Clone Information

BLAST Search Result

Clone Name	bags8g06
Clone Library Name	barley_pub

No.	Definition	Score (bits)	E Value
1	dbj\|AK121389.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	178	1e-41
2	dbj\|AK103910.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	178	1e-41
3	gb\|AY106157.1\| Zea mays PCO066687 mRNA sequence	159	1e-35
4	gb\|AY104332.1\| Zea mays PCO109929 mRNA sequence	90	1e-14
5	gb\|DP000009.1\| Oryza sativa (japonica cultivar-group) chromosome 3	66	1e-07
6	dbj\|AP008209.1\| Oryza sativa (japonica cultivar-group) genomic D...	66	1e-07
7	gb\|AC137076.1\| Genomic sequence for Oryza sativa, Nipponbare str...	66	1e-07
8	gb\|AF088901.1\|AF088901 Lilium longiflorum actin bundling protein...	50	0.009
9	gb\|AC161260.2\| Mus musculus BAC clone RP23-448A11 from chromosom...	44	0.54
10	emb\|CT010508.10\| Mouse DNA sequence from clone RP23-250G8 on chr...	44	0.54
11	emb\|AL049575.7\|HSDJ316D7 Human DNA sequence from clone RP1-316D7...	42	2.1
12	gb\|AC096863.5\| Genomic sequence for Mus musculus, clone RP23-110...	42	2.1
13	emb\|AL732392.8\| Mouse DNA sequence from clone RP23-171G10 on chr...	42	2.1
14	ref\|XM_476343.1\| Oryza sativa (japonica cultivar-group), mRNA	40	8.5
15	gb\|AE006302.1\| Lactococcus lactis subsp. lactis IL1403 section 6...	40	8.5
16	gb\|AC135104.22\| Mus musculus strain C57BL/6J clone rp23-206l6, c...	40	8.5
17	gb\|AC115867.12\| Mus musculus chromosome 6, clone RP24-326P23, co...	40	8.5
18	gb\|AC125531.3\| Mus musculus BAC clone RP23-396D12 from chromosom...	40	8.5
19	gb\|AC122429.3\| Mus musculus BAC clone RP24-175I3 from chromosome...	40	8.5
20	ref\|XM_546150.2\| PREDICTED: Canis familiaris similar to sphingos...	40	8.5
21	gb\|AC118632.7\| Mus musculus chromosome 18, clone RP24-94D24, com...	40	8.5
22	emb\|AJ298068.1\|SWH298068 Soil-borne wheat mosaic virus ORF1, ORF...	40	8.5
23	emb\|AJ577853.1\|NTA577853 Nicotiana tabacum partial mRNA for vill...	40	8.5
24	ref\|XM_779113.1\| PREDICTED: Strongylocentrotus purpuratus simila...	40	8.5
25	emb\|BX548069.7\| Zebrafish DNA sequence from clone CH211-238G23 i...	40	8.5
26	gb\|AC128649.5\| Homo sapiens 12 BAC RP11-728G4 (Roswell Park Canc...	40	8.5
27	gb\|AC063951.22\| Homo sapiens 12 BAC RP11-219I17 (Roswell Park Ca...	40	8.5
28	gb\|AC120036.5\| Homo sapiens chromosome 8, clone RP11-1134I14, co...	40	8.5
29	gb\|AC128657.2\| Homo sapiens 12 BAC RP11-1079J22 (Roswell Park Ca...	40	8.5
30	gb\|AC112481.2\| Homo sapiens 12 BAC RP11-20L19 (Roswell Park Canc...	40	8.5
31	gb\|AC079953.28\| Homo sapiens 12 BAC RP11-399D15 (Roswell Park Ca...	40	8.5
32	gb\|AC093848.2\| Homo sapiens BAC clone RP11-486G21 from 4, comple...	40	8.5
33	gb\|AC115811.12\| Mus musculus chromosome 5, clone RP23-429M21, co...	40	8.5
34	gb\|AC090196.5\| Homo sapiens chromosome 8, clone RP11-766A10, com...	40	8.5
35	dbj\|AP008213.1\| Oryza sativa (japonica cultivar-group) genomic D...	40	8.5
36	gb\|AC007756.5\|AC007756 Drosophila melanogaster, chromosome 3R, r...	40	8.5
37	gb\|AC007757.5\|AC007757 Drosophila melanogaster, chromosome 3R, r...	40	8.5
38	gb\|AC093570.30\| Mus musculus strain C57BL/6J chromosome 5 clone ...	40	8.5
39	ref\|XM_214332.3\| PREDICTED: Rattus norvegicus similar to RIKEN c...	40	8.5
40	gb\|AC096547.1\| Homo sapiens BAC clone CTD-2016K1 from 2, complet...	40	8.5
41	dbj\|AP005869.3\| Oryza sativa (japonica cultivar-group) genomic D...	40	8.5
42	emb\|Y15177.1\|DCY15177 Daucus carota DNA fragment containing tran...	40	8.5
43	gb\|AF146278.1\|AF146278 Soil-borne rye mosaic virus strain G RNA1...	40	8.5
44	dbj\|AK066298.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	40	8.5
45	gb\|AE003730.3\| Drosophila melanogaster chromosome 3R, section 68...	40	8.5
46	gb\|AC138365.16\| Mus musculus chromosome 5, clone RP23-262B5, com...	40	8.5
47	emb\|AL645471.8\| Mouse DNA sequence from clone RP23-456M3 on chro...	40	8.5
48	emb\|AL833796.4\| Mouse DNA sequence from clone RP23-361A12 on chr...	40	8.5

>dbj|AK121389.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023128M19, full
            insert sequence
          Length = 3343

 Score =  178 bits (90), Expect = 1e-41
 Identities = 177/205 (86%), Gaps = 1/205 (0%)
 Strand = Plus / Plus

                                                                        
Query: 87   tgaagggaatgagccatgcttcttcaagnacatacttctcttgggatagcacaaaatctg 146
            |||||||||||| ||||||||||||| | || |||||||| ||||||| ||||| |||||
Sbjct: 2298 tgaagggaatgaaccatgcttcttca-gaacttacttctcctgggataacacaagatctg 2356

                                                                        
Query: 147  tgattcatgggaattcattccaaaagaaactttcacttctttttggattacgctcagagg 206
            |||||||||| |||||||| || ||||| |||||||||||||| ||| | ||||||||| 
Sbjct: 2357 tgattcatggaaattcatttcagaagaagctttcacttcttttcggaatgcgctcagaga 2416

                                                                        
Query: 207  gtgcatctaggagctctggtaatggtggacccacacaaagggcatctgcattagccgctc 266
            ||| ||||| ||| || ||| |||||||||| || || |||||||| ||||| || ||||
Sbjct: 2417 gtggatctaagagttcaggtgatggtggaccaactcagagggcatcagcattggctgctc 2476

                                     
Query: 267  tatcatctgcattcaatccatcttc 291
            | |||||||||||||| ||||||||
Sbjct: 2477 tttcatctgcattcaacccatcttc 2501



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                         
Query: 529  acgttcaggtcaagggtcacaaagagcagctgcagttgctgcgct 573
            |||| |||||||||| || ||  |||||||||| |||||||||||
Sbjct: 2625 acgtgcaggtcaaggttctcagcgagcagctgctgttgctgcgct 2669



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 48/57 (84%)
 Strand = Plus / Plus

                                                                     
Query: 424  taggcctccaagctcgggtgatggacccactcaacgcgcctctgcactggctgcctt 480
            |||||||  |||||| | || |||||||||||| ||||| || ||| ||||||||||
Sbjct: 2523 taggcctaaaagctctgatggtggacccactcagcgcgcttcagcaatggctgcctt 2579

to top

>dbj|AK103910.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033150O18, full
           insert sequence
          Length = 1711

 Score =  178 bits (90), Expect = 1e-41
 Identities = 177/205 (86%), Gaps = 1/205 (0%)
 Strand = Plus / Plus

                                                                       
Query: 87  tgaagggaatgagccatgcttcttcaagnacatacttctcttgggatagcacaaaatctg 146
           |||||||||||| ||||||||||||| | || |||||||| ||||||| ||||| |||||
Sbjct: 498 tgaagggaatgaaccatgcttcttca-gaacttacttctcctgggataacacaagatctg 556

                                                                       
Query: 147 tgattcatgggaattcattccaaaagaaactttcacttctttttggattacgctcagagg 206
           |||||||||| |||||||| || ||||| |||||||||||||| ||| | ||||||||| 
Sbjct: 557 tgattcatggaaattcatttcagaagaagctttcacttcttttcggaatgcgctcagaga 616

                                                                       
Query: 207 gtgcatctaggagctctggtaatggtggacccacacaaagggcatctgcattagccgctc 266
           ||| ||||| ||| || ||| |||||||||| || || |||||||| ||||| || ||||
Sbjct: 617 gtggatctaagagttcaggtgatggtggaccaactcagagggcatcagcattggctgctc 676

                                    
Query: 267 tatcatctgcattcaatccatcttc 291
           | |||||||||||||| ||||||||
Sbjct: 677 tttcatctgcattcaacccatcttc 701



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                        
Query: 529 acgttcaggtcaagggtcacaaagagcagctgcagttgctgcgct 573
           |||| |||||||||| || ||  |||||||||| |||||||||||
Sbjct: 825 acgtgcaggtcaaggttctcagcgagcagctgctgttgctgcgct 869



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 48/57 (84%)
 Strand = Plus / Plus

                                                                    
Query: 424 taggcctccaagctcgggtgatggacccactcaacgcgcctctgcactggctgcctt 480
           |||||||  |||||| | || |||||||||||| ||||| || ||| ||||||||||
Sbjct: 723 taggcctaaaagctctgatggtggacccactcagcgcgcttcagcaatggctgcctt 779

to top

>gb|AY106157.1| Zea mays PCO066687 mRNA sequence
          Length = 989

 Score =  159 bits (80), Expect = 1e-35
 Identities = 143/164 (87%)
 Strand = Plus / Plus

                                                                       
Query: 443 gatggacccactcaacgcgcctctgcactggctgccttgtccaatgcgtttaatccatcc 502
           ||||||||||||||||| ||||| |||||||||||||| || ||||| || || ||||||
Sbjct: 8   gatggacccactcaacgtgcctcagcactggctgccttatctaatgcattcaacccatcc 67

                                                                       
Query: 503 tcaaaaccaaaaactccacctccgtcacgttcaggtcaagggtcacaaagagcagctgca 562
           | |||||| |||||  ||||||| || || ||||||| ||| || |||||||||||||| 
Sbjct: 68  ttaaaacccaaaacatcacctccatctcgctcaggtcgaggttctcaaagagcagctgct 127

                                                       
Query: 563 gttgctgcgctatcctctgtgctgactgctgagcagtctggatc 606
           || ||||| |||||||||||||||||||||||||| ||||||||
Sbjct: 128 gtagctgctctatcctctgtgctgactgctgagcaatctggatc 171



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                           
Query: 335 gatgggcccactcaacgtgcctctgcactggctgctttgtccaatgca 382
           ||||| ||||||||||||||||| ||||||||||| || || ||||||
Sbjct: 8   gatggacccactcaacgtgcctcagcactggctgccttatctaatgca 55

to top

>gb|AY104332.1| Zea mays PCO109929 mRNA sequence
          Length = 989

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 168/208 (80%), Gaps = 1/208 (0%)
 Strand = Plus / Plus

                                                                       
Query: 87  tgaagggaatgagccatgcttcttcaagnacatacttctcttgggatagcacaaaatctg 146
           |||||||||||| || |||||||||| | |||| |||||| ||||||||||||   ||  
Sbjct: 139 tgaagggaatgaaccttgcttcttca-ggacattcttctcctgggatagcacacggtccc 197

                                                                       
Query: 147 tgattcatgggaattcattccaaaagaaactttcacttctttttggattacgctcagagg 206
           || ||||||| || || ||  | |||||||||||| ||||||| ||| | || |||||||
Sbjct: 198 tggttcatggaaactcttttgagaagaaactttcagttcttttcggaatgcgttcagagg 257

                                                                       
Query: 207 gtgcatctaggagctctggtaatggtggacccacacaaagggcatctgcattagccgctc 266
           |||    || |||||| ||| |||||||||| || ||||||||||| || || || ||||
Sbjct: 258 gtggcaataagagctcaggtgatggtggaccaactcaaagggcatcagccttggcagctc 317

                                       
Query: 267 tatcatctgcattcaatccatcttcgca 294
           | ||||| ||||| |||||||| |||||
Sbjct: 318 tttcatccgcattgaatccatcgtcgca 345

to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 69/81 (85%)
 Strand = Plus / Plus

                                                                            
Query: 211      atctaggagctctggtaatggtggacccacacaaagggcatctgcattagccgctctatc 270
                ||||| ||| || ||| |||||||||| || || |||||||| ||||| || ||||| ||
Sbjct: 13624385 atctaagagttcaggtgatggtggaccaactcagagggcatcagcattggctgctctttc 13624444

                                     
Query: 271      atctgcattcaatccatcttc 291
                |||||||||||| ||||||||
Sbjct: 13624445 atctgcattcaacccatcttc 13624465



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                           
Query: 148      gattcatgggaattcattccaaaagaaactttcacttctttttggattacgctcagagg 206
                ||||||||| |||||||| || ||||| |||||||||||||| ||| | ||||||||||
Sbjct: 13624188 gattcatggaaattcatttcagaagaagctttcacttcttttcggaatgcgctcagagg 13624246



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 55/62 (88%), Gaps = 1/62 (1%)
 Strand = Plus / Plus

                                                                            
Query: 87       tgaagggaatgagccatgcttcttcaagnacatacttctcttgggatagcacaaaatctg 146
                |||||||||||| |||||||||||| || || |||||||| ||||||| ||||| |||||
Sbjct: 13623404 tgaagggaatgaaccatgcttcttc-agaacttacttctcctgggataacacaagatctg 13623462

                  
Query: 147      tg 148
                ||
Sbjct: 13623463 tg 13623464



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                             
Query: 529      acgttcaggtcaagggtcacaaagagcagctgcagttgctgcgct 573
                |||| |||||||||| || ||  |||||||||| |||||||||||
Sbjct: 13624675 acgtgcaggtcaaggttctcagcgagcagctgctgttgctgcgct 13624719



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 48/57 (84%)
 Strand = Plus / Plus

                                                                         
Query: 424      taggcctccaagctcgggtgatggacccactcaacgcgcctctgcactggctgcctt 480
                |||||||  |||||| | || |||||||||||| ||||| || ||| ||||||||||
Sbjct: 13624573 taggcctaaaagctctgatggtggacccactcagcgcgcttcagcaatggctgcctt 13624629

to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 69/81 (85%)
 Strand = Plus / Plus

                                                                            
Query: 211      atctaggagctctggtaatggtggacccacacaaagggcatctgcattagccgctctatc 270
                ||||| ||| || ||| |||||||||| || || |||||||| ||||| || ||||| ||
Sbjct: 13619360 atctaagagttcaggtgatggtggaccaactcagagggcatcagcattggctgctctttc 13619419

                                     
Query: 271      atctgcattcaatccatcttc 291
                |||||||||||| ||||||||
Sbjct: 13619420 atctgcattcaacccatcttc 13619440



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                           
Query: 148      gattcatgggaattcattccaaaagaaactttcacttctttttggattacgctcagagg 206
                ||||||||| |||||||| || ||||| |||||||||||||| ||| | ||||||||||
Sbjct: 13619163 gattcatggaaattcatttcagaagaagctttcacttcttttcggaatgcgctcagagg 13619221



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 55/62 (88%), Gaps = 1/62 (1%)
 Strand = Plus / Plus

                                                                            
Query: 87       tgaagggaatgagccatgcttcttcaagnacatacttctcttgggatagcacaaaatctg 146
                |||||||||||| |||||||||||| || || |||||||| ||||||| ||||| |||||
Sbjct: 13618379 tgaagggaatgaaccatgcttcttc-agaacttacttctcctgggataacacaagatctg 13618437

                  
Query: 147      tg 148
                ||
Sbjct: 13618438 tg 13618439



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                             
Query: 529      acgttcaggtcaagggtcacaaagagcagctgcagttgctgcgct 573
                |||| |||||||||| || ||  |||||||||| |||||||||||
Sbjct: 13619650 acgtgcaggtcaaggttctcagcgagcagctgctgttgctgcgct 13619694



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 48/57 (84%)
 Strand = Plus / Plus

                                                                         
Query: 424      taggcctccaagctcgggtgatggacccactcaacgcgcctctgcactggctgcctt 480
                |||||||  |||||| | || |||||||||||| ||||| || ||| ||||||||||
Sbjct: 13619548 taggcctaaaagctctgatggtggacccactcagcgcgcttcagcaatggctgcctt 13619604

to top

>gb|AC137076.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBb0033D20, from chromosome 3, complete sequence
          Length = 128707

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 69/81 (85%)
 Strand = Plus / Plus

                                                                         
Query: 211   atctaggagctctggtaatggtggacccacacaaagggcatctgcattagccgctctatc 270
             ||||| ||| || ||| |||||||||| || || |||||||| ||||| || ||||| ||
Sbjct: 15057 atctaagagttcaggtgatggtggaccaactcagagggcatcagcattggctgctctttc 15116

                                  
Query: 271   atctgcattcaatccatcttc 291
             |||||||||||| ||||||||
Sbjct: 15117 atctgcattcaacccatcttc 15137



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                        
Query: 148   gattcatgggaattcattccaaaagaaactttcacttctttttggattacgctcagagg 206
             ||||||||| |||||||| || ||||| |||||||||||||| ||| | ||||||||||
Sbjct: 14860 gattcatggaaattcatttcagaagaagctttcacttcttttcggaatgcgctcagagg 14918



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 55/62 (88%), Gaps = 1/62 (1%)
 Strand = Plus / Plus

                                                                         
Query: 87    tgaagggaatgagccatgcttcttcaagnacatacttctcttgggatagcacaaaatctg 146
             |||||||||||| |||||||||||| || || |||||||| ||||||| ||||| |||||
Sbjct: 14076 tgaagggaatgaaccatgcttcttc-agaacttacttctcctgggataacacaagatctg 14134

               
Query: 147   tg 148
             ||
Sbjct: 14135 tg 14136



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                          
Query: 529   acgttcaggtcaagggtcacaaagagcagctgcagttgctgcgct 573
             |||| |||||||||| || ||  |||||||||| |||||||||||
Sbjct: 15347 acgtgcaggtcaaggttctcagcgagcagctgctgttgctgcgct 15391



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 48/57 (84%)
 Strand = Plus / Plus

                                                                      
Query: 424   taggcctccaagctcgggtgatggacccactcaacgcgcctctgcactggctgcctt 480
             |||||||  |||||| | || |||||||||||| ||||| || ||| ||||||||||
Sbjct: 15245 taggcctaaaagctctgatggtggacccactcagcgcgcttcagcaatggctgcctt 15301

to top

>gb|AF088901.1|AF088901 Lilium longiflorum actin bundling protein ABP135 (Y5-7) mRNA,
            complete cds
          Length = 3295

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                        
Query: 231  gtggacccacacaaagggcatctgcattagccgctctatcatctgcattcaatccatctt 290
            ||||||| || ||||| ||||| || ||||| ||| |||| |||||||||||||| ||||
Sbjct: 2401 gtggaccgactcaaagagcatcagccttagcagctttatcttctgcattcaatccttctt 2460

             
Query: 291  c 291
            |
Sbjct: 2461 c 2461



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                        
Query: 551  agagcagctgcagttgctgcgctatcctctgtgctgactgctga 594
            |||||||||||||||||||| || ||  |||| |||||||||||
Sbjct: 2514 agagcagctgcagttgctgcactgtcaactgttctgactgctga 2557



 Score = 44.1 bits (22), Expect = 0.54
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                          
Query: 65   atgtaccactttacaaagtttctgaagggaatgagccatgcttctt 110
            ||||||| ||||| |||||| | |||||||||||||| || |||||
Sbjct: 2221 atgtaccgctttataaagttaccgaagggaatgagccgtgtttctt 2266

to top

>gb|AC161260.2| Mus musculus BAC clone RP23-448A11 from chromosome 9, complete sequence
          Length = 190608

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 166   ccaaaagaaactttcacttctttttg 191
             |||||| |||||||||||||||||||
Sbjct: 59100 ccaaaacaaactttcacttctttttg 59075

to top

>emb|CT010508.10| Mouse DNA sequence from clone RP23-250G8 on chromosome 9, complete
             sequence
          Length = 223547

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 166   ccaaaagaaactttcacttctttttg 191
             |||||| |||||||||||||||||||
Sbjct: 60684 ccaaaacaaactttcacttctttttg 60709

to top

>emb|AL049575.7|HSDJ316D7 Human DNA sequence from clone RP1-316D7 on chromosome 11p13 Contains
            part of the gene for G2 protein, ESTs, STSs and GSSs,
            complete sequence
          Length = 94835

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 353  gcctctgcactggctgctttg 373
            |||||||||||||||||||||
Sbjct: 3185 gcctctgcactggctgctttg 3205

to top

>gb|AC096863.5| Genomic sequence for Mus musculus, clone RP23-110F14, from chromosome
             17, complete sequence
          Length = 134001

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 540   aagggtcacaaagagcagctg 560
             |||||||||||||||||||||
Sbjct: 55966 aagggtcacaaagagcagctg 55946

to top

>emb|AL732392.8| Mouse DNA sequence from clone RP23-171G10 on chromosome X, complete
              sequence
          Length = 188116

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 540    aagggtcacaaagagcagctg 560
              |||||||||||||||||||||
Sbjct: 172099 aagggtcacaaagagcagctg 172079

to top

>ref|XM_476343.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1591

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 554  gcagctgcagttgctgcgct 573
            ||||||||||||||||||||
Sbjct: 1308 gcagctgcagttgctgcgct 1327

to top

>gb|AE006302.1| Lactococcus lactis subsp. lactis IL1403 section 64 of 218 of the
            complete genome
          Length = 11237

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 176  ctttcacttctttttggatt 195
            ||||||||||||||||||||
Sbjct: 7845 ctttcacttctttttggatt 7826

to top

>gb|AC135104.22| Mus musculus strain C57BL/6J clone rp23-206l6, complete sequence
          Length = 198294

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 576    cctctgtgctgactgctgag 595
              ||||||||||||||||||||
Sbjct: 165926 cctctgtgctgactgctgag 165945

to top

>gb|AC115867.12| Mus musculus chromosome 6, clone RP24-326P23, complete sequence
          Length = 162067

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 357 ctgcactggctgctttgtcc 376
           ||||||||||||||||||||
Sbjct: 518 ctgcactggctgctttgtcc 537

to top

>gb|AC125531.3| Mus musculus BAC clone RP23-396D12 from chromosome 10, complete
             sequence
          Length = 219818

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 149   attcatgggaattcattcca 168
             ||||||||||||||||||||
Sbjct: 65747 attcatgggaattcattcca 65728

to top

>gb|AC122429.3| Mus musculus BAC clone RP24-175I3 from chromosome 6, complete sequence
          Length = 188069

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 357    ctgcactggctgctttgtcc 376
              ||||||||||||||||||||
Sbjct: 119607 ctgcactggctgctttgtcc 119626

to top

>ref|XM_546150.2| PREDICTED: Canis familiaris similar to sphingosine-1-phosphate
           lyase 1 (LOC489032), mRNA
          Length = 2179

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 363 tggctgctttgtccaatgcagcat 386
           ||||||||||||| ||||||||||
Sbjct: 835 tggctgctttgtcaaatgcagcat 812

to top

>gb|AC118632.7| Mus musculus chromosome 18, clone RP24-94D24, complete sequence
          Length = 198636

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 551   agagcagctgcagttgctgc 570
             ||||||||||||||||||||
Sbjct: 72068 agagcagctgcagttgctgc 72049

to top

>emb|AJ298068.1|SWH298068 Soil-borne wheat mosaic virus ORF1, ORF1 readthrough and ORF3,
           genomic segment RNA1, (Wiltshire, UK)
          Length = 6981

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 550 aagagcagctgcagttgctg 569
           ||||||||||||||||||||
Sbjct: 275 aagagcagctgcagttgctg 294

to top

>emb|AJ577853.1|NTA577853 Nicotiana tabacum partial mRNA for villin 2 (vln2 gene)
          Length = 2000

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 545  tcacaaagagcagctgcagttgctgcgctatc 576
            |||||||||||||||||  |||||||| ||||
Sbjct: 1079 tcacaaagagcagctgccattgctgcgttatc 1110

to top

>ref|XM_779113.1| PREDICTED: Strongylocentrotus purpuratus similar to Neurogenic locus
            notch homolog protein 1 precursor (Notch 1) (Motch A)
            (mT14) (p300) (LOC578978), mRNA
          Length = 14113

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 352  tgcctctgcactggctgctttgtc 375
            |||||||||||||| |||||||||
Sbjct: 6823 tgcctctgcactggatgctttgtc 6846

to top

>emb|BX548069.7| Zebrafish DNA sequence from clone CH211-238G23 in linkage group 18,
              complete sequence
          Length = 142514

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 273    ctgcattcaatccatcttcg 292
              ||||||||||||||||||||
Sbjct: 120853 ctgcattcaatccatcttcg 120872

to top

>gb|AC128649.5| Homo sapiens 12 BAC RP11-728G4 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 167071

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 78    caaagtttctgaagggaatg 97
             ||||||||||||||||||||
Sbjct: 94408 caaagtttctgaagggaatg 94389

to top

>gb|AC063951.22| Homo sapiens 12 BAC RP11-219I17 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 181259

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 532   ttcaggtcaagggtcacaaa 551
             ||||||||||||||||||||
Sbjct: 46169 ttcaggtcaagggtcacaaa 46188

to top

>gb|AC120036.5| Homo sapiens chromosome 8, clone RP11-1134I14, complete sequence
          Length = 177423

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 572    ctatcctctgtgctgactgctgag 595
              |||||| |||||||||||||||||
Sbjct: 134264 ctatccactgtgctgactgctgag 134241

to top

>gb|AC128657.2| Homo sapiens 12 BAC RP11-1079J22 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 60001

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 78    caaagtttctgaagggaatg 97
             ||||||||||||||||||||
Sbjct: 14955 caaagtttctgaagggaatg 14974

to top

>gb|AC112481.2| Homo sapiens 12 BAC RP11-20L19 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 116996

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 164    ttccaaaagaaactttcacttctt 187
              ||||| ||||||||||||||||||
Sbjct: 107003 ttccataagaaactttcacttctt 106980

to top

>gb|AC079953.28| Homo sapiens 12 BAC RP11-399D15 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 148708

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 532   ttcaggtcaagggtcacaaa 551
             ||||||||||||||||||||
Sbjct: 11673 ttcaggtcaagggtcacaaa 11692

to top

>gb|AC093848.2| Homo sapiens BAC clone RP11-486G21 from 4, complete sequence
          Length = 175064

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 353    gcctctgcactggctgcttt 372
              ||||||||||||||||||||
Sbjct: 109382 gcctctgcactggctgcttt 109401

to top

>gb|AC115811.12| Mus musculus chromosome 5, clone RP23-429M21, complete sequence
          Length = 180812

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 150   ttcatgggaattcattccaa 169
             ||||||||||||||||||||
Sbjct: 21638 ttcatgggaattcattccaa 21657

to top

>gb|AC090196.5| Homo sapiens chromosome 8, clone RP11-766A10, complete sequence
          Length = 175708

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 74    tttacaaagtttctgaaggg 93
             ||||||||||||||||||||
Sbjct: 11977 tttacaaagtttctgaaggg 11958

to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7,
             complete sequence
          Length = 29644043

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 554   gcagctgcagttgctgcgct 573
             ||||||||||||||||||||
Sbjct: 48070 gcagctgcagttgctgcgct 48051

to top

>gb|AC007756.5|AC007756 Drosophila melanogaster, chromosome 3R, region 92E-92E, BAC clone
             BACR10P06, complete sequence
          Length = 170105

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 465   ctgcactggctgccttgtcc 484
             ||||||||||||||||||||
Sbjct: 91693 ctgcactggctgccttgtcc 91674

to top

>gb|AC007757.5|AC007757 Drosophila melanogaster, chromosome 3R, region 92E-92F, BAC clone
            BACR13J19, complete sequence
          Length = 170939

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 465  ctgcactggctgccttgtcc 484
            ||||||||||||||||||||
Sbjct: 8496 ctgcactggctgccttgtcc 8477

to top

>gb|AC093570.30| Mus musculus strain C57BL/6J chromosome 5 clone rp23-115a12, complete
              sequence
          Length = 203838

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 355    ctctgcactggctgctttgt 374
              ||||||||||||||||||||
Sbjct: 147217 ctctgcactggctgctttgt 147198

to top

>ref|XM_214332.3| PREDICTED: Rattus norvegicus similar to RIKEN cDNA 1810029B16
           (predicted) (LOC290686), mRNA
          Length = 975

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 545 tcacaaagagcagctgcagttgct 568
           ||||| ||||||||||||||||||
Sbjct: 36  tcacagagagcagctgcagttgct 13

to top

>gb|AC096547.1| Homo sapiens BAC clone CTD-2016K1 from 2, complete sequence
          Length = 129164

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 132   atagcacaaaatctgtgatt 151
             ||||||||||||||||||||
Sbjct: 21391 atagcacaaaatctgtgatt 21410

to top

>dbj|AP005869.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:B1026C12
          Length = 170240

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 554   gcagctgcagttgctgcgct 573
             ||||||||||||||||||||
Sbjct: 47369 gcagctgcagttgctgcgct 47350

to top

>emb|Y15177.1|DCY15177 Daucus carota DNA fragment containing transposon-like CACTA/TAGTG
            repeats and nested inverted repeats
          Length = 5334

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 396  ctccgcagcagaagcaggtt 415
            ||||||||||||||||||||
Sbjct: 1346 ctccgcagcagaagcaggtt 1365

to top

>gb|AF146278.1|AF146278 Soil-borne rye mosaic virus strain G RNA1 148K protein, 207K
           protein, and 37K protein genes, complete cds
          Length = 7026

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 550 aagagcagctgcagttgctg 569
           ||||||||||||||||||||
Sbjct: 305 aagagcagctgcagttgctg 324

to top

>dbj|AK066298.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013062C01, full
            insert sequence
          Length = 1591

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 554  gcagctgcagttgctgcgct 573
            ||||||||||||||||||||
Sbjct: 1308 gcagctgcagttgctgcgct 1327

to top

>gb|AE003730.3| Drosophila melanogaster chromosome 3R, section 68 of 118 of the complete
              sequence
          Length = 221402

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 465    ctgcactggctgccttgtcc 484
              ||||||||||||||||||||
Sbjct: 184077 ctgcactggctgccttgtcc 184058

to top

>gb|AC138365.16| Mus musculus chromosome 5, clone RP23-262B5, complete sequence
          Length = 172631

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 150    ttcatgggaattcattccaa 169
              ||||||||||||||||||||
Sbjct: 167899 ttcatgggaattcattccaa 167918

to top

>emb|AL645471.8| Mouse DNA sequence from clone RP23-456M3 on chromosome 11, complete
              sequence
          Length = 178361

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 576    cctctgtgctgactgctgag 595
              ||||||||||||||||||||
Sbjct: 151884 cctctgtgctgactgctgag 151865

to top

>emb|AL833796.4| Mouse DNA sequence from clone RP23-361A12 on chromosome X, complete
              sequence
          Length = 160626

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 168    aaaagaaactttcacttctt 187
              ||||||||||||||||||||
Sbjct: 144013 aaaagaaactttcacttctt 144032


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,560,000
Number of Sequences: 3902068
Number of extensions: 5560000
Number of successful extensions: 106138
Number of sequences better than 10.0: 48
Number of HSP's better than 10.0 without gapping: 48
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 105958
Number of HSP's gapped (non-prelim): 176
length of query: 623
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 600
effective length of database: 17,143,297,704
effective search space: 10285978622400
effective search space used: 10285978622400
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

to top

full-length cDNA and EST

Clone Information

BLAST Search Result