ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags7m03
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY846820.1| Triticum aestivum ribosomal protein L6 mRNA, comp... 408 e-111
2dbj|AK072777.1| Oryza sativa (japonica cultivar-group) cDNA clon... 240 3e-60
3ref|XM_466485.1| Oryza sativa (japonica cultivar-group), mRNA 214 2e-52
4dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 188 1e-44
5dbj|AP005874.3| Oryza sativa (japonica cultivar-group) genomic D... 188 1e-44
6dbj|AP005640.2| Oryza sativa (japonica cultivar-group) genomic D... 188 1e-44
7gb|AY103559.1| Zea mays PCO112591 mRNA sequence 133 5e-28
8ref|XM_472843.1| Oryza sativa (japonica cultivar-group), predic... 117 3e-23
9dbj|AK067896.1| Oryza sativa (japonica cultivar-group) cDNA clon... 117 3e-23
10emb|AL606447.3|OSJN00011 Oryza sativa genomic DNA, chromosome 4,... 74 4e-10
11dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 74 4e-10
12emb|AL121581.41|HS1022E24 Human DNA sequence from clone RP5-1022... 44 0.36
13ref|XM_363819.1| Magnaporthe grisea 70-15 hypothetical protein (... 42 1.4
14gb|AC073073.2| Homo sapiens BAC clone RP11-251G23 from 7, comple... 42 1.4
15gb|AC074397.7| Homo sapiens BAC clone RP11-598O8 from 7, complet... 42 1.4
16dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.4
17dbj|AP003541.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.4
18dbj|AP004737.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.4
19gb|AC022675.7| Mus musculus chromosome 1, clone RP23-59N15, comp... 40 5.6
20gb|AC122535.3| Mus musculus BAC clone RP24-539K4 from chromosome... 40 5.6
21gb|AC124410.4| Mus musculus BAC clone RP24-266J11 from chromosom... 40 5.6
22gb|AC098742.4| Mus musculus BAC clone RP23-122N2 from 14, comple... 40 5.6
23gb|AC146748.16| Medicago truncatula clone mth2-65k8, complete se... 40 5.6
24emb|AL590677.7| Human DNA sequence from clone RP11-214D15 on chr... 40 5.6
25emb|AL355485.9| Human DNA sequence from clone RP11-240M20 on chr... 40 5.6
26emb|AL138997.18| Human DNA sequence from clone RP11-10O23 on chr... 40 5.6
27dbj|AK094601.1| Homo sapiens cDNA FLJ37282 fis, clone BRAMY2013216 40 5.6
28gb|AC004671.1| Homo sapiens 12p13.3 PAC RPCI3-340I3 (Roswell Par... 40 5.6
29gb|AC108157.3| Homo sapiens BAC clone RP11-580P21 from 4, comple... 40 5.6
30gb|AC097659.3| Homo sapiens BAC clone RP11-408C24 from 4, comple... 40 5.6
31gb|AC074349.6| Homo sapiens BAC clone RP11-703G6 from 4, complet... 40 5.6
32gb|AC069200.6| Homo sapiens BAC clone RP11-177J6 from 4, complet... 40 5.6
33gb|AC026692.5| Homo sapiens chromosome 5 clone CTC-257L10, compl... 40 5.6
34gb|AC035147.4| Homo sapiens chromosome 5 clone CTD-2309M13, comp... 40 5.6
35gb|AC060788.11| Homo sapiens chromosome 8, clone CTD-2008O4, com... 40 5.6
36gb|AE015928.1| Bacteroides thetaiotaomicron VPI-5482, complete g... 40 5.6
37gb|AC068282.8| Homo sapiens BAC clone RP11-314L11 from 2, comple... 40 5.6
38gb|AC044787.6|AC044787 Homo sapiens chromosome 15 clone CTD-2270... 40 5.6
39gb|AC017006.4| Homo sapiens BAC clone RP11-110G2 from 2, complet... 40 5.6
40emb|X69378.1|MCYL16 M.crystallinum mRNA for ribosomal protein YL16 40 5.6
41gb|AC154243.2| Mus musculus BAC clone RP24-173F3 from 14, comple... 40 5.6
42emb|CR847530.19| Zebrafish DNA sequence from clone DKEY-14I17 in... 40 5.6
43gb|AC004047.1|AC004047 Homo sapiens chromosome 4 clone B150J4 ma... 40 5.6
44gb|AC005394.1|AC005394 Homo sapiens chromosome 19, cosmid F8518,... 40 5.6
45emb|AL354819.15| Human DNA sequence from clone RP11-7B3 on chrom... 40 5.6
46gb|AC161427.4| Gallus gallus BAC clone CH261-60M14 from chromoso... 40 5.6
47emb|AL365314.16| Mouse DNA sequence from clone RP23-106N23 on ch... 40 5.6

>gb|AY846820.1| Triticum aestivum ribosomal protein L6 mRNA, complete cds
          Length = 686

 Score =  408 bits (206), Expect = e-111
 Identities = 254/270 (94%)
 Strand = Plus / Plus

                                                                       
Query: 2   tcgacatctccaaggttaatatgcaaaagtttgatgacaagtactttgctagggagaaga 61
           |||||||||| ||||||||| |||| |||||||||||||||||||| |||||||||||||
Sbjct: 414 tcgacatctctaaggttaatgtgcagaagtttgatgacaagtacttcgctagggagaaga 473

                                                                       
Query: 62  agactagggcaaagaagtctgagggcgagctgtttgagtcggagaaggaggcaacgaaga 121
           ||||||||||||||||| ||||||||||||| ||||||||||| ||||||||||| ||||
Sbjct: 474 agactagggcaaagaagactgagggcgagctatttgagtcggataaggaggcaaccaaga 533

                                                                       
Query: 122 atctgcccgacttcaagaaggatgaccagaaggtcattgacactgagttaatcaaggcta 181
           || |||| ||||||||||||||||||||||||||||||||| ||||||| ||||||||||
Sbjct: 534 atttgccagacttcaagaaggatgaccagaaggtcattgacgctgagttgatcaaggcta 593

                                                                       
Query: 182 tagatgctgtcccagaccttaaaagttatcttggtgcccggttctccctcagggatggcg 241
           | ||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 594 tcgatgccgtcccagaccttaaaaattatcttggtgcccggttctccctcagggatggcg 653

                                         
Query: 242 acaagccgcatgagatgaccttctaagtta 271
           |||||||||||||||||||||| |||||||
Sbjct: 654 acaagccgcatgagatgaccttttaagtta 683



to top

>dbj|AK072777.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023139B06, full
           insert sequence
          Length = 1030

 Score =  240 bits (121), Expect = 3e-60
 Identities = 242/281 (86%), Gaps = 1/281 (0%)
 Strand = Plus / Plus

                                                                       
Query: 28  aagtttgatgacaagtactttgctagggagaagaagactagggcaaagaagtctgagggc 87
           |||||||||||||||||||||||  |||| |||||| | | ||| |||||| | ||||| 
Sbjct: 491 aagtttgatgacaagtactttgcccgggacaagaaggcaaaggccaagaagaccgagggt 550

                                                                       
Query: 88  gagctgtttgagtcggagaaggaggcaacgaagaatctgcccgacttcaagaaggatgac 147
           || || |||||| | |||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 551 gaactttttgagacagagaaggaggcaaccaagaatctgcccgacttcaagaaggatgac 610

                                                                       
Query: 148 cagaaggtcattgacactgagttaatcaaggctatagatgctgtcccagaccttaaaagt 207
           |||||||   | ||  ||||||| ||||||||||| || | |||||||||||| |||   
Sbjct: 611 cagaaggctgtggatgctgagttgatcaaggctatcgaggttgtcccagacctgaaatcc 670

                                                                       
Query: 208 tatcttggtgcccggttctccctcagggatggcgacaagccgcatgagatgaccttctaa 267
           |||||||||||||||||||| |||||||| ||||||||||| ||||||||||| ||||||
Sbjct: 671 tatcttggtgcccggttctctctcagggacggcgacaagccccatgagatgacattctaa 730

                                                    
Query: 268 gttatctggtacaagtttcaagatctgtggaaagtcttttt 308
           ||||   ||||||||||||||| |||| || ||||||||||
Sbjct: 731 gttagtcggtacaagtttcaagttctgagg-aagtcttttt 770



to top

>ref|XM_466485.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 660

 Score =  214 bits (108), Expect = 2e-52
 Identities = 207/240 (86%)
 Strand = Plus / Plus

                                                                       
Query: 28  aagtttgatgacaagtactttgctagggagaagaagactagggcaaagaagtctgagggc 87
           |||||||||||||||||||||||  |||| |||||| | | ||| |||||| | ||||| 
Sbjct: 421 aagtttgatgacaagtactttgcccgggacaagaaggcaaaggccaagaagaccgagggt 480

                                                                       
Query: 88  gagctgtttgagtcggagaaggaggcaacgaagaatctgcccgacttcaagaaggatgac 147
           || || |||||| | |||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 481 gaactttttgagacagagaaggaggcaaccaagaatctgcccgacttcaagaaggatgac 540

                                                                       
Query: 148 cagaaggtcattgacactgagttaatcaaggctatagatgctgtcccagaccttaaaagt 207
           |||||||   | ||  ||||||| ||||||||||| || | |||||||||||| |||   
Sbjct: 541 cagaaggctgtggatgctgagttgatcaaggctatcgaggttgtcccagacctgaaatcc 600

                                                                       
Query: 208 tatcttggtgcccggttctccctcagggatggcgacaagccgcatgagatgaccttctaa 267
           |||||||||||||||||||| |||||||| ||||||||||| ||||||||||| ||||||
Sbjct: 601 tatcttggtgcccggttctctctcagggacggcgacaagccccatgagatgacattctaa 660



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  188 bits (95), Expect = 1e-44
 Identities = 174/199 (87%), Gaps = 1/199 (0%)
 Strand = Plus / Minus

                                                                            
Query: 110      aggcaacgaagaatctgcccgacttcaagaaggatgaccagaaggtcattgacactgagt 169
                ||||||| |||||||||||||||||||||||||||||||||||||   | ||  ||||||
Sbjct: 22901950 aggcaaccaagaatctgcccgacttcaagaaggatgaccagaaggctgtggatgctgagt 22901891

                                                                            
Query: 170      taatcaaggctatagatgctgtcccagaccttaaaagttatcttggtgcccggttctccc 229
                | ||||||||||| || | |||||||||||| |||   |||||||||||||||||||| |
Sbjct: 22901890 tgatcaaggctatcgaggttgtcccagacctgaaatcctatcttggtgcccggttctctc 22901831

                                                                            
Query: 230      tcagggatggcgacaagccgcatgagatgaccttctaagttatctggtacaagtttcaag 289
                ||||||| ||||||||||| ||||||||||| ||||||||||   |||||||||||||||
Sbjct: 22901830 tcagggacggcgacaagccccatgagatgacattctaagttagtcggtacaagtttcaag 22901771

                                   
Query: 290      atctgtggaaagtcttttt 308
                 |||| || ||||||||||
Sbjct: 22901770 ttctgagg-aagtcttttt 22901753



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 71/85 (83%)
 Strand = Plus / Minus

                                                                            
Query: 28       aagtttgatgacaagtactttgctagggagaagaagactagggcaaagaagtctgagggc 87
                |||||||||||||||||||||||  |||| |||||| | | ||| |||||| | ||||| 
Sbjct: 22902126 aagtttgatgacaagtactttgcccgggacaagaaggcaaaggccaagaagaccgagggt 22902067

                                         
Query: 88       gagctgtttgagtcggagaaggagg 112
                || || |||||| | ||||||||||
Sbjct: 22902066 gaactttttgagacagagaaggagg 22902042



to top

>dbj|AP005874.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OSJNBa0016G10
          Length = 143211

 Score =  188 bits (95), Expect = 1e-44
 Identities = 174/199 (87%), Gaps = 1/199 (0%)
 Strand = Plus / Minus

                                                                         
Query: 110   aggcaacgaagaatctgcccgacttcaagaaggatgaccagaaggtcattgacactgagt 169
             ||||||| |||||||||||||||||||||||||||||||||||||   | ||  ||||||
Sbjct: 21752 aggcaaccaagaatctgcccgacttcaagaaggatgaccagaaggctgtggatgctgagt 21693

                                                                         
Query: 170   taatcaaggctatagatgctgtcccagaccttaaaagttatcttggtgcccggttctccc 229
             | ||||||||||| || | |||||||||||| |||   |||||||||||||||||||| |
Sbjct: 21692 tgatcaaggctatcgaggttgtcccagacctgaaatcctatcttggtgcccggttctctc 21633

                                                                         
Query: 230   tcagggatggcgacaagccgcatgagatgaccttctaagttatctggtacaagtttcaag 289
             ||||||| ||||||||||| ||||||||||| ||||||||||   |||||||||||||||
Sbjct: 21632 tcagggacggcgacaagccccatgagatgacattctaagttagtcggtacaagtttcaag 21573

                                
Query: 290   atctgtggaaagtcttttt 308
              |||| || ||||||||||
Sbjct: 21572 ttctgagg-aagtcttttt 21555



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 71/85 (83%)
 Strand = Plus / Minus

                                                                         
Query: 28    aagtttgatgacaagtactttgctagggagaagaagactagggcaaagaagtctgagggc 87
             |||||||||||||||||||||||  |||| |||||| | | ||| |||||| | ||||| 
Sbjct: 21928 aagtttgatgacaagtactttgcccgggacaagaaggcaaaggccaagaagaccgagggt 21869

                                      
Query: 88    gagctgtttgagtcggagaaggagg 112
             || || |||||| | ||||||||||
Sbjct: 21868 gaactttttgagacagagaaggagg 21844



to top

>dbj|AP005640.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:OSJNBa0006O15
          Length = 139723

 Score =  188 bits (95), Expect = 1e-44
 Identities = 174/199 (87%), Gaps = 1/199 (0%)
 Strand = Plus / Minus

                                                                          
Query: 110    aggcaacgaagaatctgcccgacttcaagaaggatgaccagaaggtcattgacactgagt 169
              ||||||| |||||||||||||||||||||||||||||||||||||   | ||  ||||||
Sbjct: 135288 aggcaaccaagaatctgcccgacttcaagaaggatgaccagaaggctgtggatgctgagt 135229

                                                                          
Query: 170    taatcaaggctatagatgctgtcccagaccttaaaagttatcttggtgcccggttctccc 229
              | ||||||||||| || | |||||||||||| |||   |||||||||||||||||||| |
Sbjct: 135228 tgatcaaggctatcgaggttgtcccagacctgaaatcctatcttggtgcccggttctctc 135169

                                                                          
Query: 230    tcagggatggcgacaagccgcatgagatgaccttctaagttatctggtacaagtttcaag 289
              ||||||| ||||||||||| ||||||||||| ||||||||||   |||||||||||||||
Sbjct: 135168 tcagggacggcgacaagccccatgagatgacattctaagttagtcggtacaagtttcaag 135109

                                 
Query: 290    atctgtggaaagtcttttt 308
               |||| || ||||||||||
Sbjct: 135108 ttctgagg-aagtcttttt 135091



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 71/85 (83%)
 Strand = Plus / Minus

                                                                          
Query: 28     aagtttgatgacaagtactttgctagggagaagaagactagggcaaagaagtctgagggc 87
              |||||||||||||||||||||||  |||| |||||| | | ||| |||||| | ||||| 
Sbjct: 135464 aagtttgatgacaagtactttgcccgggacaagaaggcaaaggccaagaagaccgagggt 135405

                                       
Query: 88     gagctgtttgagtcggagaaggagg 112
              || || |||||| | ||||||||||
Sbjct: 135404 gaactttttgagacagagaaggagg 135380



to top

>gb|AY103559.1| Zea mays PCO112591 mRNA sequence
          Length = 1361

 Score =  133 bits (67), Expect = 5e-28
 Identities = 190/231 (82%)
 Strand = Plus / Plus

                                                                        
Query: 28   aagtttgatgacaagtactttgctagggagaagaagactagggcaaagaagtctgagggc 87
            ||||||||||||||||||||||| ||||||||||||   | ||  |||||| | ||||||
Sbjct: 825  aagtttgatgacaagtactttgccagggagaagaagcagaaggtgaagaagaccgagggc 884

                                                                        
Query: 88   gagctgtttgagtcggagaaggaggcaacgaagaatctgcccgacttcaagaaggatgac 147
            ||||| |||||| | || ||||||||| | |||   ||||| ||||||||||||||||||
Sbjct: 885  gagctttttgagacagaaaaggaggcatccaagtcactgcctgacttcaagaaggatgac 944

                                                                        
Query: 148  cagaaggtcattgacactgagttaatcaaggctatagatgctgtcccagaccttaaaagt 207
            |||||||   | ||  |||   | ||||||||||| || |||||||  || || ||||  
Sbjct: 945  cagaaggctgtggattctgctctgatcaaggctatcgaggctgtcctggagctgaaaacc 1004

                                                               
Query: 208  tatcttggtgcccggttctccctcagggatggcgacaagccgcatgagatg 258
            |||||||| ||||||||||| ||||||||||| |||||||| |||||||||
Sbjct: 1005 tatcttggcgcccggttctctctcagggatggtgacaagccccatgagatg 1055



to top

>ref|XM_472843.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 669

 Score =  117 bits (59), Expect = 3e-23
 Identities = 188/231 (81%)
 Strand = Plus / Plus

                                                                       
Query: 28  aagtttgatgacaagtactttgctagggagaagaagactagggcaaagaagtctgagggc 87
           ||||||||||||||||||||  ||||||| ||||||   | ||| |||||| | ||||| 
Sbjct: 430 aagtttgatgacaagtacttctctagggacaagaagcagaaggcgaagaagaccgagggt 489

                                                                       
Query: 88  gagctgtttgagtcggagaaggaggcaacgaagaatctgcccgacttcaagaaggatgac 147
           || || |||||| | |||||||||||||| ||||| ||||| || ||||| ||||| |||
Sbjct: 490 gaactttttgagactgagaaggaggcaaccaagaacctgccggagttcaaaaaggaggac 549

                                                                       
Query: 148 cagaaggtcattgacactgagttaatcaaggctatagatgctgtcccagaccttaaaagt 207
           ||||| ||  | ||  | ||||| ||||| ||||| || |||||||| || || |||| |
Sbjct: 550 cagaaagttgtggatgccgagttgatcaaagctattgaagctgtcccggatctgaaaact 609

                                                              
Query: 208 tatcttggtgcccggttctccctcagggatggcgacaagccgcatgagatg 258
           || |||||||| ||||| || |||||||| ||||||||||| || ||||||
Sbjct: 610 taccttggtgcgcggttttctctcagggacggcgacaagccccacgagatg 660



to top

>dbj|AK067896.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013123D20, full
           insert sequence
          Length = 933

 Score =  117 bits (59), Expect = 3e-23
 Identities = 188/231 (81%)
 Strand = Plus / Plus

                                                                       
Query: 28  aagtttgatgacaagtactttgctagggagaagaagactagggcaaagaagtctgagggc 87
           ||||||||||||||||||||  ||||||| ||||||   | ||| |||||| | ||||| 
Sbjct: 484 aagtttgatgacaagtacttctctagggacaagaagcagaaggcgaagaagaccgagggt 543

                                                                       
Query: 88  gagctgtttgagtcggagaaggaggcaacgaagaatctgcccgacttcaagaaggatgac 147
           || || |||||| | |||||||||||||| ||||| ||||| || ||||| ||||| |||
Sbjct: 544 gaactttttgagactgagaaggaggcaaccaagaacctgccggagttcaaaaaggaggac 603

                                                                       
Query: 148 cagaaggtcattgacactgagttaatcaaggctatagatgctgtcccagaccttaaaagt 207
           ||||| ||  | ||  | ||||| ||||| ||||| || |||||||| || || |||| |
Sbjct: 604 cagaaagttgtggatgccgagttgatcaaagctattgaagctgtcccggatctgaaaact 663

                                                              
Query: 208 tatcttggtgcccggttctccctcagggatggcgacaagccgcatgagatg 258
           || |||||||| ||||| || |||||||| ||||||||||| || ||||||
Sbjct: 664 taccttggtgcgcggttttctctcagggacggcgacaagccccacgagatg 714



to top

>emb|AL606447.3|OSJN00011 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0022F23,
             complete sequence
          Length = 130273

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 121/149 (81%)
 Strand = Plus / Minus

                                                                         
Query: 110   aggcaacgaagaatctgcccgacttcaagaaggatgaccagaaggtcattgacactgagt 169
             ||||||| ||||| ||||| || ||||| ||||| |||||||| ||  | ||  | ||||
Sbjct: 79215 aggcaaccaagaacctgccggagttcaaaaaggaggaccagaaagttgtggatgccgagt 79156

                                                                         
Query: 170   taatcaaggctatagatgctgtcccagaccttaaaagttatcttggtgcccggttctccc 229
             | ||||| ||||| || |||||||| || || |||| ||| |||||||| ||||| || |
Sbjct: 79155 tgatcaaagctattgaagctgtcccggatctgaaaacttaccttggtgcgcggttttctc 79096

                                          
Query: 230   tcagggatggcgacaagccgcatgagatg 258
             ||||||| ||||||||||| || ||||||
Sbjct: 79095 tcagggacggcgacaagccccacgagatg 79067



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 70/85 (82%)
 Strand = Plus / Minus

                                                                         
Query: 28    aagtttgatgacaagtactttgctagggagaagaagactagggcaaagaagtctgagggc 87
             ||||||||||||||||||||  ||||||| ||||||   | ||| |||||| | ||||| 
Sbjct: 79388 aagtttgatgacaagtacttctctagggacaagaagcagaaggcgaagaagaccgagggt 79329

                                      
Query: 88    gagctgtttgagtcggagaaggagg 112
             || || |||||| | ||||||||||
Sbjct: 79328 gaactttttgagactgagaaggagg 79304



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 121/149 (81%)
 Strand = Plus / Minus

                                                                            
Query: 110      aggcaacgaagaatctgcccgacttcaagaaggatgaccagaaggtcattgacactgagt 169
                ||||||| ||||| ||||| || ||||| ||||| |||||||| ||  | ||  | ||||
Sbjct: 23636534 aggcaaccaagaacctgccggagttcaaaaaggaggaccagaaagttgtggatgccgagt 23636475

                                                                            
Query: 170      taatcaaggctatagatgctgtcccagaccttaaaagttatcttggtgcccggttctccc 229
                | ||||| ||||| || |||||||| || || |||| ||| |||||||| ||||| || |
Sbjct: 23636474 tgatcaaagctattgaagctgtcccggatctgaaaacttaccttggtgcgcggttttctc 23636415

                                             
Query: 230      tcagggatggcgacaagccgcatgagatg 258
                ||||||| ||||||||||| || ||||||
Sbjct: 23636414 tcagggacggcgacaagccccacgagatg 23636386



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 70/85 (82%)
 Strand = Plus / Minus

                                                                            
Query: 28       aagtttgatgacaagtactttgctagggagaagaagactagggcaaagaagtctgagggc 87
                ||||||||||||||||||||  ||||||| ||||||   | ||| |||||| | ||||| 
Sbjct: 23636707 aagtttgatgacaagtacttctctagggacaagaagcagaaggcgaagaagaccgagggt 23636648

                                         
Query: 88       gagctgtttgagtcggagaaggagg 112
                || || |||||| | ||||||||||
Sbjct: 23636647 gaactttttgagactgagaaggagg 23636623



to top

>emb|AL121581.41|HS1022E24 Human DNA sequence from clone RP5-1022E24 on chromosome 20 Contains the
              3' end of the OPRL1 gene for opiate receptor-like 1
              protein, the GPR8 gene encoding a G protein-coupled
              receptor, the KIAA0835 gene encoding a protein similar to
              the myelin transcription factor 1 (MYT1), a novel gene, 7
              CpG islands, ESTs, STSs and GSSs, complete sequence
          Length = 179888

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 138    gaaggatgaccagaaggtcattgaca 163
              ||||| ||||||||||||||||||||
Sbjct: 127641 gaaggctgaccagaaggtcattgaca 127616



to top

>ref|XM_363819.1| Magnaporthe grisea 70-15 hypothetical protein (MG01745.4) partial
           mRNA
          Length = 1389

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 34  gatgacaagtactttgctagg 54
           |||||||||||||||||||||
Sbjct: 778 gatgacaagtactttgctagg 798



to top

>gb|AC073073.2| Homo sapiens BAC clone RP11-251G23 from 7, complete sequence
          Length = 114414

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 148   cagaaggtcattgacactgag 168
             |||||||||||||||||||||
Sbjct: 94071 cagaaggtcattgacactgag 94051



to top

>gb|AC074397.7| Homo sapiens BAC clone RP11-598O8 from 7, complete sequence
          Length = 114576

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 12    caaggttaatatgcaaaagtt 32
             |||||||||||||||||||||
Sbjct: 52921 caaggttaatatgcaaaagtt 52941



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                         
Query: 50       ctagggagaagaagactagggcaaa 74
                |||||||||||||||| ||||||||
Sbjct: 24939926 ctagggagaagaagacaagggcaaa 24939950



to top

>dbj|AP003541.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0530H05
          Length = 145952

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 50    ctagggagaagaagactagggcaaa 74
             |||||||||||||||| ||||||||
Sbjct: 34481 ctagggagaagaagacaagggcaaa 34505



to top

>dbj|AP004737.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
              clone:OSJNBa0072A21
          Length = 158287

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 50     ctagggagaagaagactagggcaaa 74
              |||||||||||||||| ||||||||
Sbjct: 151009 ctagggagaagaagacaagggcaaa 151033



to top

>gb|AC022675.7| Mus musculus chromosome 1, clone RP23-59N15, complete sequence
          Length = 181063

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 67     agggcaaagaagtctgaggg 86
              ||||||||||||||||||||
Sbjct: 146528 agggcaaagaagtctgaggg 146509



to top

>gb|AC122535.3| Mus musculus BAC clone RP24-539K4 from chromosome 7, complete sequence
          Length = 186561

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 378   tgttaaatattttgagaaga 397
             ||||||||||||||||||||
Sbjct: 41657 tgttaaatattttgagaaga 41638



to top

>gb|AC124410.4| Mus musculus BAC clone RP24-266J11 from chromosome 7, complete sequence
          Length = 162876

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 378   tgttaaatattttgagaaga 397
             ||||||||||||||||||||
Sbjct: 24156 tgttaaatattttgagaaga 24175



to top

>gb|AC098742.4| Mus musculus BAC clone RP23-122N2 from 14, complete sequence
          Length = 218683

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 47     ttgctagggagaagaagact 66
              ||||||||||||||||||||
Sbjct: 217195 ttgctagggagaagaagact 217214



to top

>gb|AC146748.16| Medicago truncatula clone mth2-65k8, complete sequence
          Length = 113744

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 28    aagtttgatgacaagtactt 47
             ||||||||||||||||||||
Sbjct: 68015 aagtttgatgacaagtactt 68034



to top

>emb|AL590677.7| Human DNA sequence from clone RP11-214D15 on chromosome 10 Contains the
              5' end of the gene for a novel protein (FLJ40283), a novel
              gene and two CpG islands, complete sequence
          Length = 127714

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 12     caaggttaatatgcaaaagt 31
              ||||||||||||||||||||
Sbjct: 110693 caaggttaatatgcaaaagt 110712



to top

>emb|AL355485.9| Human DNA sequence from clone RP11-240M20 on chromosome 13, complete
              sequence
          Length = 149684

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 12     caaggttaatatgcaaaagt 31
              ||||||||||||||||||||
Sbjct: 114473 caaggttaatatgcaaaagt 114492



to top

>emb|AL138997.18| Human DNA sequence from clone RP11-10O23 on chromosome 13 Contains a
              hepatocyte nuclear factor 4 alpha (HNF4A) pseudogene,
              complete sequence
          Length = 172342

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 380    ttaaatattttgagaagatt 399
              ||||||||||||||||||||
Sbjct: 161997 ttaaatattttgagaagatt 162016



to top

>dbj|AK094601.1| Homo sapiens cDNA FLJ37282 fis, clone BRAMY2013216
          Length = 2669

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 12   caaggttaatatgcaaaagt 31
            ||||||||||||||||||||
Sbjct: 2549 caaggttaatatgcaaaagt 2530



to top

>gb|AC004671.1| Homo sapiens 12p13.3 PAC RPCI3-340I3 (Roswell Park Cancer Institute
             Human PAC Library) complete sequence
          Length = 141266

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 29    agtttgatgacaagtacttt 48
             ||||||||||||||||||||
Sbjct: 99707 agtttgatgacaagtacttt 99726



to top

>gb|AC108157.3| Homo sapiens BAC clone RP11-580P21 from 4, complete sequence
          Length = 167001

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 12    caaggttaatatgcaaaagt 31
             ||||||||||||||||||||
Sbjct: 50782 caaggttaatatgcaaaagt 50763



to top

>gb|AC097659.3| Homo sapiens BAC clone RP11-408C24 from 4, complete sequence
          Length = 131944

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 278   acaagtttcaagatctgtgg 297
             ||||||||||||||||||||
Sbjct: 10670 acaagtttcaagatctgtgg 10651



to top

>gb|AC074349.6| Homo sapiens BAC clone RP11-703G6 from 4, complete sequence
          Length = 176467

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 12    caaggttaatatgcaaaagt 31
             ||||||||||||||||||||
Sbjct: 81340 caaggttaatatgcaaaagt 81321



to top

>gb|AC069200.6| Homo sapiens BAC clone RP11-177J6 from 4, complete sequence
          Length = 148930

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 12     caaggttaatatgcaaaagt 31
              ||||||||||||||||||||
Sbjct: 146662 caaggttaatatgcaaaagt 146643



to top

>gb|AC026692.5| Homo sapiens chromosome 5 clone CTC-257L10, complete sequence
          Length = 139377

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 12     caaggttaatatgcaaaagt 31
              ||||||||||||||||||||
Sbjct: 125250 caaggttaatatgcaaaagt 125269



to top

>gb|AC035147.4| Homo sapiens chromosome 5 clone CTD-2309M13, complete sequence
          Length = 104940

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 12    caaggttaatatgcaaaagt 31
             ||||||||||||||||||||
Sbjct: 41389 caaggttaatatgcaaaagt 41370



to top

>gb|AC060788.11| Homo sapiens chromosome 8, clone CTD-2008O4, complete sequence
          Length = 177717

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 381    taaatattttgagaagatta 400
              ||||||||||||||||||||
Sbjct: 117739 taaatattttgagaagatta 117758



to top

>gb|AE015928.1| Bacteroides thetaiotaomicron VPI-5482, complete genome
          Length = 6260361

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 103     gagaaggaggcaacgaagaa 122
               ||||||||||||||||||||
Sbjct: 3692702 gagaaggaggcaacgaagaa 3692721



to top

>gb|AC068282.8| Homo sapiens BAC clone RP11-314L11 from 2, complete sequence
          Length = 205342

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 12     caaggttaatatgcaaaagt 31
              ||||||||||||||||||||
Sbjct: 125976 caaggttaatatgcaaaagt 125957



to top

>gb|AC044787.6|AC044787 Homo sapiens chromosome 15 clone CTD-2270N23 map 15q21, complete
             sequence
          Length = 148147

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 12    caaggttaatatgcaaaagt 31
             ||||||||||||||||||||
Sbjct: 96939 caaggttaatatgcaaaagt 96958



to top

>gb|AC017006.4| Homo sapiens BAC clone RP11-110G2 from 2, complete sequence
          Length = 191953

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 12    caaggttaatatgcaaaagt 31
             ||||||||||||||||||||
Sbjct: 85127 caaggttaatatgcaaaagt 85108



to top

>emb|X69378.1|MCYL16 M.crystallinum mRNA for ribosomal protein YL16
          Length = 1015

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 28  aagtttgatgacaagtactt 47
           ||||||||||||||||||||
Sbjct: 522 aagtttgatgacaagtactt 541



to top

>gb|AC154243.2| Mus musculus BAC clone RP24-173F3 from 14, complete sequence
          Length = 152254

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 47    ttgctagggagaagaagact 66
             ||||||||||||||||||||
Sbjct: 67982 ttgctagggagaagaagact 68001



to top

>emb|CR847530.19| Zebrafish DNA sequence from clone DKEY-14I17 in linkage group 20,
             complete sequence
          Length = 144640

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 365   tttgatttctacctgttaaa 384
             ||||||||||||||||||||
Sbjct: 64505 tttgatttctacctgttaaa 64486



to top

>gb|AC004047.1|AC004047 Homo sapiens chromosome 4 clone B150J4 map 4q25, complete sequence
          Length = 134649

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 12    caaggttaatatgcaaaagt 31
             ||||||||||||||||||||
Sbjct: 60015 caaggttaatatgcaaaagt 59996



to top

>gb|AC005394.1|AC005394 Homo sapiens chromosome 19, cosmid F8518, complete sequence
          Length = 44935

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 12   caaggttaatatgcaaaagt 31
            ||||||||||||||||||||
Sbjct: 1590 caaggttaatatgcaaaagt 1571



to top

>emb|AL354819.15| Human DNA sequence from clone RP11-7B3 on chromosome 13 Contains the 3'
              end of the gene for a novel calx-beta domain containing
              protein similar to sea urchin ECM3, a novel gene, a
              phospholipase A2 group XII (PLA2G12) pseudogene and a novel
              KIAA0565 KIAA1074 and breast cancer antigen NY-BR-1
              containing pseudogene, complete sequence
          Length = 153149

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 12     caaggttaatatgcaaaagt 31
              ||||||||||||||||||||
Sbjct: 124110 caaggttaatatgcaaaagt 124129



to top

>gb|AC161427.4| Gallus gallus BAC clone CH261-60M14 from chromosome ul, complete sequence
          Length = 174770

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 136    aagaaggatgaccagaaggt 155
              ||||||||||||||||||||
Sbjct: 148499 aagaaggatgaccagaaggt 148480



to top

>emb|AL365314.16| Mouse DNA sequence from clone RP23-106N23 on chromosome 1, complete
             sequence
          Length = 182054

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 67    agggcaaagaagtctgaggg 86
             ||||||||||||||||||||
Sbjct: 74874 agggcaaagaagtctgaggg 74893


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,956,268
Number of Sequences: 3902068
Number of extensions: 3956268
Number of successful extensions: 68575
Number of sequences better than 10.0: 47
Number of HSP's better than 10.0 without gapping: 47
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 68398
Number of HSP's gapped (non-prelim): 169
length of query: 418
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 396
effective length of database: 17,147,199,772
effective search space: 6790291109712
effective search space used: 6790291109712
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top