ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags8g11
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|XM_465290.1| Oryza sativa (japonica cultivar-group), mRNA 82 7e-13
2dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 82 7e-13
3dbj|AP004789.3| Oryza sativa (japonica cultivar-group) genomic D... 82 7e-13
4ref|NM_127716.2| Arabidopsis thaliana RNA binding / nucleic acid... 42 0.63
5gb|AY059760.1| Arabidopsis thaliana unknown protein (At2g21440) ... 42 0.63
6gb|AC006841.7| Arabidopsis thaliana chromosome 2 clone F3K23 map... 42 0.63
7gb|BT003003.1| Arabidopsis thaliana clone U10992 unknown protein... 42 0.63
8ref|NM_106722.2| Arabidopsis thaliana CMT1 (CHROMOMETHYLASE 1); ... 38 9.9
9gb|AY436699.1| Human rhinovirus sp. strain 9316 polymerase (3D) ... 38 9.9
10ref|XM_956960.1| Neurospora crassa OR74A hypothetical protein (N... 38 9.9
11ref|XM_330958.1| Neurospora crassa OR74A hypothetical protein (N... 38 9.9
12gb|AC087801.69| Mus musculus strain C57BL/6J clone rp23-396i23 m... 38 9.9
13gb|AC125130.3| Mus musculus BAC clone RP24-309C7 from chromosome... 38 9.9
14gb|AC125074.3| Mus musculus BAC clone RP23-464N18 from chromosom... 38 9.9
15gb|AC098709.3| Mus musculus BAC clone RP23-1K14 from 1, complete... 38 9.9
16emb|BX323049.20| Zebrafish DNA sequence from clone DKEY-30L22 in... 38 9.9
17emb|AL391872.7| Human DNA sequence from clone RP11-87M1 on chrom... 38 9.9
18emb|AL929547.13| Mouse DNA sequence from clone RP23-180L23 on ch... 38 9.9
19dbj|AB239765.1| Cricetulus griseus 2BE2121 gene for hypothetical... 38 9.9
20dbj|AK161274.1| Mus musculus adult male testis cDNA, RIKEN full-... 38 9.9
21ref|NM_001033162.1| Mus musculus RIKEN cDNA 1700012A16 gene (170... 38 9.9
22gb|AF039371.1|AF039371 Arabidopsis thaliana ecotype Ler chromome... 38 9.9
23gb|AC027684.3| Homo sapiens chromosome 16 clone RP11-148F10, com... 38 9.9
24gb|AF039366.1|AF039366 Arabidopsis thaliana ecotype Kl-0 chromom... 38 9.9
25gb|AF039373.1|AF039373 Arabidopsis thaliana ecotype RLD chromome... 38 9.9
26gb|AF039374.1|AF039374 Arabidopsis suecica ecotype Sue-2(9510) c... 38 9.9
27gb|AF039372.1|AF039372 Arabidopsis thaliana ecotype No-0 chromom... 38 9.9
28gb|AF039370.1|AF039370 Arabidopsis thaliana ecotype Nd-1 chromom... 38 9.9
29gb|AF039369.1|AF039369 Arabidopsis thaliana ecotype Nd-0 chromom... 38 9.9
30gb|AF039368.1|AF039368 Arabidopsis thaliana ecotype Metz-0 chrom... 38 9.9
31gb|AF039367.1|AF039367 Arabidopsis thaliana ecotype Col-0 chromo... 38 9.9
32gb|AF039364.1|AF039364 Arabidopsis thaliana ecotype Kl-0 chromom... 38 9.9
33dbj|AK005886.1| Mus musculus adult male testis cDNA, RIKEN full-... 38 9.9
34gb|BC113157.1| Mus musculus RIKEN cDNA 1700012A16 gene, mRNA (cD... 38 9.9
35gb|AC093515.4| Homo sapiens chromosome 16 clone CTD-2535I10, com... 38 9.9
36gb|AF111216.1|AF111216 Cyprinella caerulea NADH dehydrogenase su... 38 9.9
37dbj|AB024027.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 38 9.9
38gb|AC011713.2|F23A5 Arabidopsis thaliana chromosome 1 BAC F23A5 ... 38 9.9
39gb|AC009294.8|AC009294 Homo sapiens chromosome 11, clone 579_H_1... 38 9.9
40dbj|AP002963.3| Homo sapiens genomic DNA, chromosome 11 clone:RP... 38 9.9
41emb|BX005088.4| Zebrafish DNA sequence from clone CH211-160E15 i... 38 9.9
42gb|AC099712.21| Mus musculus chromosome 1, clone RP23-400C10, co... 38 9.9
43tpd|BR000241.1| TPA: TPA_exp: Cricetulus griseus Msh3, DHFR, 2BE... 38 9.9
44gb|U53501.1|ATU53501 Arabidopsis thaliana chromosome I cosmid g8... 38 9.9 
>ref|XM_465290.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 921

 Score = 81.8 bits (41), Expect = 7e-13
 Identities = 140/174 (80%)
 Strand = Plus / Plus

                                                                       
Query: 22  tgttcgtatttggaacctnccgaaaaagaagaacatacataaggacctgaacctggcttt 81
           ||||||| ||||||| || || |||||||| |||||||| ||||||||||| || |||||
Sbjct: 492 tgttcgtgtttggaatctcccaaaaaagaaaaacatacacaaggacctgaatcttgcttt 551

                                                                       
Query: 82  caaagggtttcctggcttggtaactataaacccagcanactntggaactaagaagacccg 141
           ||| || ||||| ||| | |||| |||  | |||||    | || ||  |||||||| ||
Sbjct: 552 caagggatttccaggccttgtaaatattgagccagcggtttctgcaaacaagaagactcg 611

                                                                 
Query: 142 tgatcctatttgcaagggttttgcatttgtcaaactggagtcagtggacgctgc 195
           ||||||||| |||||||||||||| | | | |||||||| || ||||| |||||
Sbjct: 612 tgatcctatatgcaagggttttgcctatcttaaactggaatctgtggaggctgc 665
to top
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 81.8 bits (41), Expect = 7e-13
 Identities = 140/174 (80%)
 Strand = Plus / Plus

                                                                            
Query: 22       tgttcgtatttggaacctnccgaaaaagaagaacatacataaggacctgaacctggcttt 81
                ||||||| ||||||| || || |||||||| |||||||| ||||||||||| || |||||
Sbjct: 13128688 tgttcgtgtttggaatctcccaaaaaagaaaaacatacacaaggacctgaatcttgcttt 13128747

                                                                            
Query: 82       caaagggtttcctggcttggtaactataaacccagcanactntggaactaagaagacccg 141
                ||| || ||||| ||| | |||| |||  | |||||    | || ||  |||||||| ||
Sbjct: 13128748 caagggatttccaggccttgtaaatattgagccagcggtttctgcaaacaagaagactcg 13128807

                                                                      
Query: 142      tgatcctatttgcaagggttttgcatttgtcaaactggagtcagtggacgctgc 195
                ||||||||| |||||||||||||| | | | |||||||| || ||||| |||||
Sbjct: 13128808 tgatcctatatgcaagggttttgcctatcttaaactggaatctgtggaggctgc 13128861
to top
>dbj|AP004789.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0476C12
          Length = 157570

 Score = 81.8 bits (41), Expect = 7e-13
 Identities = 140/174 (80%)
 Strand = Plus / Plus

                                                                          
Query: 22     tgttcgtatttggaacctnccgaaaaagaagaacatacataaggacctgaacctggcttt 81
              ||||||| ||||||| || || |||||||| |||||||| ||||||||||| || |||||
Sbjct: 105265 tgttcgtgtttggaatctcccaaaaaagaaaaacatacacaaggacctgaatcttgcttt 105324

                                                                          
Query: 82     caaagggtttcctggcttggtaactataaacccagcanactntggaactaagaagacccg 141
              ||| || ||||| ||| | |||| |||  | |||||    | || ||  |||||||| ||
Sbjct: 105325 caagggatttccaggccttgtaaatattgagccagcggtttctgcaaacaagaagactcg 105384

                                                                    
Query: 142    tgatcctatttgcaagggttttgcatttgtcaaactggagtcagtggacgctgc 195
              ||||||||| |||||||||||||| | | | |||||||| || ||||| |||||
Sbjct: 105385 tgatcctatatgcaagggttttgcctatcttaaactggaatctgtggaggctgc 105438
to top
>ref|NM_127716.2| Arabidopsis thaliana RNA binding / nucleic acid binding AT2G21440
            mRNA, complete cds
          Length = 3265

 Score = 42.1 bits (21), Expect = 0.63
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 155  aagggttttgcatttgtcaaa 175
            |||||||||||||||||||||
Sbjct: 1215 aagggttttgcatttgtcaaa 1235
to top
>gb|AY059760.1| Arabidopsis thaliana unknown protein (At2g21440) mRNA, complete cds
          Length = 3300

 Score = 42.1 bits (21), Expect = 0.63
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 155  aagggttttgcatttgtcaaa 175
            |||||||||||||||||||||
Sbjct: 1215 aagggttttgcatttgtcaaa 1235
to top
>gb|AC006841.7| Arabidopsis thaliana chromosome 2 clone F3K23 map mi148, complete
             sequence
          Length = 125045

 Score = 42.1 bits (21), Expect = 0.63
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 155   aagggttttgcatttgtcaaa 175
             |||||||||||||||||||||
Sbjct: 73455 aagggttttgcatttgtcaaa 73435
to top
>gb|BT003003.1| Arabidopsis thaliana clone U10992 unknown protein (At2g21440) mRNA,
            complete cds
          Length = 3043

 Score = 42.1 bits (21), Expect = 0.63
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 155  aagggttttgcatttgtcaaa 175
            |||||||||||||||||||||
Sbjct: 1114 aagggttttgcatttgtcaaa 1134
to top
>ref|NM_106722.2| Arabidopsis thaliana CMT1 (CHROMOMETHYLASE 1); DNA binding /
            chromatin binding AT1G80740 (CMT1) mRNA, complete cds
          Length = 2593

 Score = 38.2 bits (19), Expect = 9.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 79   tttcaaagggtttcctggc 97
            |||||||||||||||||||
Sbjct: 1400 tttcaaagggtttcctggc 1418
to top
>gb|AY436699.1| Human rhinovirus sp. strain 9316 polymerase (3D) mRNA, partial cds
          Length = 468

 Score = 38.2 bits (19), Expect = 9.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 53  aacatacataaggacctga 71
           |||||||||||||||||||
Sbjct: 344 aacatacataaggacctga 326
to top
>ref|XM_956960.1| Neurospora crassa OR74A hypothetical protein (NCU08842.1) partial
           mRNA
          Length = 1443

 Score = 38.2 bits (19), Expect = 9.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 8   gatgatggcgttcatgttc 26
           |||||||||||||||||||
Sbjct: 558 gatgatggcgttcatgttc 540
to top
>ref|XM_330958.1| Neurospora crassa OR74A hypothetical protein (NCU08842.1) partial
           mRNA
          Length = 1443

 Score = 38.2 bits (19), Expect = 9.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 8   gatgatggcgttcatgttc 26
           |||||||||||||||||||
Sbjct: 558 gatgatggcgttcatgttc 540
to top
>gb|AC087801.69| Mus musculus strain C57BL/6J clone rp23-396i23 map 1, complete sequence
          Length = 197679

 Score = 38.2 bits (19), Expect = 9.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 43    gaaaaagaagaacatacat 61
             |||||||||||||||||||
Sbjct: 84372 gaaaaagaagaacatacat 84390
to top
>gb|AC125130.3| Mus musculus BAC clone RP24-309C7 from chromosome 14, complete sequence
          Length = 159361

 Score = 38.2 bits (19), Expect = 9.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 156    agggttttgcatttgtcaa 174
              |||||||||||||||||||
Sbjct: 117032 agggttttgcatttgtcaa 117014
to top
>gb|AC125074.3| Mus musculus BAC clone RP23-464N18 from chromosome 14, complete sequence
          Length = 181200

 Score = 38.2 bits (19), Expect = 9.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 156    agggttttgcatttgtcaa 174
              |||||||||||||||||||
Sbjct: 178742 agggttttgcatttgtcaa 178760
to top
>gb|AC098709.3| Mus musculus BAC clone RP23-1K14 from 1, complete sequence
          Length = 189774

 Score = 38.2 bits (19), Expect = 9.9
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 59    cataaggacctgaacctggcttt 81
             ||||| |||||||||||||||||
Sbjct: 31319 cataatgacctgaacctggcttt 31297
to top
>emb|BX323049.20| Zebrafish DNA sequence from clone DKEY-30L22 in linkage group 9, complete
              sequence
          Length = 214040

 Score = 38.2 bits (19), Expect = 9.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 160    ttttgcatttgtcaaactg 178
              |||||||||||||||||||
Sbjct: 172782 ttttgcatttgtcaaactg 172800
to top
>emb|AL391872.7| Human DNA sequence from clone RP11-87M1 on chromosome 9 Contains a
             ribosomal protein L4 (HRPL4) (RPL4) pseudogene, complete
             sequence
          Length = 175952

 Score = 38.2 bits (19), Expect = 9.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 54    acatacataaggacctgaa 72
             |||||||||||||||||||
Sbjct: 57338 acatacataaggacctgaa 57356
to top
>emb|AL929547.13| Mouse DNA sequence from clone RP23-180L23 on chromosome 11 Contains
             part of a novel gene and a CpG island, complete sequence
          Length = 218414

 Score = 38.2 bits (19), Expect = 9.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 54    acatacataaggacctgaa 72
             |||||||||||||||||||
Sbjct: 60890 acatacataaggacctgaa 60908
to top
>dbj|AB239765.1| Cricetulus griseus 2BE2121 gene for hypothetical protein, partial cds
          Length = 52638

 Score = 38.2 bits (19), Expect = 9.9
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 165  catttgtcaaactggagtcagtg 187
            ||||||||| |||||||||||||
Sbjct: 2755 catttgtcagactggagtcagtg 2777
to top
>dbj|AK161274.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
            library, clone:4922505A09 product:similar to GE36 [Homo
            sapiens], full insert sequence
          Length = 2046

 Score = 38.2 bits (19), Expect = 9.9
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 59   cataaggacctgaacctggcttt 81
            ||||| |||||||||||||||||
Sbjct: 1193 cataatgacctgaacctggcttt 1215
to top
>ref|NM_001033162.1| Mus musculus RIKEN cDNA 1700012A16 gene (1700012A16Rik), mRNA
          Length = 2046

 Score = 38.2 bits (19), Expect = 9.9
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 59   cataaggacctgaacctggcttt 81
            ||||| |||||||||||||||||
Sbjct: 1193 cataatgacctgaacctggcttt 1215
to top
>gb|AF039371.1|AF039371 Arabidopsis thaliana ecotype Ler chromomethylase (CMT1) gene,
            complete cds
          Length = 9643

 Score = 38.2 bits (19), Expect = 9.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 79   tttcaaagggtttcctggc 97
            |||||||||||||||||||
Sbjct: 2720 tttcaaagggtttcctggc 2738
to top
>gb|AC027684.3| Homo sapiens chromosome 16 clone RP11-148F10, complete sequence
          Length = 187520

 Score = 38.2 bits (19), Expect = 9.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 75    tggctttcaaagggtttcc 93
             |||||||||||||||||||
Sbjct: 92170 tggctttcaaagggtttcc 92188
to top
>gb|AF039366.1|AF039366 Arabidopsis thaliana ecotype Kl-0 chromomethylase (CMT1) gene,
            complete cds
          Length = 4896

 Score = 38.2 bits (19), Expect = 9.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 79   tttcaaagggtttcctggc 97
            |||||||||||||||||||
Sbjct: 2697 tttcaaagggtttcctggc 2715
to top
>gb|AF039373.1|AF039373 Arabidopsis thaliana ecotype RLD chromomethylase (CMT1) gene,
            complete cds
          Length = 9642

 Score = 38.2 bits (19), Expect = 9.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 79   tttcaaagggtttcctggc 97
            |||||||||||||||||||
Sbjct: 2720 tttcaaagggtttcctggc 2738
to top
>gb|AF039374.1|AF039374 Arabidopsis suecica ecotype Sue-2(9510) chromomethylase (CMT1) gene,
            partial cds
          Length = 4364

 Score = 38.2 bits (19), Expect = 9.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 79   tttcaaagggtttcctggc 97
            |||||||||||||||||||
Sbjct: 2720 tttcaaagggtttcctggc 2738
to top
>gb|AF039372.1|AF039372 Arabidopsis thaliana ecotype No-0 chromomethylase (CMT1) gene,
            complete cds
          Length = 9643

 Score = 38.2 bits (19), Expect = 9.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 79   tttcaaagggtttcctggc 97
            |||||||||||||||||||
Sbjct: 2720 tttcaaagggtttcctggc 2738
to top
>gb|AF039370.1|AF039370 Arabidopsis thaliana ecotype Nd-1 chromomethylase (CMT1) gene,
            complete cds
          Length = 4920

 Score = 38.2 bits (19), Expect = 9.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 79   tttcaaagggtttcctggc 97
            |||||||||||||||||||
Sbjct: 2720 tttcaaagggtttcctggc 2738
to top
>gb|AF039369.1|AF039369 Arabidopsis thaliana ecotype Nd-0 chromomethylase (CMT1) gene,
            partial cds
          Length = 4364

 Score = 38.2 bits (19), Expect = 9.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 79   tttcaaagggtttcctggc 97
            |||||||||||||||||||
Sbjct: 2720 tttcaaagggtttcctggc 2738
to top
>gb|AF039368.1|AF039368 Arabidopsis thaliana ecotype Metz-0 chromomethylase (CMT1) gene,
            complete cds
          Length = 4614

 Score = 38.2 bits (19), Expect = 9.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 79   tttcaaagggtttcctggc 97
            |||||||||||||||||||
Sbjct: 2695 tttcaaagggtttcctggc 2713
to top
>gb|AF039367.1|AF039367 Arabidopsis thaliana ecotype Col-0 chromomethylase (CMT1) gene,
            complete cds
          Length = 4595

 Score = 38.2 bits (19), Expect = 9.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 79   tttcaaagggtttcctggc 97
            |||||||||||||||||||
Sbjct: 2675 tttcaaagggtttcctggc 2693
to top
>gb|AF039364.1|AF039364 Arabidopsis thaliana ecotype Kl-0 chromomethylase (CMT1) mRNA,
            complete cds
          Length = 2531

 Score = 38.2 bits (19), Expect = 9.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 79   tttcaaagggtttcctggc 97
            |||||||||||||||||||
Sbjct: 1400 tttcaaagggtttcctggc 1418
to top
>dbj|AK005886.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
            library, clone:1700012A16 product:similar to GE36 [Homo
            sapiens], full insert sequence
          Length = 2042

 Score = 38.2 bits (19), Expect = 9.9
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 59   cataaggacctgaacctggcttt 81
            ||||| |||||||||||||||||
Sbjct: 1189 cataatgacctgaacctggcttt 1211
to top
>gb|BC113157.1| Mus musculus RIKEN cDNA 1700012A16 gene, mRNA (cDNA clone MGC:130601
            IMAGE:40058375), complete cds
          Length = 1982

 Score = 38.2 bits (19), Expect = 9.9
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 59   cataaggacctgaacctggcttt 81
            ||||| |||||||||||||||||
Sbjct: 1239 cataatgacctgaacctggcttt 1261
to top
>gb|AC093515.4| Homo sapiens chromosome 16 clone CTD-2535I10, complete sequence
          Length = 184182

 Score = 38.2 bits (19), Expect = 9.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 75     tggctttcaaagggtttcc 93
              |||||||||||||||||||
Sbjct: 155616 tggctttcaaagggtttcc 155634
to top
>gb|AF111216.1|AF111216 Cyprinella caerulea NADH dehydrogenase subunit 2 (ND2) gene,
           mitochondrial gene encoding mitochondrial protein,
           complete cds
          Length = 1044

 Score = 38.2 bits (19), Expect = 9.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 139 ccgtgatcctatttgcaag 157
           |||||||||||||||||||
Sbjct: 203 ccgtgatcctatttgcaag 221
to top
>dbj|AB024027.1| Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K18B18
          Length = 35896

 Score = 38.2 bits (19), Expect = 9.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 44   aaaaagaagaacatacata 62
            |||||||||||||||||||
Sbjct: 1267 aaaaagaagaacatacata 1285
to top
>gb|AC011713.2|F23A5 Arabidopsis thaliana chromosome 1 BAC F23A5 sequence, complete sequence
          Length = 109694

 Score = 38.2 bits (19), Expect = 9.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 79    tttcaaagggtttcctggc 97
             |||||||||||||||||||
Sbjct: 29051 tttcaaagggtttcctggc 29069
to top
>gb|AC009294.8|AC009294 Homo sapiens chromosome 11, clone 579_H_17, complete sequence
          Length = 211316

 Score = 38.2 bits (19), Expect = 9.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 79    tttcaaagggtttcctggc 97
             |||||||||||||||||||
Sbjct: 19301 tttcaaagggtttcctggc 19319
to top
>dbj|AP002963.3| Homo sapiens genomic DNA, chromosome 11 clone:RP11-97I14, complete
             sequence
          Length = 183204

 Score = 38.2 bits (19), Expect = 9.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 79    tttcaaagggtttcctggc 97
             |||||||||||||||||||
Sbjct: 94649 tttcaaagggtttcctggc 94631
to top
>emb|BX005088.4| Zebrafish DNA sequence from clone CH211-160E15 in linkage group 9,
             complete sequence
          Length = 193489

 Score = 38.2 bits (19), Expect = 9.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 160   ttttgcatttgtcaaactg 178
             |||||||||||||||||||
Sbjct: 74005 ttttgcatttgtcaaactg 73987
to top
>gb|AC099712.21| Mus musculus chromosome 1, clone RP23-400C10, complete sequence
          Length = 196059

 Score = 38.2 bits (19), Expect = 9.9
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 59    cataaggacctgaacctggcttt 81
             ||||| |||||||||||||||||
Sbjct: 60666 cataatgacctgaacctggcttt 60688
to top
>tpd|BR000241.1| TPA: TPA_exp: Cricetulus griseus Msh3, DHFR, 2BE2121 genes for MutS
             homolog 3, dihydrofolate reductase, hypothetical protein,
             partial and complete cds
          Length = 121368

 Score = 38.2 bits (19), Expect = 9.9
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 165   catttgtcaaactggagtcagtg 187
             ||||||||| |||||||||||||
Sbjct: 71485 catttgtcagactggagtcagtg 71507
to top
>gb|U53501.1|ATU53501 Arabidopsis thaliana chromosome I cosmid g8261 DNA (cytosine-5-)
            methyltransferase, zinc finger protein 1, nucleoporin 98,
            poly A+ RNA export protein, plasma membrane ATPase 2, and
            serine/threonine protein kinase genes, complete cds
          Length = 37570

 Score = 38.2 bits (19), Expect = 9.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 79   tttcaaagggtttcctggc 97
            |||||||||||||||||||
Sbjct: 2207 tttcaaagggtttcctggc 2189


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,677,008
Number of Sequences: 3902068
Number of extensions: 1677008
Number of successful extensions: 108510
Number of sequences better than 10.0: 44
Number of HSP's better than 10.0 without gapping: 44
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 108402
Number of HSP's gapped (non-prelim): 108
length of query: 199
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 177
effective length of database: 17,147,199,772
effective search space: 3035054359644
effective search space used: 3035054359644
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top