>gb|AC087698.5| Homo sapiens chromosome 8, clone RP11-25K19, complete sequence
          Length = 150750

 Score = 40.1 bits (20), Expect = 0.67
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 27    ggaggttaagataaactttg 46
             ||||||||||||||||||||
Sbjct: 94763 ggaggttaagataaactttg 94782

>gb|AC083934.3| Homo sapiens chromosome 8, clone RP11-108L23, complete sequence
          Length = 157749

 Score = 40.1 bits (20), Expect = 0.67
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 27    ggaggttaagataaactttg 46
             ||||||||||||||||||||
Sbjct: 41892 ggaggttaagataaactttg 41911

>emb|AL513406.1|CNS07EFT Human DNA sequence chromosome 8 of Homo sapiens (human)
          Length = 204955

 Score = 40.1 bits (20), Expect = 0.67
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 27    ggaggttaagataaactttg 46
             ||||||||||||||||||||
Sbjct: 57459 ggaggttaagataaactttg 57440

>gb|AY751780.1| Anagyris vein yellowing virus putative movement protein,
           polyprotein, and coat protein genes, complete cds
          Length = 6151

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 40  aactttgatggcttcataa 58
           |||||||||||||||||||
Sbjct: 440 aactttgatggcttcataa 422

>gb|AC158793.4| Mus musculus chromosome 1, clone RP23-269P13, complete sequence
          Length = 183447

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 29    aggttaagataaactttga 47
             |||||||||||||||||||
Sbjct: 68976 aggttaagataaactttga 68958

>gb|AC034116.10| Mus musculus chromosome 16, clone RP23-428P5, complete sequence
          Length = 210023

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                    
Query: 7      gtcgaccagtgcatgcangggg 28
              ||||||||||||||||| ||||
Sbjct: 125311 gtcgaccagtgcatgcatgggg 125332

>ref|XM_001004331.1| PREDICTED: Mus musculus RIKEN cDNA 9130230N09 gene (9130230N09Rik),
           mRNA
          Length = 3725

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 42  ctttgatggcttcataacc 60
           |||||||||||||||||||
Sbjct: 933 ctttgatggcttcataacc 951

>ref|XM_974618.1| PREDICTED: Mus musculus RIKEN cDNA 9130230N09 gene (9130230N09Rik),
           mRNA
          Length = 3725

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 42  ctttgatggcttcataacc 60
           |||||||||||||||||||
Sbjct: 933 ctttgatggcttcataacc 951

>ref|XM_986326.1| PREDICTED: Mus musculus RIKEN cDNA 9130230N09 gene (9130230N09Rik),
           mRNA
          Length = 3725

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 42  ctttgatggcttcataacc 60
           |||||||||||||||||||
Sbjct: 933 ctttgatggcttcataacc 951

>gb|BC009075.1| Mus musculus UDP-GlcNAc:betaGal
          beta-1,3-N-acetylglucosaminyltransferase 2, mRNA (cDNA
          clone MGC:6892 IMAGE:2654354), complete cds
          Length = 2468

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                             
Query: 42 ctttgatggcttcataacc 60
          |||||||||||||||||||
Sbjct: 11 ctttgatggcttcataacc 29

>gb|AC135233.19| Medicago truncatula clone mth2-14c14, complete sequence
          Length = 108028

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 34    aagataaactttgatggct 52
             |||||||||||||||||||
Sbjct: 59167 aagataaactttgatggct 59149

>emb|AL772364.20| Mouse DNA sequence from clone RP23-242C19 on chromosome 11 Contains a
             ribosomal protein S16 (Rps16) pseudogene, the B3gnt1 gene
             for beta-1,3-N-acetylglucosaminyltransferase 1, the Murr1
             gene for U2af1-rs1 region 1, the U2af1-rs1 gene for U2
             small nuclear ribonucleoprotein auxiliary factor (U2AF) 1
             (related sequence 1) and two CpG islands, complete
             sequence
          Length = 210863

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 42    ctttgatggcttcataacc 60
             |||||||||||||||||||
Sbjct: 94376 ctttgatggcttcataacc 94358

>gb|AC087477.8| Homo sapiens chromosome 15, clone RP11-522B15, complete sequence
          Length = 191434

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 36     gataaactttgatggcttcataa 58
              |||||||| ||||||||||||||
Sbjct: 114313 gataaactgtgatggcttcataa 114335

>dbj|AK163599.1| Mus musculus 4 days neonate male adipose cDNA, RIKEN full-length
           enriched library, clone:B430201H09 product:hypothetical
           protein, full insert sequence
          Length = 2908

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 42  ctttgatggcttcataacc 60
           |||||||||||||||||||
Sbjct: 116 ctttgatggcttcataacc 134

>gb|AC021867.19| Homo sapiens 3 BAC RP11-220G20 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 146809

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 34     aagataaactttgatggct 52
              |||||||||||||||||||
Sbjct: 125111 aagataaactttgatggct 125093


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 397,723
Number of Sequences: 3902068
Number of extensions: 397723
Number of successful extensions: 24979
Number of sequences better than 10.0: 15
Number of HSP's better than 10.0 without gapping: 15
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 24962
Number of HSP's gapped (non-prelim): 17
length of query: 68
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 47
effective length of database: 17,151,101,840
effective search space: 806101786480
effective search space used: 806101786480
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)