ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags8e11
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AC147500.6| Mus musculus BAC clone RP24-281C21 from chromosom... 44 0.47
2gb|AY606951.1| Lactarius pallidus 18S ribosomal RNA gene, partia... 42 1.9
3gb|AC161060.6| Mus musculus BAC clone RP23-69N10 from chromosome... 42 1.9
4gb|AY336961.1| Lactarius spinosulus internal transcribed spacer ... 42 1.9
5gb|AY336960.1| Lactarius spinosulus 18S ribosomal RNA gene, part... 42 1.9
6gb|AC128662.4| Mus musculus BAC clone RP24-440E3 from chromosome... 42 1.9
7gb|AC159336.13| Mus musculus 10 BAC RP24-430N21 (Roswell Park Ca... 42 1.9
8gb|AC153852.9| Mus musculus 10 BAC RP23-136F8 (Roswell Park Canc... 42 1.9
9gb|AC169375.4| Sorghum bicolor clone SB_BBc0020O07, complete seq... 42 1.9
10gb|AC182810.1| Gasterosteus aculeatus clone VMRC28-119K03, compl... 42 1.9
11gb|DQ097875.1| Lactarius kauffmanii 18S ribosomal RNA gene, part... 42 1.9
12gb|DQ097869.1| Lactarius affinis 18S ribosomal RNA gene, partial... 42 1.9
13dbj|AK099163.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.9
14dbj|AK061153.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.9
15dbj|AK059738.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.9
16emb|AJ534935.1|LTR534935 Lactarius trivialis partial 18S rRNA ge... 42 1.9
17ref|NM_176825.2| Homo sapiens sulfotransferase family, cytosolic... 40 7.4
18ref|NM_001056.3| Homo sapiens sulfotransferase family, cytosolic... 40 7.4
19ref|XM_525851.1| PREDICTED: Pan troglodytes similar to Sulfotran... 40 7.4
20gb|AF186261.1|AF186257S5 Homo sapiens sulfotransferase 1C1 (SULT... 40 7.4
21gb|CP000144.1| Rhodobacter sphaeroides 2.4.1 chromosome 2, compl... 40 7.4
22ref|XM_675671.1| Aspergillus nidulans FGSC A4 hypothetical prote... 40 7.4
23ref|XR_004037.1| PREDICTED: Mus musculus similar to SWI/SNF-rela... 40 7.4
24gb|AC129570.10| Mus musculus chromosome 14, clone RP23-343H21, c... 40 7.4
25gb|AC126263.4| Mus musculus BAC clone RP23-359P12 from chromosom... 40 7.4
26gb|AC113506.12| Mus musculus chromosome 9, clone RP23-373O2, com... 40 7.4
27gb|AC006029.2| Homo sapiens BAC clone GS1-195F7 from 7q31.2-q32,... 40 7.4
28gb|BT007813.1| Synthetic construct Homo sapiens sulfotransferase... 40 7.4
29gb|BT006951.1| Homo sapiens sulfotransferase family, cytosolic, ... 40 7.4
30gb|BC005353.1| Homo sapiens sulfotransferase family, cytosolic, ... 40 7.4
31dbj|AP007162.1| Aspergillus oryzae RIB40 genomic DNA, SC102 40 7.4
32gb|AC027238.5| Homo sapiens chromosome 8, clone RP11-377F20, com... 40 7.4
33gb|AC007542.3| Homo sapiens 12p12 BAC RPCI11-320J20 (Roswell Par... 40 7.4
34gb|AC154855.2| Mus musculus BAC clone RP23-18N3 from chromosome ... 40 7.4
35ref|XM_392552.2| PREDICTED: Apis mellifera similar to CG14307-PB... 40 7.4
36gb|AC019100.4| Homo sapiens BAC clone RP11-443K8 from 2, complet... 40 7.4
37gb|AF186256.1|AF186256 Homo sapiens sulfotransferase 1C1 (SULT1C... 40 7.4
38gb|AF186255.1|AF186255 Homo sapiens sulfotransferase 1C1 (SULT1C... 40 7.4
39gb|AF186254.1|AF186254 Homo sapiens sulfotransferase 1C1 (SULT1C... 40 7.4
40gb|AF186253.1|AF186253 Homo sapiens sulfotransferase 1C1 (SULT1C... 40 7.4
41gb|AF186252.1|AF186252 Homo sapiens sulfotransferase 1C1 (SULT1C... 40 7.4
42gb|AF186251.1|AF186251 Homo sapiens sulfotransferase 1C1 (SULT1C... 40 7.4
43gb|AY892489.1| Synthetic construct Homo sapiens clone FLH025557.... 40 7.4
44gb|AY892488.1| Synthetic construct Homo sapiens clone FLH025556.... 40 7.4
45gb|AY890001.1| Synthetic construct Homo sapiens clone FLH025560.... 40 7.4
46gb|AF026304.1|AF026304 Oryctolagus cuniculus sulfotransferase mR... 40 7.4
47gb|AF026303.1|HAST5 Homo sapiens sulfotransferase mRNA, complete... 40 7.4
48emb|AL935143.9| Zebrafish DNA sequence from clone CH211-192E21, ... 40 7.4
49gb|U66036.1|HSU66036 Human sulfotransferase mRNA, complete cds 40 7.4
50emb|AL832145.1|HSM803452 Homo sapiens mRNA; cDNA DKFZp686K19111 ... 40 7.4
51gb|AC138025.4| Mus musculus BAC clone RP24-430F5 from 8, complet... 40 7.4
52emb|AL929506.8| Mouse DNA sequence from clone RP23-223I8 on chro... 40 7.4
53dbj|AB008164.1| Homo sapiens mRNA for ST1C2, complete cds 40 7.4 
>gb|AC147500.6| Mus musculus BAC clone RP24-281C21 from chromosome 8, complete sequence
          Length = 185450

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 218   taaaagcagcaggtccttttattcct 243
             ||||||||||||||||| ||||||||
Sbjct: 71479 taaaagcagcaggtcctcttattcct 71454
to top
>gb|AY606951.1| Lactarius pallidus 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene,
           and internal transcribed spacer 2, complete sequence;
           and 28S ribosomal RNA gene, partial sequence
          Length = 724

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 359 ggtttatggctctgttgcttt 379
           |||||||||||||||||||||
Sbjct: 574 ggtttatggctctgttgcttt 594
to top
>gb|AC161060.6| Mus musculus BAC clone RP23-69N10 from chromosome 6, complete sequence
          Length = 222363

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 357    caggtttatggctctgttgct 377
              |||||||||||||||||||||
Sbjct: 205678 caggtttatggctctgttgct 205698
to top
>gb|AY336961.1| Lactarius spinosulus internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene and internal
           transcribed spacer 2, complete sequence; and 28S
           ribosomal RNA gene, partial sequence
          Length = 656

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 359 ggtttatggctctgttgcttt 379
           |||||||||||||||||||||
Sbjct: 531 ggtttatggctctgttgcttt 551
to top
>gb|AY336960.1| Lactarius spinosulus 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene
           and internal transcribed spacer 2, complete sequence;
           and 28S ribosomal RNA gene, partial sequence
          Length = 665

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 359 ggtttatggctctgttgcttt 379
           |||||||||||||||||||||
Sbjct: 540 ggtttatggctctgttgcttt 560
to top
>gb|AC128662.4| Mus musculus BAC clone RP24-440E3 from chromosome 6, complete sequence
          Length = 134729

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 357    caggtttatggctctgttgct 377
              |||||||||||||||||||||
Sbjct: 109426 caggtttatggctctgttgct 109446
to top
>gb|AC159336.13| Mus musculus 10 BAC RP24-430N21 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 180454

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 493    tttggttacttggcagggttt 513
              |||||||||||||||||||||
Sbjct: 137885 tttggttacttggcagggttt 137905
to top
>gb|AC153852.9| Mus musculus 10 BAC RP23-136F8 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 222518

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 493   tttggttacttggcagggttt 513
             |||||||||||||||||||||
Sbjct: 30716 tttggttacttggcagggttt 30736
to top
>gb|AC169375.4| Sorghum bicolor clone SB_BBc0020O07, complete sequence
          Length = 117931

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 303   cagctcttctccatcaaagtcacca 327
             |||||||||||||||| ||||||||
Sbjct: 27042 cagctcttctccatcagagtcacca 27018
to top
>gb|AC182810.1| Gasterosteus aculeatus clone VMRC28-119K03, complete sequence
          Length = 131913

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 354    ctgcaggtttatggctctgtt 374
              |||||||||||||||||||||
Sbjct: 102003 ctgcaggtttatggctctgtt 102023
to top
>gb|DQ097875.1| Lactarius kauffmanii 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene,
           and internal transcribed spacer 2, complete sequence;
           and 28S ribosomal RNA gene, partial sequence
          Length = 923

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 359 ggtttatggctctgttgcttt 379
           |||||||||||||||||||||
Sbjct: 597 ggtttatggctctgttgcttt 617
to top
>gb|DQ097869.1| Lactarius affinis 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene,
           and internal transcribed spacer 2, complete sequence;
           and 28S ribosomal RNA gene, partial sequence
          Length = 1472

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 359 ggtttatggctctgttgcttt 379
           |||||||||||||||||||||
Sbjct: 944 ggtttatggctctgttgcttt 964
to top
>dbj|AK099163.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023067B14, full
           insert sequence
          Length = 1474

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 434 ctgccaaaccctcactcaaaaggatccat 462
           ||||||||||||||| ||| |||||||||
Sbjct: 543 ctgccaaaccctcacccaagaggatccat 571
to top
>dbj|AK061153.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-208-F02, full
           insert sequence
          Length = 1516

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 434 ctgccaaaccctcactcaaaaggatccat 462
           ||||||||||||||| ||| |||||||||
Sbjct: 550 ctgccaaaccctcacccaagaggatccat 578
to top
>dbj|AK059738.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-202-E12, full
           insert sequence
          Length = 1198

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 434 ctgccaaaccctcactcaaaaggatccat 462
           ||||||||||||||| ||| |||||||||
Sbjct: 550 ctgccaaaccctcacccaagaggatccat 578
to top
>emb|AJ534935.1|LTR534935 Lactarius trivialis partial 18S rRNA gene, ITS1, 5.8S rRNA gene,
           ITS2 and partial 28S rRNA gene, strain I42
          Length = 692

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 359 ggtttatggctctgttgcttt 379
           |||||||||||||||||||||
Sbjct: 551 ggtttatggctctgttgcttt 571
to top
>ref|NM_176825.2| Homo sapiens sulfotransferase family, cytosolic, 1C, member 1
           (SULT1C1), transcript variant 2, mRNA
          Length = 2832

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 274 ttcaaaatactcttcccagg 293
           ||||||||||||||||||||
Sbjct: 969 ttcaaaatactcttcccagg 950
to top
>ref|NM_001056.3| Homo sapiens sulfotransferase family, cytosolic, 1C, member 1
           (SULT1C1), transcript variant 1, mRNA
          Length = 2799

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 274 ttcaaaatactcttcccagg 293
           ||||||||||||||||||||
Sbjct: 936 ttcaaaatactcttcccagg 917
to top
>ref|XM_525851.1| PREDICTED: Pan troglodytes similar to Sulfotransferase 1C1
           (SULT1C#1) (ST1C2) (humSULTC2) (LOC470470), mRNA
          Length = 1710

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 274 ttcaaaatactcttcccagg 293
           ||||||||||||||||||||
Sbjct: 909 ttcaaaatactcttcccagg 890
to top
>gb|AF186261.1|AF186257S5 Homo sapiens sulfotransferase 1C1 (SULT1C1) gene, exons 5, 6, and 7
          Length = 1604

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 274 ttcaaaatactcttcccagg 293
           ||||||||||||||||||||
Sbjct: 458 ttcaaaatactcttcccagg 439
to top
>gb|CP000144.1| Rhodobacter sphaeroides 2.4.1 chromosome 2, complete genome
          Length = 943016

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 194    ggagcaggagattgaggaac 213
              ||||||||||||||||||||
Sbjct: 103719 ggagcaggagattgaggaac 103700
to top
>ref|XM_675671.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN7494.2), mRNA
          Length = 2181

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 136 agaagaaggaggagcaactt 155
           ||||||||||||||||||||
Sbjct: 926 agaagaaggaggagcaactt 945
to top
>ref|XR_004037.1| PREDICTED: Mus musculus similar to SWI/SNF-related matrix-associated
            actin-dependent regulator of chromatin subfamily C member
            1 (SWI/SNF complex 155 kDa subunit) (BRG1-associated
            factor 155) (SWI3-related protein) (LOC672848), mRNA
          Length = 1490

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 194  ggagcaggagattgaggaac 213
            ||||||||||||||||||||
Sbjct: 1462 ggagcaggagattgaggaac 1443
to top
>gb|AC129570.10| Mus musculus chromosome 14, clone RP23-343H21, complete sequence
          Length = 198703

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 210   gaacacagtaaaagcagcag 229
             ||||||||||||||||||||
Sbjct: 72306 gaacacagtaaaagcagcag 72287
to top
>gb|AC126263.4| Mus musculus BAC clone RP23-359P12 from chromosome 8, complete sequence
          Length = 223991

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 518   tgatgttcagttaaaagtaa 537
             ||||||||||||||||||||
Sbjct: 53519 tgatgttcagttaaaagtaa 53538
to top
>gb|AC113506.12| Mus musculus chromosome 9, clone RP23-373O2, complete sequence
          Length = 171170

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 285   cttcccaggagatccatgca 304
             ||||||||||||||||||||
Sbjct: 18077 cttcccaggagatccatgca 18096
to top
>gb|AC006029.2| Homo sapiens BAC clone GS1-195F7 from 7q31.2-q32, complete sequence
          Length = 143851

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 205    ttgaggaacacagtaaaagc 224
              ||||||||||||||||||||
Sbjct: 138031 ttgaggaacacagtaaaagc 138050
to top
>gb|BT007813.1| Synthetic construct Homo sapiens sulfotransferase family,
           cytosolic, 1C, member 1 mRNA, partial cds
          Length = 891

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 274 ttcaaaatactcttcccagg 293
           ||||||||||||||||||||
Sbjct: 483 ttcaaaatactcttcccagg 464
to top
>gb|BT006951.1| Homo sapiens sulfotransferase family, cytosolic, 1C, member 1 mRNA,
           complete cds
          Length = 891

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 274 ttcaaaatactcttcccagg 293
           ||||||||||||||||||||
Sbjct: 483 ttcaaaatactcttcccagg 464
to top
>gb|BC005353.1| Homo sapiens sulfotransferase family, cytosolic, 1C, member 1,
           transcript variant 1, mRNA (cDNA clone MGC:12452
           IMAGE:4051264), complete cds
          Length = 1237

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 274 ttcaaaatactcttcccagg 293
           ||||||||||||||||||||
Sbjct: 553 ttcaaaatactcttcccagg 534
to top
>dbj|AP007162.1| Aspergillus oryzae RIB40 genomic DNA, SC102
          Length = 1779707

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 297     tccatgcagctcttctccat 316
               ||||||||||||||||||||
Sbjct: 1268536 tccatgcagctcttctccat 1268517
to top
>gb|AC027238.5| Homo sapiens chromosome 8, clone RP11-377F20, complete sequence
          Length = 193250

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 397   gtaaagccagctatctcttcagat 420
             |||||||||||||||||| |||||
Sbjct: 92045 gtaaagccagctatctctgcagat 92068
to top
>gb|AC007542.3| Homo sapiens 12p12 BAC RPCI11-320J20 (Roswell Park Cancer Institute Human
              BAC Library) complete sequence
          Length = 162081

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 519    gatgttcagttaaaagtaaa 538
              ||||||||||||||||||||
Sbjct: 109622 gatgttcagttaaaagtaaa 109603
to top
>gb|AC154855.2| Mus musculus BAC clone RP23-18N3 from chromosome 14, complete
            sequence
          Length = 197373

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 194  ggagcaggagattgaggaac 213
            ||||||||||||||||||||
Sbjct: 4482 ggagcaggagattgaggaac 4501
to top
>ref|XM_392552.2| PREDICTED: Apis mellifera similar to CG14307-PB, isoform B
           (LOC409022), mRNA
          Length = 1491

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 134 ggagaagaaggaggagcaac 153
           ||||||||||||||||||||
Sbjct: 811 ggagaagaaggaggagcaac 830
to top
>gb|AC019100.4| Homo sapiens BAC clone RP11-443K8 from 2, complete sequence
          Length = 213475

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 274    ttcaaaatactcttcccagg 293
              ||||||||||||||||||||
Sbjct: 155958 ttcaaaatactcttcccagg 155939
to top
>gb|AF186256.1|AF186256 Homo sapiens sulfotransferase 1C1 (SULT1C1) mRNA, complete cds,
           alternatively spliced
          Length = 1369

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 274 ttcaaaatactcttcccagg 293
           ||||||||||||||||||||
Sbjct: 685 ttcaaaatactcttcccagg 666
to top
>gb|AF186255.1|AF186255 Homo sapiens sulfotransferase 1C1 (SULT1C1) mRNA, complete cds,
           alternatively spliced
          Length = 1653

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 274 ttcaaaatactcttcccagg 293
           ||||||||||||||||||||
Sbjct: 969 ttcaaaatactcttcccagg 950
to top
>gb|AF186254.1|AF186254 Homo sapiens sulfotransferase 1C1 (SULT1C1) mRNA, complete cds,
           alternatively spliced
          Length = 1518

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 274 ttcaaaatactcttcccagg 293
           ||||||||||||||||||||
Sbjct: 834 ttcaaaatactcttcccagg 815
to top
>gb|AF186253.1|AF186253 Homo sapiens sulfotransferase 1C1 (SULT1C1) mRNA, complete cds,
           alternatively spliced
          Length = 1336

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 274 ttcaaaatactcttcccagg 293
           ||||||||||||||||||||
Sbjct: 652 ttcaaaatactcttcccagg 633
to top
>gb|AF186252.1|AF186252 Homo sapiens sulfotransferase 1C1 (SULT1C1) mRNA, complete cds,
           alternatively spliced
          Length = 1620

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 274 ttcaaaatactcttcccagg 293
           ||||||||||||||||||||
Sbjct: 936 ttcaaaatactcttcccagg 917
to top
>gb|AF186251.1|AF186251 Homo sapiens sulfotransferase 1C1 (SULT1C1) mRNA, complete cds,
           alternatively spliced
          Length = 1485

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 274 ttcaaaatactcttcccagg 293
           ||||||||||||||||||||
Sbjct: 801 ttcaaaatactcttcccagg 782
to top
>gb|AY892489.1| Synthetic construct Homo sapiens clone FLH025557.01L
           sulfotransferase family cytosolic 1C member 1 (SULT1C1)
           mRNA, partial cds
          Length = 891

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 274 ttcaaaatactcttcccagg 293
           ||||||||||||||||||||
Sbjct: 483 ttcaaaatactcttcccagg 464
to top
>gb|AY892488.1| Synthetic construct Homo sapiens clone FLH025556.01L
           sulfotransferase family cytosolic 1C member 1 (SULT1C1)
           mRNA, partial cds
          Length = 891

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 274 ttcaaaatactcttcccagg 293
           ||||||||||||||||||||
Sbjct: 483 ttcaaaatactcttcccagg 464
to top
>gb|AY890001.1| Synthetic construct Homo sapiens clone FLH025560.01X
           sulfotransferase family cytosolic 1C member 1 (SULT1C1)
           mRNA, complete cds
          Length = 891

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 274 ttcaaaatactcttcccagg 293
           ||||||||||||||||||||
Sbjct: 483 ttcaaaatactcttcccagg 464
to top
>gb|AF026304.1|AF026304 Oryctolagus cuniculus sulfotransferase mRNA, complete cds
          Length = 1451

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 274 ttcaaaatactcttcccagg 293
           ||||||||||||||||||||
Sbjct: 541 ttcaaaatactcttcccagg 522
to top
>gb|AF026303.1|HAST5 Homo sapiens sulfotransferase mRNA, complete cds
          Length = 1041

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 274 ttcaaaatactcttcccagg 293
           ||||||||||||||||||||
Sbjct: 568 ttcaaaatactcttcccagg 549
to top
>emb|AL935143.9| Zebrafish DNA sequence from clone CH211-192E21, complete sequence
          Length = 157691

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 313   ccatcaaagtcaccaaacca 332
             ||||||||||||||||||||
Sbjct: 33498 ccatcaaagtcaccaaacca 33479
to top
>gb|U66036.1|HSU66036 Human sulfotransferase mRNA, complete cds
          Length = 1334

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 274 ttcaaaatactcttcccagg 293
           ||||||||||||||||||||
Sbjct: 659 ttcaaaatactcttcccagg 640
to top
>emb|AL832145.1|HSM803452 Homo sapiens mRNA; cDNA DKFZp686K19111 (from clone DKFZp686K19111)
          Length = 6383

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 274  ttcaaaatactcttcccagg 293
            ||||||||||||||||||||
Sbjct: 5710 ttcaaaatactcttcccagg 5691
to top
>gb|AC138025.4| Mus musculus BAC clone RP24-430F5 from 8, complete sequence
          Length = 165737

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 518   tgatgttcagttaaaagtaa 537
             ||||||||||||||||||||
Sbjct: 43047 tgatgttcagttaaaagtaa 43028
to top
>emb|AL929506.8| Mouse DNA sequence from clone RP23-223I8 on chromosome 4, complete
             sequence
          Length = 63478

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 174   aaggacaaggggacatatgg 193
             ||||||||||||||||||||
Sbjct: 23034 aaggacaaggggacatatgg 23053
to top
>dbj|AB008164.1| Homo sapiens mRNA for ST1C2, complete cds
          Length = 2431

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 274 ttcaaaatactcttcccagg 293
           ||||||||||||||||||||
Sbjct: 606 ttcaaaatactcttcccagg 587


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,020,222
Number of Sequences: 3902068
Number of extensions: 5020222
Number of successful extensions: 120512
Number of sequences better than 10.0: 53
Number of HSP's better than 10.0 without gapping: 53
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 120409
Number of HSP's gapped (non-prelim): 103
length of query: 543
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 520
effective length of database: 17,143,297,704
effective search space: 8914514806080
effective search space used: 8914514806080
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top