ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags7l23
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|U54767.1|HVU54767 Hordeum vulgare caffeic acid O-methyltransf... 101 1e-19
2ref|XM_880923.1| PREDICTED: Bos taurus hypothetical protein LOC6... 38 1.7
3gb|CP000356.1| Sphingopyxis alaskensis RB2256, complete genome 36 6.9
4emb|X14112.1|HE1CG Human herpesvirus 1 complete genome 36 6.9
5ref|XM_969160.1| PREDICTED: Tribolium castaneum similar to CG169... 36 6.9
6gb|CP000089.1| Dechloromonas aromatica RCB, complete genome 36 6.9
7dbj|AB256521.1| Human herpesvirus 1 UL38 gene for infected cell ... 36 6.9
8ref|XM_396407.2| PREDICTED: Apis mellifera similar to heparan su... 36 6.9
9gb|AC157086.2| Mus musculus BAC clone RP24-79B18 from chromosome... 36 6.9
10gb|U05002.1|PDNIRSECF Paracoccus denitrificans Pd1222 nirI, cyto... 36 6.9
11gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. ... 36 6.9
12gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete... 36 6.9
13gb|M22962.1|HS1CAS Herpes simplex virus type 1 capsid assembly a... 36 6.9

>gb|U54767.1|HVU54767 Hordeum vulgare caffeic acid O-methyltransferase (HvCOMT) gene,
            complete cds
          Length = 5238

 Score =  101 bits (51), Expect = 1e-19
 Identities = 51/51 (100%)
 Strand = Plus / Plus

                                                               
Query: 1    gctggtggcaaggcgctgacccccaacgagctcgtagagaacgtggagaca 51
            |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2867 gctggtggcaaggcgctgacccccaacgagctcgtagagaacgtggagaca 2917



to top

>ref|XM_880923.1| PREDICTED: Bos taurus hypothetical protein LOC615912 (LOC615912),
           mRNA
          Length = 1390

 Score = 38.2 bits (19), Expect = 1.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 9   caaggcgctgacccccaac 27
           |||||||||||||||||||
Sbjct: 396 caaggcgctgacccccaac 414



to top

>gb|CP000356.1| Sphingopyxis alaskensis RB2256, complete genome
          Length = 3345170

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 12     ggcgctgacccccaacga 29
              ||||||||||||||||||
Sbjct: 260719 ggcgctgacccccaacga 260736



to top

>emb|X14112.1|HE1CG Human herpesvirus 1 complete genome
          Length = 152261

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 12    ggcgctgacccccaacga 29
             ||||||||||||||||||
Sbjct: 84755 ggcgctgacccccaacga 84772



to top

>ref|XM_969160.1| PREDICTED: Tribolium castaneum similar to CG1697-PB, isoform B
           (LOC663099), mRNA
          Length = 1125

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 17  tgacccccaacgagctcg 34
           ||||||||||||||||||
Sbjct: 149 tgacccccaacgagctcg 166



to top

>gb|CP000089.1| Dechloromonas aromatica RCB, complete genome
          Length = 4501104

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                 
Query: 4       ggtggcaaggcgctgacc 21
               ||||||||||||||||||
Sbjct: 1079261 ggtggcaaggcgctgacc 1079278



to top

>dbj|AB256521.1| Human herpesvirus 1 UL38 gene for infected cell protein 32,
           complete cds, strain: MTD-1730
          Length = 1398

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 12  ggcgctgacccccaacga 29
           ||||||||||||||||||
Sbjct: 225 ggcgctgacccccaacga 242



to top

>ref|XM_396407.2| PREDICTED: Apis mellifera similar to heparan sulfate (glucosamine)
            3-O-sulfotransferase 5 (LOC412956), mRNA
          Length = 1110

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 21   ccccaacgagctcgtaga 38
            ||||||||||||||||||
Sbjct: 1084 ccccaacgagctcgtaga 1067



to top

>gb|AC157086.2| Mus musculus BAC clone RP24-79B18 from chromosome 9, complete sequence
          Length = 200734

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 13    gcgctgacccccaacgag 30
             ||||||||||||||||||
Sbjct: 60812 gcgctgacccccaacgag 60795



to top

>gb|U05002.1|PDNIRSECF Paracoccus denitrificans Pd1222 nirI, cytochrome cd1 nitrite
           reductase (nirS), S-adenosyl-L-methionine
           uroporphyrinogen III methyltransferase (nirE),
           cytochrome c (nirC), nirF and nirD genes, complete cds
          Length = 5574

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 7   ggcaaggcgctgaccccc 24
           ||||||||||||||||||
Sbjct: 877 ggcaaggcgctgaccccc 894



to top

>gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. k10, complete genome
          Length = 4829781

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                 
Query: 12      ggcgctgacccccaacga 29
               ||||||||||||||||||
Sbjct: 1214647 ggcgctgacccccaacga 1214630



to top

>gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete sequence
          Length = 2648638

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                 
Query: 13      gcgctgacccccaacgag 30
               ||||||||||||||||||
Sbjct: 2645949 gcgctgacccccaacgag 2645932



to top

>gb|M22962.1|HS1CAS Herpes simplex virus type 1 capsid assembly and DNA maturation
           protein gene, complete cds
          Length = 2098

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 12  ggcgctgacccccaacga 29
           ||||||||||||||||||
Sbjct: 633 ggcgctgacccccaacga 650


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 172,331
Number of Sequences: 3902068
Number of extensions: 172331
Number of successful extensions: 46004
Number of sequences better than 10.0: 13
Number of HSP's better than 10.0 without gapping: 13
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 45741
Number of HSP's gapped (non-prelim): 263
length of query: 51
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 31
effective length of database: 17,155,003,908
effective search space: 531805121148
effective search space used: 531805121148
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)
to top