||  ||||||||
Sbjct: 22462 ttggccttgatggcggtgcagaggcaggcggcggcg 22497



to top

>emb|AL606454.3|OSJN00009 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0033G05,
             complete sequence
          Length = 142556

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                 
Query: 323   ttggccctgatggcggtgcagaggcacacggcggcg 358
             |||||| |||||||||||||||||||  ||||||||
Sbjct: 89513 ttggccttgatggcggtgcagaggcaggcggcggcg 89548



to top

>dbj|AK034359.1| Mus musculus adult male diencephalon cDNA, RIKEN full-length
           enriched library, clone:9330182N22
           product:unclassifiable, full insert sequence
          Length = 2350

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 13  atgtatatccttttacaaatatg 35
           |||||||||||||||||||||||
Sbjct: 94  atgtatatccttttacaaatatg 116



to top

>gb|AC132394.3| Mus musculus BAC clone RP23-391F16 from chromosome 6, complete sequence
          Length = 197171

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 13     atgtatatccttttacaaatatg 35
              |||||||||||||||||||||||
Sbjct: 134465 atgtatatccttttacaaatatg 134443



to top

>ref|NM_195930.1| Oryza sativa (japonica cultivar-group) putative lipid tranfer
           protein (OSJNAb0078C13.14), mRNA
          Length = 393

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 334 ggcggtgcagaggcacacggcggcgtcgaggtcggcga 371
           ||||||||||||||| ||||| |||||||  |||||||
Sbjct: 291 ggcggtgcagaggcagacggcagcgtcgatatcggcga 254



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 437 agcacgttggcgcacacgcccagcttcaa 465
           ||||||||||||||||| | |||||||||
Sbjct: 188 agcacgttggcgcacactctcagcttcaa 160



to top

>gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome
          Length = 3402093

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 351     cggcggcgtcgaggtcggcgag 372
               ||||||||||||||||||||||
Sbjct: 2864055 cggcggcgtcgaggtcggcgag 2864034



to top

>gb|CP000319.1| Nitrobacter hamburgensis X14, complete genome
          Length = 4406967

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 351     cggcggcgtcgaggtcggcgag 372
               ||||||||||||||||||||||
Sbjct: 3593634 cggcggcgtcgaggtcggcgag 3593613



to top

>emb|BX569781.7| Zebrafish DNA sequence from clone DKEY-72L18 in linkage group 17,
              complete sequence
          Length = 170138

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 29     aaatatgcaaatcatgcatttagata 54
              |||||||||||| |||||||||||||
Sbjct: 131135 aaatatgcaaatgatgcatttagata 131160



to top

>gb|AE004524.1| Pseudomonas aeruginosa PAO1, section 85 of 529 of the complete genome
          Length = 11749

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 350  acggcggcgtcgaggtcggcga 371
            ||||||||||||||||||||||
Sbjct: 4416 acggcggcgtcgaggtcggcga 4395



to top

>emb|Z93108.1|MAZ93108 M.acuminata mRNA; clone pBAN UU70
          Length = 785

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                           
Query: 325 ggccctgatggcggtgcagaggcacacggcggcgtcgaggtcggcgag 372
           |||| |||| || | ||| |||||||||||||| ||||||||| ||||
Sbjct: 398 ggccntgatagcagngcaaaggcacacggcggcctcgaggtcgacgag 351



to top

>emb|BX255913.8| Zebrafish DNA sequence from clone DKEY-85N7 in linkage group 20, complete
              sequence
          Length = 248581

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 205    gattatgcatggatggatggat 226
              ||||||||||||||||||||||
Sbjct: 126598 gattatgcatggatggatggat 126577



to top

>gb|AF011922.1|AF011922 Pseudomonas aeruginosa aru gene cluster, ArgR regulatory protein
            (argR), succinylornithine aminotransferase (aruC),
            arginine/ornithine succinyltransferase AI subunit (aruF),
            arginine/ornithine succinyltransferase AII subunit
            (aruG), succinylglutamate 5-semialdehyde dehydrogenase
            (aruD), succinylarginine dihydrolase (aruB),
            succinylglutamate desuccinylase (aruE) genes, complete
            cds; and alanine tRNA synthetase (alaS) gene, partial cds
          Length = 12949

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 350  acggcggcgtcgaggtcggcga 371
            ||||||||||||||||||||||
Sbjct: 7794 acggcggcgtcgaggtcggcga 7773



to top

>gb|AC150432.2| Branchiostoma floridae clone CH302-9D15, complete sequence
          Length = 173785

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 26    tacaaatatgcaaatcatgca 46
             |||||||||||||||||||||
Sbjct: 30579 tacaaatatgcaaatcatgca 30559



to top

>gb|AC154761.2| Mus musculus BAC clone RP24-416E4 from chromosome 17, complete sequence
          Length = 169027

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 213   atggatggatggatcagatgg 233
             |||||||||||||||||||||
Sbjct: 40501 atggatggatggatcagatgg 40481



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 213   atggatggatggatcagatgg 233
             |||||||||||||||||||||
Sbjct: 40448 atggatggatggatcagatgg 40428



to top

>ref|XM_746730.1| Aspergillus fumigatus Af293 hypothetical protein (Afu4g10030) partial
            mRNA
          Length = 1251

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 276  ggaggagggtcaggtcgatgg 296
            |||||||||||||||||||||
Sbjct: 999  ggaggagggtcaggtcgatgg 1019



to top

>ref|XM_776757.1| PREDICTED: Strongylocentrotus purpuratus hypothetical protein
           LOC576450 (LOC576450), mRNA
          Length = 907

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 309 tgatgccgaggatgttggccc 329
           |||||||||||||||||||||
Sbjct: 115 tgatgccgaggatgttggccc 95



to top

>emb|AL939128.1|SCO939128 Streptomyces coelicolor A3(2) complete genome; segment 25/29
          Length = 296500

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 350    acggcggcgtcgaggtcggcg 370
              |||||||||||||||||||||
Sbjct: 131502 acggcggcgtcgaggtcggcg 131482



to top

>emb|AL627097.6| Mouse DNA sequence from clone RP23-59B16 on chromosome 11 Contains a
             novel pseudogene, the Zfp287 gene for zinc finger protein
             287, three novel genes (4921522H14Rik), a WD repeat and
             SOCS box containing protein 2 pseudogene (LOC213946), the
             gene for a novel protein (MGC39058) and the 5' end of the
             Trim16 gene for tripartite motif protein 16, complete
             sequence
          Length = 161686

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 451   cacgcccagcttcaacgtgtt 471
             |||||||||||||||||||||
Sbjct: 51091 cacgcccagcttcaacgtgtt 51111



to top

>emb|BX510349.5| Zebrafish DNA sequence from clone CH211-69E13 in linkage group 7,
             complete sequence
          Length = 152064

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 213   atggatggatggatcagatgg 233
             |||||||||||||||||||||
Sbjct: 42088 atggatggatggatcagatgg 42068



to top

>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome
          Length = 5331656

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 351     cggcggcgtcgaggtcggcga 371
               |||||||||||||||||||||
Sbjct: 4768255 cggcggcgtcgaggtcggcga 4768235



to top

>emb|BX324224.11| Zebrafish DNA sequence from clone CH211-168H21 in linkage group 13,
              complete sequence
          Length = 147168

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 206    attatgcatggatggatggat 226
              |||||||||||||||||||||
Sbjct: 127960 attatgcatggatggatggat 127940



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 206    attatgcatggatggatggat 226
              |||||||||||||||||||||
Sbjct: 126590 attatgcatggatggatggat 126570



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 209    atgcatggatggatggatca 228
              ||||||||||||||||||||
Sbjct: 126159 atgcatggatggatggatca 126140



to top

>emb|BX537260.8| Zebrafish DNA sequence from clone DKEY-234J21 in linkage group 1,
             complete sequence
          Length = 150038

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 89    aagcttatcaagcatgcatgcacaa 113
             |||||||| ||||||||||||||||
Sbjct: 36511 aagcttataaagcatgcatgcacaa 36487



to top

>emb|BX539325.9| Zebrafish DNA sequence from clone CH211-253B18 in linkage group 3,
              complete sequence
          Length = 183783

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 206    attatgcatggatggatggat 226
              |||||||||||||||||||||
Sbjct: 117575 attatgcatggatggatggat 117595



to top

>gb|AY105889.1| Zea mays PCO106909 mRNA sequence
          Length = 1420

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 330 tgatggcggtgcagaggcacacggc 354
           |||||| ||||||||||||||||||
Sbjct: 861 tgatggtggtgcagaggcacacggc 837



to top

>gb|AE000782.1| Archaeoglobus fulgidus DSM 4304, complete genome
          Length = 2178400

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 423     gcttcagcaggttcagcacgt 443
               |||||||||||||||||||||
Sbjct: 1711084 gcttcagcaggttcagcacgt 1711064



to top

>emb|BX284664.8| Zebrafish DNA sequence from clone DKEY-7I23 in linkage group 8,
             complete sequence
          Length = 228202

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 209   atgcatggatggatggatcagatgg 233
             ||||||||||||||||||| |||||
Sbjct: 32507 atgcatggatggatggatcggatgg 32483



to top

>gb|U73214.1|TAU73214 Triticum aestivum cold acclimation protein WCOR518 (Wcor518) mRNA,
           parial cds
          Length = 1168

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 330 tgatggcggtgcagaggcacacggcggcgtcgaggtc 366
           |||||| |||||||||||| |  ||||||||||||||
Sbjct: 845 tgatggtggtgcagaggcagagcgcggcgtcgaggtc 809



to top

>gb|AC102318.8| Mus musculus chromosome 7, clone RP24-447C20, complete sequence
          Length = 145005

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 207   ttatgcatggatggatggat 226
             ||||||||||||||||||||
Sbjct: 27463 ttatgcatggatggatggat 27444



to top

>gb|CP000148.1| Geobacter metallireducens GS-15, complete genome
          Length = 3997420

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 267     actggttgaggaggagggtc 286
               ||||||||||||||||||||
Sbjct: 3750512 actggttgaggaggagggtc 3750531



to top

>gb|CP000108.1| Chlorobium chlorochromatii CaD3, complete genome
          Length = 2572079

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 299    acattgagcttgatgccgaggatg 322
              ||||||||||||||||||| ||||
Sbjct: 185925 acattgagcttgatgccgatgatg 185902



to top

>ref|XM_483067.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1470

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 437 agcacgttggcgcacacgcccagc 460
           ||||||||||||||||||| ||||
Sbjct: 980 agcacgttggcgcacacgcgcagc 957



to top

>ref|NM_194119.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 369

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 351 cggcggcgtcgaggtcggcg 370
           ||||||||||||||||||||
Sbjct: 316 cggcggcgtcgaggtcggcg 297



to top

>gb|AC137922.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone
            OSJNBa0046A04, complete sequence
          Length = 141001

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 437  agcacgttggcgcacacgcccagcttca 464
            ||||||||||||||||| | ||||||||
Sbjct: 9329 agcacgttggcgcacacacgcagcttca 9356



to top

>gb|AC135558.6| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBa0007C02, complete sequence
          Length = 148265

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 437   agcacgttggcgcacacgcccagcttca 464
             ||||||||||||||||| | ||||||||
Sbjct: 87287 agcacgttggcgcacacacgcagcttca 87260



to top

>gb|AC102152.12| Mus musculus chromosome 7, clone RP23-314H9, complete sequence
          Length = 206923

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 207  ttatgcatggatggatggat 226
            ||||||||||||||||||||
Sbjct: 7668 ttatgcatggatggatggat 7687



to top

>gb|AE017283.1| Propionibacterium acnes KPA171202, complete genome
          Length = 2560265

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 481     gctgcccctgccggtcgacg 500
               ||||||||||||||||||||
Sbjct: 2541669 gctgcccctgccggtcgacg 2541688



to top

>gb|AC146277.2| Pan troglodytes BAC clone CH251-17J20 from X, complete sequence
          Length = 160219

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 23    ttttacaaatatgcaaatca 42
             ||||||||||||||||||||
Sbjct: 79965 ttttacaaatatgcaaatca 79946



to top

>gb|AC146276.2| Pan troglodytes BAC clone CH251-149B14 from X, complete sequence
          Length = 180335

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 23     ttttacaaatatgcaaatca 42
              ||||||||||||||||||||
Sbjct: 118176 ttttacaaatatgcaaatca 118195



to top

>gb|AC127690.4| Mus musculus BAC clone RP24-215A3 from chromosome 17, complete sequence
          Length = 187751

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 162    acatacatatggtgcgtgtgtatg 185
              |||||||||||||| |||||||||
Sbjct: 176440 acatacatatggtgtgtgtgtatg 176417



to top

>gb|AC129326.3| Mus musculus BAC clone RP23-326H12 from chromosome 19, complete
             sequence
          Length = 184128

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 17    atatccttttacaaatatgcaaat 40
             |||| |||||||||||||||||||
Sbjct: 31462 atatacttttacaaatatgcaaat 31439



to top

>gb|AC116451.7| Mus musculus chromosome 19, clone RP24-273P9, complete sequence
          Length = 218079

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 17     atatccttttacaaatatgcaaat 40
              |||| |||||||||||||||||||
Sbjct: 130669 atatacttttacaaatatgcaaat 130646



to top

>gb|AC147428.6| Medicago truncatula clone mth2-34i10, complete sequence
          Length = 112873

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 207   ttatgcatggatggatggat 226
             ||||||||||||||||||||
Sbjct: 75308 ttatgcatggatggatggat 75327



to top

>emb|Z70689.2|HSU19D8 Human DNA sequence from clone LL0XNC01-19D8 on chromosome X Contains
             the 5' end of the NXF2 gene for nuclear RNA export factor
             2, complete sequence
          Length = 33884

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 23    ttttacaaatatgcaaatca 42
             ||||||||||||||||||||
Sbjct: 16771 ttttacaaatatgcaaatca 16790



to top

>emb|AL590069.5| Human DNA sequence from clone RP11-353J17 on chromosome X, complete
              sequence
          Length = 158828

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 23     ttttacaaatatgcaaatca 42
              ||||||||||||||||||||
Sbjct: 139818 ttttacaaatatgcaaatca 139837



to top

>emb|CR391991.7| Zebrafish DNA sequence from clone DKEY-150E11 in linkage group 2,
            complete sequence
          Length = 188653

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 209  atgcatggatggatggatca 228
            ||||||||||||||||||||
Sbjct: 4625 atgcatggatggatggatca 4606



to top

>emb|CR555306.1| Azoarcus sp. EbN1 complete genome
          Length = 4296230

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 357   cgtcgaggtcggcgagcccg 376
             ||||||||||||||||||||
Sbjct: 31381 cgtcgaggtcggcgagcccg 31400



to top

>emb|CR456683.7| Zebrafish DNA sequence from clone CH211-39I13 in linkage group 13,
             complete sequence
          Length = 166196

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 209   atgcatggatggatggatca 228
             ||||||||||||||||||||
Sbjct: 35927 atgcatggatggatggatca 35946



to top

>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome
          Length = 5513844

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 349    cacggcggcgtcgaggtcggcgag 372
              ||||||||||||||| ||||||||
Sbjct: 164966 cacggcggcgtcgagatcggcgag 164989



to top

>emb|BX890614.10| Zebrafish DNA sequence from clone DKEY-46N5, complete sequence
          Length = 115990

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 209   atgcatggatggatggatca 228
             ||||||||||||||||||||
Sbjct: 42466 atgcatggatggatggatca 42447



to top

>emb|BX927071.12| Zebrafish DNA sequence from clone DKEY-286O23 in linkage group 18,
            complete sequence
          Length = 143863

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 207  ttatgcatggatggatggat 226
            ||||||||||||||||||||
Sbjct: 4184 ttatgcatggatggatggat 4165



to top

>gb|AC108043.3| Homo sapiens BAC clone RP11-270L13 from 4, complete sequence
          Length = 138020

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 334   ggcggtgcagaggcacacggcggc 357
             |||||||||||||| |||||||||
Sbjct: 45282 ggcggtgcagaggcccacggcggc 45305



to top

>emb|AL928929.11| Zebrafish DNA sequence from clone CH211-218M9 in linkage group 20,
             complete sequence
          Length = 134154

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 25    ttacaaatatgcaaatcatgcatt 48
             |||||||||| |||||||||||||
Sbjct: 60608 ttacaaatatacaaatcatgcatt 60585



to top

>gb|AY168646.1| Deltfia acidovorans tdn operon, partial sequence and unknown gene
          Length = 5622

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 232  ggggcaggtgaagttggcgg 251
            ||||||||||||||||||||
Sbjct: 4615 ggggcaggtgaagttggcgg 4596



to top

>emb|BX247877.13| Zebrafish DNA sequence from clone DKEY-16J24, complete sequence
          Length = 189537

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 207    ttatgcatggatggatggat 226
              ||||||||||||||||||||
Sbjct: 136322 ttatgcatggatggatggat 136303



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                            
Query: 437      agcacgttggcgcacacgcccagcttca 464
                ||||||||||||||||| | ||||||||
Sbjct: 11807598 agcacgttggcgcacacacgcagcttca 11807625



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7,
              complete sequence
          Length = 29644043

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 351    cggcggcgtcgaggtcggcg 370
              ||||||||||||||||||||
Sbjct: 718853 cggcggcgtcgaggtcggcg 718872



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 400      gttcgccggcacgccgatct 419
                ||||||||||||||||||||
Sbjct: 31718707 gttcgccggcacgccgatct 31718726



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                            
Query: 437      agcacgttggcgcacacgcccagcttca 464
                ||||||||||||||||| | ||||||||
Sbjct: 30578509 agcacgttggcgcacacacgcagcttca 30578536



to top

>dbj|AP003268.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0503C12
          Length = 147180

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 400    gttcgccggcacgccgatct 419
              ||||||||||||||||||||
Sbjct: 132439 gttcgccggcacgccgatct 132458



to top

>dbj|AP003309.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:OSJNBb0036G09
          Length = 124118

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 437   agcacgttggcgcacacgcccagcttca 464
             ||||||||||||||||| | ||||||||
Sbjct: 61113 agcacgttggcgcacacacgcagcttca 61140



to top

>dbj|AP003560.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:B1060H01
          Length = 157987

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 437   agcacgttggcgcacacgcccagcttca 464
             ||||||||||||||||| | ||||||||
Sbjct: 20786 agcacgttggcgcacacacgcagcttca 20813



to top

>dbj|AB177545.1| Delftia acidovorans ORF7NA, ORF7NB, ORF7NC, ORF7ND, ORF7NE, ORF7NF,
            ORF7NG, ORF7NH genes for glutamine synthetase, glutamine
            amidotransferase, large subunit of aniline dioxygenase,
            small subunit of aniline dioxygenase, reductase,
            LysR-type regulatory gene, small ferredoxin-like protein,
            catechol 2,3-dioxygenase, complete cds
          Length = 8039

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 232  ggggcaggtgaagttggcgg 251
            ||||||||||||||||||||
Sbjct: 2841 ggggcaggtgaagttggcgg 2822



to top

>gb|AF235504.1|AF235504 Streptomyces hygroscopicus var. ascomyceticus FK520 biosynthetic gene
             cluster, partial sequence
          Length = 77534

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 347   cacacggcggcgtcgaggtcggcg 370
             |||||||||||||||| |||||||
Sbjct: 36322 cacacggcggcgtcgaagtcggcg 36345



to top

>gb|AF263912.1|AF263912 Streptomyces noursei ATCC 11455 nystatin biosynthetic gene cluster,
             complete sequence
          Length = 123580

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 351   cggcggcgtcgaggtcggcgagcc 374
             |||||||||||||| |||||||||
Sbjct: 81371 cggcggcgtcgaggccggcgagcc 81348



to top

>dbj|AP003874.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1118_G09
          Length = 115815

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 351   cggcggcgtcgaggtcggcg 370
             ||||||||||||||||||||
Sbjct: 57384 cggcggcgtcgaggtcggcg 57403



to top

>dbj|BA000045.2| Gloeobacter violaceus PCC 7421 DNA, complete genome
          Length = 4659019

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 350     acggcggcgtcgaggtcggcgagc 373
               ||||||||||||||||||| ||||
Sbjct: 3603602 acggcggcgtcgaggtcggagagc 3603579



to top

>emb|AL935272.17| Zebrafish DNA sequence from clone CH211-266K22, complete sequence
          Length = 145553

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 209   atgcatggatggatggatca 228
             ||||||||||||||||||||
Sbjct: 20475 atgcatggatggatggatca 20456



to top

>dbj|AP005244.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1513_F02
          Length = 126845

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 351   cggcggcgtcgaggtcggcg 370
             ||||||||||||||||||||
Sbjct: 38660 cggcggcgtcgaggtcggcg 38679



to top

>emb|CR356233.12| Zebrafish DNA sequence from clone CH211-262N1, complete sequence
          Length = 146900

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 213    atggatggatggatcagatg 232
              ||||||||||||||||||||
Sbjct: 101574 atggatggatggatcagatg 101555



to top

>emb|BX936328.7| Zebrafish DNA sequence from clone CH211-11F20 in linkage group 18,
             complete sequence
          Length = 113038

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 207   ttatgcatggatggatggat 226
             ||||||||||||||||||||
Sbjct: 84068 ttatgcatggatggatggat 84049



to top

>emb|CT025920.8| Zebrafish DNA sequence from clone CH73-64P10 in linkage group 18,
             complete sequence
          Length = 90660

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 207   ttatgcatggatggatggat 226
             ||||||||||||||||||||
Sbjct: 16844 ttatgcatggatggatggat 16825



to top

>dbj|AP003503.2| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-86D13, complete
            sequence
          Length = 175454

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 165  tacatatggtgcgtgtgtat 184
            ||||||||||||||||||||
Sbjct: 4252 tacatatggtgcgtgtgtat 4271



to top

>dbj|AP003462.2| Homo sapiens genomic DNA, chromosome 11q clone:RP11-480C22, complete
              sequences
          Length = 190032

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 165    tacatatggtgcgtgtgtat 184
              ||||||||||||||||||||
Sbjct: 163846 tacatatggtgcgtgtgtat 163865



to top

>gb|U34333.1|PVU34333 Phaseolus vulgaris proline-rich 14 kDa protein mRNA, complete cds
          Length = 677

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 292 gatggggacattgagcttgatgcc 315
           ||||||||||||||| ||||||||
Sbjct: 337 gatggggacattgaggttgatgcc 314



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                            
Query: 437      agcacgttggcgcacacgcccagcttca 464
                ||||||||||||||||| | ||||||||
Sbjct: 11886009 agcacgttggcgcacacacgcagcttca 11886036



to top

>emb|BX890608.15| Zebrafish DNA sequence from clone CH211-195J11 in linkage group 2,
              complete sequence
          Length = 194388

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 209    atgcatggatggatggatca 228
              ||||||||||||||||||||
Sbjct: 107889 atgcatggatggatggatca 107870



to top

>emb|BX000530.10| Mouse DNA sequence from clone RP24-500B8 on chromosome 2, complete
             sequence
          Length = 45884

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 87    acaagcttatcaagcatgcatgca 110
             |||||| |||||||||||||||||
Sbjct: 13671 acaagcatatcaagcatgcatgca 13648



to top

>gb|AY504541.1| Macroderma gigas isolate Rnew NADH dehydrogenase subunit 2 (ND2)
           gene, complete cds; mitochondrial
          Length = 1044

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 273 tgaggaggagggtcaggtcgatgg 296
           |||||||||||||||||| |||||
Sbjct: 466 tgaggaggagggtcaggttgatgg 443


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,821,327
Number of Sequences: 3902068
Number of extensions: 4821327
Number of successful extensions: 335532
Number of sequences better than 10.0: 164
Number of HSP's better than 10.0 without gapping: 172
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 332321
Number of HSP's gapped (non-prelim): 3189
length of query: 568
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 545
effective length of database: 17,143,297,704
effective search space: 9343097248680
effective search space used: 9343097248680
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top