ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags7m18
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|BT018028.1| Zea mays clone EL01N0529H05.c mRNA sequence 40 0.34
2gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome 38 1.3
3emb|BX248343.1| Mycobacterium bovis subsp. bovis AF2122/97 compl... 38 1.3
4emb|BX842580.1| Mycobacterium tuberculosis H37Rv complete genome... 38 1.3
5emb|BX248357.1| Corynebacterium diphtheriae gravis NCTC13129, co... 38 1.3
6ref|XM_865704.1| PREDICTED: Bos taurus similar to Voltage-depend... 36 5.3
7gb|AC160138.2| Mus musculus BAC clone RP23-83G6 from chromosome ... 36 5.3
8dbj|BA000035.2| Corynebacterium efficiens YS-314 DNA, complete g... 36 5.3
9dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome 36 5.3
10gb|AC006499.13|AC006499 Homo sapiens chromosome 4 clone C0494H11... 36 5.3
11gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. ... 36 5.3
12emb|AL670673.15| Mouse DNA sequence from clone RP23-32L5 on chro... 36 5.3
13emb|AL935270.6| Mouse DNA sequence from clone RP23-391A14 on chr... 36 5.3

>gb|BT018028.1| Zea mays clone EL01N0529H05.c mRNA sequence
          Length = 1336

 Score = 40.1 bits (20), Expect = 0.34
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                   
Query: 4   gctagccctgtcccttctggtagatcgaccaaccctgagg 43
           ||||||||||||||||| ||| | ||  ||||||||||||
Sbjct: 300 gctagccctgtcccttccggtcggtcctccaaccctgagg 339



to top

>gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome
          Length = 4403837

 Score = 38.2 bits (19), Expect = 1.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 17      cttctggtagatcgaccaa 35
               |||||||||||||||||||
Sbjct: 2905431 cttctggtagatcgaccaa 2905449



to top

>emb|BX248343.1| Mycobacterium bovis subsp. bovis AF2122/97 complete genome; segment
             10/14
          Length = 307550

 Score = 38.2 bits (19), Expect = 1.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 17    cttctggtagatcgaccaa 35
             |||||||||||||||||||
Sbjct: 59235 cttctggtagatcgaccaa 59253



to top

>emb|BX842580.1| Mycobacterium tuberculosis H37Rv complete genome; segment 9/13
          Length = 346051

 Score = 38.2 bits (19), Expect = 1.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 17     cttctggtagatcgaccaa 35
              |||||||||||||||||||
Sbjct: 136251 cttctggtagatcgaccaa 136269



to top

>emb|BX248357.1| Corynebacterium diphtheriae gravis NCTC13129, complete genome; segment
              4/8
          Length = 349535

 Score = 38.2 bits (19), Expect = 1.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 17     cttctggtagatcgaccaa 35
              |||||||||||||||||||
Sbjct: 348657 cttctggtagatcgaccaa 348675



to top

>ref|XM_865704.1| PREDICTED: Bos taurus similar to Voltage-dependent anion-selective
           channel protein 3 (VDAC-3) (mVDAC3) (Outer mitochondrial
           membrane protein porin 3) (LOC507216), mRNA
          Length = 504

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 16  ccttctggtagatcgacc 33
           ||||||||||||||||||
Sbjct: 340 ccttctggtagatcgacc 323



to top

>gb|AC160138.2| Mus musculus BAC clone RP23-83G6 from chromosome 12, complete sequence
          Length = 223906

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 5      ctagccctgtcccttctg 22
              ||||||||||||||||||
Sbjct: 125207 ctagccctgtcccttctg 125224



to top

>dbj|BA000035.2| Corynebacterium efficiens YS-314 DNA, complete genome
          Length = 3147090

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                 
Query: 17      cttctggtagatcgacca 34
               ||||||||||||||||||
Sbjct: 1864095 cttctggtagatcgacca 1864112



to top

>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome
          Length = 6021225

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                 
Query: 17      cttctggtagatcgacca 34
               ||||||||||||||||||
Sbjct: 3900696 cttctggtagatcgacca 3900679



to top

>gb|AC006499.13|AC006499 Homo sapiens chromosome 4 clone C0494H11, complete sequence
          Length = 195384

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 1      tctgctagccctgtccct 18
              ||||||||||||||||||
Sbjct: 172837 tctgctagccctgtccct 172820



to top

>gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. k10, complete genome
          Length = 4829781

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                 
Query: 17      cttctggtagatcgacca 34
               ||||||||||||||||||
Sbjct: 1096735 cttctggtagatcgacca 1096718



to top

>emb|AL670673.15| Mouse DNA sequence from clone RP23-32L5 on chromosome 4, complete
              sequence
          Length = 202412

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 3      tgctagccctgtcccttc 20
              ||||||||||||||||||
Sbjct: 113701 tgctagccctgtcccttc 113718



to top

>emb|AL935270.6| Mouse DNA sequence from clone RP23-391A14 on chromosome 2, complete
             sequence
          Length = 127274

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 4     gctagccctgtcccttct 21
             ||||||||||||||||||
Sbjct: 36444 gctagccctgtcccttct 36461


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 201,913
Number of Sequences: 3902068
Number of extensions: 201913
Number of successful extensions: 52005
Number of sequences better than 10.0: 13
Number of HSP's better than 10.0 without gapping: 13
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 51938
Number of HSP's gapped (non-prelim): 67
length of query: 44
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 24
effective length of database: 17,155,003,908
effective search space: 411720093792
effective search space used: 411720093792
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)
to top