| Clone Name | rbasd11l03 |
|---|---|
| Clone Library Name | barley_pub |
| No. | Definition | Score (bits) |
E Value |
1 | emb|AL117259.6|CNS01DRJ Human chromosome 14 DNA sequence BAC R-3... | 42 | 0.73 | 2 | emb|AL132708.3|CNS01DTA Human chromosome 14 DNA sequence BAC R-3... | 42 | 0.73 | 3 | gb|K02212.1|HUMA1ATP Human alpha-1-antitrypsin gene (S variant),... | 42 | 0.73 | 4 | emb|BX928749.12| Zebrafish DNA sequence from clone CH211-201A8 i... | 40 | 2.9 |
|---|
>emb|AL117259.6|CNS01DRJ Human chromosome 14 DNA sequence BAC R-304M6 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 193301 Score = 42.1 bits (21), Expect = 0.73 Identities = 21/21 (100%) Strand = Plus / Plus Query: 128 ccctggggatgttacaggctg 148 ||||||||||||||||||||| Sbjct: 10633 ccctggggatgttacaggctg 10653
>emb|AL132708.3|CNS01DTA Human chromosome 14 DNA sequence BAC R-349I1 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 147505 Score = 42.1 bits (21), Expect = 0.73 Identities = 21/21 (100%) Strand = Plus / Plus Query: 128 ccctggggatgttacaggctg 148 ||||||||||||||||||||| Sbjct: 136724 ccctggggatgttacaggctg 136744
>gb|K02212.1|HUMA1ATP Human alpha-1-antitrypsin gene (S variant), complete cds Length = 12222 Score = 42.1 bits (21), Expect = 0.73 Identities = 21/21 (100%) Strand = Plus / Plus Query: 128 ccctggggatgttacaggctg 148 ||||||||||||||||||||| Sbjct: 10621 ccctggggatgttacaggctg 10641
>emb|BX928749.12| Zebrafish DNA sequence from clone CH211-201A8 in linkage group 2, complete sequence Length = 215263 Score = 40.1 bits (20), Expect = 2.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 85 agacgctcagagcagaagac 104 |||||||||||||||||||| Sbjct: 16029 agacgctcagagcagaagac 16048 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 899,896 Number of Sequences: 3902068 Number of extensions: 899896 Number of successful extensions: 50113 Number of sequences better than 10.0: 4 Number of HSP's better than 10.0 without gapping: 4 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 50109 Number of HSP's gapped (non-prelim): 4 length of query: 227 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 205 effective length of database: 17,147,199,772 effective search space: 3515175953260 effective search space used: 3515175953260 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)