ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | bags8g14 |
|---|---|
| Clone Library Name | barley_pub |
>gb|BT016492.1| Zea mays clone Contig325 mRNA sequence Length = 1365 Score = 400 bits (202), Expect = e-108 Identities = 351/401 (87%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgcttttggctcgtcgtgtgctcaagtcc 80 ||||||||||| || |||||||||||||| || || |||||||| |||||||||||| || Sbjct: 339 accaactatgcagctgcctactgcactggccttctgttggctcgccgtgtgctcaagacc 398 Query: 81 cgtgatctggatgaggagtatgaaggcaatgttgaggccactggtgaggacttctctgtt 140 |||| | | ||| |||| ||||| |||||||||||||||||||||||||||||||||||| Sbjct: 399 cgtggtttagataaggaatatgagggcaatgttgaggccactggtgaggacttctctgtt 458 Query: 141 gagcctgctgatgagaggaggcctttccgtgcgctcttggatgttggtcttatcaggact 200 ||||| |||||||||||||||||||||||||| |||||||||||||| ||||| |||||| Sbjct: 459 gagccagctgatgagaggaggcctttccgtgctctcttggatgttggccttattaggact 518 Query: 201 acgactggaaaccntgtgtttggtgcacttaagggagctttggacggtggtctggacatt 260 || ||||| |||| ||| |||||||| || |||||||||||||| ||||| ||||| ||| Sbjct: 519 acaactgggaaccgtgtctttggtgccctcaagggagctttggatggtggcctggatatt 578 Query: 261 ccccacagtgacaagagatttgctggtttcaagaaggacgagaagtctctggatgctgag 320 || ||||| || ||||| |||||||||||||||||||| || ||| ||||||||||| Sbjct: 579 cctcacagcgagaagaggtttgctggtttcaagaaggatgacaagcagctggatgctgat 638 Query: 321 attcaccgcaagtacatctatggagggcatgttgctgactacatgaggtcgctagcagat 380 || || ||||||||||||||||| || ||||||||||||||||||||| || || || Sbjct: 639 atccatcgcaagtacatctatggtggccatgttgctgactacatgaggaacctcgctgaa 698 Query: 381 gaggaacccgagaagtaccaaactcacttcagtgagtacat 421 ||||| || ||||||||||| ||||||||||||||||||| Sbjct: 699 gaggagccagagaagtaccagtctcacttcagtgagtacat 739
>gb|AY109375.1| Zea mays CL457_2 mRNA sequence Length = 1397 Score = 392 bits (198), Expect = e-106 Identities = 350/401 (87%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgcttttggctcgtcgtgtgctcaagtcc 80 ||||||||||| || |||||||||||||| || || |||||||| |||||||||||| || Sbjct: 355 accaactatgcagctgcctactgcactggccttctgttggctcgccgtgtgctcaagacc 414 Query: 81 cgtgatctggatgaggagtatgaaggcaatgttgaggccactggtgaggacttctctgtt 140 |||| | | ||| |||| ||||| |||||||||||||||||||||||||| ||||||||| Sbjct: 415 cgtggtttagataaggaatatgagggcaatgttgaggccactggtgaggatttctctgtt 474 Query: 141 gagcctgctgatgagaggaggcctttccgtgcgctcttggatgttggtcttatcaggact 200 ||||| |||||||||||||||||||||||||| |||||||||||||| ||||| |||||| Sbjct: 475 gagccagctgatgagaggaggcctttccgtgctctcttggatgttggccttattaggact 534 Query: 201 acgactggaaaccntgtgtttggtgcacttaagggagctttggacggtggtctggacatt 260 || ||||| |||| ||| |||||||| || |||||||||||||| ||||| ||||| ||| Sbjct: 535 acaactgggaaccgtgtctttggtgccctcaagggagctttggatggtggcctggatatt 594 Query: 261 ccccacagtgacaagagatttgctggtttcaagaaggacgagaagtctctggatgctgag 320 || ||||| || ||||| |||||||||||||||||||| || ||| ||||||||||| Sbjct: 595 cctcacagcgagaagaggtttgctggtttcaagaaggatgacaagcagctggatgctgat 654 Query: 321 attcaccgcaagtacatctatggagggcatgttgctgactacatgaggtcgctagcagat 380 || || ||||||||||||||||| || ||||||||||||||||||||| || || || Sbjct: 655 atccatcgcaagtacatctatggtggccatgttgctgactacatgaggaacctcgctgaa 714 Query: 381 gaggaacccgagaagtaccaaactcacttcagtgagtacat 421 ||||| || ||||||||||| ||||||||||||||||||| Sbjct: 715 gaggagccagagaagtaccagtctcacttcagtgagtacat 755
>gb|AY106024.1| Zea mays PCO063168 mRNA sequence Length = 620 Score = 383 bits (193), Expect = e-103 Identities = 351/404 (86%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgcttttggctcgtcgtgtgctcaagtcc 80 |||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| | Sbjct: 178 accaactatgctgcagcctactgcactggtcttcttttggctcgtcgtgttctcaagatc 237 Query: 81 cgtgatctggatgaggagtatgaaggcaatgttgaggccactggtgaggacttctctgtt 140 |||||| ||||| |||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 238 cgtgatttggatcaggagtatgagggcaatgttgaggccactggtgaggacttctctgtc 297 Query: 141 gagcctgctgatgagaggaggcctttccgtgcgctcttggatgttggtcttatcaggact 200 ||||| || || |||||||||||||||||||| ||||| ||||| || ||||| |||||| Sbjct: 298 gagccagcggaagagaggaggcctttccgtgccctcttagatgtcggccttattaggact 357 Query: 201 acgactggaaaccntgtgtttggtgcacttaagggagctttggacggtggtctggacatt 260 || |||||||||| ||| |||||||| || |||||||||||||| |||||||| || ||| Sbjct: 358 actactggaaaccgtgtctttggtgccctcaagggagctttggatggtggtctagatatt 417 Query: 261 ccccacagtgacaagagatttgctggtttcaagaaggacgagaagtctctggatgctgag 320 || ||||| || ||||| |||||||| ||||||||||| || ||| ||||||||||| Sbjct: 418 cctcacagcgataagaggtttgctggcttcaagaaggatgataagcagctggatgctgat 477 Query: 321 attcaccgcaagtacatctatggagggcatgttgctgactacatgaggtcgctagcagat 380 || || ||||||||||||||||| ||||||||||| || |||| | || || ||| Sbjct: 478 atccatcgcaagtacatctatggtctccatgttgctgagtatatgaagaatctggctgat 537 Query: 381 gaggaacccgagaagtaccaaactcacttcagtgagtacatcaa 424 ||||| |||||||||||||| |||||||||| ||||||||||| Sbjct: 538 gaggagcccgagaagtaccaggctcacttcagcgagtacatcaa 581
>ref|NM_190269.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 915 Score = 359 bits (181), Expect = 5e-96 Identities = 364/424 (85%), Gaps = 1/424 (0%) Strand = Plus / Plus Query: 1 tggtcttgacgttgttactcaccaactatgctgcagcctactgcactggtctgcttttgg 60 ||||||||| |||| | |||||||||||||| ||||| ||||||||||| ||||| ||| Sbjct: 261 tggtcttgaagttggt-ctcaccaactatgcggcagcttactgcactggcttgcttctgg 319 Query: 61 ctcgtcgtgtgctcaagtcccgtgatctggatgaggagtatgaaggcaatgttgaggcca 120 ||||||||||||||| | ||||| | |||| ||||||| || |||||||||||||||| Sbjct: 320 ctcgtcgtgtgctcacgctccgtggtttggaccaggagtacgagggcaatgttgaggcca 379 Query: 121 ctggtgaggacttctctgttgagcctgctgatgagaggaggcctttccgtgcgctcttgg 180 |||| ||||||| || |||||| || |||||||| ||||||||||||||||| ||||||| Sbjct: 380 ctggggaggactactatgttgaaccagctgatgaaaggaggcctttccgtgctctcttgg 439 Query: 181 atgttggtcttatcaggactacgactggaaaccntgtgtttggtgcacttaagggagctt 240 ||||||| || || ||||| || |||||||||| ||| |||||||| || |||||||||| Sbjct: 440 atgttggcctcattaggacaaccactggaaaccgtgtctttggtgccctcaagggagctt 499 Query: 241 tggacggtggtctggacattccccacagtgacaagagatttgctggtttcaagaaggacg 300 |||| |||||||| |||||||| |||||||||||||| |||||||| ||||||||||||| Sbjct: 500 tggatggtggtcttgacattcctcacagtgacaagaggtttgctgggttcaagaaggacg 559 Query: 301 agaagtctctggatgctgagattcaccgcaagtacatctatggagggcatgttgctgact 360 ||||| || ||| |||| |||||||||||||||||||| || ||||| || ||||||| Sbjct: 560 agaagcagcttgattctgatattcaccgcaagtacatctacggtgggcacgtggctgact 619 Query: 361 acatgaggtcgctagcagatgaggaacccgagaagtaccaaactcacttcagtgagtaca 420 |||||||||| | || || |||||||| ||||| | |||| | ||||| ||||||||| Sbjct: 620 acatgaggtctatggctgaggaggaacctgagaaattccaagcccactttagtgagtacc 679 Query: 421 tcaa 424 |||| Sbjct: 680 tcaa 683
>ref|NM_190270.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 906 Score = 351 bits (177), Expect = 1e-93 Identities = 363/424 (85%), Gaps = 1/424 (0%) Strand = Plus / Plus Query: 1 tggtcttgacgttgttactcaccaactatgctgcagcctactgcactggtctgcttttgg 60 ||||||||| |||| | |||||||||||||| ||||| || |||||||| ||||||||| Sbjct: 252 tggtcttgaagttggt-ctcaccaactatgcggcagcttattgcactggcttgcttttgg 310 Query: 61 ctcgtcgtgtgctcaagtcccgtgatctggatgaggagtatgaaggcaatgttgaggcca 120 |||| |||||||||||| ||||| | |||| ||||||| || |||||| ||||||||| Sbjct: 311 ctcgccgtgtgctcaagctccgtggtttggaccaggagtacgagggcaatattgaggcca 370 Query: 121 ctggtgaggacttctctgttgagcctgctgatgagaggaggcctttccgtgcgctcttgg 180 |||| ||||||| || |||||| || |||||||| ||| ||||||||||||| ||||||| Sbjct: 371 ctggggaggactactatgttgaaccagctgatgaaaggcggcctttccgtgctctcttgg 430 Query: 181 atgttggtcttatcaggactacgactggaaaccntgtgtttggtgcacttaagggagctt 240 ||||||| || || ||||| || |||||||||| ||| |||||||| || |||||||||| Sbjct: 431 atgttggcctcattaggacaaccactggaaaccgtgtctttggtgccctcaagggagctt 490 Query: 241 tggacggtggtctggacattccccacagtgacaagagatttgctggtttcaagaaggacg 300 |||| |||||||| |||||||| |||||||||||||| |||||||| ||||||||||||| Sbjct: 491 tggatggtggtcttgacattcctcacagtgacaagaggtttgctgggttcaagaaggacg 550 Query: 301 agaagtctctggatgctgagattcaccgcaagtacatctatggagggcatgttgctgact 360 ||||| || ||| |||| |||||||||||||||||||| || ||||| || ||||||| Sbjct: 551 agaagcagcttgattctgatattcaccgcaagtacatctacggtgggcacgtggctgact 610 Query: 361 acatgaggtcgctagcagatgaggaacccgagaagtaccaaactcacttcagtgagtaca 420 |||||||||| | || || |||||||| ||||| | |||| | ||||||||||||||| Sbjct: 611 acatgaggtctatggcggaggaggaacctgagaaattccaagcccacttcagtgagtacc 670 Query: 421 tcaa 424 |||| Sbjct: 671 tcaa 674
>emb|X64622.1|OS5SRRNMR O.sativa Rrl5 mRNA for 5S ribosomal RNA Length = 1114 Score = 351 bits (177), Expect = 1e-93 Identities = 363/424 (85%), Gaps = 1/424 (0%) Strand = Plus / Plus Query: 1 tggtcttgacgttgttactcaccaactatgctgcagcctactgcactggtctgcttttgg 60 ||||||||| |||| | |||||||||||||| ||||| || |||||||| ||||||||| Sbjct: 261 tggtcttgaagttggt-ctcaccaactatgcggcagcttattgcactggcttgcttttgg 319 Query: 61 ctcgtcgtgtgctcaagtcccgtgatctggatgaggagtatgaaggcaatgttgaggcca 120 |||| |||||||||||| ||||| | |||| ||||||| || |||||| ||||||||| Sbjct: 320 ctcgccgtgtgctcaagctccgtggtttggaccaggagtacgagggcaatattgaggcca 379 Query: 121 ctggtgaggacttctctgttgagcctgctgatgagaggaggcctttccgtgcgctcttgg 180 |||| ||||||| || |||||| || |||||||| ||| ||||||||||||| ||||||| Sbjct: 380 ctggggaggactactatgttgaaccagctgatgaaaggcggcctttccgtgctctcttgg 439 Query: 181 atgttggtcttatcaggactacgactggaaaccntgtgtttggtgcacttaagggagctt 240 ||||||| || || ||||| || |||||||||| ||| |||||||| || |||||||||| Sbjct: 440 atgttggcctcattaggacaaccactggaaaccgtgtctttggtgccctcaagggagctt 499 Query: 241 tggacggtggtctggacattccccacagtgacaagagatttgctggtttcaagaaggacg 300 |||| |||||||| |||||||| |||||||||||||| |||||||| ||||||||||||| Sbjct: 500 tggatggtggtcttgacattcctcacagtgacaagaggtttgctgggttcaagaaggacg 559 Query: 301 agaagtctctggatgctgagattcaccgcaagtacatctatggagggcatgttgctgact 360 ||||| || ||| |||| |||||||||||||||||||| || ||||| || ||||||| Sbjct: 560 agaagcagcttgattctgatattcaccgcaagtacatctacggtgggcacgtggctgact 619 Query: 361 acatgaggtcgctagcagatgaggaacccgagaagtaccaaactcacttcagtgagtaca 420 |||||||||| | || || |||||||| ||||| | |||| | ||||||||||||||| Sbjct: 620 acatgaggtctatggcggaggaggaacctgagaaattccaagcccacttcagtgagtacc 679 Query: 421 tcaa 424 |||| Sbjct: 680 tcaa 683
>dbj|AK104693.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-036-H05, full insert sequence Length = 1219 Score = 351 bits (177), Expect = 1e-93 Identities = 363/424 (85%), Gaps = 1/424 (0%) Strand = Plus / Plus Query: 1 tggtcttgacgttgttactcaccaactatgctgcagcctactgcactggtctgcttttgg 60 ||||||||| |||| | |||||||||||||| ||||| || |||||||| ||||||||| Sbjct: 348 tggtcttgaagttggt-ctcaccaactatgcggcagcttattgcactggcttgcttttgg 406 Query: 61 ctcgtcgtgtgctcaagtcccgtgatctggatgaggagtatgaaggcaatgttgaggcca 120 |||| |||||||||||| ||||| | |||| ||||||| || |||||| ||||||||| Sbjct: 407 ctcgccgtgtgctcaagctccgtggtttggaccaggagtacgagggcaatattgaggcca 466 Query: 121 ctggtgaggacttctctgttgagcctgctgatgagaggaggcctttccgtgcgctcttgg 180 |||| ||||||| || |||||| || |||||||| ||| ||||||||||||| ||||||| Sbjct: 467 ctggggaggactactatgttgaaccagctgatgaaaggcggcctttccgtgctctcttgg 526 Query: 181 atgttggtcttatcaggactacgactggaaaccntgtgtttggtgcacttaagggagctt 240 ||||||| || || ||||| || |||||||||| ||| |||||||| || |||||||||| Sbjct: 527 atgttggcctcattaggacaaccactggaaaccgtgtctttggtgccctcaagggagctt 586 Query: 241 tggacggtggtctggacattccccacagtgacaagagatttgctggtttcaagaaggacg 300 |||| |||||||| |||||||| |||||||||||||| |||||||| ||||||||||||| Sbjct: 587 tggatggtggtcttgacattcctcacagtgacaagaggtttgctgggttcaagaaggacg 646 Query: 301 agaagtctctggatgctgagattcaccgcaagtacatctatggagggcatgttgctgact 360 ||||| || ||| |||| |||||||||||||||||||| || ||||| || ||||||| Sbjct: 647 agaagcagcttgattctgatattcaccgcaagtacatctacggtgggcacgtggctgact 706 Query: 361 acatgaggtcgctagcagatgaggaacccgagaagtaccaaactcacttcagtgagtaca 420 |||||||||| | || || |||||||| ||||| | |||| | ||||||||||||||| Sbjct: 707 acatgaggtctatggcggaggaggaacctgagaaattccaagcccacttcagtgagtacc 766 Query: 421 tcaa 424 |||| Sbjct: 767 tcaa 770
>dbj|AK065268.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002K21, full insert sequence Length = 1219 Score = 343 bits (173), Expect = 3e-91 Identities = 362/424 (85%), Gaps = 1/424 (0%) Strand = Plus / Plus Query: 1 tggtcttgacgttgttactcaccaactatgctgcagcctactgcactggtctgcttttgg 60 ||||||||| |||| | |||||||||||||| ||||| || |||||||| ||||||||| Sbjct: 349 tggtcttgaagttggt-ctcaccaactatgcggcagcttattgcactggcttgcttttgg 407 Query: 61 ctcgtcgtgtgctcaagtcccgtgatctggatgaggagtatgaaggcaatgttgaggcca 120 |||| |||||||||||| ||||| | |||| ||||||| || |||||| ||||||||| Sbjct: 408 ctcgccgtgtgctcaagctccgtggtttggaccaggagtacgagggcaatattgaggcca 467 Query: 121 ctggtgaggacttctctgttgagcctgctgatgagaggaggcctttccgtgcgctcttgg 180 |||| ||||||| || |||||| || |||||||| ||| ||||||||||||| ||||||| Sbjct: 468 ctggggaggactactatgttgaaccagctgatgaaaggcggcctttccgtgctctcttgg 527 Query: 181 atgttggtcttatcaggactacgactggaaaccntgtgtttggtgcacttaagggagctt 240 ||||||| || || ||||| || |||||||||| ||| |||||||| || |||||||||| Sbjct: 528 atgttggcctcattaggacaaccactggaaaccgtgtctttggtgccctcaagggagctt 587 Query: 241 tggacggtggtctggacattccccacagtgacaagagatttgctggtttcaagaaggacg 300 |||| |||||||| |||||||| |||||||||||||| |||||||| ||||||||||||| Sbjct: 588 tggatggtggtcttgacattcctcacagtgacaagaggtttgctgggttcaagaaggacg 647 Query: 301 agaagtctctggatgctgagattcaccgcaagtacatctatggagggcatgttgctgact 360 ||||| || ||| ||| |||||||||||||||||||| || ||||| || ||||||| Sbjct: 648 agaagcagcttgattctggtattcaccgcaagtacatctacggtgggcacgtggctgact 707 Query: 361 acatgaggtcgctagcagatgaggaacccgagaagtaccaaactcacttcagtgagtaca 420 |||||||||| | || || |||||||| ||||| | |||| | ||||||||||||||| Sbjct: 708 acatgaggtctatggcggaggaggaacctgagaaattccaagcccacttcagtgagtacc 767 Query: 421 tcaa 424 |||| Sbjct: 768 tcaa 771
>gb|BT016417.1| Zea mays clone Contig250 mRNA sequence Length = 1212 Score = 339 bits (171), Expect = 4e-90 Identities = 302/346 (87%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgcttttggctcgtcgtgtgctcaagtcc 80 ||||||||||| || |||||||||||||| || || |||||||| |||||||||||| | Sbjct: 354 accaactatgcagctgcctactgcactggccttctgttggctcgccgtgtgctcaagatc 413 Query: 81 cgtgatctggatgaggagtatgaaggcaatgttgaggccactggtgaggacttctctgtt 140 |||| | ||||| ||||||| || |||||||||||||||||||||||||||||||||||| Sbjct: 414 cgtggtttggatcaggagtacgagggcaatgttgaggccactggtgaggacttctctgtt 473 Query: 141 gagcctgctgatgagaggaggcctttccgtgcgctcttggatgttggtcttatcaggact 200 ||||| |||||||||||||||||||||||||| |||||||||||||| |||||||||||| Sbjct: 474 gagccagctgatgagaggaggcctttccgtgctctcttggatgttggccttatcaggact 533 Query: 201 acgactggaaaccntgtgtttggtgcacttaagggagctttggacggtggtctggacatt 260 || || || |||| ||| |||||||| || |||||||| ||||| || || ||||| ||| Sbjct: 534 acaacagggaaccgtgtctttggtgccctcaagggagcattggatggaggcctggatatt 593 Query: 261 ccccacagtgacaagagatttgctggtttcaagaaggacgagaagtctctggatgctgag 320 || ||||| || ||||| |||||||| |||||||||||||| ||| |||||||||| Sbjct: 594 cctcacagcgagaagaggtttgctggattcaagaaggacgacaagcagttggatgctgat 653 Query: 321 attcaccgcaagtacatctatggagggcatgttgctgactacatga 366 | ||||||| |||||||||||| || ||||||||||||||||||| Sbjct: 654 acccaccgcaggtacatctatggtggccatgttgctgactacatga 699
>ref|NM_123336.3| Arabidopsis thaliana 5S rRNA binding / structural constituent of ribosome AT5G39740 mRNA, complete cds Length = 1223 Score = 188 bits (95), Expect = 1e-44 Identities = 226/270 (83%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgcttttggctcgtcgtgtgctcaagtcc 80 ||||||||||||||||| ||||| ||||| || ||||||||||||||||| || || Sbjct: 319 accaactatgctgcagcttactgtactggccttcttttggctcgtcgtgttctgaaaatg 378 Query: 81 cgtgatctggatgaggagtatgaaggcaatgttgaggccactggtgaggacttctctgtt 140 | || ||||||| ||||| || || || || ||||||||||| |||||||| ||||| Sbjct: 379 ctggaaatggatgatgagtacgagggaaacgtagaggccactggagaggacttttctgtg 438 Query: 141 gagcctgctgatgagaggaggcctttccgtgcgctcttggatgttggtcttatcaggact 200 || || ||||| || || ||||||||||| || | |||||||| |||||||||||| Sbjct: 439 gaaccaactgattccagaagacctttccgtgctcttcttgatgttggacttatcaggact 498 Query: 201 acgactggaaaccntgtgtttggtgcacttaagggagctttggacggtggtctggacatt 260 || |||||||||| ||||||||||||||| ||||||||||||||||| ||||| || || Sbjct: 499 accactggaaaccgtgtgtttggtgcactcaagggagctttggacggaggtcttgatatc 558 Query: 261 ccccacagtgacaagagatttgctggtttc 290 || ||||||||||||||||||||||||||| Sbjct: 559 cctcacagtgacaagagatttgctggtttc 588
>gb|BT008706.1| Arabidopsis thaliana At5g39740 gene, complete cds Length = 906 Score = 188 bits (95), Expect = 1e-44 Identities = 226/270 (83%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgcttttggctcgtcgtgtgctcaagtcc 80 ||||||||||||||||| ||||| ||||| || ||||||||||||||||| || || Sbjct: 277 accaactatgctgcagcttactgtactggccttcttttggctcgtcgtgttctgaaaatg 336 Query: 81 cgtgatctggatgaggagtatgaaggcaatgttgaggccactggtgaggacttctctgtt 140 | || ||||||| ||||| || || || || ||||||||||| |||||||| ||||| Sbjct: 337 ctggaaatggatgatgagtacgagggaaacgtagaggccactggagaggacttttctgtg 396 Query: 141 gagcctgctgatgagaggaggcctttccgtgcgctcttggatgttggtcttatcaggact 200 || || ||||| || || ||||||||||| || | |||||||| |||||||||||| Sbjct: 397 gaaccaactgattccagaagacctttccgtgctcttcttgatgttggacttatcaggact 456 Query: 201 acgactggaaaccntgtgtttggtgcacttaagggagctttggacggtggtctggacatt 260 || |||||||||| ||||||||||||||| ||||||||||||||||| ||||| || || Sbjct: 457 accactggaaaccgtgtgtttggtgcactcaagggagctttggacggaggtcttgatatc 516 Query: 261 ccccacagtgacaagagatttgctggtttc 290 || ||||||||||||||||||||||||||| Sbjct: 517 cctcacagtgacaagagatttgctggtttc 546
>gb|AY093123.1| Arabidopsis thaliana ribosomal protein L5 - like (At5g39740) mRNA, complete cds Length = 1100 Score = 188 bits (95), Expect = 1e-44 Identities = 226/270 (83%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgcttttggctcgtcgtgtgctcaagtcc 80 ||||||||||||||||| ||||| ||||| || ||||||||||||||||| || || Sbjct: 307 accaactatgctgcagcttactgtactggccttcttttggctcgtcgtgttctgaaaatg 366 Query: 81 cgtgatctggatgaggagtatgaaggcaatgttgaggccactggtgaggacttctctgtt 140 | || ||||||| ||||| || || || || ||||||||||| |||||||| ||||| Sbjct: 367 ctggaaatggatgatgagtacgagggaaacgtagaggccactggagaggacttttctgtg 426 Query: 141 gagcctgctgatgagaggaggcctttccgtgcgctcttggatgttggtcttatcaggact 200 || || ||||| || || ||||||||||| || | |||||||| |||||||||||| Sbjct: 427 gaaccaactgattccagaagacctttccgtgctcttcttgatgttggacttatcaggact 486 Query: 201 acgactggaaaccntgtgtttggtgcacttaagggagctttggacggtggtctggacatt 260 || |||||||||| ||||||||||||||| ||||||||||||||||| ||||| || || Sbjct: 487 accactggaaaccgtgtgtttggtgcactcaagggagctttggacggaggtcttgatatc 546 Query: 261 ccccacagtgacaagagatttgctggtttc 290 || ||||||||||||||||||||||||||| Sbjct: 547 cctcacagtgacaagagatttgctggtttc 576
>gb|AY079020.1| Arabidopsis thaliana AT5g39740/MKM21_30 mRNA, complete cds Length = 1128 Score = 188 bits (95), Expect = 1e-44 Identities = 226/270 (83%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgcttttggctcgtcgtgtgctcaagtcc 80 ||||||||||||||||| ||||| ||||| || ||||||||||||||||| || || Sbjct: 319 accaactatgctgcagcttactgtactggccttcttttggctcgtcgtgttctgaaaatg 378 Query: 81 cgtgatctggatgaggagtatgaaggcaatgttgaggccactggtgaggacttctctgtt 140 | || ||||||| ||||| || || || || ||||||||||| |||||||| ||||| Sbjct: 379 ctggaaatggatgatgagtacgagggaaacgtagaggccactggagaggacttttctgtg 438 Query: 141 gagcctgctgatgagaggaggcctttccgtgcgctcttggatgttggtcttatcaggact 200 || || ||||| || || ||||||||||| || | |||||||| |||||||||||| Sbjct: 439 gaaccaactgattccagaagacctttccgtgctcttcttgatgttggacttatcaggact 498 Query: 201 acgactggaaaccntgtgtttggtgcacttaagggagctttggacggtggtctggacatt 260 || |||||||||| ||||||||||||||| ||||||||||||||||| ||||| || || Sbjct: 499 accactggaaaccgtgtgtttggtgcactcaagggagctttggacggaggtcttgatatc 558 Query: 261 ccccacagtgacaagagatttgctggtttc 290 || ||||||||||||||||||||||||||| Sbjct: 559 cctcacagtgacaagagatttgctggtttc 588
>emb|BX831866.1|CNS09ZT2 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH35ZF09 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1048 Score = 180 bits (91), Expect = 2e-42 Identities = 225/270 (83%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgcttttggctcgtcgtgtgctcaagtcc 80 ||||||||||||||||| ||||| ||||| || ||||||||||||||||| || || Sbjct: 296 accaactatgctgcagcttactgtactggccttcttttggctcgtcgtgttctgaaaatg 355 Query: 81 cgtgatctggatgaggagtatgaaggcaatgttgaggccactggtgaggacttctctgtt 140 | || ||||||| ||||| || || || || ||||||||||| |||||||| ||||| Sbjct: 356 ctggaaatggatgatgagtacgagggtaacgtagaggccactggagaggacttttctgtg 415 Query: 141 gagcctgctgatgagaggaggcctttccgtgcgctcttggatgttggtcttatcaggact 200 || || ||||| || || ||||||||||| || | |||||||| |||||||||||| Sbjct: 416 gaaccaactgattccagaagacctttccgtgctcttcttgatgttggacttatcaggact 475 Query: 201 acgactggaaaccntgtgtttggtgcacttaagggagctttggacggtggtctggacatt 260 || |||||||||| ||||||||||| ||| ||||||||||||||||| ||||| || || Sbjct: 476 accactggaaaccgtgtgtttggtgaactcaagggagctttggacggaggtcttgatatc 535 Query: 261 ccccacagtgacaagagatttgctggtttc 290 || ||||||||||||||||||||||||||| Sbjct: 536 cctcacagtgacaagagatttgctggtttc 565
>gb|AY087197.1| Arabidopsis thaliana clone 32753 mRNA, complete sequence Length = 1248 Score = 159 bits (80), Expect = 9e-36 Identities = 169/199 (84%) Strand = Plus / Plus Query: 88 tggatgaggagtatgaaggcaatgttgaggccactggtgaggacttctctgttgagcctg 147 ||||||| |||||||| || || |||||||||||||| |||||||| || |||||||| Sbjct: 406 tggatgacgagtatgagggaaacgttgaggccactggagaggacttttccgttgagccaa 465 Query: 148 ctgatgagaggaggcctttccgtgcgctcttggatgttggtcttatcaggactacgactg 207 ||||| ||||| ||||||||||| || | |||||||| ||||||||||| || || | Sbjct: 466 ctgattcaaggagacctttccgtgctcttcttgatgttggacttatcaggaccacaacag 525 Query: 208 gaaaccntgtgtttggtgcacttaagggagctttggacggtggtctggacattccccaca 267 |||||| |||||| ||||| |||||||| |||||||| |||||||| || || || |||| Sbjct: 526 gaaaccgtgtgttcggtgctcttaagggtgctttggatggtggtcttgatatccctcaca 585 Query: 268 gtgacaagagatttgctgg 286 ||||||||||||||||||| Sbjct: 586 gtgacaagagatttgctgg 604 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 24 aactatgctgcagcctactgcactggtctgcttttggctcgtcgtgt 70 |||||||||||||| ||||| ||||| || ||||||||||| ||||| Sbjct: 342 aactatgctgcagcttactgtactggccttcttttggctcgccgtgt 388
>emb|BX832617.1|CNS09YMN Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH85ZA07 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1060 Score = 157 bits (79), Expect = 4e-35 Identities = 222/270 (82%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgcttttggctcgtcgtgtgctcaagtcc 80 ||||||||||||||||| ||||| ||||| || ||||||||||||||||| || || Sbjct: 304 accaactatgctgcagcttactgtactggccttcttttggctcgtcgtgttctgaaaatg 363 Query: 81 cgtgatctggatgaggagtatgaaggcaatgttgaggccactggtgaggacttctctgtt 140 | || ||||||| ||||| || || || || ||||||||||| |||||||| ||||| Sbjct: 364 ctggaaatggatgatgagtacgagggaaacgtagaggccactggagaggacttttctgtg 423 Query: 141 gagcctgctgatgagaggaggcctttccgtgcgctcttggatgttggtcttatcaggact 200 || || ||||| || || |||||||||| || | |||||||| |||||||||||| Sbjct: 424 gaaccaactgattccagaagaactttccgtgctcttcttgatgttggacttatcaggact 483 Query: 201 acgactggaaaccntgtgtttggtgcacttaagggagctttggacggtggtctggacatt 260 || |||||||| | ||||||||||||||| ||||||||||||||||| ||||| || || Sbjct: 484 accactggaaaacgtgtgtttggtgcactcaagggagctttggacggaggtcttgatatc 543 Query: 261 ccccacagtgacaagagatttgctggtttc 290 || || ||||| |||||||||||||||||| Sbjct: 544 cctcaaagtgaaaagagatttgctggtttc 573
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 153 bits (77), Expect = 6e-34 Identities = 122/137 (89%) Strand = Plus / Plus Query: 232 agggagctttggacggtggtctggacattccccacagtgacaagagatttgctggtttca 291 ||||||||||||| |||||||| |||||||| |||||||||||||| |||||||| |||| Sbjct: 38968709 agggagctttggatggtggtcttgacattcctcacagtgacaagaggtttgctgggttca 38968768 Query: 292 agaaggacgagaagtctctggatgctgagattcaccgcaagtacatctatggagggcatg 351 |||||||||||||| || ||| |||| |||||||||||||||||||| || ||||| | Sbjct: 38968769 agaaggacgagaagcagcttgattctgatattcaccgcaagtacatctacggtgggcacg 38968828 Query: 352 ttgctgactacatgagg 368 | ||||||||||||||| Sbjct: 38968829 tggctgactacatgagg 38968845 Score = 153 bits (77), Expect = 6e-34 Identities = 122/137 (89%) Strand = Plus / Plus Query: 232 agggagctttggacggtggtctggacattccccacagtgacaagagatttgctggtttca 291 ||||||||||||| |||||||| |||||||| |||||||||||||| |||||||| |||| Sbjct: 38963391 agggagctttggatggtggtcttgacattcctcacagtgacaagaggtttgctgggttca 38963450 Query: 292 agaaggacgagaagtctctggatgctgagattcaccgcaagtacatctatggagggcatg 351 |||||||||||||| || ||| |||| |||||||||||||||||||| || ||||| | Sbjct: 38963451 agaaggacgagaagcagcttgattctgatattcaccgcaagtacatctacggtgggcacg 38963510 Query: 352 ttgctgactacatgagg 368 | ||||||||||||||| Sbjct: 38963511 tggctgactacatgagg 38963527 Score = 113 bits (57), Expect = 5e-22 Identities = 98/112 (87%) Strand = Plus / Plus Query: 115 aggccactggtgaggacttctctgttgagcctgctgatgagaggaggcctttccgtgcgc 174 |||||||||| ||||||| || |||||| || |||||||| ||||||||||||||||| | Sbjct: 38963110 aggccactggggaggactactatgttgaaccagctgatgaaaggaggcctttccgtgctc 38963169 Query: 175 tcttggatgttggtcttatcaggactacgactggaaaccntgtgtttggtgc 226 ||||||||||||| || || ||||| || |||||||||| ||| |||||||| Sbjct: 38963170 tcttggatgttggcctcattaggacaaccactggaaaccgtgtctttggtgc 38963221 Score = 105 bits (53), Expect = 1e-19 Identities = 97/112 (86%) Strand = Plus / Plus Query: 115 aggccactggtgaggacttctctgttgagcctgctgatgagaggaggcctttccgtgcgc 174 |||||||||| ||||||| || |||||| || |||||||| ||| ||||||||||||| | Sbjct: 38968426 aggccactggggaggactactatgttgaaccagctgatgaaaggcggcctttccgtgctc 38968485 Query: 175 tcttggatgttggtcttatcaggactacgactggaaaccntgtgtttggtgc 226 ||||||||||||| || || ||||| || |||||||||| ||| |||||||| Sbjct: 38968486 tcttggatgttggcctcattaggacaaccactggaaaccgtgtctttggtgc 38968537 Score = 61.9 bits (31), Expect = 2e-06 Identities = 67/79 (84%) Strand = Plus / Plus Query: 39 tactgcactggtctgcttttggctcgtcgtgtgctcaagtcccgtgatctggatgaggag 98 ||||||||||| ||||| |||||||||||||||||| | ||||| | |||| ||||| Sbjct: 38962952 tactgcactggcttgcttctggctcgtcgtgtgctcacgctccgtggtttggaccaggag 38963011 Query: 99 tatgaaggcaatgttgagg 117 || || ||||||||||||| Sbjct: 38963012 tacgagggcaatgttgagg 38963030 Score = 56.0 bits (28), Expect = 1e-04 Identities = 64/76 (84%) Strand = Plus / Plus Query: 42 tgcactggtctgcttttggctcgtcgtgtgctcaagtcccgtgatctggatgaggagtat 101 |||||||| ||||||||||||| |||||||||||| ||||| | |||| ||||||| Sbjct: 38968265 tgcactggcttgcttttggctcgccgtgtgctcaagctccgtggtttggaccaggagtac 38968324 Query: 102 gaaggcaatgttgagg 117 || |||||| |||||| Sbjct: 38968325 gagggcaatattgagg 38968340 Score = 40.1 bits (20), Expect = 5.8 Identities = 38/44 (86%) Strand = Plus / Plus Query: 381 gaggaacccgagaagtaccaaactcacttcagtgagtacatcaa 424 |||||||| ||||| | |||| | ||||||||||||||| |||| Sbjct: 38969058 gaggaacctgagaaattccaagcccacttcagtgagtacctcaa 38969101
>dbj|AP003349.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0674H09 Length = 142955 Score = 153 bits (77), Expect = 6e-34 Identities = 122/137 (89%) Strand = Plus / Plus Query: 232 agggagctttggacggtggtctggacattccccacagtgacaagagatttgctggtttca 291 ||||||||||||| |||||||| |||||||| |||||||||||||| |||||||| |||| Sbjct: 42342 agggagctttggatggtggtcttgacattcctcacagtgacaagaggtttgctgggttca 42401 Query: 292 agaaggacgagaagtctctggatgctgagattcaccgcaagtacatctatggagggcatg 351 |||||||||||||| || ||| |||| |||||||||||||||||||| || ||||| | Sbjct: 42402 agaaggacgagaagcagcttgattctgatattcaccgcaagtacatctacggtgggcacg 42461 Query: 352 ttgctgactacatgagg 368 | ||||||||||||||| Sbjct: 42462 tggctgactacatgagg 42478 Score = 153 bits (77), Expect = 6e-34 Identities = 122/137 (89%) Strand = Plus / Plus Query: 232 agggagctttggacggtggtctggacattccccacagtgacaagagatttgctggtttca 291 ||||||||||||| |||||||| |||||||| |||||||||||||| |||||||| |||| Sbjct: 37024 agggagctttggatggtggtcttgacattcctcacagtgacaagaggtttgctgggttca 37083 Query: 292 agaaggacgagaagtctctggatgctgagattcaccgcaagtacatctatggagggcatg 351 |||||||||||||| || ||| |||| |||||||||||||||||||| || ||||| | Sbjct: 37084 agaaggacgagaagcagcttgattctgatattcaccgcaagtacatctacggtgggcacg 37143 Query: 352 ttgctgactacatgagg 368 | ||||||||||||||| Sbjct: 37144 tggctgactacatgagg 37160 Score = 113 bits (57), Expect = 5e-22 Identities = 98/112 (87%) Strand = Plus / Plus Query: 115 aggccactggtgaggacttctctgttgagcctgctgatgagaggaggcctttccgtgcgc 174 |||||||||| ||||||| || |||||| || |||||||| ||||||||||||||||| | Sbjct: 36743 aggccactggggaggactactatgttgaaccagctgatgaaaggaggcctttccgtgctc 36802 Query: 175 tcttggatgttggtcttatcaggactacgactggaaaccntgtgtttggtgc 226 ||||||||||||| || || ||||| || |||||||||| ||| |||||||| Sbjct: 36803 tcttggatgttggcctcattaggacaaccactggaaaccgtgtctttggtgc 36854 Score = 105 bits (53), Expect = 1e-19 Identities = 97/112 (86%) Strand = Plus / Plus Query: 115 aggccactggtgaggacttctctgttgagcctgctgatgagaggaggcctttccgtgcgc 174 |||||||||| ||||||| || |||||| || |||||||| ||| ||||||||||||| | Sbjct: 42059 aggccactggggaggactactatgttgaaccagctgatgaaaggcggcctttccgtgctc 42118 Query: 175 tcttggatgttggtcttatcaggactacgactggaaaccntgtgtttggtgc 226 ||||||||||||| || || ||||| || |||||||||| ||| |||||||| Sbjct: 42119 tcttggatgttggcctcattaggacaaccactggaaaccgtgtctttggtgc 42170 Score = 61.9 bits (31), Expect = 2e-06 Identities = 67/79 (84%) Strand = Plus / Plus Query: 39 tactgcactggtctgcttttggctcgtcgtgtgctcaagtcccgtgatctggatgaggag 98 ||||||||||| ||||| |||||||||||||||||| | ||||| | |||| ||||| Sbjct: 36585 tactgcactggcttgcttctggctcgtcgtgtgctcacgctccgtggtttggaccaggag 36644 Query: 99 tatgaaggcaatgttgagg 117 || || ||||||||||||| Sbjct: 36645 tacgagggcaatgttgagg 36663 Score = 56.0 bits (28), Expect = 1e-04 Identities = 64/76 (84%) Strand = Plus / Plus Query: 42 tgcactggtctgcttttggctcgtcgtgtgctcaagtcccgtgatctggatgaggagtat 101 |||||||| ||||||||||||| |||||||||||| ||||| | |||| ||||||| Sbjct: 41898 tgcactggcttgcttttggctcgccgtgtgctcaagctccgtggtttggaccaggagtac 41957 Query: 102 gaaggcaatgttgagg 117 || |||||| |||||| Sbjct: 41958 gagggcaatattgagg 41973 Score = 40.1 bits (20), Expect = 5.8 Identities = 38/44 (86%) Strand = Plus / Plus Query: 381 gaggaacccgagaagtaccaaactcacttcagtgagtacatcaa 424 |||||||| ||||| | |||| | ||||||||||||||| |||| Sbjct: 42691 gaggaacctgagaaattccaagcccacttcagtgagtacctcaa 42734
>dbj|AP003316.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0696G06 Length = 142571 Score = 153 bits (77), Expect = 6e-34 Identities = 122/137 (89%) Strand = Plus / Plus Query: 232 agggagctttggacggtggtctggacattccccacagtgacaagagatttgctggtttca 291 ||||||||||||| |||||||| |||||||| |||||||||||||| |||||||| |||| Sbjct: 133495 agggagctttggatggtggtcttgacattcctcacagtgacaagaggtttgctgggttca 133554 Query: 292 agaaggacgagaagtctctggatgctgagattcaccgcaagtacatctatggagggcatg 351 |||||||||||||| || ||| |||| |||||||||||||||||||| || ||||| | Sbjct: 133555 agaaggacgagaagcagcttgattctgatattcaccgcaagtacatctacggtgggcacg 133614 Query: 352 ttgctgactacatgagg 368 | ||||||||||||||| Sbjct: 133615 tggctgactacatgagg 133631 Score = 153 bits (77), Expect = 6e-34 Identities = 122/137 (89%) Strand = Plus / Plus Query: 232 agggagctttggacggtggtctggacattccccacagtgacaagagatttgctggtttca 291 ||||||||||||| |||||||| |||||||| |||||||||||||| |||||||| |||| Sbjct: 128177 agggagctttggatggtggtcttgacattcctcacagtgacaagaggtttgctgggttca 128236 Query: 292 agaaggacgagaagtctctggatgctgagattcaccgcaagtacatctatggagggcatg 351 |||||||||||||| || ||| |||| |||||||||||||||||||| || ||||| | Sbjct: 128237 agaaggacgagaagcagcttgattctgatattcaccgcaagtacatctacggtgggcacg 128296 Query: 352 ttgctgactacatgagg 368 | ||||||||||||||| Sbjct: 128297 tggctgactacatgagg 128313 Score = 113 bits (57), Expect = 5e-22 Identities = 98/112 (87%) Strand = Plus / Plus Query: 115 aggccactggtgaggacttctctgttgagcctgctgatgagaggaggcctttccgtgcgc 174 |||||||||| ||||||| || |||||| || |||||||| ||||||||||||||||| | Sbjct: 127896 aggccactggggaggactactatgttgaaccagctgatgaaaggaggcctttccgtgctc 127955 Query: 175 tcttggatgttggtcttatcaggactacgactggaaaccntgtgtttggtgc 226 ||||||||||||| || || ||||| || |||||||||| ||| |||||||| Sbjct: 127956 tcttggatgttggcctcattaggacaaccactggaaaccgtgtctttggtgc 128007 Score = 105 bits (53), Expect = 1e-19 Identities = 97/112 (86%) Strand = Plus / Plus Query: 115 aggccactggtgaggacttctctgttgagcctgctgatgagaggaggcctttccgtgcgc 174 |||||||||| ||||||| || |||||| || |||||||| ||| ||||||||||||| | Sbjct: 133212 aggccactggggaggactactatgttgaaccagctgatgaaaggcggcctttccgtgctc 133271 Query: 175 tcttggatgttggtcttatcaggactacgactggaaaccntgtgtttggtgc 226 ||||||||||||| || || ||||| || |||||||||| ||| |||||||| Sbjct: 133272 tcttggatgttggcctcattaggacaaccactggaaaccgtgtctttggtgc 133323 Score = 61.9 bits (31), Expect = 2e-06 Identities = 67/79 (84%) Strand = Plus / Plus Query: 39 tactgcactggtctgcttttggctcgtcgtgtgctcaagtcccgtgatctggatgaggag 98 ||||||||||| ||||| |||||||||||||||||| | ||||| | |||| ||||| Sbjct: 127738 tactgcactggcttgcttctggctcgtcgtgtgctcacgctccgtggtttggaccaggag 127797 Query: 99 tatgaaggcaatgttgagg 117 || || ||||||||||||| Sbjct: 127798 tacgagggcaatgttgagg 127816 Score = 56.0 bits (28), Expect = 1e-04 Identities = 64/76 (84%) Strand = Plus / Plus Query: 42 tgcactggtctgcttttggctcgtcgtgtgctcaagtcccgtgatctggatgaggagtat 101 |||||||| ||||||||||||| |||||||||||| ||||| | |||| ||||||| Sbjct: 133051 tgcactggcttgcttttggctcgccgtgtgctcaagctccgtggtttggaccaggagtac 133110 Query: 102 gaaggcaatgttgagg 117 || |||||| |||||| Sbjct: 133111 gagggcaatattgagg 133126 Score = 40.1 bits (20), Expect = 5.8 Identities = 38/44 (86%) Strand = Plus / Plus Query: 381 gaggaacccgagaagtaccaaactcacttcagtgagtacatcaa 424 |||||||| ||||| | |||| | ||||||||||||||| |||| Sbjct: 133844 gaggaacctgagaaattccaagcccacttcagtgagtacctcaa 133887
>ref|NM_113448.2| Arabidopsis thaliana ATL5 (A. THALIANA RIBOSOMAL PROTEIN L5); structural constituent of ribosome AT3G25520 (ATL5) mRNA, complete cds Length = 1254 Score = 151 bits (76), Expect = 2e-33 Identities = 168/199 (84%) Strand = Plus / Plus Query: 88 tggatgaggagtatgaaggcaatgttgaggccactggtgaggacttctctgttgagcctg 147 ||||||| |||||||| || || |||||||||||||| || ||||| || |||||||| Sbjct: 406 tggatgacgagtatgagggaaacgttgaggccactggagaagacttttccgttgagccaa 465 Query: 148 ctgatgagaggaggcctttccgtgcgctcttggatgttggtcttatcaggactacgactg 207 ||||| ||||| ||||||||||| || | |||||||| ||||||||||| || || | Sbjct: 466 ctgattcaaggagacctttccgtgctcttcttgatgttggacttatcaggaccacaacag 525 Query: 208 gaaaccntgtgtttggtgcacttaagggagctttggacggtggtctggacattccccaca 267 |||||| |||||| ||||| |||||||| |||||||| |||||||| || || || |||| Sbjct: 526 gaaaccgtgtgttcggtgctcttaagggtgctttggatggtggtcttgatatccctcaca 585 Query: 268 gtgacaagagatttgctgg 286 ||||||||||||||||||| Sbjct: 586 gtgacaagagatttgctgg 604 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 24 aactatgctgcagcctactgcactggtctgcttttggctcgtcgtgt 70 |||||||||||||| ||||| ||||| || ||||||||||| ||||| Sbjct: 342 aactatgctgcagcttactgtactggccttcttttggctcgccgtgt 388
>gb|BT000411.1| Arabidopsis thaliana putative ribosomal protein (At3g25520) mRNA, complete cds Length = 969 Score = 151 bits (76), Expect = 2e-33 Identities = 168/199 (84%) Strand = Plus / Plus Query: 88 tggatgaggagtatgaaggcaatgttgaggccactggtgaggacttctctgttgagcctg 147 ||||||| |||||||| || || |||||||||||||| || ||||| || |||||||| Sbjct: 344 tggatgacgagtatgagggaaacgttgaggccactggagaagacttttccgttgagccaa 403 Query: 148 ctgatgagaggaggcctttccgtgcgctcttggatgttggtcttatcaggactacgactg 207 ||||| ||||| ||||||||||| || | |||||||| ||||||||||| || || | Sbjct: 404 ctgattcaaggagacctttccgtgctcttcttgatgttggacttatcaggaccacaacag 463 Query: 208 gaaaccntgtgtttggtgcacttaagggagctttggacggtggtctggacattccccaca 267 |||||| |||||| ||||| |||||||| |||||||| |||||||| || || || |||| Sbjct: 464 gaaaccgtgtgttcggtgctcttaagggtgctttggatggtggtcttgatatccctcaca 523 Query: 268 gtgacaagagatttgctgg 286 ||||||||||||||||||| Sbjct: 524 gtgacaagagatttgctgg 542 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 24 aactatgctgcagcctactgcactggtctgcttttggctcgtcgtgt 70 |||||||||||||| ||||| ||||| || ||||||||||| ||||| Sbjct: 280 aactatgctgcagcttactgtactggccttcttttggctcgccgtgt 326
>gb|BT008705.1| Arabidopsis thaliana At3g25520 gene, complete cds Length = 906 Score = 151 bits (76), Expect = 2e-33 Identities = 168/199 (84%) Strand = Plus / Plus Query: 88 tggatgaggagtatgaaggcaatgttgaggccactggtgaggacttctctgttgagcctg 147 ||||||| |||||||| || || |||||||||||||| || ||||| || |||||||| Sbjct: 344 tggatgacgagtatgagggaaacgttgaggccactggagaagacttttccgttgagccaa 403 Query: 148 ctgatgagaggaggcctttccgtgcgctcttggatgttggtcttatcaggactacgactg 207 ||||| ||||| ||||||||||| || | |||||||| ||||||||||| || || | Sbjct: 404 ctgattcaaggagacctttccgtgctcttcttgatgttggacttatcaggaccacaacag 463 Query: 208 gaaaccntgtgtttggtgcacttaagggagctttggacggtggtctggacattccccaca 267 |||||| |||||| ||||| |||||||| |||||||| |||||||| || || || |||| Sbjct: 464 gaaaccgtgtgttcggtgctcttaagggtgctttggatggtggtcttgatatccctcaca 523 Query: 268 gtgacaagagatttgctgg 286 ||||||||||||||||||| Sbjct: 524 gtgacaagagatttgctgg 542 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 24 aactatgctgcagcctactgcactggtctgcttttggctcgtcgtgt 70 |||||||||||||| ||||| ||||| || ||||||||||| ||||| Sbjct: 280 aactatgctgcagcttactgtactggccttcttttggctcgccgtgt 326
>gb|AY136319.1| Arabidopsis thaliana putative ribosomal protein (At3g25520) mRNA, complete cds Length = 1161 Score = 151 bits (76), Expect = 2e-33 Identities = 168/199 (84%) Strand = Plus / Plus Query: 88 tggatgaggagtatgaaggcaatgttgaggccactggtgaggacttctctgttgagcctg 147 ||||||| |||||||| || || |||||||||||||| || ||||| || |||||||| Sbjct: 403 tggatgacgagtatgagggaaacgttgaggccactggagaagacttttccgttgagccaa 462 Query: 148 ctgatgagaggaggcctttccgtgcgctcttggatgttggtcttatcaggactacgactg 207 ||||| ||||| ||||||||||| || | |||||||| ||||||||||| || || | Sbjct: 463 ctgattcaaggagacctttccgtgctcttcttgatgttggacttatcaggaccacaacag 522 Query: 208 gaaaccntgtgtttggtgcacttaagggagctttggacggtggtctggacattccccaca 267 |||||| |||||| ||||| |||||||| |||||||| |||||||| || || || |||| Sbjct: 523 gaaaccgtgtgttcggtgctcttaagggtgctttggatggtggtcttgatatccctcaca 582 Query: 268 gtgacaagagatttgctgg 286 ||||||||||||||||||| Sbjct: 583 gtgacaagagatttgctgg 601 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 24 aactatgctgcagcctactgcactggtctgcttttggctcgtcgtgt 70 |||||||||||||| ||||| ||||| || ||||||||||| ||||| Sbjct: 339 aactatgctgcagcttactgtactggccttcttttggctcgccgtgt 385
>gb|AY065103.1| Arabidopsis thaliana 60S ribosomal protein L5 (At3g25550) mRNA, complete cds Length = 1151 Score = 151 bits (76), Expect = 2e-33 Identities = 168/199 (84%) Strand = Plus / Plus Query: 88 tggatgaggagtatgaaggcaatgttgaggccactggtgaggacttctctgttgagcctg 147 ||||||| |||||||| || || |||||||||||||| || ||||| || |||||||| Sbjct: 401 tggatgacgagtatgagggaaacgttgaggccactggagaagacttttccgttgagccaa 460 Query: 148 ctgatgagaggaggcctttccgtgcgctcttggatgttggtcttatcaggactacgactg 207 ||||| ||||| ||||||||||| || | |||||||| ||||||||||| || || | Sbjct: 461 ctgattcaaggagacctttccgtgctcttcttgatgttggacttatcaggaccacaacag 520 Query: 208 gaaaccntgtgtttggtgcacttaagggagctttggacggtggtctggacattccccaca 267 |||||| |||||| ||||| |||||||| |||||||| |||||||| || || || |||| Sbjct: 521 gaaaccgtgtgttcggtgctcttaagggtgctttggatggtggtcttgatatccctcaca 580 Query: 268 gtgacaagagatttgctgg 286 ||||||||||||||||||| Sbjct: 581 gtgacaagagatttgctgg 599 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 24 aactatgctgcagcctactgcactggtctgcttttggctcgtcgtgt 70 |||||||||||||| ||||| ||||| || ||||||||||| ||||| Sbjct: 337 aactatgctgcagcttactgtactggccttcttttggctcgccgtgt 383
>gb|AY081701.1| Arabidopsis thaliana 60S ribosomal protein L5 (At3g25550) mRNA, complete cds Length = 925 Score = 151 bits (76), Expect = 2e-33 Identities = 168/199 (84%) Strand = Plus / Plus Query: 88 tggatgaggagtatgaaggcaatgttgaggccactggtgaggacttctctgttgagcctg 147 ||||||| |||||||| || || |||||||||||||| || ||||| || |||||||| Sbjct: 344 tggatgacgagtatgagggaaacgttgaggccactggagaagacttttccgttgagccaa 403 Query: 148 ctgatgagaggaggcctttccgtgcgctcttggatgttggtcttatcaggactacgactg 207 ||||| ||||| ||||||||||| || | |||||||| ||||||||||| || || | Sbjct: 404 ctgattcaaggagacctttccgtgctcttcttgatgttggacttatcaggaccacaacag 463 Query: 208 gaaaccntgtgtttggtgcacttaagggagctttggacggtggtctggacattccccaca 267 |||||| |||||| ||||| |||||||| |||||||| |||||||| || || || |||| Sbjct: 464 gaaaccgtgtgttcggtgctcttaagggtgctttggatggtggtcttgatatccctcaca 523 Query: 268 gtgacaagagatttgctgg 286 ||||||||||||||||||| Sbjct: 524 gtgacaagagatttgctgg 542 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 24 aactatgctgcagcctactgcactggtctgcttttggctcgtcgtgt 70 |||||||||||||| ||||| ||||| || ||||||||||| ||||| Sbjct: 280 aactatgctgcagcttactgtactggccttcttttggctcgccgtgt 326
>gb|AY054161.1| Arabidopsis thaliana AT5g39740/MKM21_30 mRNA, complete cds Length = 1108 Score = 151 bits (76), Expect = 2e-33 Identities = 168/199 (84%) Strand = Plus / Plus Query: 88 tggatgaggagtatgaaggcaatgttgaggccactggtgaggacttctctgttgagcctg 147 ||||||| |||||||| || || |||||||||||||| || ||||| || |||||||| Sbjct: 391 tggatgacgagtatgagggaaacgttgaggccactggagaagacttttccgttgagccaa 450 Query: 148 ctgatgagaggaggcctttccgtgcgctcttggatgttggtcttatcaggactacgactg 207 ||||| ||||| ||||||||||| || | |||||||| ||||||||||| || || | Sbjct: 451 ctgattcaaggagacctttccgtgctcttcttgatgttggacttatcaggaccacaacag 510 Query: 208 gaaaccntgtgtttggtgcacttaagggagctttggacggtggtctggacattccccaca 267 |||||| |||||| ||||| |||||||| |||||||| |||||||| || || || |||| Sbjct: 511 gaaaccgtgtgttcggtgctcttaagggtgctttggatggtggtcttgatatccctcaca 570 Query: 268 gtgacaagagatttgctgg 286 ||||||||||||||||||| Sbjct: 571 gtgacaagagatttgctgg 589 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 24 aactatgctgcagcctactgcactggtctgcttttggctcgtcgtgt 70 |||||||||||||| ||||| ||||| || ||||||||||| ||||| Sbjct: 327 aactatgctgcagcttactgtactggccttcttttggctcgccgtgt 373
>gb|AY186611.1| Arabidopsis thaliana ribosomal protein L5 mRNA, complete cds Length = 906 Score = 151 bits (76), Expect = 2e-33 Identities = 168/199 (84%) Strand = Plus / Plus Query: 88 tggatgaggagtatgaaggcaatgttgaggccactggtgaggacttctctgttgagcctg 147 ||||||| |||||||| || || |||||||||||||| || ||||| || |||||||| Sbjct: 344 tggatgacgagtatgagggaaacgttgaggccactggagaagacttttccgttgagccaa 403 Query: 148 ctgatgagaggaggcctttccgtgcgctcttggatgttggtcttatcaggactacgactg 207 ||||| ||||| ||||||||||| || | |||||||| ||||||||||| || || | Sbjct: 404 ctgattcaaggagacctttccgtgctcttcttgatgttggacttatcaggaccacaacag 463 Query: 208 gaaaccntgtgtttggtgcacttaagggagctttggacggtggtctggacattccccaca 267 |||||| |||||| ||||| |||||||| |||||||| |||||||| || || || |||| Sbjct: 464 gaaaccgtgtgttcggtgctcttaagggtgctttggatggtggtcttgatatccctcaca 523 Query: 268 gtgacaagagatttgctgg 286 ||||||||||||||||||| Sbjct: 524 gtgacaagagatttgctgg 542 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 24 aactatgctgcagcctactgcactggtctgcttttggctcgtcgtgt 70 |||||||||||||| ||||| ||||| || ||||||||||| ||||| Sbjct: 280 aactatgctgcagcttactgtactggccttcttttggctcgccgtgt 326
>emb|BX823967.1|CNS0A6W1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH10ZG11 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1076 Score = 151 bits (76), Expect = 2e-33 Identities = 168/199 (84%) Strand = Plus / Plus Query: 88 tggatgaggagtatgaaggcaatgttgaggccactggtgaggacttctctgttgagcctg 147 ||||||| |||||||| || || |||||||||||||| || ||||| || |||||||| Sbjct: 376 tggatgacgagtatgagggaaacgttgaggccactggagaagacttttccgttgagccaa 435 Query: 148 ctgatgagaggaggcctttccgtgcgctcttggatgttggtcttatcaggactacgactg 207 ||||| ||||| ||||||||||| || | |||||||| ||||||||||| || || | Sbjct: 436 ctgattcaaggagacctttccgtgctcttcttgatgttggacttatcaggaccacaacag 495 Query: 208 gaaaccntgtgtttggtgcacttaagggagctttggacggtggtctggacattccccaca 267 |||||| |||||| ||||| |||||||| |||||||| |||||||| || || || |||| Sbjct: 496 gaaaccgtgtgttcggtgctcttaagggtgctttggatggtggtcttgatatccctcaca 555 Query: 268 gtgacaagagatttgctgg 286 ||||||||||||||||||| Sbjct: 556 gtgacaagagatttgctgg 574 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 24 aactatgctgcagcctactgcactggtctgcttttggctcgtcgtgt 70 |||||||||||||| ||||| ||||| || ||||||||||| ||||| Sbjct: 312 aactatgctgcagcttactgtactggccttcttttggctcgccgtgt 358
>gb|BT002427.1| Arabidopsis thaliana ribosomal protein, putative (At3g25520) mRNA, complete cds Length = 1117 Score = 151 bits (76), Expect = 2e-33 Identities = 168/199 (84%) Strand = Plus / Plus Query: 88 tggatgaggagtatgaaggcaatgttgaggccactggtgaggacttctctgttgagcctg 147 ||||||| |||||||| || || |||||||||||||| || ||||| || |||||||| Sbjct: 401 tggatgacgagtatgagggaaacgttgaggccactggagaagacttttccgttgagccaa 460 Query: 148 ctgatgagaggaggcctttccgtgcgctcttggatgttggtcttatcaggactacgactg 207 ||||| ||||| ||||||||||| || | |||||||| ||||||||||| || || | Sbjct: 461 ctgattcaaggagacctttccgtgctcttcttgatgttggacttatcaggaccacaacag 520 Query: 208 gaaaccntgtgtttggtgcacttaagggagctttggacggtggtctggacattccccaca 267 |||||| |||||| ||||| |||||||| |||||||| |||||||| || || || |||| Sbjct: 521 gaaaccgtgtgttcggtgctcttaagggtgctttggatggtggtcttgatatccctcaca 580 Query: 268 gtgacaagagatttgctgg 286 ||||||||||||||||||| Sbjct: 581 gtgacaagagatttgctgg 599 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 24 aactatgctgcagcctactgcactggtctgcttttggctcgtcgtgt 70 |||||||||||||| ||||| ||||| || ||||||||||| ||||| Sbjct: 337 aactatgctgcagcttactgtactggccttcttttggctcgccgtgt 383
>dbj|AB049724.1| Pisum sativum ssa-15 mRNA for putative senescence-associated protein, complete cds Length = 1100 Score = 139 bits (70), Expect = 8e-30 Identities = 219/269 (81%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgcttttggctcgtcgtgtgctcaagtcc 80 |||||||||||||||||||| ||||| ||||| || |||||||| ||||| || || | Sbjct: 339 accaactatgctgcagcctattgcaccggtctcctgttggctcgccgtgttcttaaaact 398 Query: 81 cgtgatctggatgaggagtatgaaggcaatgttgaggccactggtgaggacttctctgtt 140 | ||| |||||||||||||||| |||||||| ||||| | ||| || || | || ||| Sbjct: 399 cttgaaatggatgaggagtatgagggcaatgtagaggctagtggagaagattattcggtt 458 Query: 141 gagcctgctgatgagaggaggcctttccgtgcgctcttggatgttggtcttatcaggact 200 || || |||||| ||||||||||||||||| || | ||||||||| | | | ||| Sbjct: 459 gaaccagctgattccaggaggcctttccgtgctcttcttgatgttggtttggttaagacc 518 Query: 201 acgactggaaaccntgtgtttggtgcacttaagggagctttggacggtggtctggacatt 260 || || || |||| ||||||||||||||| |||||||||||||| || ||| |||| ||| Sbjct: 519 acaaccggtaaccgtgtgtttggtgcactcaagggagctttggatggaggtttggatatt 578 Query: 261 ccccacagtgacaagagatttgctggttt 289 || ||||||||||| || ||||||||||| Sbjct: 579 cctcacagtgacaaaaggtttgctggttt 607
>gb|AY365248.1| Cucumis sativus 60S ribosomal protein L5 mRNA, complete cds Length = 1171 Score = 135 bits (68), Expect = 1e-28 Identities = 157/187 (83%) Strand = Plus / Plus Query: 102 gaaggcaatgttgaggccactggtgaggacttctctgttgagcctgctgatgagaggagg 161 ||||||||||| ||||| |||||||| || | ||| |||||||| || || || ||| Sbjct: 379 gaaggcaatgtggaggctactggtgaagattactcggttgagccagcagacaccagaagg 438 Query: 162 cctttccgtgcgctcttggatgttggtcttatcaggactacgactggaaaccntgtgttt 221 || |||||||| ||| | |||||||| |||||||| ||||| |||||||||| || ||| Sbjct: 439 ccattccgtgctctccttgatgttgggcttatcagaactacaactggaaaccgcgttttt 498 Query: 222 ggtgcacttaagggagctttggacggtggtctggacattccccacagtgacaagagattt 281 ||||| || |||||||||||||| ||||| |||||||||| |||||||||||||| ||| Sbjct: 499 ggtgctctgaagggagctttggatggtggattggacattcctcacagtgacaagaggttt 558 Query: 282 gctggtt 288 ||||||| Sbjct: 559 gctggtt 565 Score = 61.9 bits (31), Expect = 2e-06 Identities = 43/47 (91%) Strand = Plus / Plus Query: 18 ctcaccaactatgctgcagcctactgcactggtctgcttttggctcg 64 |||||||||||||||||||| ||||||||||| || || |||||||| Sbjct: 295 ctcaccaactatgctgcagcatactgcactgggcttctattggctcg 341 Score = 42.1 bits (21), Expect = 1.5 Identities = 36/41 (87%) Strand = Plus / Plus Query: 384 gaacccgagaagtaccaaactcacttcagtgagtacatcaa 424 ||||| ||||| || ||| |||||||||| ||||||||||| Sbjct: 661 gaacctgagaaatatcaatctcacttcagcgagtacatcaa 701
>gb|BT014015.1| Lycopersicon esculentum clone 133077F, mRNA sequence Length = 1274 Score = 121 bits (61), Expect = 2e-24 Identities = 216/268 (80%) Strand = Plus / Plus Query: 88 tggatgaggagtatgaaggcaatgttgaggccactggtgaggacttctctgttgagcctg 147 |||||||||||||| |||| || |||||||| ||| ||||| | ||| ||||| | || Sbjct: 455 tggatgaggagtatcaaggtaaccctgaggccagtggagaggattactcagttgaacttg 514 Query: 148 ctgatgagaggaggcctttccgtgcgctcttggatgttggtcttatcaggactacgactg 207 |||| ||||||||||||||||| |||||||||||||||||||| || ||||| |||| Sbjct: 515 ctgaaagcaggaggcctttccgtgctctcttggatgttggtcttattagaactactactg 574 Query: 208 gaaaccntgtgtttggtgcacttaagggagctttggacggtggtctggacattccccaca 267 |||| | |||||||||||| || ||||| || ||||| ||||| || || ||||| || Sbjct: 575 gaaatcgtgtgtttggtgctctcaagggtgcattggatggtggacttgatattcctcatg 634 Query: 268 gtgacaagagatttgctggtttcaagaaggacgagaagtctctggatgctgagattcacc 327 |||| ||||| |||||||| |||| || || ||| || ||||||||| |||||| Sbjct: 635 gtgagaagaggtttgctggattcagcaaagattccaagcaacttgatgctgaggttcacc 694 Query: 328 gcaagtacatctatggagggcatgttgc 355 ||||||| || ||||| || |||||||| Sbjct: 695 gcaagtatatatatggtggccatgttgc 722
>dbj|AB016876.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MKM21 Length = 44499 Score = 89.7 bits (45), Expect = 7e-15 Identities = 101/120 (84%) Strand = Plus / Plus Query: 115 aggccactggtgaggacttctctgttgagcctgctgatgagaggaggcctttccgtgcgc 174 |||||||||| |||||||| ||||| || || ||||| || || ||||||||||| | Sbjct: 7915 aggccactggagaggacttttctgtggaaccaactgattccagaagacctttccgtgctc 7974 Query: 175 tcttggatgttggtcttatcaggactacgactggaaaccntgtgtttggtgcacttaagg 234 | | |||||||| |||||||||||||| |||||||||| ||||||||||||||| |||| Sbjct: 7975 ttcttgatgttggacttatcaggactaccactggaaaccgtgtgtttggtgcactcaagg 8034 Score = 77.8 bits (39), Expect = 3e-11 Identities = 54/59 (91%) Strand = Plus / Plus Query: 232 agggagctttggacggtggtctggacattccccacagtgacaagagatttgctggtttc 290 |||||||||||||||| ||||| || || || ||||||||||||||||||||||||||| Sbjct: 8148 agggagctttggacggaggtcttgatatccctcacagtgacaagagatttgctggtttc 8206 Score = 40.1 bits (20), Expect = 5.8 Identities = 29/32 (90%) Strand = Plus / Plus Query: 39 tactgcactggtctgcttttggctcgtcgtgt 70 ||||| ||||| || ||||||||||||||||| Sbjct: 7747 tactgtactggccttcttttggctcgtcgtgt 7778
>dbj|AB025639.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MWL2 Length = 84896 Score = 73.8 bits (37), Expect = 4e-10 Identities = 99/120 (82%) Strand = Plus / Minus Query: 115 aggccactggtgaggacttctctgttgagcctgctgatgagaggaggcctttccgtgcgc 174 |||||||||| || ||||| || |||||||| ||||| ||||| ||||||||||| | Sbjct: 57081 aggccactggagaagacttttccgttgagccaactgattcaaggagacctttccgtgctc 57022 Query: 175 tcttggatgttggtcttatcaggactacgactggaaaccntgtgtttggtgcacttaagg 234 | | |||||||| ||||||||||| || || ||||||| |||||| ||||| ||||||| Sbjct: 57021 ttcttgatgttggacttatcaggaccacaacaggaaaccgtgtgttcggtgctcttaagg 56962 Score = 61.9 bits (31), Expect = 2e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 232 agggagctttggacggtggtctggacattccccacagtgacaagagatttgctgg 286 |||| |||||||| |||||||| || || || ||||||||||||||||||||||| Sbjct: 56848 agggtgctttggatggtggtcttgatatccctcacagtgacaagagatttgctgg 56794
>gb|BT012733.1| Lycopersicon esculentum clone 113662F, mRNA sequence Length = 1161 Score = 71.9 bits (36), Expect = 2e-09 Identities = 131/163 (80%) Strand = Plus / Plus Query: 88 tggatgaggagtatgaaggcaatgttgaggccactggtgaggacttctctgttgagcctg 147 ||||||| || ||| |||| ||| |||| | || ||| ||||||| ||||||||| |||| Sbjct: 401 tggatgaagaatatcaaggaaatcttgatgtcaatggagaggactactctgttgaacctg 460 Query: 148 ctgatgagaggaggcctttccgtgcgctcttggatgttggtcttatcaggactacgactg 207 |||| ||||||||||||||||| |||||||| || || || | || ||||| || | Sbjct: 461 ctgaaagcaggaggcctttccgtgctctcttggacgtcggcctcttaagaactactacag 520 Query: 208 gaaaccntgtgtttggtgcacttaagggagctttggacggtgg 250 | |||| |||||||||||| || ||||| || ||||| ||||| Sbjct: 521 ggaaccgtgtgtttggtgctctcaagggtgcattggatggtgg 563
>emb|X95566.1|PS5SRNA P.sativum 5S rRNA gene Length = 1115 Score = 71.9 bits (36), Expect = 2e-09 Identities = 83/95 (87%), Gaps = 4/95 (4%) Strand = Plus / Plus Query: 215 tgtgtttggtg-cacttaaggga-gctttggacggtggtctggacattccccacagtgac 272 ||||||||||| |||| |||||| |||||||| || ||| |||| ||||| ||||||||| Sbjct: 476 tgtgtttggtgacactcaagggaagctttggatggaggtttggatattcctcacagtgac 535 Query: 273 aagagatttgctggttt--caagaaggacgagaag 305 ||||| ||||||||||| ||| |||||||||||| Sbjct: 536 aagaggtttgctggttttgcaacaaggacgagaag 570 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgcttttggct 62 |||||||||||||||||||| ||||| ||||| || |||||| Sbjct: 276 accaactatgctgcagcctattgcaccggtctcctgttggct 317 Score = 46.1 bits (23), Expect = 0.094 Identities = 29/31 (93%) Strand = Plus / Plus Query: 88 tggatgaggagtatgaaggcaatgttgaggc 118 |||||||||||||||| |||||||| ||||| Sbjct: 346 tggatgaggagtatgagggcaatgtagaggc 376
>gb|DQ228334.1| Solanum tuberosum clone 145F02 unknown mRNA Length = 1114 Score = 60.0 bits (30), Expect = 6e-06 Identities = 128/161 (79%) Strand = Plus / Plus Query: 126 gaggacttctctgttgagcctgctgatgagaggaggcctttccgtgcgctcttggatgtt 185 ||||||| ||| ||||| |||||||| ||||||||||||||||| |||||||| || Sbjct: 416 gaggactactccgttgaacctgctgaaagcaggaggcctttccgtgctctcttggacgtc 475 Query: 186 ggtcttatcaggactacgactggaaaccntgtgtttggtgcacttaagggagctttggac 245 || || | || ||||| || || |||| ||| |||||||| || ||||| || ||||| Sbjct: 476 ggcctcttaagaactaccacagggaaccgtgtttttggtgctctcaagggtgcattggat 535 Query: 246 ggtggtctggacattccccacagtgacaagagatttgctgg 286 ||||| | ||||| || || ||||| ||||| |||||||| Sbjct: 536 ggtgggattgacatccctcatagtgagaagaggtttgctgg 576
>gb|DQ206526.1| Suberites fuscus isolate TOA21 ribosomal protein 5 large subunit mRNA, partial cds Length = 437 Score = 54.0 bits (27), Expect = 4e-04 Identities = 33/35 (94%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 |||||||||||||| || ||||||||||||||||| Sbjct: 208 accaactatgctgctgcatactgcactggtctgct 242
>dbj|AP004484.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT06I17, TM0017, complete sequence Length = 121127 Score = 54.0 bits (27), Expect = 4e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 232 agggagctttggacggtggtctggacattccccacagtgacaagagatttgctgg 286 ||||||| ||||| || |||||||| ||||| |||||||| || ||||||||||| Sbjct: 46778 agggagccttggatgggggtctggatattcctcacagtgataaaagatttgctgg 46724
>gb|AF481056.1| Aplysia californica alpha tubulin 2 mRNA, complete cds Length = 1945 Score = 50.1 bits (25), Expect = 0.006 Identities = 37/41 (90%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgcttttggc 61 |||||||||||||| || ||||||||||| |||||||||| Sbjct: 73 accaactatgctgctgcatactgcactggattgcttttggc 113
>dbj|AB001583.1| Solanum melongena mRNA for ribosomal protein L5, partial cds Length = 399 Score = 50.1 bits (25), Expect = 0.006 Identities = 40/45 (88%) Strand = Plus / Plus Query: 322 ttcaccgcaagtacatctatggagggcatgttgctgactacatga 366 ||||||||||||| |||||||| || |||||||||| ||||||| Sbjct: 36 ttcaccgcaagtatatctatggtggccatgttgctgcatacatga 80
>gb|AC128859.4| Rattus norvegicus 10 BAC CH230-436I22 (Children's Hospital Oakland Research Institute) complete sequence Length = 156078 Score = 48.1 bits (24), Expect = 0.024 Identities = 30/32 (93%) Strand = Plus / Minus Query: 24 aactatgctgcagcctactgcactggtctgct 55 ||||||||||||||||| |||||||| ||||| Sbjct: 124428 aactatgctgcagcctattgcactggcctgct 124397
>emb|BX028070.1|CNS08TTM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA42AA03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 959 Score = 48.1 bits (24), Expect = 0.024 Identities = 33/36 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgctt 56 ||||||||||| || ||||||||||| ||||||||| Sbjct: 350 accaactatgccgccgcctactgcaccggtctgctt 385
>emb|BX008571.1|CNS08ERZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA14AC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 955 Score = 48.1 bits (24), Expect = 0.024 Identities = 33/36 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgctt 56 ||||||||||| || ||||||||||| ||||||||| Sbjct: 366 accaactatgccgccgcctactgcaccggtctgctt 401
>emb|Z99296.2|SPAC3H5 S.pombe chromosome I cosmid c3H5 Length = 34284 Score = 48.1 bits (24), Expect = 0.024 Identities = 48/56 (85%) Strand = Plus / Plus Query: 310 tggatgctgagattcaccgcaagtacatctatggagggcatgttgctgactacatg 365 |||||| ||||| || |||||| || |||||||| || ||||||||||| |||||| Sbjct: 1230 tggatgatgagactctccgcaaatatatctatggtggccatgttgctgaatacatg 1285
>emb|X06148.1|RNRPL5 Rat mRNA for ribosomal protein L5 Length = 1069 Score = 48.1 bits (24), Expect = 0.024 Identities = 30/32 (93%) Strand = Plus / Plus Query: 24 aactatgctgcagcctactgcactggtctgct 55 ||||||||||||||||| |||||||| ||||| Sbjct: 403 aactatgctgcagcctattgcactggcctgct 434
>emb|AL031528.1|SPBC11C11 S.pombe chromosome II cosmid c11C11 Length = 22500 Score = 48.1 bits (24), Expect = 0.024 Identities = 48/56 (85%) Strand = Plus / Minus Query: 310 tggatgctgagattcaccgcaagtacatctatggagggcatgttgctgactacatg 365 |||||| ||||| || ||| ||||| |||||||| || ||||||||||| |||||| Sbjct: 20270 tggatgatgagactctccgtaagtatatctatggtggtcatgttgctgaatacatg 20215
>gb|BC060561.1| Rattus norvegicus ribosomal protein L5, mRNA (cDNA clone MGC:72798 IMAGE:6918805), complete cds Length = 1041 Score = 48.1 bits (24), Expect = 0.024 Identities = 30/32 (93%) Strand = Plus / Plus Query: 24 aactatgctgcagcctactgcactggtctgct 55 ||||||||||||||||| |||||||| ||||| Sbjct: 350 aactatgctgcagcctattgcactggcctgct 381
>ref|NM_001022319.1| Schizosaccharomyces pombe 972h- hypothetical protein (SPBC11C11.09c), partial mRNA Length = 885 Score = 48.1 bits (24), Expect = 0.024 Identities = 48/56 (85%) Strand = Plus / Plus Query: 310 tggatgctgagattcaccgcaagtacatctatggagggcatgttgctgactacatg 365 |||||| ||||| || ||| ||||| |||||||| || ||||||||||| |||||| Sbjct: 569 tggatgatgagactctccgtaagtatatctatggtggtcatgttgctgaatacatg 624
>ref|NM_001019604.1| Schizosaccharomyces pombe 972h- hypothetical protein (SPAC3H5.12c), partial mRNA Length = 885 Score = 48.1 bits (24), Expect = 0.024 Identities = 48/56 (85%) Strand = Plus / Plus Query: 310 tggatgctgagattcaccgcaagtacatctatggagggcatgttgctgactacatg 365 |||||| ||||| || |||||| || |||||||| || ||||||||||| |||||| Sbjct: 569 tggatgatgagactctccgcaaatatatctatggtggccatgttgctgaatacatg 624
>ref|NM_031099.1| Rattus norvegicus ribosomal protein L5 (Rpl5), mRNA Length = 1069 Score = 48.1 bits (24), Expect = 0.024 Identities = 30/32 (93%) Strand = Plus / Plus Query: 24 aactatgctgcagcctactgcactggtctgct 55 ||||||||||||||||| |||||||| ||||| Sbjct: 403 aactatgctgcagcctattgcactggcctgct 434
>ref|XM_576632.1| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L5 (LOC501206), mRNA Length = 983 Score = 48.1 bits (24), Expect = 0.024 Identities = 30/32 (93%) Strand = Plus / Plus Query: 24 aactatgctgcagcctactgcactggtctgct 55 ||||||||||||||||| |||||||| ||||| Sbjct: 308 aactatgctgcagcctattgcactggcctgct 339
>gb|AY961534.1| Lysiphlebus testaceipes ribosomal protein L5 (RpL5) mRNA, complete cds Length = 894 Score = 48.1 bits (24), Expect = 0.024 Identities = 30/32 (93%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtct 52 |||||||| ||||| ||||||||||||||||| Sbjct: 277 accaactacgctgctgcctactgcactggtct 308
>gb|U48270.1|SPU48270 Schizosaccharomyces pombe ribosomal protein L5 gene, complete cds Length = 1238 Score = 48.1 bits (24), Expect = 0.024 Identities = 48/56 (85%) Strand = Plus / Plus Query: 310 tggatgctgagattcaccgcaagtacatctatggagggcatgttgctgactacatg 365 |||||| ||||| || |||||| || |||||||| || ||||||||||| |||||| Sbjct: 605 tggatgatgagactctccgcaaatatatctatggtggccatgttgctgaatacatg 660
>gb|M17419.1|RATRPL5 Rat ribosomal protein L5 mRNA, complete cds Length = 999 Score = 48.1 bits (24), Expect = 0.024 Identities = 30/32 (93%) Strand = Plus / Plus Query: 24 aactatgctgcagcctactgcactggtctgct 55 ||||||||||||||||| |||||||| ||||| Sbjct: 336 aactatgctgcagcctattgcactggcctgct 367
>dbj|AB016045.1| Schizosaccharomyces pombe mRNA for ribosomal protein L5 homolog, partial cds Length = 779 Score = 48.1 bits (24), Expect = 0.024 Identities = 48/56 (85%) Strand = Plus / Plus Query: 310 tggatgctgagattcaccgcaagtacatctatggagggcatgttgctgactacatg 365 |||||| ||||| || ||| ||||| |||||||| || ||||||||||| |||||| Sbjct: 431 tggatgatgagactctccgtaagtatatctatggtggtcatgttgctgaatacatg 486
>emb|BX072137.1|CNS09RTP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9DG12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 833 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 360 accaactatgccgccgcctactgcaccggtctgct 394
>emb|BX071725.1|CNS09RI9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9BE06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 913 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 129 accaactatgccgccgcctactgcaccggtctgct 163
>emb|BX070877.1|CNS09QUP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8AG09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 676 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 287 accaactatgccgccgcctactgcaccggtctgct 321
>emb|BX070441.1|CNS09QIL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC7CB09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 908 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 352 accaactatgccgccgcctactgcaccggtctgct 386
>emb|BX069649.1|CNS09PWL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6BF04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 907 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 350 accaactatgccgccgcctactgcaccggtctgct 384
>emb|BX061084.1|CNS09JAO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC41CH06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 941 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 364 accaactatgccgccgcctactgcaccggtctgct 398
>emb|BX069291.1|CNS09PMN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53DE11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 969 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 373 accaactatgccgccgcctactgcaccggtctgct 407
>emb|BX068955.1|CNS09PDB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53BG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 697 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 368 accaactatgccgccgcctactgcaccggtctgct 402
>emb|BX068814.1|CNS09P9E Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53AH11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 952 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Minus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 866 accaactatgccgccgcctactgcaccggtctgct 832
>emb|BX068813.1|CNS09P9D Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53AH11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1020 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 362 accaactatgccgccgcctactgcaccggtctgct 396
>emb|BX068507.1|CNS09P0V Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52DC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 972 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 593 accaactatgccgccgcctactgcaccggtctgct 627
>emb|BX068442.1|CNS09OZ2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52CG10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 951 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 379 accaactatgccgccgcctactgcaccggtctgct 413
>emb|BX067725.1|CNS09OF5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51CB08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 939 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 340 accaactatgccgccgcctactgcaccggtctgct 374
>emb|BX067047.1|CNS09NWB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50CC08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 891 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 354 accaactatgccgccgcctactgcaccggtctgct 388
>emb|BX067225.1|CNS09O19 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50DC08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 965 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 346 accaactatgccgccgcctactgcaccggtctgct 380
>emb|BX067123.1|CNS09NYF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50CF12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 685 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 369 accaactatgccgccgcctactgcaccggtctgct 403
>emb|BX066661.1|CNS09NLL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50AC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 940 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 359 accaactatgccgccgcctactgcaccggtctgct 393
>emb|BX066513.1|CNS09NHH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5DD10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 937 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 361 accaactatgccgccgcctactgcaccggtctgct 395
>emb|BX066357.1|CNS09ND5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5CE10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 930 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 362 accaactatgccgccgcctactgcaccggtctgct 396
>emb|BX065367.1|CNS09MLN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49BA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1008 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 344 accaactatgccgccgcctactgcaccggtctgct 378
>emb|BX065342.1|CNS09MKY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC49AG12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 888 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Minus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 685 accaactatgccgccgcctactgcaccggtctgct 651
>emb|BX065341.1|CNS09MKX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49AG12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1021 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 336 accaactatgccgccgcctactgcaccggtctgct 370
>emb|BX065225.1|CNS09MHP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49AB02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 987 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 329 accaactatgccgccgcctactgcaccggtctgct 363
>emb|BX065207.1|CNS09MH7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49AA04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 984 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 353 accaactatgccgccgcctactgcaccggtctgct 387
>emb|BX064978.1|CNS09MAU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC48CF11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 977 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 340 accaactatgccgccgcctactgcaccggtctgct 374
>emb|BX064130.1|CNS09LNA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46BB09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 852 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 337 accaactatgccgccgcctactgcaccggtctgct 371
>emb|BX063800.1|CNS09LE4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC45DD04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 426 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 64 accaactatgccgccgcctactgcaccggtctgct 98
>emb|BX062102.1|CNS09K2Y Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43AH11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 857 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 336 accaactatgccgccgcctactgcaccggtctgct 370
>emb|BX061737.1|CNS09JST Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42CG12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 911 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 367 accaactatgccgccgcctactgcaccggtctgct 401
>emb|BX061348.1|CNS09JI0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42AD11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 764 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 335 accaactatgccgccgcctactgcaccggtctgct 369
>emb|BX061272.1|CNS09JFW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC41DH12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 705 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 352 accaactatgccgccgcctactgcaccggtctgct 386
>emb|BX060709.1|CNS09J09 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC41AG12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 937 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 335 accaactatgccgccgcctactgcaccggtctgct 369
>emb|BX060454.1|CNS09IT6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40DD01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 819 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 340 accaactatgccgccgcctactgcaccggtctgct 374
>emb|BX060398.1|CNS09IRM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40DA06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 721 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 344 accaactatgccgccgcctactgcaccggtctgct 378
>emb|BX060357.1|CNS09IQH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40CG08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 613 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 250 accaactatgccgccgcctactgcaccggtctgct 284
>emb|BX060171.1|CNS09ILB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40BG08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 971 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 344 accaactatgccgccgcctactgcaccggtctgct 378
>emb|BX060096.1|CNS09IJ8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40BD03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 783 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 344 accaactatgccgccgcctactgcaccggtctgct 378
>emb|BX057724.1|CNS09GPC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC37DC03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 886 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 367 accaactatgccgccgcctactgcaccggtctgct 401
>emb|BX057702.1|CNS09GOQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC37DB04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 591 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 346 accaactatgccgccgcctactgcaccggtctgct 380
>emb|BX056485.1|CNS09FQX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC35DC02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 875 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 344 accaactatgccgccgcctactgcaccggtctgct 378
>emb|BX056402.1|CNS09FOM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC35CF12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1049 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 362 accaactatgccgccgcctactgcaccggtctgct 396
>emb|BX056121.1|CNS09FGT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC35AF11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 865 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 364 accaactatgccgccgcctactgcaccggtctgct 398
>emb|BX055563.1|CNS09F1B Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC34AH10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 751 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 353 accaactatgccgccgcctactgcaccggtctgct 387
>emb|BX055539.1|CNS09F0N Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC34AG10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 902 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 353 accaactatgccgccgcctactgcaccggtctgct 387
>emb|BX054946.1|CNS09EK6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC33BD02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 703 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 342 accaactatgccgccgcctactgcaccggtctgct 376
>emb|BX053064.1|CNS09D3W Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC30CA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 530 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 174 accaactatgccgccgcctactgcaccggtctgct 208
>emb|BX054258.1|CNS09E12 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC32BD06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 942 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 339 accaactatgccgccgcctactgcaccggtctgct 373
>emb|BX054179.1|CNS09DYV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC32BA01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 910 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 359 accaactatgccgccgcctactgcaccggtctgct 393
>emb|BX052492.1|CNS09CO0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC3CD06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 984 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 360 accaactatgccgccgcctactgcaccggtctgct 394
>emb|BX052031.1|CNS09CB7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC29DG06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 848 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 290 accaactatgccgccgcctactgcaccggtctgct 324
>emb|BX051778.1|CNS09C46 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC29BE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 931 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 343 accaactatgccgccgcctactgcaccggtctgct 377
>emb|BX051308.1|CNS09BR4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC28CC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 953 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 242 accaactatgccgccgcctactgcaccggtctgct 276
>emb|BX050125.1|CNS09AU9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC26BE11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 713 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 343 accaactatgccgccgcctactgcaccggtctgct 377
>emb|BX049866.1|CNS09AN2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC26AA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 922 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Minus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 708 accaactatgccgccgcctactgcaccggtctgct 674
>emb|BX049865.1|CNS09AN1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC26AA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 954 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 349 accaactatgccgccgcctactgcaccggtctgct 383
>emb|BX048664.1|CNS099PO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC23DG10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 940 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 178 accaactatgccgccgcctactgcaccggtctgct 212
>emb|BX048642.1|CNS099P2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC23DF11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 877 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 343 accaactatgccgccgcctactgcaccggtctgct 377
>emb|BX046441.1|CNS097ZX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC20AD06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1008 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 343 accaactatgccgccgcctactgcaccggtctgct 377
>emb|BX048405.1|CNS099IH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC23CB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 830 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 366 accaactatgccgccgcctactgcaccggtctgct 400
>emb|BX048093.1|CNS0999T Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC23AA06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 797 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 365 accaactatgccgccgcctactgcaccggtctgct 399
>emb|BX047973.1|CNS0996H Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC22DC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 928 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 319 accaactatgccgccgcctactgcaccggtctgct 353
>emb|BX047820.1|CNS09928 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC22CC08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 973 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 345 accaactatgccgccgcctactgcaccggtctgct 379
>emb|BX047472.1|CNS098SK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC21DA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 963 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 361 accaactatgccgccgcctactgcaccggtctgct 395
>emb|BX046891.1|CNS098CF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC20DA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 742 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 212 accaactatgccgccgcctactgcaccggtctgct 246
>emb|BX046053.1|CNS097P5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC2BH07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 946 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 343 accaactatgccgccgcctactgcaccggtctgct 377
>emb|BX045835.1|CNS097J3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC2AF10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 963 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 356 accaactatgccgccgcctactgcaccggtctgct 390
>emb|BX044952.1|CNS096UK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC18DE05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 992 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 263 accaactatgccgccgcctactgcaccggtctgct 297
>emb|BX045309.1|CNS0974H Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC19BF03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 931 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 360 accaactatgccgccgcctactgcaccggtctgct 394
>emb|BX045229.1|CNS09729 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC19BB06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 463 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 374 accaactatgccgccgcctactgcaccggtctgct 408
>emb|BX042893.1|CNS0959D Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC15AE09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 756 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Minus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 702 accaactatgccgccgcctactgcaccggtctgct 668
>emb|BX042892.1|CNS0959C Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC15AE09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 928 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 351 accaactatgccgccgcctactgcaccggtctgct 385
>emb|BX044183.1|CNS09697 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC17CE02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 589 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 350 accaactatgccgccgcctactgcaccggtctgct 384
>emb|BX044179.1|CNS09693 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC17CD12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 981 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 352 accaactatgccgccgcctactgcaccggtctgct 386
>emb|BX043744.1|CNS095X0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC16CB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 868 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 358 accaactatgccgccgcctactgcaccggtctgct 392
>emb|BX041808.1|CNS094F8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC13BH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 801 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 358 accaactatgccgccgcctactgcaccggtctgct 392
>emb|BX041765.1|CNS094E1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC13BF04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 731 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 357 accaactatgccgccgcctactgcaccggtctgct 391
>emb|BX040982.1|CNS093SA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC12AE01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 992 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 348 accaactatgccgccgcctactgcaccggtctgct 382
>emb|BX039800.1|CNS092VG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC10BB04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 777 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 146 accaactatgccgccgcctactgcaccggtctgct 180
>emb|BX037062.1|CNS090RE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA9BE01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 970 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 344 accaactatgccgccgcctactgcaccggtctgct 378
>emb|BX036382.1|CNS0908I Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA8BA01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 358 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 105 accaactatgccgccgcctactgcaccggtctgct 139
>emb|BX036311.1|CNS0906J Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA8AD12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 569 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 363 accaactatgccgccgcctactgcaccggtctgct 397
>emb|BX036244.1|CNS0904O Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA7DH11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 947 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 357 accaactatgccgccgcctactgcaccggtctgct 391
>emb|BX036220.1|CNS09040 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA7DG09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 896 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 327 accaactatgccgccgcctactgcaccggtctgct 361
>emb|BX036176.1|CNS0902S Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA7DE09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 976 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 331 accaactatgccgccgcctactgcaccggtctgct 365
>emb|BX035828.1|CNS08ZT4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA7BD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 991 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 364 accaactatgccgccgcctactgcaccggtctgct 398
>emb|BX035130.1|CNS08Z9Q Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA6BD04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 900 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 334 accaactatgccgccgcctactgcaccggtctgct 368
>emb|BX033651.1|CNS08Y4N Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA5AH12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 555 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 356 accaactatgccgccgcctactgcaccggtctgct 390
>emb|BX033000.1|CNS08XMK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA49BA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 921 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 349 accaactatgccgccgcctactgcaccggtctgct 383
>emb|BX032517.1|CNS08X95 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA48BG04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 951 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 354 accaactatgccgccgcctactgcaccggtctgct 388
>emb|BX029959.1|CNS08VA3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA44DA07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 966 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 349 accaactatgccgccgcctactgcaccggtctgct 383
>emb|BX029742.1|CNS08V42 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA44BG08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 956 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 338 accaactatgccgccgcctactgcaccggtctgct 372
>emb|BX029726.1|CNS08V3M Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA44BF12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1048 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 360 accaactatgccgccgcctactgcaccggtctgct 394
>emb|BX029020.1|CNS08UK0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA43BF01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 993 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 142 accaactatgccgccgcctactgcaccggtctgct 176
>emb|BX028793.1|CNS08UDP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA43AA03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 994 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 350 accaactatgccgccgcctactgcaccggtctgct 384
>emb|BX028263.1|CNS08TYZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA42BA05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 920 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 337 accaactatgccgccgcctactgcaccggtctgct 371
>emb|BX027759.1|CNS08TKZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA41CB06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 741 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 368 accaactatgccgccgcctactgcaccggtctgct 402
>emb|BX027717.1|CNS08TJT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA41BH05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 964 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 335 accaactatgccgccgcctactgcaccggtctgct 369
>emb|BX027449.1|CNS08TCD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA41AD09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 855 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 298 accaactatgccgccgcctactgcaccggtctgct 332
>emb|BX027226.1|CNS08T66 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA40DC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1014 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 359 accaactatgccgccgcctactgcaccggtctgct 393
>emb|BX025392.1|CNS08RR8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA38DG12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 961 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 119 accaactatgccgccgcctactgcaccggtctgct 153
>emb|BX022858.1|CNS08PSU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA34DH01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 891 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 39 accaactatgccgccgcctactgcaccggtctgct 73
>emb|BX024660.1|CNS08R6W Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA37CH07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 364 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 77 accaactatgccgccgcctactgcaccggtctgct 111
>emb|BX024607.1|CNS08R5F Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA37CD02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 730 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 345 accaactatgccgccgcctactgcaccggtctgct 379
>emb|BX024532.1|CNS08R3C Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA37BG07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 959 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 366 accaactatgccgccgcctactgcaccggtctgct 400
>emb|BX024396.1|CNS08QZK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA37AG10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 805 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 110 accaactatgccgccgcctactgcaccggtctgct 144
>emb|BX023991.1|CNS08QOB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA36CE02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 719 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 355 accaactatgccgccgcctactgcaccggtctgct 389
>emb|BX023463.1|CNS08Q9N Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA35DE02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 721 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 365 accaactatgccgccgcctactgcaccggtctgct 399
>emb|BX021699.1|CNS08OWN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA32AG07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 975 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 355 accaactatgccgccgcctactgcaccggtctgct 389
>emb|BX021547.1|CNS08OSF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA31DG11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 756 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 370 accaactatgccgccgcctactgcaccggtctgct 404
>emb|BX021239.1|CNS08OJV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA31CA01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 704 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 370 accaactatgccgccgcctactgcaccggtctgct 404
>emb|BX021076.1|CNS08OFC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA31AH12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 887 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 358 accaactatgccgccgcctactgcaccggtctgct 392
>emb|BX020843.1|CNS08O8V Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA30DA01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 886 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 358 accaactatgccgccgcctactgcaccggtctgct 392
>emb|BX020804.1|CNS08O7S Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA30CF10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 787 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Minus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 560 accaactatgccgccgcctactgcaccggtctgct 526
>emb|BX020803.1|CNS08O7R Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA30CF10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 784 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 340 accaactatgccgccgcctactgcaccggtctgct 374
>emb|BX020685.1|CNS08O4H Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA30BH10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 616 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 105 accaactatgccgccgcctactgcaccggtctgct 139
>emb|BX020465.1|CNS08NYD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA30AE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 924 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 359 accaactatgccgccgcctactgcaccggtctgct 393
>emb|BX020377.1|CNS08NVX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA30AA07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 920 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 339 accaactatgccgccgcctactgcaccggtctgct 373
>emb|BX019012.1|CNS08MU0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA28DE05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 871 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 351 accaactatgccgccgcctactgcaccggtctgct 385
>emb|BX018509.1|CNS08MG1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA28AD12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 595 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 64 accaactatgccgccgcctactgcaccggtctgct 98
>emb|BX017649.1|CNS08LS5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA26CG09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 946 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 359 accaactatgccgccgcctactgcaccggtctgct 393
>emb|BX017470.1|CNS08LN6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA26BF01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 596 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 337 accaactatgccgccgcctactgcaccggtctgct 371
>emb|BX017008.1|CNS08LAC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA25CC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 632 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 355 accaactatgccgccgcctactgcaccggtctgct 389
>emb|BX016928.1|CNS08L84 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA25BG06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 555 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 203 accaactatgccgccgcctactgcaccggtctgct 237
>emb|BX015789.1|CNS08KCH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA23CG11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1011 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 349 accaactatgccgccgcctactgcaccggtctgct 383
>emb|BX015709.1|CNS08KA9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA23CD04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 973 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 359 accaactatgccgccgcctactgcaccggtctgct 393
>emb|BX016197.1|CNS08KNT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA24BB12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 925 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 332 accaactatgccgccgcctactgcaccggtctgct 366
>emb|BX016195.1|CNS08KNR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA24BB11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 978 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 507 accaactatgccgccgcctactgcaccggtctgct 541
>emb|BX016151.1|CNS08KMJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA24AH11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 999 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 358 accaactatgccgccgcctactgcaccggtctgct 392
>emb|BX014821.1|CNS08JLL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA22BB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 933 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 241 accaactatgccgccgcctactgcaccggtctgct 275
>emb|BX014471.1|CNS08JBV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA21DB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 633 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 102 accaactatgccgccgcctactgcaccggtctgct 136
>emb|BX014327.1|CNS08J7V Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA21CB05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 921 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 346 accaactatgccgccgcctactgcaccggtctgct 380
>emb|BX014036.1|CNS08IZS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA21AC11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 825 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 230 accaactatgccgccgcctactgcaccggtctgct 264
>emb|BX013669.1|CNS08IPL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA20CC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 678 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 102 accaactatgccgccgcctactgcaccggtctgct 136
>emb|BX013009.1|CNS08I79 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA2CD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 592 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 356 accaactatgccgccgcctactgcaccggtctgct 390
>emb|BX012170.1|CNS08HJY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA19BE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 972 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 345 accaactatgccgccgcctactgcaccggtctgct 379
>emb|BX011984.1|CNS08HES Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA19AD09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 910 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 354 accaactatgccgccgcctactgcaccggtctgct 388
>emb|BX011867.1|CNS08HBJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA18DG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 917 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 350 accaactatgccgccgcctactgcaccggtctgct 384
>emb|BX011754.1|CNS08H8E Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA18DB02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 796 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 353 accaactatgccgccgcctactgcaccggtctgct 387
>emb|BX010038.1|CNS08FWQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA16AG04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 555 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 341 accaactatgccgccgcctactgcaccggtctgct 375
>emb|BX008602.1|CNS08ESU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA14AD08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 951 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 358 accaactatgccgccgcctactgcaccggtctgct 392
>emb|BX007885.1|CNS08E8X Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA13AD10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 910 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 367 accaactatgccgccgcctactgcaccggtctgct 401
>emb|BX007280.1|CNS08DS4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA12AG08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1045 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 356 accaactatgccgccgcctactgcaccggtctgct 390
>emb|BX006576.1|CNS08D8K Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA11AE05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 996 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 114 accaactatgccgccgcctactgcaccggtctgct 148
>emb|BX005611.1|CNS08CHR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA1AF12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 901 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 360 accaactatgccgccgcctactgcaccggtctgct 394
>gb|AY130401.1| Scyliorhinus canicula ribosomal protein L5 mRNA, partial cds Length = 815 Score = 46.1 bits (23), Expect = 0.094 Identities = 35/39 (89%) Strand = Plus / Plus Query: 18 ctcaccaactatgctgcagcctactgcactggtctgctt 56 ||||||||||||||||| | || ||||||||||||||| Sbjct: 246 ctcaccaactatgctgcgtcttattgcactggtctgctt 284
>ref|XM_346313.2| PREDICTED: Rattus norvegicus similar to ribosomal protein L5 (LOC367816), mRNA Length = 969 Score = 46.1 bits (23), Expect = 0.094 Identities = 29/31 (93%) Strand = Plus / Plus Query: 24 aactatgctgcagcctactgcactggtctgc 54 ||||||||||||||||| |||||||| |||| Sbjct: 303 aactatgctgcagcctattgcactggcctgc 333
>ref|XM_319782.2| Anopheles gambiae str. PEST ENSANGP00000005182 (ENSANGG00000003995), partial mRNA Length = 750 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 283 accaactatgccgccgcctactgcaccggtctgct 317
>ref|XM_552944.1| Anopheles gambiae str. PEST ENSANGP00000025444 (ENSANGG00000003995), partial mRNA Length = 1560 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 283 accaactatgccgccgcctactgcaccggtctgct 317
>gb|AF002238.1|AF002238 Anopheles gambiae ribosomal protein L5 mRNA, complete cds Length = 1200 Score = 46.1 bits (23), Expect = 0.094 Identities = 32/35 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgct 55 ||||||||||| || ||||||||||| |||||||| Sbjct: 341 accaactatgccgccgcctactgcaccggtctgct 375
>gb|AY389938.1| Protopterus dolloi ribosomal protein L5 mRNA, partial cds Length = 815 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Plus Query: 42 tgcactggtctgcttttggctcgtcg 67 |||||||| ||||||||||||||||| Sbjct: 270 tgcactggcctgcttttggctcgtcg 295
>emb|BX060816.1|CNS09J38 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC41BD12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 990 Score = 44.1 bits (22), Expect = 0.37 Identities = 31/34 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgc 54 ||||||||||| || ||||||||||| ||||||| Sbjct: 355 accaactatgccgccgcctactgcaccggtctgc 388
>emb|BX022848.1|CNS08PSK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA34DG08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 996 Score = 44.1 bits (22), Expect = 0.37 Identities = 31/34 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgc 54 ||||||||||| || ||||||||||| ||||||| Sbjct: 362 accaactatgccgccgcctactgcaccggtctgc 395
>emb|BX020477.1|CNS08NYP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA30AF06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 752 Score = 44.1 bits (22), Expect = 0.37 Identities = 31/34 (91%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactggtctgc 54 ||||||||||| || ||||||||||| ||||||| Sbjct: 331 accaactatgccgccgcctactgcaccggtctgc 364
>gb|AF066077.1|AF066077 Helianthus annuus RPL5A-related protein (RPL5A) mRNA, complete cds Length = 894 Score = 44.1 bits (22), Expect = 0.37 Identities = 34/38 (89%) Strand = Plus / Plus Query: 18 ctcaccaactatgctgcagcctactgcactggtctgct 55 ||||||||||| ||||| || ||||||||||| ||||| Sbjct: 274 ctcaccaactacgctgccgcttactgcactggcctgct 311
>gb|BC106128.1| Mus musculus ribosomal protein L5, mRNA (cDNA clone MGC:117998 IMAGE:2651407), complete cds Length = 986 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 27 tatgctgcagcctactgcactggtctgct 55 |||||||||||||| |||||||| ||||| Sbjct: 307 tatgctgcagcctattgcactggcctgct 335
>gb|BC083318.1| Mus musculus ribosomal protein L5, mRNA (cDNA clone MGC:101934 IMAGE:6818756), complete cds Length = 1033 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 27 tatgctgcagcctactgcactggtctgct 55 |||||||||||||| |||||||| ||||| Sbjct: 339 tatgctgcagcctattgcactggcctgct 367
>gb|AC084780.10| Mus musculus chromosome 5, clone RP23-212N20, complete sequence Length = 234357 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 27 tatgctgcagcctactgcactggtctgct 55 |||||||||||||| |||||||| ||||| Sbjct: 954 tatgctgcagcctattgcactggcctgct 982
>gb|BC076208.1| Danio rerio ribosomal protein L5b, mRNA (cDNA clone MGC:92728 IMAGE:7075897), complete cds Length = 1044 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 27 tatgctgcagcctactgcactggtctgct 55 |||||||| |||||||||||||| ||||| Sbjct: 361 tatgctgctgcctactgcactgggctgct 389
>gb|BC071498.1| Danio rerio ribosomal protein L5b, mRNA (cDNA clone MGC:86854 IMAGE:6902957), complete cds Length = 1069 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 27 tatgctgcagcctactgcactggtctgct 55 |||||||| |||||||||||||| ||||| Sbjct: 361 tatgctgctgcctactgcactgggctgct 389
>gb|AC166779.3| Mus musculus chromosome 18, clone RP23-399N10, complete sequence Length = 200851 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Minus Query: 27 tatgctgcagcctactgcactggtctgct 55 |||||||||||||| |||||||| ||||| Sbjct: 15221 tatgctgcagcctattgcactggcctgct 15193
>ref|NM_016980.1| Mus musculus ribosomal protein L5 (Rpl5), mRNA Length = 1015 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 27 tatgctgcagcctactgcactggtctgct 55 |||||||||||||| |||||||| ||||| Sbjct: 337 tatgctgcagcctattgcactggcctgct 365
>gb|AC134595.3| Mus musculus BAC clone RP23-388E14 from chromosome 15, complete sequence Length = 189263 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Minus Query: 27 tatgctgcagcctactgcactggtctgct 55 |||||||||||||| |||||||| ||||| Sbjct: 183066 tatgctgcagcctattgcactggcctgct 183038
>ref|NM_001002106.1| Danio rerio ribosomal protein L5b (rpl5b), mRNA Length = 1069 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 27 tatgctgcagcctactgcactggtctgct 55 |||||||| |||||||||||||| ||||| Sbjct: 361 tatgctgctgcctactgcactgggctgct 389
>ref|XM_001005224.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L5 (LOC673295), mRNA Length = 528 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 27 tatgctgcagcctactgcactggtctgct 55 |||||||||||||| |||||||| ||||| Sbjct: 283 tatgctgcagcctattgcactggcctgct 311
>gb|BC067999.1| Xenopus tropicalis ubiquitin protein ligase E3A (human papilloma virus E6-associated protein, Angelman syndrome), mRNA (cDNA clone MGC:69536 IMAGE:5336627), complete cds Length = 2948 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 95 ggagtatgaaggcaatgttga 115 ||||||||||||||||||||| Sbjct: 2274 ggagtatgaaggcaatgttga 2294
>gb|AC124467.3| Mus musculus BAC clone RP24-163L18 from chromosome 15, complete sequence Length = 169366 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 27 tatgctgcagcctactgcactggtctgct 55 |||||||||||||| |||||||| ||||| Sbjct: 120162 tatgctgcagcctattgcactggcctgct 120190
>ref|XR_004839.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L5 (LOC675821), mRNA Length = 1002 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 27 tatgctgcagcctactgcactggtctgct 55 |||||||||||||| |||||||| ||||| Sbjct: 329 tatgctgcagcctattgcactggcctgct 357
>ref|XR_002121.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L5 (LOC668032), mRNA Length = 1002 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 27 tatgctgcagcctactgcactggtctgct 55 |||||||||||||| |||||||| ||||| Sbjct: 329 tatgctgcagcctattgcactggcctgct 357
>ref|XR_002783.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L5 (LOC633631), mRNA Length = 932 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 27 tatgctgcagcctactgcactggtctgct 55 |||||||||||||| |||||||| ||||| Sbjct: 282 tatgctgcagcctattgcactggcctgct 310
>ref|XM_907186.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L5 (LOC632900), mRNA Length = 432 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 27 tatgctgcagcctactgcactggtctgct 55 |||||||||||||| |||||||| ||||| Sbjct: 283 tatgctgcagcctattgcactggcctgct 311
>ref|XM_979543.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L5 (LOC632900), mRNA Length = 432 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 27 tatgctgcagcctactgcactggtctgct 55 |||||||||||||| |||||||| ||||| Sbjct: 283 tatgctgcagcctattgcactggcctgct 311
>ref|XM_976689.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L5 (LOC665407), mRNA Length = 1059 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 27 tatgctgcagcctactgcactggtctgct 55 |||||||||||||| |||||||| ||||| Sbjct: 363 tatgctgcagcctattgcactggcctgct 391
>emb|BX548019.36| Zebrafish DNA sequence from clone DKEY-20D1 in linkage group 6, complete sequence Length = 202848 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Minus Query: 27 tatgctgcagcctactgcactggtctgct 55 |||||||| |||||||||||||| ||||| Sbjct: 43113 tatgctgctgcctactgcactgggctgct 43085
>gb|AC126410.12| Mus musculus chromosome 5, clone RP23-368H6, complete sequence Length = 187058 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 27 tatgctgcagcctactgcactggtctgct 55 |||||||||||||| |||||||| ||||| Sbjct: 51238 tatgctgcagcctattgcactggcctgct 51266
>gb|AC122915.2| Mus musculus BAC clone RP23-27G7 from 5, complete sequence Length = 220145 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 27 tatgctgcagcctactgcactggtctgct 55 |||||||||||||| |||||||| ||||| Sbjct: 49047 tatgctgcagcctattgcactggcctgct 49075
>gb|AC121789.2| Mus musculus BAC clone RP23-398C14 from 1, complete sequence Length = 181157 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 27 tatgctgcagcctactgcactggtctgct 55 |||||||||||||| |||||||| ||||| Sbjct: 121669 tatgctgcagcctattgcactggcctgct 121697
>ref|NM_001001213.1| Xenopus tropicalis ubiquitin protein ligase E3A (human papilloma virus E6-associated protein, Angelman syndrome) (ube3a), mRNA Length = 2948 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 95 ggagtatgaaggcaatgttga 115 ||||||||||||||||||||| Sbjct: 2274 ggagtatgaaggcaatgttga 2294
>emb|AL645923.14| Mouse DNA sequence from clone RP23-75H1 on chromosome 13 Contains three vomeronasal 1 receptor, H (V1rh) pseudogenes, a V1ri pseudogene, a ribosomal protein L5 (RPL5) pseudogene, the V1rh9, V1rh10 and V1rh20 genes for vomeronasal 1 receptors H9, H10 and H20, the gene for a novel vomeronasal 1 receptor, H (V1rh) family member and a novel gene, complete sequence Length = 157361 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 27 tatgctgcagcctactgcactggtctgct 55 |||||||||||||| |||||||| ||||| Sbjct: 57908 tatgctgcagcctattgcactggcctgct 57936
>gb|BC026934.1| Mus musculus ribosomal protein L5, mRNA (cDNA clone MGC:25420 IMAGE:2651564), complete cds Length = 1015 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 27 tatgctgcagcctactgcactggtctgct 55 |||||||||||||| |||||||| ||||| Sbjct: 337 tatgctgcagcctattgcactggcctgct 365
>ref|NM_001007318.1| Danio rerio zgc:92173 (zgc:92173), mRNA Length = 4093 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 95 ggagtatgaaggcaatgttga 115 ||||||||||||||||||||| Sbjct: 2140 ggagtatgaaggcaatgttga 2160
>gb|BC085646.1| Danio rerio zgc:92173, mRNA (cDNA clone MGC:92173 IMAGE:7050907), complete cds Length = 4093 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 95 ggagtatgaaggcaatgttga 115 ||||||||||||||||||||| Sbjct: 2140 ggagtatgaaggcaatgttga 2160
>gb|AC083836.6| Homo sapiens, clone RP11-90D11, complete sequence Length = 173428 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 118 ccactggtgaggacttctctg 138 ||||||||||||||||||||| Sbjct: 64839 ccactggtgaggacttctctg 64859
>dbj|AK152381.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched library, clone:I830067I12 product:ribosomal protein L5, full insert sequence Length = 1023 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 27 tatgctgcagcctactgcactggtctgct 55 |||||||||||||| |||||||| ||||| Sbjct: 356 tatgctgcagcctattgcactggcctgct 384
>dbj|AK169313.1| Mus musculus 17 days embryo kidney cDNA, RIKEN full-length enriched library, clone:I920182J09 product:ribosomal protein L5, full insert sequence Length = 1021 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 27 tatgctgcagcctactgcactggtctgct 55 |||||||||||||| |||||||| ||||| Sbjct: 357 tatgctgcagcctattgcactggcctgct 385
>emb|BX571699.10| Zebrafish DNA sequence from clone DKEYP-116G9 in linkage group 6, complete sequence Length = 173467 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 27 tatgctgcagcctactgcactggtctgct 55 |||||||| |||||||||||||| ||||| Sbjct: 96581 tatgctgctgcctactgcactgggctgct 96609
>dbj|AK166865.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched library, clone:I1C0019E04 product:ribosomal protein L5, full insert sequence Length = 983 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 27 tatgctgcagcctactgcactggtctgct 55 |||||||||||||| |||||||| ||||| Sbjct: 318 tatgctgcagcctattgcactggcctgct 346
>dbj|AK088036.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN full-length enriched library, clone:E430002K12 product:ribosomal protein L5, full insert sequence Length = 1023 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 27 tatgctgcagcctactgcactggtctgct 55 |||||||||||||| |||||||| ||||| Sbjct: 359 tatgctgcagcctattgcactggcctgct 387
>dbj|AK013107.1| Mus musculus 10, 11 days embryo whole body cDNA, RIKEN full-length enriched library, clone:2810417J10 product:ribosomal protein L5, full insert sequence Length = 1021 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 27 tatgctgcagcctactgcactggtctgct 55 |||||||||||||| |||||||| ||||| Sbjct: 357 tatgctgcagcctattgcactggcctgct 385
>dbj|AK008489.1| Mus musculus adult male small intestine cDNA, RIKEN full-length enriched library, clone:2010300E13 product:ribosomal protein L5, full insert sequence Length = 1024 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 27 tatgctgcagcctactgcactggtctgct 55 |||||||||||||| |||||||| ||||| Sbjct: 360 tatgctgcagcctattgcactggcctgct 388
>gb|BC091752.1| Mus musculus ribosomal protein L5, mRNA (cDNA clone MGC:102309 IMAGE:4208431), complete cds Length = 1024 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 27 tatgctgcagcctactgcactggtctgct 55 |||||||||||||| |||||||| ||||| Sbjct: 337 tatgctgcagcctattgcactggcctgct 365
>emb|CR388007.7| Zebrafish DNA sequence from clone DKEY-22G9 in linkage group 6, complete sequence Length = 221983 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 95 ggagtatgaaggcaatgttga 115 ||||||||||||||||||||| Sbjct: 108300 ggagtatgaaggcaatgttga 108320
>gb|AY713114.1| Ithomia xenos xenos voucher 8004 ribosomal protein L5 (L5) gene, partial cds Length = 700 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactgg 49 |||||||||||||| || ||||||||||| Sbjct: 288 accaactatgctgctgcatactgcactgg 316
>gb|AY713113.1| Ithomia iphianassa n. ssp. RM-2005 voucher 8914 ribosomal protein L5 (L5) gene, partial cds Length = 679 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactgg 49 |||||||||||||| || ||||||||||| Sbjct: 293 accaactatgctgctgcatactgcactgg 321
>gb|AY713112.1| Ithomia xenos xenos voucher 8332 ribosomal protein L5 (L5) gene, partial cds Length = 700 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 21 accaactatgctgcagcctactgcactgg 49 |||||||||||||| || ||||||||||| Sbjct: 288 accaactatgctgctgcatactgcactgg 316 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,019,731 Number of Sequences: 3902068 Number of extensions: 3019731 Number of successful extensions: 49266 Number of sequences better than 10.0: 288 Number of HSP's better than 10.0 without gapping: 287 Number of HSP's successfully gapped in prelim test: 1 Number of HSP's that attempted gapping in prelim test: 48850 Number of HSP's gapped (non-prelim): 401 length of query: 430 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 408 effective length of database: 17,147,199,772 effective search space: 6996057506976 effective search space used: 6996057506976 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
