ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags7k18
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1emb|Z23130.1|HVBLT63A H.vulgare BLT63 mRNA, complete CDS 62 5e-08
2gb|L11740.1|BLYEFIA Barley elongation factor 1 alpha, (EF-1A) mR... 62 5e-08
3emb|CR388054.11| Zebrafish DNA sequence from clone CH211-82E18 i... 54 1e-05
4emb|BX901943.3| Zebrafish DNA sequence from clone CH211-269I23 i... 54 1e-05
5ref|XM_679755.1| PREDICTED: Danio rerio similar to statin-like (... 54 1e-05
6ref|NM_001017795.1| Danio rerio zgc:110335 (zgc:110335), mRNA 54 1e-05
7gb|BC092884.1| Danio rerio zgc:110335, mRNA (cDNA clone MGC:1103... 54 1e-05
8emb|BX005350.6| Zebrafish DNA sequence from clone DKEY-58C8 in l... 54 1e-05
9gb|AF136825.1|AF136825 Zea mays clone c elongation factor 1 alph... 48 8e-04
10gb|AF136823.1|AF136823 Zea mays clone a elongation factor 1 alph... 48 8e-04
11gb|BT016740.1| Zea mays clone Contig573 mRNA sequence 46 0.003
12dbj|AB056104.1| Carassius auratus mRNA for elongation factor-1 a... 46 0.003
13dbj|AB013606.1| Oryzias latipes mRNA for elongation factor 1 alp... 46 0.003
14dbj|AB020734.1| Oryzias latipes gene for polypeptide elongation ... 46 0.003
15gb|BC060907.1| Danio rerio zgc:73138, mRNA (cDNA clone MGC:73138... 44 0.013
16ref|NM_200009.1| Danio rerio zgc:73138 (zgc:73138), mRNA 44 0.013
17emb|AJ720062.1| Gallus gallus mRNA for hypothetical protein, clo... 44 0.013
18ref|NM_204157.2| Gallus gallus eukaryotic translation elongation... 44 0.013
19gb|AC181983.2| Gallus gallus BAC clone CH261-63A17 from chromoso... 44 0.013
20ref|XM_697094.1| PREDICTED: Danio rerio hypothetical protein LOC... 44 0.013
21gb|DQ083080.1| Prochilodus rubrotaeniatus elongation factor-1 al... 44 0.013
22gb|AF369385.1|AF369385 Gallus gallus EST AW313486-based amplicon... 44 0.013
23emb|BX323884.5| Zebrafish DNA sequence from clone DKEY-187A12 in... 44 0.013
24emb|BX935744.1| Gallus gallus finished cDNA, clone ChEST2k15 44 0.013
25gb|AF268667.1|AF268667 Coturnix coturnix DNA sequence derived us... 44 0.013
26gb|L00677.1|CHKEF1A Gallus gallus elongation factor 1 alpha mRNA... 44 0.013
27ref|XM_817373.1| Trypanosoma brucei TREU927 elongation factor 1-... 42 0.050
28ref|XM_817372.1| Trypanosoma brucei TREU927 elongation factor 1-... 42 0.050
29ref|XM_817371.1| Trypanosoma brucei TREU927 elongation factor 1-... 42 0.050
30gb|AF136827.1|AF136827 Zea mays clone e elongation factor 1 alph... 42 0.050
31gb|U10562.1|TBU10562 Trypanosoma brucei elongation factor-1 alph... 42 0.050
32gb|L25868.1|TRBTEF1A Trypanosoma brucei elongation factor 1-alph... 42 0.050
33ref|XM_531399.1| PREDICTED: Pan troglodytes similar to eukaryoti... 40 0.20
34gb|BT016525.1| Zea mays clone Contig358 mRNA sequence 40 0.20
35gb|BT016514.1| Zea mays clone Contig347 mRNA sequence 40 0.20
36gb|BT018898.1| Zea mays clone EL01T0207D05.d mRNA sequence 40 0.20
37gb|BT017771.1| Zea mays clone EL01N0502E05.c mRNA sequence 40 0.20
38gb|BT016889.1| Zea mays clone Contig722 mRNA sequence 40 0.20
39gb|AY264207.1| Centrodoras cf. brachiatus elongation factor-1 al... 40 0.20
40gb|AY264206.1| Lithodoras dorsalis elongation factor-1 alpha gen... 40 0.20
41gb|AY580204.1| Encope michelini elongation factor 1 alpha mRNA, ... 40 0.20
42gb|AF479046.1| Triticum aestivum elongation factor-1 alpha mRNA,... 40 0.20
43dbj|AB193485.1| Takifugu rubripes EF-1a mRNA for elongation fact... 40 0.20
44dbj|BS000087.1| Pan troglodytes chromosome 22 clone:RP43-110O22,... 40 0.20
45gb|AF136829.1|AF136829 Zea mays clone g elongation factor 1 alph... 40 0.20
46gb|AF136828.1|AF136828 Zea mays clone f elongation factor 1 alph... 40 0.20
47gb|AF136826.1|AF136826 Zea mays clone d elongation factor 1 alph... 40 0.20
48gb|AF136824.1|AF136824 Zea mays clone b elongation factor 1 alph... 40 0.20
49gb|AY109326.1| Zea mays CL1256_1 mRNA sequence 40 0.20
50dbj|AP001687.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 40 0.20
51dbj|AP000459.4| Homo sapiens genomic DNA, chromosome 21q, clone:... 40 0.20
52ref|NM_001037873.1| Takifugu rubripes elongation factor 1 alpha ... 40 0.20
53gb|DQ284495.1| Solanum tuberosum clone 063G03 elongation factor-... 40 0.20
54emb|AL133222.2|HS69P17 Homo sapiens chromosome 21 BAC RPCIP704P1... 40 0.20
55gb|BT016242.1| Zea mays clone Contig75 mRNA sequence 38 0.78
56gb|AC097023.6| Rattus norvegicus BAC CH230-35L12 (Children's Hos... 38 0.78
57gb|BC072542.1| Rattus norvegicus eukaryotic translation elongati... 38 0.78
58gb|BC063162.1| Rattus norvegicus eukaryotic translation elongati... 38 0.78
59gb|AY264258.1| Dianema longibarbus elongation factor-1 alpha gen... 38 0.78
60gb|AY264256.1| Synodontis sp. GM-2003 elongation factor-1 alpha ... 38 0.78
61gb|AY264247.1| Acanthodoras spinosissimus elongation factor-1 al... 38 0.78
62gb|AY264246.1| Doras punctatus elongation factor-1 alpha gene, e... 38 0.78
63gb|AY264245.1| Trachydoras cf. microstomus elongation factor-1 a... 38 0.78
64gb|AY264244.1| Trachydoras nattereri haplotype II elongation fac... 38 0.78
65gb|AY264242.1| Trachydoras nattereri haplotype I elongation fact... 38 0.78
66gb|AY264241.1| Leptodoras cf. copei elongation factor-1 alpha ge... 38 0.78
67gb|AY264240.1| Leptodoras linnelli elongation factor-1 alpha gen... 38 0.78
68gb|AY264239.1| Leptodoras praelongus elongation factor-1 alpha g... 38 0.78
69gb|AY264238.1| Leptodoras cf. praelongus elongation factor-1 alp... 38 0.78
70gb|AY264237.1| Leptodoras sp. 1-GM-2003 elongation factor-1 alph... 38 0.78
71gb|AY264236.1| Leptodoras sp. 3-GM-2003 elongation factor-1 alph... 38 0.78
72gb|AY264235.1| Leptodoras sp. 3-GM-2003 elongation factor-1 alph... 38 0.78
73gb|AY264234.1| Leptodoras sp. 3-GM-2003 elongation factor-1 alph... 38 0.78
74gb|AY264233.1| Leptodoras acipenserinus elongation factor-1 alph... 38 0.78
75gb|AY264230.1| Leptodoras hasemani elongation factor-1 alpha gen... 38 0.78
76gb|AY264229.1| Hemidoras morrisi elongation factor-1 alpha gene,... 38 0.78
77gb|AY264228.1| Opsodoras stuebelii elongation factor-1 alpha gen... 38 0.78
78gb|AY264227.1| Hemidoras stenopeltis haplotype II elongation fac... 38 0.78
79gb|AY264226.1| Hemidoras stenopeltis haplotype I elongation fact... 38 0.78
80gb|AY264225.1| Hassar sp. GM-2003 elongation factor-1 alpha gene... 38 0.78
81gb|AY264224.1| Hassar sp. GM-2003 elongation factor-1 alpha gene... 38 0.78
82gb|AY264223.1| Opsodoras sp. GM-2003 elongation factor-1 alpha g... 38 0.78
83gb|AY264222.1| Opsodoras ternetzi haplotype I elongation factor-... 38 0.78
84gb|AY264221.1| Nemadoras hemipeltis elongation factor-1 alpha ge... 38 0.78
85gb|AY264220.1| Nemadoras trimaculatus elongation factor-1 alpha ... 38 0.78
86gb|AY264219.1| Doras micropoeus elongation factor-1 alpha gene, ... 38 0.78
87gb|AY264218.1| Doras carinatus elongation factor-1 alpha gene, e... 38 0.78
88gb|AY264216.1| Pterodoras granulosus elongation factor-1 alpha g... 38 0.78
89gb|AY264214.1| Oxydoras niger haplotype II elongation factor-1 a... 38 0.78
90gb|AY264213.1| Oxydoras niger haplotype I elongation factor-1 al... 38 0.78
91gb|AY264203.1| Physopyxis lyra elongation factor-1 alpha gene, e... 38 0.78
92gb|AY264202.1| Hypodoras forficulatus elongation factor-1 alpha ... 38 0.78
93gb|AY264198.1| Zungaro zungaro elongation factor-1 alpha gene, e... 38 0.78
94gb|AY264197.1| Sorubim lima elongation factor-1 alpha gene, exon... 38 0.78
95gb|DQ447161.1| Passiflora edulis translation elongation factor 1... 38 0.78
96gb|DQ087497.1| Trochospongilla pennsylvanica elongation factor 1... 38 0.78
97emb|AJ866727.1| Dicentrarchus labrax partial mRNA for elongation... 38 0.78
98ref|NM_175838.1| Rattus norvegicus eukaryotic translation elonga... 38 0.78
99gb|DQ083088.1| Prochilodus magdalenae elongation factor-1 alpha ... 38 0.78
100gb|DQ083087.1| Prochilodus magdalenae elongation factor-1 alpha ... 38 0.78
101gb|DQ083086.1| Prochilodus magdalenae elongation factor-1 alpha ... 38 0.78
102gb|DQ083085.1| Prochilodus rubrotaeniatus elongation factor-1 al... 38 0.78
103gb|DQ083084.1| Prochilodus rubrotaeniatus elongation factor-1 al... 38 0.78
104gb|DQ083083.1| Prochilodus rubrotaeniatus elongation factor-1 al... 38 0.78
105gb|DQ083082.1| Prochilodus rubrotaeniatus elongation factor-1 al... 38 0.78
106gb|DQ083081.1| Prochilodus rubrotaeniatus elongation factor-1 al... 38 0.78
107gb|DQ083079.1| Prochilodus mariae elongation factor-1 alpha (EF1... 38 0.78
108gb|DQ083078.1| Prochilodus mariae elongation factor-1 alpha (EF1... 38 0.78
109gb|DQ083077.1| Prochilodus mariae elongation factor-1 alpha (EF1... 38 0.78
110gb|DQ083076.1| Prochilodus mariae elongation factor-1 alpha (EF1... 38 0.78
111gb|DQ083075.1| Prochilodus mariae elongation factor-1 alpha (EF1... 38 0.78
112gb|DQ083074.1| Prochilodus mariae elongation factor-1 alpha (EF1... 38 0.78
113gb|DQ083073.1| Prochilodus mariae elongation factor-1 alpha (EF1... 38 0.78
114gb|DQ083072.1| Prochilodus mariae elongation factor-1 alpha (EF1... 38 0.78
115gb|DQ083070.1| Prochilodus mariae elongation factor-1 alpha (EF1... 38 0.78
116gb|DQ083069.1| Prochilodus mariae elongation factor-1 alpha (EF1... 38 0.78
117gb|DQ083068.1| Prochilodus mariae elongation factor-1 alpha (EF1... 38 0.78
118gb|DQ083067.1| Prochilodus mariae elongation factor-1 alpha (EF1... 38 0.78
119gb|DQ083066.1| Prochilodus mariae elongation factor-1 alpha (EF1... 38 0.78
120gb|DQ083065.1| Prochilodus mariae elongation factor-1 alpha (EF1... 38 0.78
121gb|DQ083064.1| Prochilodus mariae elongation factor-1 alpha (EF1... 38 0.78
122gb|DQ083063.1| Prochilodus mariae elongation factor-1 alpha (EF1... 38 0.78
123gb|DQ083062.1| Prochilodus mariae elongation factor-1 alpha (EF1... 38 0.78
124gb|DQ083061.1| Prochilodus mariae elongation factor-1 alpha (EF1... 38 0.78
125gb|DQ083060.1| Prochilodus mariae elongation factor-1 alpha (EF1... 38 0.78
126gb|DQ083059.1| Prochilodus mariae elongation factor-1 alpha (EF1... 38 0.78
127gb|DQ083058.1| Prochilodus mariae elongation factor-1 alpha (EF1... 38 0.78
128gb|DQ083057.1| Prochilodus mariae elongation factor-1 alpha (EF1... 38 0.78
129gb|DQ083056.1| Prochilodus mariae elongation factor-1 alpha (EF1... 38 0.78
130gb|DQ083055.1| Prochilodus mariae elongation factor-1 alpha (EF1... 38 0.78
131gb|AF485331.1| Cyprinus carpio elongation factor 1-alpha mRNA, c... 38 0.78
132gb|AC092725.3| Homo sapiens chromosome 16 clone RP11-673P17, com... 38 0.78
133gb|U08844.1|PPU08844 Porphyra purpurea elongation factor EF1-alp... 38 0.78
134ref|XM_215885.3| PREDICTED: Rattus norvegicus similar to zinc fi... 38 0.78
135gb|BC091297.1| Rattus norvegicus eukaryotic translation elongati... 38 0.78
136gb|BC111707.1| Rattus norvegicus eukaryotic translation elongati... 38 0.78
137emb|X61043.1|RNEF1AA R.norvegicus mRNA for elongation factor 1 a... 38 0.78
138emb|X63561.1|RNELF1A R.norvegicus mRNA for elongation factor 1-a... 38 0.78
139gb|AF041463.1|AF041463 Manihot esculenta elongation factor 1-alp... 38 0.78
140ref|NM_033539.1| Rattus norvegicus eukaryotic translation elonga... 38 0.78
141dbj|AB075952.1| Oreochromis niloticus EF-1a mRNA for elongation ... 38 0.78
142gb|L10339.1|RATEF1AX Rat elongation factor-1 alpha (ef-1) mRNA, ... 38 0.78
143dbj|AB003709.1| Owenia fusiformis mRNA for elongation factor-1al... 38 0.78
144gb|AY550990.1| Elaeis guineensis elongation factor 1-alpha 1 (EF... 36 3.1
145gb|DQ471105.1| Tubeufia cerea isolate AFTOL-ID 1316 translation ... 36 3.1
146gb|AY264255.1| Centromochlus heckelii elongation factor-1 alpha ... 36 3.1
147gb|AY264243.1| Trachydoras steindachneri elongation factor-1 alp... 36 3.1
148emb|CR735017.2|CNS0GTX4 Tetraodon nigroviridis full-length cDNA 36 3.1
149emb|CR734904.2|CNS0GTTZ Tetraodon nigroviridis full-length cDNA 36 3.1
150emb|CR733931.2|CNS0GT2Y Tetraodon nigroviridis full-length cDNA 36 3.1
151emb|CR733917.2|CNS0GT2K Tetraodon nigroviridis full-length cDNA 36 3.1
152emb|CR733688.2|CNS0GSW7 Tetraodon nigroviridis full-length cDNA 36 3.1
153emb|CR732349.2|CNS0GS0Y Tetraodon nigroviridis full-length cDNA 36 3.1
154emb|CR732122.2|CNS0GRUN Tetraodon nigroviridis full-length cDNA 36 3.1
155emb|CR731738.2|CNS0GRJZ Tetraodon nigroviridis full-length cDNA 36 3.1
156emb|CR730131.2|CNS0GQBD Tetraodon nigroviridis full-length cDNA 36 3.1
157emb|CR728708.2|CNS0GP7U Tetraodon nigroviridis full-length cDNA 36 3.1
158emb|CR728391.2|CNS0GOZ1 Tetraodon nigroviridis full-length cDNA 36 3.1
159emb|CR728365.2|CNS0GOYB Tetraodon nigroviridis full-length cDNA 36 3.1
160emb|CR728539.1|CNS0GP35 Tetraodon nigroviridis full-length cDNA 36 3.1
161emb|CR728050.2|CNS0GOPK Tetraodon nigroviridis full-length cDNA 36 3.1
162emb|CR727656.2|CNS0GOEM Tetraodon nigroviridis full-length cDNA 36 3.1
163emb|CR727218.2|CNS0GO2G Tetraodon nigroviridis full-length cDNA 36 3.1
164emb|CR727203.2|CNS0GO21 Tetraodon nigroviridis full-length cDNA 36 3.1
165emb|CR726822.2|CNS0GNRG Tetraodon nigroviridis full-length cDNA 36 3.1
166emb|CR726256.2|CNS0GNBQ Tetraodon nigroviridis full-length cDNA 36 3.1
167emb|CR725822.2|CNS0GMZO Tetraodon nigroviridis full-length cDNA 36 3.1
168emb|CR725347.2|CNS0GMMH Tetraodon nigroviridis full-length cDNA 36 3.1
169emb|CR725433.2|CNS0GMOV Tetraodon nigroviridis full-length cDNA 36 3.1
170emb|CR724974.2|CNS0GMC4 Tetraodon nigroviridis full-length cDNA 36 3.1
171emb|CR724186.2|CNS0GLQ8 Tetraodon nigroviridis full-length cDNA 36 3.1
172emb|CR723732.2|CNS0GLDM Tetraodon nigroviridis full-length cDNA 36 3.1
173emb|CR723455.2|CNS0GL5X Tetraodon nigroviridis full-length cDNA 36 3.1
174emb|CR723407.2|CNS0GL4L Tetraodon nigroviridis full-length cDNA 36 3.1
175emb|CR703641.2|CNS0G5VP Tetraodon nigroviridis full-length cDNA 36 3.1
176emb|CR697394.2|CNS0G126 Tetraodon nigroviridis full-length cDNA 36 3.1
177emb|CR693228.2|CNS0FXUG Tetraodon nigroviridis full-length cDNA 36 3.1
178emb|CR692485.2|CNS0FX9T Tetraodon nigroviridis full-length cDNA 36 3.1
179emb|CR690840.2|CNS0FW04 Tetraodon nigroviridis full-length cDNA 36 3.1
180emb|CR687295.1|CNS0FT9N Tetraodon nigroviridis full-length cDNA 36 3.1
181emb|CR681034.2|CNS0FOFQ Tetraodon nigroviridis full-length cDNA 36 3.1
182emb|CR679277.2|CNS0FN2X Tetraodon nigroviridis full-length cDNA 36 3.1
183emb|CR677608.2|CNS0FLSY Tetraodon nigroviridis full-length cDNA 36 3.1
184emb|CR677761.2|CNS0FLX5 Tetraodon nigroviridis full-length cDNA 36 3.1
185emb|CR678478.1|CNS0FMGR Tetraodon nigroviridis full-length cDNA 36 3.1
186emb|CR678326.1|CNS0FMCO Tetraodon nigroviridis full-length cDNA 36 3.1
187emb|CR677885.2|CNS0FM0L Tetraodon nigroviridis full-length cDNA 36 3.1
188emb|CR677409.2|CNS0FLNH Tetraodon nigroviridis full-length cDNA 36 3.1
189emb|CR675905.2|CNS0FKHZ Tetraodon nigroviridis full-length cDNA 36 3.1
190emb|CR675801.2|CNS0FKF3 Tetraodon nigroviridis full-length cDNA 36 3.1
191emb|CR675388.2|CNS0FK3M Tetraodon nigroviridis full-length cDNA 36 3.1
192emb|CR675123.2|CNS0FJW9 Tetraodon nigroviridis full-length cDNA 36 3.1
193emb|CR674541.2|CNS0FJG3 Tetraodon nigroviridis full-length cDNA 36 3.1
194emb|CR674177.1|CNS0FJ5Z Tetraodon nigroviridis full-length cDNA 36 3.1
195emb|CR673868.2|CNS0FIXE Tetraodon nigroviridis full-length cDNA 36 3.1
196emb|CR673551.1|CNS0FIOL Tetraodon nigroviridis full-length cDNA 36 3.1
197emb|CR673454.2|CNS0FILW Tetraodon nigroviridis full-length cDNA 36 3.1
198emb|CR672817.2|CNS0FI47 Tetraodon nigroviridis full-length cDNA 36 3.1
199emb|CR672522.2|CNS0FHW0 Tetraodon nigroviridis full-length cDNA 36 3.1
200emb|CR672427.2|CNS0FHTD Tetraodon nigroviridis full-length cDNA 36 3.1
201emb|CR671794.2|CNS0FHBS Tetraodon nigroviridis full-length cDNA 36 3.1
202emb|CR669604.2|CNS0FFMY Tetraodon nigroviridis full-length cDNA 36 3.1
203emb|CR668349.2|CNS0FEO3 Tetraodon nigroviridis full-length cDNA 36 3.1
204emb|CR667314.2|CNS0FDVC Tetraodon nigroviridis full-length cDNA 36 3.1
205emb|CR666706.2|CNS0FDEG Tetraodon nigroviridis full-length cDNA 36 3.1
206emb|CR666536.2|CNS0FD9Q Tetraodon nigroviridis full-length cDNA 36 3.1
207emb|CR666332.2|CNS0FD42 Tetraodon nigroviridis full-length cDNA 36 3.1
208emb|CR666125.2|CNS0FCYB Tetraodon nigroviridis full-length cDNA 36 3.1
209emb|CR666016.2|CNS0FCVA Tetraodon nigroviridis full-length cDNA 36 3.1
210emb|CR664877.2|CNS0FBZN Tetraodon nigroviridis full-length cDNA 36 3.1
211emb|CR664825.2|CNS0FBY7 Tetraodon nigroviridis full-length cDNA 36 3.1
212emb|CR663406.2|CNS0FAUS Tetraodon nigroviridis full-length cDNA 36 3.1
213emb|CR662677.2|CNS0FAAJ Tetraodon nigroviridis full-length cDNA 36 3.1
214emb|CR662215.2|CNS0F9XP Tetraodon nigroviridis full-length cDNA 36 3.1
215emb|CR661799.2|CNS0F9M5 Tetraodon nigroviridis full-length cDNA 36 3.1
216emb|CR661408.2|CNS0F9BA Tetraodon nigroviridis full-length cDNA 36 3.1
217emb|CR657956.1|CNS0F6NE Tetraodon nigroviridis full-length cDNA 36 3.1
218emb|CR660271.2|CNS0F8FP Tetraodon nigroviridis full-length cDNA 36 3.1
219emb|CR659772.2|CNS0F81U Tetraodon nigroviridis full-length cDNA 36 3.1
220emb|CR657394.2|CNS0F67S Tetraodon nigroviridis full-length cDNA 36 3.1
221emb|AJ132534.1|PAB132534 Picea abies mRNA for translation elonga... 36 3.1
222gb|AF321836.1| Salmo salar elongation factor 1 alpha mRNA, compl... 36 3.1
223dbj|AB124568.1| Pelodiscus sinensis PsEF1a mRNA for elongation f... 36 3.1
224gb|AC021636.16| Homo sapiens chromosome 8, clone RP11-637F16, co... 36 3.1
225gb|AY879117.1| Calostoma cinnabarinum isolate AFTOL-ID 439 trans... 36 3.1
226dbj|AB073629.1| Bruguiera sexangula bsef-1A mRNA for eukaryotic ... 36 3.1
227dbj|AB032900.1| Seriola quinqueradiata mRNA for elongation facto... 36 3.1 
>emb|Z23130.1|HVBLT63A H.vulgare BLT63 mRNA, complete CDS
          Length = 1560

 Score = 61.9 bits (31), Expect = 5e-08
 Identities = 33/34 (97%)
 Strand = Plus / Plus

                                              
Query: 1    ggttatgcccctgtgctggactgccncacatccc 34
            ||||||||||||||||||||||||| ||||||||
Sbjct: 1076 ggttatgcccctgtgctggactgccacacatccc 1109
to top
>gb|L11740.1|BLYEFIA Barley elongation factor 1 alpha, (EF-1A) mRNA sequence
          Length = 1725

 Score = 61.9 bits (31), Expect = 5e-08
 Identities = 33/34 (97%)
 Strand = Plus / Plus

                                              
Query: 1    ggttatgcccctgtgctggactgccncacatccc 34
            ||||||||||||||||||||||||| ||||||||
Sbjct: 1137 ggttatgcccctgtgctggactgccacacatccc 1170
to top
>emb|CR388054.11| Zebrafish DNA sequence from clone CH211-82E18 in linkage group 1,
             complete sequence
          Length = 162569

 Score = 54.0 bits (27), Expect = 1e-05
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                           
Query: 1     ggttatgcccctgtgctggactgccncaca 30
             ||||||||||||||||||||||||| ||||
Sbjct: 30583 ggttatgcccctgtgctggactgccacaca 30612
to top
>emb|BX901943.3| Zebrafish DNA sequence from clone CH211-269I23 in linkage group 1,
             complete sequence
          Length = 43165

 Score = 54.0 bits (27), Expect = 1e-05
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                           
Query: 1     ggttatgcccctgtgctggactgccncaca 30
             ||||||||||||||||||||||||| ||||
Sbjct: 24991 ggttatgcccctgtgctggactgccacaca 25020
to top
>ref|XM_679755.1| PREDICTED: Danio rerio similar to statin-like (LOC556833), mRNA
          Length = 1247

 Score = 54.0 bits (27), Expect = 1e-05
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                         
Query: 1   ggttatgcccctgtgctggactgccncaca 30
           ||||||||||||||||||||||||| ||||
Sbjct: 292 ggttatgcccctgtgctggactgccacaca 321
to top
>ref|NM_001017795.1| Danio rerio zgc:110335 (zgc:110335), mRNA
          Length = 2127

 Score = 54.0 bits (27), Expect = 1e-05
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                          
Query: 1    ggttatgcccctgtgctggactgccncaca 30
            ||||||||||||||||||||||||| ||||
Sbjct: 1151 ggttatgcccctgtgctggactgccacaca 1180
to top
>gb|BC092884.1| Danio rerio zgc:110335, mRNA (cDNA clone MGC:110335 IMAGE:7402736),
            complete cds
          Length = 2127

 Score = 54.0 bits (27), Expect = 1e-05
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                          
Query: 1    ggttatgcccctgtgctggactgccncaca 30
            ||||||||||||||||||||||||| ||||
Sbjct: 1151 ggttatgcccctgtgctggactgccacaca 1180
to top
>emb|BX005350.6| Zebrafish DNA sequence from clone DKEY-58C8 in linkage group 1, complete
              sequence
          Length = 195436

 Score = 54.0 bits (27), Expect = 1e-05
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                            
Query: 1      ggttatgcccctgtgctggactgccncaca 30
              ||||||||||||||||||||||||| ||||
Sbjct: 171744 ggttatgcccctgtgctggactgccacaca 171715
to top
>gb|AF136825.1|AF136825 Zea mays clone c elongation factor 1 alpha mRNA, complete cds
          Length = 1609

 Score = 48.1 bits (24), Expect = 8e-04
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                           
Query: 4    tatgcccctgtgctggactgccncacatccc 34
            |||||||||||||||||||||| ||| ||||
Sbjct: 1109 tatgcccctgtgctggactgccacacctccc 1139
to top
>gb|AF136823.1|AF136823 Zea mays clone a elongation factor 1 alpha mRNA, complete cds
          Length = 1600

 Score = 48.1 bits (24), Expect = 8e-04
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                           
Query: 4    tatgcccctgtgctggactgccncacatccc 34
            |||||||||||||||||||||| ||| ||||
Sbjct: 1104 tatgcccctgtgctggactgccacacctccc 1134
to top
>gb|BT016740.1| Zea mays clone Contig573 mRNA sequence
          Length = 1712

 Score = 46.1 bits (23), Expect = 0.003
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                              
Query: 1    ggttatgcccctgtgctggactgccncacatccc 34
            ||||||||||| ||||||||||||| ||| ||||
Sbjct: 1125 ggttatgccccagtgctggactgccacacctccc 1158
to top
>dbj|AB056104.1| Carassius auratus mRNA for elongation factor-1 alpha, complete cds
          Length = 1704

 Score = 46.1 bits (23), Expect = 0.003
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 4    tatgcccctgtgctggactgccncac 29
            |||||||||||||||||||||| |||
Sbjct: 1104 tatgcccctgtgctggactgccacac 1129
to top
>dbj|AB013606.1| Oryzias latipes mRNA for elongation factor 1 alpha, complete cds
          Length = 1386

 Score = 46.1 bits (23), Expect = 0.003
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 4    tatgcccctgtgctggactgccncac 29
            |||||||||||||||||||||| |||
Sbjct: 1069 tatgcccctgtgctggactgccacac 1094
to top
>dbj|AB020734.1| Oryzias latipes gene for polypeptide elongation factor 1 alpha,
            complete cds
          Length = 10485

 Score = 46.1 bits (23), Expect = 0.003
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 4    tatgcccctgtgctggactgccncac 29
            |||||||||||||||||||||| |||
Sbjct: 5008 tatgcccctgtgctggactgccacac 5033
to top
>gb|BC060907.1| Danio rerio zgc:73138, mRNA (cDNA clone MGC:73138 IMAGE:4790654),
            complete cds
          Length = 2172

 Score = 44.1 bits (22), Expect = 0.013
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 1    ggttatgcccctgtgctggactgccncac 29
            |||||||||||||||||||| |||| |||
Sbjct: 1120 ggttatgcccctgtgctggattgccacac 1148
to top
>ref|NM_200009.1| Danio rerio zgc:73138 (zgc:73138), mRNA
          Length = 2172

 Score = 44.1 bits (22), Expect = 0.013
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 1    ggttatgcccctgtgctggactgccncac 29
            |||||||||||||||||||| |||| |||
Sbjct: 1120 ggttatgcccctgtgctggattgccacac 1148
to top
>emb|AJ720062.1| Gallus gallus mRNA for hypothetical protein, clone 10b5
          Length = 3070

 Score = 44.1 bits (22), Expect = 0.013
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 1    ggttatgcccctgtgctggactgccncac 29
            |||||||||||||||||||| |||| |||
Sbjct: 2455 ggttatgcccctgtgctggattgccacac 2483
to top
>ref|NM_204157.2| Gallus gallus eukaryotic translation elongation factor 1 alpha 1
            (EEF1A1), mRNA
          Length = 3070

 Score = 44.1 bits (22), Expect = 0.013
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 1    ggttatgcccctgtgctggactgccncac 29
            |||||||||||||||||||| |||| |||
Sbjct: 2455 ggttatgcccctgtgctggattgccacac 2483
to top
>gb|AC181983.2| Gallus gallus BAC clone CH261-63A17 from chromosome ul, complete sequence
          Length = 161905

 Score = 44.1 bits (22), Expect = 0.013
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 1      ggttatgcccctgtgctggactgccncac 29
              |||||||||||||||||||| |||| |||
Sbjct: 128475 ggttatgcccctgtgctggattgccacac 128447
to top
>ref|XM_697094.1| PREDICTED: Danio rerio hypothetical protein LOC554716 (LOC554716),
            mRNA
          Length = 2128

 Score = 44.1 bits (22), Expect = 0.013
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 1    ggttatgcccctgtgctggactgccncac 29
            |||||||||||||||||||| |||| |||
Sbjct: 1121 ggttatgcccctgtgctggattgccacac 1149
to top
>gb|DQ083080.1| Prochilodus rubrotaeniatus elongation factor-1 alpha (EF1) gene,
           EF1-26 allele, exons 6, 7 and partial cds
          Length = 330

 Score = 44.1 bits (22), Expect = 0.013
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 1   ggttatgcccctgtgctggactgccncac 29
           |||||||||||||||||||| |||| |||
Sbjct: 193 ggttatgcccctgtgctggattgccacac 221
to top
>gb|AF369385.1|AF369385 Gallus gallus EST AW313486-based amplicon sequence
          Length = 768

 Score = 44.1 bits (22), Expect = 0.013
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 1   ggttatgcccctgtgctggactgccncac 29
           |||||||||||||||||||| |||| |||
Sbjct: 269 ggttatgcccctgtgctggattgccacac 297
to top
>emb|BX323884.5| Zebrafish DNA sequence from clone DKEY-187A12 in linkage group 13,
             complete sequence
          Length = 137509

 Score = 44.1 bits (22), Expect = 0.013
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 1     ggttatgcccctgtgctggactgccncac 29
             |||||||||||||||||||| |||| |||
Sbjct: 11000 ggttatgcccctgtgctggattgccacac 10972
to top
>emb|BX935744.1| Gallus gallus finished cDNA, clone ChEST2k15
          Length = 1043

 Score = 44.1 bits (22), Expect = 0.013
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 1   ggttatgcccctgtgctggactgccncac 29
           |||||||||||||||||||| |||| |||
Sbjct: 444 ggttatgcccctgtgctggattgccacac 472
to top
>gb|AF268667.1|AF268667 Coturnix coturnix DNA sequence derived using primers specific for
           chicken EST AW313486
          Length = 966

 Score = 44.1 bits (22), Expect = 0.013
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 1   ggttatgcccctgtgctggactgccncac 29
           |||||||||||||||||||| |||| |||
Sbjct: 735 ggttatgcccctgtgctggattgccacac 707
to top
>gb|L00677.1|CHKEF1A Gallus gallus elongation factor 1 alpha mRNA, complete cds
          Length = 1690

 Score = 44.1 bits (22), Expect = 0.013
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 1    ggttatgcccctgtgctggactgccncac 29
            |||||||||||||||||||| |||| |||
Sbjct: 1126 ggttatgcccctgtgctggattgccacac 1154
to top
>ref|XM_817373.1| Trypanosoma brucei TREU927 elongation factor 1-alpha (Tb10.70.5650)
            partial mRNA
          Length = 1350

 Score = 42.1 bits (21), Expect = 0.050
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 1    ggttatgcccctgtgctggactgccncacatc 32
            |||||||| || ||||||||||||| ||||||
Sbjct: 1030 ggttatgcgcccgtgctggactgccacacatc 1061
to top
>ref|XM_817372.1| Trypanosoma brucei TREU927 elongation factor 1-alpha (Tb10.70.5670)
            partial mRNA
          Length = 1350

 Score = 42.1 bits (21), Expect = 0.050
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 1    ggttatgcccctgtgctggactgccncacatc 32
            |||||||| || ||||||||||||| ||||||
Sbjct: 1030 ggttatgcgcccgtgctggactgccacacatc 1061
to top
>ref|XM_817371.1| Trypanosoma brucei TREU927 elongation factor 1-alpha (Tb10.70.5680)
           partial mRNA
          Length = 1047

 Score = 42.1 bits (21), Expect = 0.050
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 1   ggttatgcccctgtgctggactgccncacatc 32
           |||||||| || ||||||||||||| ||||||
Sbjct: 727 ggttatgcgcccgtgctggactgccacacatc 758
to top
>gb|AF136827.1|AF136827 Zea mays clone e elongation factor 1 alpha mRNA, complete cds
          Length = 1606

 Score = 42.1 bits (21), Expect = 0.050
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 7    gcccctgtgctggactgccncacatccc 34
            ||||||||||||||||||| ||| ||||
Sbjct: 1124 gcccctgtgctggactgccacacgtccc 1151
to top
>gb|U10562.1|TBU10562 Trypanosoma brucei elongation factor-1 alpha mRNA, complete cds
          Length = 2024

 Score = 42.1 bits (21), Expect = 0.050
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 1    ggttatgcccctgtgctggactgccncacatc 32
            |||||||| || ||||||||||||| ||||||
Sbjct: 1084 ggttatgcgcccgtgctggactgccacacatc 1115
to top
>gb|L25868.1|TRBTEF1A Trypanosoma brucei elongation factor 1-alpha (tef1) gene, partial cds
          Length = 1195

 Score = 42.1 bits (21), Expect = 0.050
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 1    ggttatgcccctgtgctggactgccncacatc 32
            |||||||| || ||||||||||||| ||||||
Sbjct: 980  ggttatgcgcccgtgctggactgccacacatc 1011
to top
>ref|XM_531399.1| PREDICTED: Pan troglodytes similar to eukaryotic translation
           elongation factor 1 alpha 2 (LOC473927), mRNA
          Length = 713

 Score = 40.1 bits (20), Expect = 0.20
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 4   tatgcccctgtgctggactgccncaca 30
           ||||||||||||||||| |||| ||||
Sbjct: 400 tatgcccctgtgctggattgccacaca 426
to top
>gb|BT016525.1| Zea mays clone Contig358 mRNA sequence
          Length = 1705

 Score = 40.1 bits (20), Expect = 0.20
 Identities = 28/31 (90%)
 Strand = Plus / Plus

                                           
Query: 4    tatgcccctgtgctggactgccncacatccc 34
            |||||||| ||||||||||||| ||| ||||
Sbjct: 1112 tatgccccagtgctggactgccacacctccc 1142
to top
>gb|BT016514.1| Zea mays clone Contig347 mRNA sequence
          Length = 1687

 Score = 40.1 bits (20), Expect = 0.20
 Identities = 28/31 (90%)
 Strand = Plus / Plus

                                           
Query: 4    tatgcccctgtgctggactgccncacatccc 34
            |||||||| ||||||||||||| ||| ||||
Sbjct: 1113 tatgccccagtgctggactgccacacctccc 1143
to top
>gb|BT018898.1| Zea mays clone EL01T0207D05.d mRNA sequence
          Length = 1483

 Score = 40.1 bits (20), Expect = 0.20
 Identities = 28/31 (90%)
 Strand = Plus / Plus

                                           
Query: 4    tatgcccctgtgctggactgccncacatccc 34
            |||||||| ||||||||||||| ||| ||||
Sbjct: 1072 tatgccccagtgctggactgccacacctccc 1102
to top
>gb|BT017771.1| Zea mays clone EL01N0502E05.c mRNA sequence
          Length = 959

 Score = 40.1 bits (20), Expect = 0.20
 Identities = 28/31 (90%)
 Strand = Plus / Plus

                                          
Query: 4   tatgcccctgtgctggactgccncacatccc 34
           |||||||| ||||||||||||| ||| ||||
Sbjct: 493 tatgccccagtgctggactgccacacctccc 523
to top
>gb|BT016889.1| Zea mays clone Contig722 mRNA sequence
          Length = 930

 Score = 40.1 bits (20), Expect = 0.20
 Identities = 28/31 (90%)
 Strand = Plus / Minus

                                          
Query: 4   tatgcccctgtgctggactgccncacatccc 34
           |||||||| ||||||||||||| ||| ||||
Sbjct: 610 tatgccccagtgctggactgccacacctccc 580
to top
>gb|AY264207.1| Centrodoras cf. brachiatus elongation factor-1 alpha gene, exons 4
           through 8 and partial cds
          Length = 1087

 Score = 40.1 bits (20), Expect = 0.20
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 4   tatgcccctgtgctggactg 23
           ||||||||||||||||||||
Sbjct: 739 tatgcccctgtgctggactg 758
to top
>gb|AY264206.1| Lithodoras dorsalis elongation factor-1 alpha gene, exons 4 through
           8 and partial cds
          Length = 1110

 Score = 40.1 bits (20), Expect = 0.20
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 4   tatgcccctgtgctggactg 23
           ||||||||||||||||||||
Sbjct: 762 tatgcccctgtgctggactg 781
to top
>gb|AY580204.1| Encope michelini elongation factor 1 alpha mRNA, partial cds
          Length = 1233

 Score = 40.1 bits (20), Expect = 0.20
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                       
Query: 4    tatgcccctgtgctggactgccncaca 30
            |||||||||||||| ||||||| ||||
Sbjct: 1021 tatgcccctgtgcttgactgccacaca 1047
to top
>gb|AF479046.1| Triticum aestivum elongation factor-1 alpha mRNA, partial cds
          Length = 432

 Score = 40.1 bits (20), Expect = 0.20
 Identities = 28/31 (90%)
 Strand = Plus / Plus

                                          
Query: 4   tatgcccctgtgctggactgccncacatccc 34
           |||||||| ||||||||||||| ||| ||||
Sbjct: 121 tatgccccagtgctggactgccacacgtccc 151
to top
>dbj|AB193485.1| Takifugu rubripes EF-1a mRNA for elongation factor 1 alpha, complete
            cds
          Length = 1765

 Score = 40.1 bits (20), Expect = 0.20
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                       
Query: 4    tatgcccctgtgctggactgccncaca 30
            ||||||||||||||||| |||| ||||
Sbjct: 1128 tatgcccctgtgctggattgccacaca 1154
to top
>dbj|BS000087.1| Pan troglodytes chromosome 22 clone:RP43-110O22, map 22, complete
             sequences
          Length = 156630

 Score = 40.1 bits (20), Expect = 0.20
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                        
Query: 4     tatgcccctgtgctggactgccncaca 30
             ||||||||||||||||| |||| ||||
Sbjct: 34246 tatgcccctgtgctggattgccacaca 34272
to top
>gb|AF136829.1|AF136829 Zea mays clone g elongation factor 1 alpha mRNA, complete cds
          Length = 1592

 Score = 40.1 bits (20), Expect = 0.20
 Identities = 28/31 (90%)
 Strand = Plus / Plus

                                           
Query: 4    tatgcccctgtgctggactgccncacatccc 34
            |||||||| ||||||||||||| ||| ||||
Sbjct: 1133 tatgccccagtgctggactgccacacctccc 1163
to top
>gb|AF136828.1|AF136828 Zea mays clone f elongation factor 1 alpha mRNA, complete cds
          Length = 1596

 Score = 40.1 bits (20), Expect = 0.20
 Identities = 28/31 (90%)
 Strand = Plus / Plus

                                           
Query: 4    tatgcccctgtgctggactgccncacatccc 34
            |||| ||||||||||||||||| ||| ||||
Sbjct: 1102 tatggccctgtgctggactgccacacctccc 1132
to top
>gb|AF136826.1|AF136826 Zea mays clone d elongation factor 1 alpha mRNA, complete cds
          Length = 1546

 Score = 40.1 bits (20), Expect = 0.20
 Identities = 28/31 (90%)
 Strand = Plus / Plus

                                           
Query: 4    tatgcccctgtgctggactgccncacatccc 34
            |||||||| ||||||||||||| ||| ||||
Sbjct: 1064 tatgccccagtgctggactgccacacctccc 1094
to top
>gb|AF136824.1|AF136824 Zea mays clone b elongation factor 1 alpha mRNA, complete cds
          Length = 1604

 Score = 40.1 bits (20), Expect = 0.20
 Identities = 28/31 (90%)
 Strand = Plus / Plus

                                           
Query: 4    tatgcccctgtgctggactgccncacatccc 34
            |||||||| ||||||||||||| ||| ||||
Sbjct: 1093 tatgccccagtgctggactgccacacctccc 1123
to top
>gb|AY109326.1| Zea mays CL1256_1 mRNA sequence
          Length = 2360

 Score = 40.1 bits (20), Expect = 0.20
 Identities = 28/31 (90%)
 Strand = Plus / Plus

                                           
Query: 4    tatgcccctgtgctggactgccncacatccc 34
            |||||||| ||||||||||||| ||| ||||
Sbjct: 1721 tatgccccagtgctggactgccacacctccc 1751
to top
>dbj|AP001687.1| Homo sapiens genomic DNA, chromosome 21q, section 31/105
          Length = 340000

 Score = 40.1 bits (20), Expect = 0.20
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                         
Query: 4      tatgcccctgtgctggactgccncaca 30
              ||||||||||||||||| |||| ||||
Sbjct: 170731 tatgcccctgtgctggattgccacaca 170757
to top
>dbj|AP000459.4| Homo sapiens genomic DNA, chromosome 21q, clone:RP11-42M17, complete
             sequence
          Length = 171863

 Score = 40.1 bits (20), Expect = 0.20
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                        
Query: 4     tatgcccctgtgctggactgccncaca 30
             ||||||||||||||||| |||| ||||
Sbjct: 59650 tatgcccctgtgctggattgccacaca 59676
to top
>ref|NM_001037873.1| Takifugu rubripes elongation factor 1 alpha (ef-1a), mRNA
          Length = 1765

 Score = 40.1 bits (20), Expect = 0.20
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                       
Query: 4    tatgcccctgtgctggactgccncaca 30
            ||||||||||||||||| |||| ||||
Sbjct: 1128 tatgcccctgtgctggattgccacaca 1154
to top
>gb|DQ284495.1| Solanum tuberosum clone 063G03 elongation factor-1 alpha-like mRNA,
            complete cds
          Length = 1621

 Score = 40.1 bits (20), Expect = 0.20
 Identities = 28/31 (90%)
 Strand = Plus / Plus

                                           
Query: 4    tatgcccctgtgctggactgccncacatccc 34
            |||||||| ||||||||||||| ||| ||||
Sbjct: 1083 tatgccccagtgctggactgccacacctccc 1113
to top
>emb|AL133222.2|HS69P17 Homo sapiens chromosome 21 BAC RPCIP704P1769, complete sequence
          Length = 102619

 Score = 40.1 bits (20), Expect = 0.20
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                        
Query: 4     tatgcccctgtgctggactgccncaca 30
             ||||||||||||||||| |||| ||||
Sbjct: 14012 tatgcccctgtgctggattgccacaca 13986
to top
>gb|BT016242.1| Zea mays clone Contig75 mRNA sequence
          Length = 1421

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           |||||||| ||||||||||||| |||
Sbjct: 886 tatgccccagtgctggactgccacac 911
to top
>gb|AC097023.6| Rattus norvegicus BAC CH230-35L12 (Children's Hospital Oakland Research
             Institute) complete sequence
          Length = 228433

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Minus

                                       
Query: 4     tatgcccctgtgctggactgccncac 29
             ||||||||||| |||||||||| |||
Sbjct: 20177 tatgcccctgttctggactgccacac 20152
to top
>gb|BC072542.1| Rattus norvegicus eukaryotic translation elongation factor 1 alpha 1,
            mRNA (cDNA clone MGC:91600 IMAGE:7103726), complete cds
          Length = 1775

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                      
Query: 4    tatgcccctgtgctggactgccncac 29
            ||||||||||| |||||||||| |||
Sbjct: 1139 tatgcccctgttctggactgccacac 1164
to top
>gb|BC063162.1| Rattus norvegicus eukaryotic translation elongation factor 1 alpha 1,
            mRNA (cDNA clone MGC:72753 IMAGE:6918979), complete cds
          Length = 1771

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                      
Query: 4    tatgcccctgtgctggactgccncac 29
            ||||||||||| |||||||||| |||
Sbjct: 1140 tatgcccctgttctggactgccacac 1165
to top
>gb|AY264258.1| Dianema longibarbus elongation factor-1 alpha gene, exons 4 through
           8 and partial cds
          Length = 1194

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           |||||||| ||||||||||||| |||
Sbjct: 852 tatgccccagtgctggactgccacac 877
to top
>gb|AY264256.1| Synodontis sp. GM-2003 elongation factor-1 alpha gene, exons 4
           through 8 and partial cds
          Length = 1142

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 782 tatgcccctgtgctggattgccacac 807
to top
>gb|AY264247.1| Acanthodoras spinosissimus elongation factor-1 alpha gene, exons 4
           through 8 and partial cds
          Length = 1077

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||| |||||||||||||||| |||
Sbjct: 756 tatgctcctgtgctggactgccacac 781
to top
>gb|AY264246.1| Doras punctatus elongation factor-1 alpha gene, exons 4 through 8
           and partial cds
          Length = 1115

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 765 tatgcccctgtgctggattgccacac 790
to top
>gb|AY264245.1| Trachydoras cf. microstomus elongation factor-1 alpha gene, exons 4
           through 8 and partial cds
          Length = 1118

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 767 tatgcccctgtgctggattgccacac 792
to top
>gb|AY264244.1| Trachydoras nattereri haplotype II elongation factor-1 alpha gene,
           exons 4 through 8 and partial cds
          Length = 1110

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 762 tatgcccctgtgctggattgccacac 787
to top
>gb|AY264242.1| Trachydoras nattereri haplotype I elongation factor-1 alpha gene,
           exons 4 through 8 and partial cds
          Length = 1090

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 769 tatgcccctgtgctggattgccacac 794
to top
>gb|AY264241.1| Leptodoras cf. copei elongation factor-1 alpha gene, exons 4
           through 8 and partial cds
          Length = 1109

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 760 tatgcccctgtgctggattgccacac 785
to top
>gb|AY264240.1| Leptodoras linnelli elongation factor-1 alpha gene, exons 4 through
           8 and partial cds
          Length = 1111

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 763 tatgcccctgtgctggattgccacac 788
to top
>gb|AY264239.1| Leptodoras praelongus elongation factor-1 alpha gene, exons 4
           through 8 and partial cds
          Length = 1118

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 769 tatgcccctgtgctggattgccacac 794
to top
>gb|AY264238.1| Leptodoras cf. praelongus elongation factor-1 alpha gene, exons 4
           through 8 and partial cds
          Length = 1113

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 764 tatgcccctgtgctggattgccacac 789
to top
>gb|AY264237.1| Leptodoras sp. 1-GM-2003 elongation factor-1 alpha gene, exons 4
           through 8 and partial cds
          Length = 1110

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 761 tatgcccctgtgctggattgccacac 786
to top
>gb|AY264236.1| Leptodoras sp. 3-GM-2003 elongation factor-1 alpha gene, exons 4
           through 8 and partial cds
          Length = 1083

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 760 tatgcccctgtgctggattgccacac 785
to top
>gb|AY264235.1| Leptodoras sp. 3-GM-2003 elongation factor-1 alpha gene, exons 4
           through 8 and partial cds
          Length = 1111

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 762 tatgcccctgtgctggattgccacac 787
to top
>gb|AY264234.1| Leptodoras sp. 3-GM-2003 elongation factor-1 alpha gene, exons 4
           through 8 and partial cds
          Length = 1111

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 760 tatgcccctgtgctggattgccacac 785
to top
>gb|AY264233.1| Leptodoras acipenserinus elongation factor-1 alpha gene, exons 4
           through 8 and partial cds
          Length = 1113

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 764 tatgcccctgtgctggattgccacac 789
to top
>gb|AY264230.1| Leptodoras hasemani elongation factor-1 alpha gene, exons 4 through
           8 and partial cds
          Length = 1110

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 761 tatgcccctgtgctggattgccacac 786
to top
>gb|AY264229.1| Hemidoras morrisi elongation factor-1 alpha gene, exons 4 through 8
           and partial cds
          Length = 1157

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 810 tatgcccctgtgctggattgccacac 835
to top
>gb|AY264228.1| Opsodoras stuebelii elongation factor-1 alpha gene, exons 4 through
           8 and partial cds
          Length = 1112

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 765 tatgcccctgtgctggattgccacac 790
to top
>gb|AY264227.1| Hemidoras stenopeltis haplotype II elongation factor-1 alpha gene,
           exons 4 through 8 and partial cds
          Length = 1111

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 763 tatgcccctgtgctggattgccacac 788
to top
>gb|AY264226.1| Hemidoras stenopeltis haplotype I elongation factor-1 alpha gene,
           exons 4 through 8 and partial cds
          Length = 1086

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 762 tatgcccctgtgctggattgccacac 787
to top
>gb|AY264225.1| Hassar sp. GM-2003 elongation factor-1 alpha gene, exons 4 through
           8 and partial cds
          Length = 1112

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 763 tatgcccctgtgctggattgccacac 788
to top
>gb|AY264224.1| Hassar sp. GM-2003 elongation factor-1 alpha gene, exons 4 through
           8 and partial cds
          Length = 1112

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 763 tatgcccctgtgctggattgccacac 788
to top
>gb|AY264223.1| Opsodoras sp. GM-2003 elongation factor-1 alpha gene, exons 4
           through 8 and partial cds
          Length = 1113

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 764 tatgcccctgtgctggattgccacac 789
to top
>gb|AY264222.1| Opsodoras ternetzi haplotype I elongation factor-1 alpha gene,
           exons 4 through 8 and partial cds
          Length = 1107

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 759 tatgcccctgtgctggattgccacac 784
to top
>gb|AY264221.1| Nemadoras hemipeltis elongation factor-1 alpha gene, exons 4
           through 8 and partial cds
          Length = 1114

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 765 tatgcccctgtgctggattgccacac 790
to top
>gb|AY264220.1| Nemadoras trimaculatus elongation factor-1 alpha gene, exons 4
           through 8 and partial cds
          Length = 1109

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 762 tatgcccctgtgctggattgccacac 787
to top
>gb|AY264219.1| Doras micropoeus elongation factor-1 alpha gene, exons 4 through 8
           and partial cds
          Length = 1112

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 761 tatgcccctgtgctggattgccacac 786
to top
>gb|AY264218.1| Doras carinatus elongation factor-1 alpha gene, exons 4 through 8
           and partial cds
          Length = 1083

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 759 tatgcccctgtgctggattgccacac 784
to top
>gb|AY264216.1| Pterodoras granulosus elongation factor-1 alpha gene, exons 4
           through 8 and partial cds
          Length = 1106

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 765 tatgcccctgtgctggattgccacac 790
to top
>gb|AY264214.1| Oxydoras niger haplotype II elongation factor-1 alpha gene, exons 4
           through 8 and partial cds
          Length = 1116

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 767 tatgcccctgtgctggattgccacac 792
to top
>gb|AY264213.1| Oxydoras niger haplotype I elongation factor-1 alpha gene, exons 4
           through 8 and partial cds
          Length = 1086

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 764 tatgcccctgtgctggattgccacac 789
to top
>gb|AY264203.1| Physopyxis lyra elongation factor-1 alpha gene, exons 4 through 8
           and partial cds
          Length = 1105

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||| |||||||||||||||| |||
Sbjct: 752 tatgctcctgtgctggactgccacac 777
to top
>gb|AY264202.1| Hypodoras forficulatus elongation factor-1 alpha gene, exons 4
           through 8 and partial cds
          Length = 1124

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||| |||||||||||||||| |||
Sbjct: 767 tatgctcctgtgctggactgccacac 792
to top
>gb|AY264198.1| Zungaro zungaro elongation factor-1 alpha gene, exons 4 through 8
           and partial cds
          Length = 1060

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||| |||||||||||||||| |||
Sbjct: 712 tatgctcctgtgctggactgccacac 737
to top
>gb|AY264197.1| Sorubim lima elongation factor-1 alpha gene, exons 4 through 8 and
           partial cds
          Length = 1168

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||| |||||||||||||||| |||
Sbjct: 820 tatgctcctgtgctggactgccacac 845
to top
>gb|DQ447161.1| Passiflora edulis translation elongation factor 1a-2 (EF1a2) mRNA,
           partial cds
          Length = 358

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 30/34 (88%)
 Strand = Plus / Plus

                                             
Query: 1   ggttatgcccctgtgctggactgccncacatccc 34
           ||||||||||| || || ||||||| ||||||||
Sbjct: 125 ggttatgccccagtcctcgactgccacacatccc 158
to top
>gb|DQ087497.1| Trochospongilla pennsylvanica elongation factor 1 alpha mRNA, partial
            cds
          Length = 1233

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                  
Query: 8    cccctgtgctggactgccncac 29
            |||||||||||||||||| |||
Sbjct: 1025 cccctgtgctggactgccacac 1046
to top
>emb|AJ866727.1| Dicentrarchus labrax partial mRNA for elongation factor 1-alpha
           (ef1-alpha gene)
          Length = 955

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 27/30 (90%)
 Strand = Plus / Plus

                                         
Query: 1   ggttatgcccctgtgctggactgccncaca 30
           ||||| |||||||||||||| |||| ||||
Sbjct: 851 ggttacgcccctgtgctggattgccacaca 880
to top
>ref|NM_175838.1| Rattus norvegicus eukaryotic translation elongation factor 1 alpha 1
            (Eef1a1), mRNA
          Length = 1737

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                      
Query: 4    tatgcccctgtgctggactgccncac 29
            ||||||||||| |||||||||| |||
Sbjct: 1144 tatgcccctgttctggactgccacac 1169
to top
>gb|DQ083088.1| Prochilodus magdalenae elongation factor-1 alpha (EF1) gene, EF1-3
           allele, exons 6, 7 and partial cds
          Length = 333

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 199 tatgcccctgtgctggattgccacac 224
to top
>gb|DQ083087.1| Prochilodus magdalenae elongation factor-1 alpha (EF1) gene, EF1-2
           allele, exons 6, 7 and partial cds
          Length = 328

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 194 tatgcccctgtgctggattgccacac 219
to top
>gb|DQ083086.1| Prochilodus magdalenae elongation factor-1 alpha (EF1) gene, EF1-1
           allele, exons 6, 7 and partial cds
          Length = 330

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 196 tatgcccctgtgctggattgccacac 221
to top
>gb|DQ083085.1| Prochilodus rubrotaeniatus elongation factor-1 alpha (EF1) gene,
           EF1-31 allele, exons 6, 7 and partial cds
          Length = 328

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 194 tatgcccctgtgctggattgccacac 219
to top
>gb|DQ083084.1| Prochilodus rubrotaeniatus elongation factor-1 alpha (EF1) gene,
           EF1-30 allele, exons 6, 7 and partial cds
          Length = 328

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 194 tatgcccctgtgctggattgccacac 219
to top
>gb|DQ083083.1| Prochilodus rubrotaeniatus elongation factor-1 alpha (EF1) gene,
           EF1-29 allele, exons 6, 7 and partial cds
          Length = 328

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 194 tatgcccctgtgctggattgccacac 219
to top
>gb|DQ083082.1| Prochilodus rubrotaeniatus elongation factor-1 alpha (EF1) gene,
           EF1-28 allele, exons 6, 7 and partial cds
          Length = 330

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 196 tatgcccctgtgctggattgccacac 221
to top
>gb|DQ083081.1| Prochilodus rubrotaeniatus elongation factor-1 alpha (EF1) gene,
           EF1-27 allele, exons 6, 7 and partial cds
          Length = 328

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 194 tatgcccctgtgctggattgccacac 219
to top
>gb|DQ083079.1| Prochilodus mariae elongation factor-1 alpha (EF1) gene, EF1-25
           allele, exons 6, 7 and partial cds
          Length = 328

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 194 tatgcccctgtgctggattgccacac 219
to top
>gb|DQ083078.1| Prochilodus mariae elongation factor-1 alpha (EF1) gene, EF1-24
           allele, exons 6, 7 and partial cds
          Length = 328

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 194 tatgcccctgtgctggattgccacac 219
to top
>gb|DQ083077.1| Prochilodus mariae elongation factor-1 alpha (EF1) gene, EF1-23
           allele, exons 6, 7 and partial cds
          Length = 328

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 194 tatgcccctgtgctggattgccacac 219
to top
>gb|DQ083076.1| Prochilodus mariae elongation factor-1 alpha (EF1) gene, EF1-22
           allele, exons 6, 7 and partial cds
          Length = 330

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 196 tatgcccctgtgctggattgccacac 221
to top
>gb|DQ083075.1| Prochilodus mariae elongation factor-1 alpha (EF1) gene, EF1-21
           allele, exons 6, 7 and partial cds
          Length = 330

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 196 tatgcccctgtgctggattgccacac 221
to top
>gb|DQ083074.1| Prochilodus mariae elongation factor-1 alpha (EF1) gene, EF1-20
           allele, exons 6, 7 and partial cds
          Length = 330

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 196 tatgcccctgtgctggattgccacac 221
to top
>gb|DQ083073.1| Prochilodus mariae elongation factor-1 alpha (EF1) gene, EF1-19
           allele, exons 6, 7 and partial cds
          Length = 328

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 194 tatgcccctgtgctggattgccacac 219
to top
>gb|DQ083072.1| Prochilodus mariae elongation factor-1 alpha (EF1) gene, EF1-18
           allele, exons 6, 7 and partial cds
          Length = 330

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 196 tatgcccctgtgctggattgccacac 221
to top
>gb|DQ083070.1| Prochilodus mariae elongation factor-1 alpha (EF1) gene, EF1-16
           allele, exons 6, 7 and partial cds
          Length = 330

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 196 tatgcccctgtgctggattgccacac 221
to top
>gb|DQ083069.1| Prochilodus mariae elongation factor-1 alpha (EF1) gene, EF1-15
           allele, exons 6, 7 and partial cds
          Length = 330

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 196 tatgcccctgtgctggattgccacac 221
to top
>gb|DQ083068.1| Prochilodus mariae elongation factor-1 alpha (EF1) gene, EF1-14
           allele, exons 6, 7 and partial cds
          Length = 330

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 196 tatgcccctgtgctggattgccacac 221
to top
>gb|DQ083067.1| Prochilodus mariae elongation factor-1 alpha (EF1) gene, EF1-13
           allele, exons 6, 7 and partial cds
          Length = 330

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 196 tatgcccctgtgctggattgccacac 221
to top
>gb|DQ083066.1| Prochilodus mariae elongation factor-1 alpha (EF1) gene, EF1-12
           allele, exons 6, 7 and partial cds
          Length = 330

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 196 tatgcccctgtgctggattgccacac 221
to top
>gb|DQ083065.1| Prochilodus mariae elongation factor-1 alpha (EF1) gene, EF1-11
           allele, exons 6, 7 and partial cds
          Length = 330

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 196 tatgcccctgtgctggattgccacac 221
to top
>gb|DQ083064.1| Prochilodus mariae elongation factor-1 alpha (EF1) gene, EF1-10
           allele, exons 6, 7 and partial cds
          Length = 330

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 196 tatgcccctgtgctggattgccacac 221
to top
>gb|DQ083063.1| Prochilodus mariae elongation factor-1 alpha (EF1) gene, EF1-9
           allele, exons 6, 7 and partial cds
          Length = 330

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 196 tatgcccctgtgctggattgccacac 221
to top
>gb|DQ083062.1| Prochilodus mariae elongation factor-1 alpha (EF1) gene, EF1-8
           allele, exons 6, 7 and partial cds
          Length = 328

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 194 tatgcccctgtgctggattgccacac 219
to top
>gb|DQ083061.1| Prochilodus mariae elongation factor-1 alpha (EF1) gene, EF1-7
           allele, exons 6, 7 and partial cds
          Length = 328

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 194 tatgcccctgtgctggattgccacac 219
to top
>gb|DQ083060.1| Prochilodus mariae elongation factor-1 alpha (EF1) gene, EF1-6
           allele, exons 6, 7 and partial cds
          Length = 330

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 196 tatgcccctgtgctggattgccacac 221
to top
>gb|DQ083059.1| Prochilodus mariae elongation factor-1 alpha (EF1) gene, EF1-5
           allele, exons 6, 7 and partial cds
          Length = 333

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 199 tatgcccctgtgctggattgccacac 224
to top
>gb|DQ083058.1| Prochilodus mariae elongation factor-1 alpha (EF1) gene, EF1-4
           allele, exons 6, 7 and partial cds
          Length = 330

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 196 tatgcccctgtgctggattgccacac 221
to top
>gb|DQ083057.1| Prochilodus mariae elongation factor-1 alpha (EF1) gene, EF1-3
           allele, exons 6, 7 and partial cds
          Length = 328

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 194 tatgcccctgtgctggattgccacac 219
to top
>gb|DQ083056.1| Prochilodus mariae elongation factor-1 alpha (EF1) gene, EF1-2
           allele, exons 6, 7 and partial cds
          Length = 330

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 196 tatgcccctgtgctggattgccacac 221
to top
>gb|DQ083055.1| Prochilodus mariae elongation factor-1 alpha (EF1) gene, EF1-1
           allele, exons 6, 7 and partial cds
          Length = 328

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 4   tatgcccctgtgctggactgccncac 29
           ||||||||||||||||| |||| |||
Sbjct: 194 tatgcccctgtgctggattgccacac 219
to top
>gb|AF485331.1| Cyprinus carpio elongation factor 1-alpha mRNA, complete cds
          Length = 1757

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                      
Query: 4    tatgcccctgtgctggactgccncac 29
            |||||||| ||||||||||||| |||
Sbjct: 1126 tatgccccagtgctggactgccacac 1151
to top
>gb|AC092725.3| Homo sapiens chromosome 16 clone RP11-673P17, complete sequence
          Length = 205399

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Minus

                                        
Query: 4      tatgcccctgtgctggactgccncac 29
              ||||||||||| |||||||||| |||
Sbjct: 125383 tatgcccctgtactggactgccacac 125358
to top
>gb|U08844.1|PPU08844 Porphyra purpurea elongation factor EF1-alpha (tef-c) mRNA, complete
            cds
          Length = 1617

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                      
Query: 4    tatgcccctgtgctggactgccncac 29
            |||||||| ||||||||||||| |||
Sbjct: 1153 tatgccccggtgctggactgccacac 1178
to top
>ref|XM_215885.3| PREDICTED: Rattus norvegicus similar to zinc finger protein 341
            (LOC296300), mRNA
          Length = 3273

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Minus

                                      
Query: 4    tatgcccctgtgctggactgccncac 29
            ||||||||||| |||||||||| |||
Sbjct: 1299 tatgcccctgttctggactgccacac 1274
to top
>gb|BC091297.1| Rattus norvegicus eukaryotic translation elongation factor 1 alpha 1,
            mRNA (cDNA clone MGC:109226 IMAGE:7309009), complete cds
          Length = 1746

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                      
Query: 4    tatgcccctgtgctggactgccncac 29
            ||||||||||| |||||||||| |||
Sbjct: 1125 tatgcccctgttctggactgccacac 1150
to top
>gb|BC111707.1| Rattus norvegicus eukaryotic translation elongation factor 1 alpha 1,
            mRNA (cDNA clone MGC:125172 IMAGE:7367097), complete cds
          Length = 1734

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                      
Query: 4    tatgcccctgtgctggactgccncac 29
            ||||||||||| |||||||||| |||
Sbjct: 1108 tatgcccctgttctggactgccacac 1133
to top
>emb|X61043.1|RNEF1AA R.norvegicus mRNA for elongation factor 1 alpha
          Length = 1737

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                      
Query: 4    tatgcccctgtgctggactgccncac 29
            ||||||||||| |||||||||| |||
Sbjct: 1144 tatgcccctgttctggactgccacac 1169
to top
>emb|X63561.1|RNELF1A R.norvegicus mRNA for elongation factor 1-alpha
          Length = 1714

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                      
Query: 4    tatgcccctgtgctggactgccncac 29
            ||||||||||| |||||||||| |||
Sbjct: 1117 tatgcccctgttctggactgccacac 1142
to top
>gb|AF041463.1|AF041463 Manihot esculenta elongation factor 1-alpha (MeEF1) gene, complete
            cds
          Length = 4866

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 30/34 (88%)
 Strand = Plus / Plus

                                              
Query: 1    ggttatgcccctgtgctggactgccncacatccc 34
            ||||||||||| |||||||| |||| ||| ||||
Sbjct: 4113 ggttatgccccagtgctggattgccacacctccc 4146
to top
>ref|NM_033539.1| Rattus norvegicus eukaryotic translation elongation factor 1 alpha 2
            like 1 (Eef1a2l1), mRNA
          Length = 1404

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                      
Query: 4    tatgcccctgtgctggactgccncac 29
            ||||||||||| |||||||||| |||
Sbjct: 1079 tatgcccctgttctggactgccacac 1104
to top
>dbj|AB075952.1| Oreochromis niloticus EF-1a mRNA for elongation factor 1a, complete
            cds
          Length = 1743

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                      
Query: 4    tatgcccctgtgctggactgccncac 29
            ||||||||||||||||| |||| |||
Sbjct: 1103 tatgcccctgtgctggattgccacac 1128
to top
>gb|L10339.1|RATEF1AX Rat elongation factor-1 alpha (ef-1) mRNA, complete cds
          Length = 1404

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                      
Query: 4    tatgcccctgtgctggactgccncac 29
            ||||||||||| |||||||||| |||
Sbjct: 1079 tatgcccctgttctggactgccacac 1104
to top
>dbj|AB003709.1| Owenia fusiformis mRNA for elongation factor-1alpha, partial cds
          Length = 1122

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 27/30 (90%)
 Strand = Plus / Plus

                                         
Query: 1   ggttatgcccctgtgctggactgccncaca 30
           ||||||||||||||| |||| |||| ||||
Sbjct: 928 ggttatgcccctgtgttggattgccacaca 957
to top
>gb|AY550990.1| Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete
            cds
          Length = 1623

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                         
Query: 1    ggttatgcccctgtgctggactgccncac 29
            ||||||||||||||||| || |||| |||
Sbjct: 1103 ggttatgcccctgtgcttgattgccacac 1131
to top
>gb|DQ471105.1| Tubeufia cerea isolate AFTOL-ID 1316 translation elongation
           factor-1 alpha (EF1a) gene, partial sequence
          Length = 956

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                        
Query: 1   ggttatgcccctgtgctggactgccncac 29
           ||||| ||||||||||| ||||||| |||
Sbjct: 730 ggttacgcccctgtgcttgactgccacac 758
to top
>gb|AY264255.1| Centromochlus heckelii elongation factor-1 alpha gene, exons 4
           through 8 and partial cds
          Length = 1072

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                 
Query: 4   tatgcccctgtgctggactgcc 25
           ||||||||||||||||| ||||
Sbjct: 697 tatgcccctgtgctggattgcc 718
to top
>gb|AY264243.1| Trachydoras steindachneri elongation factor-1 alpha gene, exons 4
           through 8 and partial cds
          Length = 1120

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                 
Query: 4   tatgcccctgtgctggactgcc 25
           ||||||||||||||||| ||||
Sbjct: 768 tatgcccctgtgctggattgcc 789
to top
>emb|CR735017.2|CNS0GTX4 Tetraodon nigroviridis full-length cDNA
          Length = 1557

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                         
Query: 1    ggttatgcccctgtgctggactgccncac 29
            |||||| | |||||||||||||||| |||
Sbjct: 1138 ggttatactcctgtgctggactgccacac 1166
to top
>emb|CR734904.2|CNS0GTTZ Tetraodon nigroviridis full-length cDNA
          Length = 1675

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                         
Query: 1    ggttatgcccctgtgctggactgccncac 29
            ||||| ||||| ||||||||||||| |||
Sbjct: 1124 ggttacgccccggtgctggactgccacac 1152
to top
>emb|CR733931.2|CNS0GT2Y Tetraodon nigroviridis full-length cDNA
          Length = 1680

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                         
Query: 1    ggttatgcccctgtgctggactgccncac 29
            ||||| ||||| ||||||||||||| |||
Sbjct: 1131 ggttacgccccggtgctggactgccacac 1159
to top
>emb|CR733917.2|CNS0GT2K Tetraodon nigroviridis full-length cDNA
          Length = 1678

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                         
Query: 1    ggttatgcccctgtgctggactgccncac 29
            ||||| ||||| ||||||||||||| |||
Sbjct: 1129 ggttacgccccggtgctggactgccacac 1157
to top
>emb|CR733688.2|CNS0GSW7 Tetraodon nigroviridis full-length cDNA
          Length = 1677

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                         
Query: 1    ggttatgcccctgtgctggactgccncac 29
            ||||| ||||| ||||||||||||| |||
Sbjct: 1129 ggttacgccccggtgctggactgccacac 1157
to top
>emb|CR732349.2|CNS0GS0Y Tetraodon nigroviridis full-length cDNA
          Length = 1657

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                         
Query: 1    ggttatgcccctgtgctggactgccncac 29
            ||||| ||||| ||||||||||||| |||
Sbjct: 1113 ggttacgccccggtgctggactgccacac 1141
to top
>emb|CR732122.2|CNS0GRUN Tetraodon nigroviridis full-length cDNA
          Length = 1411

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                        
Query: 1   ggttatgcccctgtgctggactgccncac 29
           ||||| ||||| ||||||||||||| |||
Sbjct: 862 ggttacgccccggtgctggactgccacac 890
to top
>emb|CR731738.2|CNS0GRJZ Tetraodon nigroviridis full-length cDNA
          Length = 1028

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                        
Query: 1   ggttatgcccctgtgctggactgccncac 29
           ||||| ||||| ||||||||||||| |||
Sbjct: 492 ggttacgccccggtgctggactgccacac 520
to top
>emb|CR730131.2|CNS0GQBD Tetraodon nigroviridis full-length cDNA
          Length = 1678

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                         
Query: 1    ggttatgcccctgtgctggactgccncac 29
            ||||| ||||| ||||||||||||| |||
Sbjct: 1127 ggttacgccccggtgctggactgccacac 1155
to top
>emb|CR728708.2|CNS0GP7U Tetraodon nigroviridis full-length cDNA
          Length = 1409

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                        
Query: 1   ggttatgcccctgtgctggactgccncac 29
           ||||| ||||| ||||||||||||| |||
Sbjct: 861 ggttacgccccggtgctggactgccacac 889
to top
>emb|CR728391.2|CNS0GOZ1 Tetraodon nigroviridis full-length cDNA
          Length = 1401

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                        
Query: 1   ggttatgcccctgtgctggactgccncac 29
           ||||| ||||| ||||||||||||| |||
Sbjct: 851 ggttacgccccggtgctggactgccacac 879
to top
>emb|CR728365.2|CNS0GOYB Tetraodon nigroviridis full-length cDNA
          Length = 1674

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                         
Query: 1    ggttatgcccctgtgctggactgccncac 29
            ||||| ||||| ||||||||||||| |||
Sbjct: 1126 ggttacgccccggtgctggactgccacac 1154
to top
>emb|CR728539.1|CNS0GP35 Tetraodon nigroviridis full-length cDNA
          Length = 1395

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                        
Query: 1   ggttatgcccctgtgctggactgccncac 29
           ||||| ||||| ||||||||||||| |||
Sbjct: 851 ggttacgccccggtgctggactgccacac 879
to top
>emb|CR728050.2|CNS0GOPK Tetraodon nigroviridis full-length cDNA
          Length = 1400

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                        
Query: 1   ggttatgcccctgtgctggactgccncac 29
           ||||| ||||| ||||||||||||| |||
Sbjct: 854 ggttacgccccggtgctggactgccacac 882
to top
>emb|CR727656.2|CNS0GOEM Tetraodon nigroviridis full-length cDNA
          Length = 1675

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                         
Query: 1    ggttatgcccctgtgctggactgccncac 29
            ||||| ||||| ||||||||||||| |||
Sbjct: 1127 ggttacgccccggtgctggactgccacac 1155
to top
>emb|CR727218.2|CNS0GO2G Tetraodon nigroviridis full-length cDNA
          Length = 1667

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                         
Query: 1    ggttatgcccctgtgctggactgccncac 29
            ||||| ||||| ||||||||||||| |||
Sbjct: 1129 ggttacgccccggtgctggactgccacac 1157
to top
>emb|CR727203.2|CNS0GO21 Tetraodon nigroviridis full-length cDNA
          Length = 1042

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                        
Query: 1   ggttatgcccctgtgctggactgccncac 29
           ||||| ||||| ||||||||||||| |||
Sbjct: 501 ggttacgccccggtgctggactgccacac 529
to top
>emb|CR726822.2|CNS0GNRG Tetraodon nigroviridis full-length cDNA
          Length = 1067

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                        
Query: 1   ggttatgcccctgtgctggactgccncac 29
           ||||| ||||| ||||||||||||| |||
Sbjct: 519 ggttacgccccggtgctggactgccacac 547
to top
>emb|CR726256.2|CNS0GNBQ Tetraodon nigroviridis full-length cDNA
          Length = 1657

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                         
Query: 1    ggttatgcccctgtgctggactgccncac 29
            ||||| ||||| ||||||||||||| |||
Sbjct: 1138 ggttacgccccggtgctggactgccacac 1166
to top
>emb|CR725822.2|CNS0GMZO Tetraodon nigroviridis full-length cDNA
          Length = 1675

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                         
Query: 1    ggttatgcccctgtgctggactgccncac 29
            ||||| ||||| ||||||||||||| |||
Sbjct: 1128 ggttacgccccggtgctggactgccacac 1156
to top
>emb|CR725347.2|CNS0GMMH Tetraodon nigroviridis full-length cDNA
          Length = 1410

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                        
Query: 1   ggttatgcccctgtgctggactgccncac 29
           ||||| ||||| ||||||||||||| |||
Sbjct: 862 ggttacgccccggtgctggactgccacac 890
to top
>emb|CR725433.2|CNS0GMOV Tetraodon nigroviridis full-length cDNA
          Length = 1677

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                         
Query: 1    ggttatgcccctgtgctggactgccncac 29
            ||||| ||||| ||||||||||||| |||
Sbjct: 1128 ggttacgccccggtgctggactgccacac 1156
to top
>emb|CR724974.2|CNS0GMC4 Tetraodon nigroviridis full-length cDNA
          Length = 1416

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                        
Query: 1   ggttatgcccctgtgctggactgccncac 29
           ||||| ||||| ||||||||||||| |||
Sbjct: 863 ggttacgccccggtgctggactgccacac 891
to top
>emb|CR724186.2|CNS0GLQ8 Tetraodon nigroviridis full-length cDNA
          Length = 1073

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                        
Query: 1   ggttatgcccctgtgctggactgccncac 29
           ||||| ||||| ||||||||||||| |||
Sbjct: 524 ggttacgccccggtgctggactgccacac 552
to top
>emb|CR723732.2|CNS0GLDM Tetraodon nigroviridis full-length cDNA
          Length = 1365

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                        
Query: 1   ggttatgcccctgtgctggactgccncac 29
           ||||| ||||| ||||||||||||| |||
Sbjct: 842 ggttacgccccggtgctggactgccacac 870
to top
>emb|CR723455.2|CNS0GL5X Tetraodon nigroviridis full-length cDNA
          Length = 1068

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                        
Query: 1   ggttatgcccctgtgctggactgccncac 29
           ||||| ||||| ||||||||||||| |||
Sbjct: 520 ggttacgccccggtgctggactgccacac 548
to top
>emb|CR723407.2|CNS0GL4L Tetraodon nigroviridis full-length cDNA
          Length = 1409

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                        
Query: 1   ggttatgcccctgtgctggactgccncac 29
           ||||| ||||| ||||||||||||| |||
Sbjct: 860 ggttacgccccggtgctggactgccacac 888
to top
>emb|CR703641.2|CNS0G5VP Tetraodon nigroviridis full-length cDNA
          Length = 844

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                        
Query: 1   ggttatgcccctgtgctggactgccncac 29
           ||||| ||||| ||||||||||||| |||
Sbjct: 295 ggttacgccccggtgctggactgccacac 323
to top
>emb|CR697394.2|CNS0G126 Tetraodon nigroviridis full-length cDNA
          Length = 1644

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                         
Query: 1    ggttatgcccctgtgctggactgccncac 29
            ||||| ||||| ||||||||||||| |||
Sbjct: 1122 ggttacgccccggtgctggactgccacac 1150
to top
>emb|CR693228.2|CNS0FXUG Tetraodon nigroviridis full-length cDNA
          Length = 1669

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                         
Query: 1    ggttatgcccctgtgctggactgccncac 29
            ||||| ||||| ||||||||||||| |||
Sbjct: 1120 ggttacgccccggtgctggactgccacac 1148
to top
>emb|CR692485.2|CNS0FX9T Tetraodon nigroviridis full-length cDNA
          Length = 1674

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                         
Query: 1    ggttatgcccctgtgctggactgccncac 29
            ||||| ||||| ||||||||||||| |||
Sbjct: 1128 ggttacgccccggtgctggactgccacac 1156
to top
>emb|CR690840.2|CNS0FW04 Tetraodon nigroviridis full-length cDNA
          Length = 1658

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                         
Query: 1    ggttatgcccctgtgctggactgccncac 29
            ||||| ||||| ||||||||||||| |||
Sbjct: 1118 ggttacgccccggtgctggactgccacac 1146
to top
>emb|CR687295.1|CNS0FT9N Tetraodon nigroviridis full-length cDNA
          Length = 1653

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                         
Query: 1    ggttatgcccctgtgctggactgccncac 29
            ||||| ||||| ||||||||||||| |||
Sbjct: 1120 ggttacgccccggtgctggactgccacac 1148
to top
>emb|CR681034.2|CNS0FOFQ Tetraodon nigroviridis full-length cDNA
          Length = 1669

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                         
Query: 1    ggttatgcccctgtgctggactgccncac 29
            ||||| ||||| ||||||||||||| |||
Sbjct: 1125 ggttacgccccggtgctggactgccacac 1153
to top
>emb|CR679277.2|CNS0FN2X Tetraodon nigroviridis full-length cDNA
          Length = 1680

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                         
Query: 1    ggttatgcccctgtgctggactgccncac 29
            ||||| ||||| ||||||||||||| |||
Sbjct: 1124 ggttacgccccggtgctggactgccacac 1152
to top
>emb|CR677608.2|CNS0FLSY Tetraodon nigroviridis full-length cDNA
          Length = 1367

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                        
Query: 1   ggttatgcccctgtgctggactgccncac 29
           ||||| ||||| ||||||||||||| |||
Sbjct: 820 ggttacgccccggtgctggactgccacac 848
to top
>emb|CR677761.2|CNS0FLX5 Tetraodon nigroviridis full-length cDNA
          Length = 1673

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                         
Query: 1    ggttatgcccctgtgctggactgccncac 29
            ||||| ||||| ||||||||||||| |||
Sbjct: 1127 ggttacgccccggtgctggactgccacac 1155
to top
>emb|CR678478.1|CNS0FMGR Tetraodon nigroviridis full-length cDNA
          Length = 1651

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                         
Query: 1    ggttatgcccctgtgctggactgccncac 29
            ||||| ||||| ||||||||||||| |||
Sbjct: 1119 ggttacgccccggtgctggactgccacac 1147
to top
>emb|CR678326.1|CNS0FMCO Tetraodon nigroviridis full-length cDNA
          Length = 1545

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                         
Query: 1    ggttatgcccctgtgctggactgccncac 29
            ||||| ||||| ||||||||||||| |||
Sbjct: 1066 ggttacgccccggtgctggactgccacac 1094
to top
>emb|CR677885.2|CNS0FM0L Tetraodon nigroviridis full-length cDNA
          Length = 1644

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                         
Query: 1    ggttatgcccctgtgctggactgccncac 29
            ||||| ||||| ||||||||||||| |||
Sbjct: 1113 ggttacgccccggtgctggactgccacac 1141
to top
>emb|CR677409.2|CNS0FLNH Tetraodon nigroviridis full-length cDNA
          Length = 664

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                        
Query: 1   ggttatgcccctgtgctggactgccncac 29
           ||||| ||||| ||||||||||||| |||
Sbjct: 115 ggttacgccccggtgctggactgccacac 143
to top
>emb|CR675905.2|CNS0FKHZ Tetraodon nigroviridis full-length cDNA
          Length = 1669

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                         
Query: 1    ggttatgcccctgtgctggactgccncac 29
            ||||| ||||| ||||||||||||| |||
Sbjct: 1120 ggttacgccccggtgctggactgccacac 1148
to top
>emb|CR675801.2|CNS0FKF3 Tetraodon nigroviridis full-length cDNA
          Length = 1674

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                         
Query: 1    ggttatgcccctgtgctggactgccncac 29
            ||||| ||||| ||||||||||||| |||
Sbjct: 1128 ggttacgccccggtgctggactgccacac 1156
to top
>emb|CR675388.2|CNS0FK3M Tetraodon nigroviridis full-length cDNA
          Length = 1676

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                         
Query: 1    ggttatgcccctgtgctggactgccncac 29
            ||||| ||||| ||||||||||||| |||
Sbjct: 1128 ggttacgccccggtgctggactgccacac 1156
to top
>emb|CR675123.2|CNS0FJW9 Tetraodon nigroviridis full-length cDNA
          Length = 1671

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                         
Query: 1    ggttatgcccctgtgctggactgccncac 29
            ||||| ||||| ||||||||||||| |||
Sbjct: 1124 ggttacgccccggtgctggactgccacac 1152
to top
>emb|CR674541.2|CNS0FJG3 Tetraodon nigroviridis full-length cDNA
          Length = 802

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                        
Query: 1   ggttatgcccctgtgctggactgccncac 29
           ||||| ||||| ||||||||||||| |||
Sbjct: 295 ggttacgccccggtgctggactgccacac 323
to top
>emb|CR674177.1|CNS0FJ5Z Tetraodon nigroviridis full-length cDNA
          Length = 1674

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                         
Query: 1    ggttatgcccctgtgctggactgccncac 29
            ||||| ||||| ||||||||||||| |||
Sbjct: 1128 ggttacgccccggtgctggactgccacac 1156
to top
>emb|CR673868.2|CNS0FIXE Tetraodon nigroviridis full-length cDNA
          Length = 1411

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                        
Query: 1   ggttatgcccctgtgctggactgccncac 29
           ||||| ||||| ||||||||||||| |||
Sbjct: 882 ggttacgccccggtgctggactgccacac 910
to top
>emb|CR673551.1|CNS0FIOL Tetraodon nigroviridis full-length cDNA
          Length = 1668

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                         
Query: 1    ggttatgcccctgtgctggactgccncac 29
            ||||| ||||| ||||||||||||| |||
Sbjct: 1124 ggttacgccccggtgctggactgccacac 1152
to top
>emb|CR673454.2|CNS0FILW Tetraodon nigroviridis full-length cDNA
          Length = 1378

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                        
Query: 1   ggttatgcccctgtgctggactgccncac 29
           ||||| ||||| ||||||||||||| |||
Sbjct: 848 ggttacgccccggtgctggactgccacac 876
to top
>emb|CR672817.2|CNS0FI47 Tetraodon nigroviridis full-length cDNA
          Length = 1674

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                         
Query: 1    ggttatgcccctgtgctggactgccncac 29
            ||||| ||||| ||||||||||||| |||
Sbjct: 1129 ggttacgccccggtgctggactgccacac 1157
to top
>emb|CR672522.2|CNS0FHW0 Tetraodon nigroviridis full-length cDNA
          Length = 1453

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                         
Query: 1    ggttatgcccctgtgctggactgccncac 29
            ||||| ||||| ||||||||||||| |||
Sbjct: 1123 ggttacgccccggtgctggactgccacac 1151
to top
>emb|CR672427.2|CNS0FHTD Tetraodon nigroviridis full-length cDNA
          Length = 907

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                        
Query: 1   ggttatgcccctgtgctggactgccncac 29
           ||||| ||||| ||||||||||||| |||
Sbjct: 359 ggttacgccccggtgctggactgccacac 387
to top
>emb|CR671794.2|CNS0FHBS Tetraodon nigroviridis full-length cDNA
          Length = 1622

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                         
Query: 1    ggttatgcccctgtgctggactgccncac 29
            ||||| ||||| ||||||||||||| |||
Sbjct: 1085 ggttacgccccggtgctggactgccacac 1113
to top
>emb|CR669604.2|CNS0FFMY Tetraodon nigroviridis full-length cDNA
          Length = 1665

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                         
Query: 1    ggttatgcccctgtgctggactgccncac 29
            ||||| ||||| ||||||||||||| |||
Sbjct: 1121 ggttacgccccggtgctggactgccacac 1149
to top
>emb|CR668349.2|CNS0FEO3 Tetraodon nigroviridis full-length cDNA
          Length = 1703

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                         
Query: 1    ggttatgcccctgtgctggactgccncac 29
            ||||| ||||| ||||||||||||| |||
Sbjct: 1140 ggttacgccccggtgctggactgccacac 1168
to top
>emb|CR667314.2|CNS0FDVC Tetraodon nigroviridis full-length cDNA
          Length = 1630

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                         
Query: 1    ggttatgcccctgtgctggactgccncac 29
            ||||| ||||| ||||||||||||| |||
Sbjct: 1081 ggttacgccccggtgctggactgccacac 1109
to top
>emb|CR666706.2|CNS0FDEG Tetraodon nigroviridis full-length cDNA
          Length = 1422

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                        
Query: 1   ggttatgcccctgtgctggactgccncac 29
           ||||| ||||| ||||||||||||| |||
Sbjct: 891 ggttacgccccggtgctggactgccacac 919
to top
>emb|CR666536.2|CNS0FD9Q Tetraodon nigroviridis full-length cDNA
          Length = 1675

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                         
Query: 1    ggttatgcccctgtgctggactgccncac 29
            ||||| ||||| ||||||||||||| |||
Sbjct: 1127 ggttacgccccggtgctggactgccacac 1155
to top
>emb|CR666332.2|CNS0FD42 Tetraodon nigroviridis full-length cDNA
          Length = 1672

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                         
Query: 1    ggttatgcccctgtgctggactgccncac 29
            ||||| ||||| ||||||||||||| |||
Sbjct: 1125 ggttacgccccggtgctggactgccacac 1153
to top
>emb|CR666125.2|CNS0FCYB Tetraodon nigroviridis full-length cDNA
          Length = 1653

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                         
Query: 1    ggttatgcccctgtgctggactgccncac 29
            ||||| ||||| ||||||||||||| |||
Sbjct: 1120 ggttacgccccggtgctggactgccacac 1148
to top
>emb|CR666016.2|CNS0FCVA Tetraodon nigroviridis full-length cDNA
          Length = 1375

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                        
Query: 1   ggttatgcccctgtgctggactgccncac 29
           ||||| ||||| ||||||||||||| |||
Sbjct: 849 ggttacgccccggtgctggactgccacac 877
to top
>emb|CR664877.2|CNS0FBZN Tetraodon nigroviridis full-length cDNA
          Length = 633

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                        
Query: 1   ggttatgcccctgtgctggactgccncac 29
           ||||| ||||| ||||||||||||| |||
Sbjct: 84  ggttacgccccggtgctggactgccacac 112
to top
>emb|CR664825.2|CNS0FBY7 Tetraodon nigroviridis full-length cDNA
          Length = 1625

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                         
Query: 1    ggttatgcccctgtgctggactgccncac 29
            ||||| ||||| ||||||||||||| |||
Sbjct: 1105 ggttacgccccggtgctggactgccacac 1133
to top
>emb|CR663406.2|CNS0FAUS Tetraodon nigroviridis full-length cDNA
          Length = 1671

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                         
Query: 1    ggttatgcccctgtgctggactgccncac 29
            ||||| ||||| ||||||||||||| |||
Sbjct: 1125 ggttacgccccggtgctggactgccacac 1153
to top
>emb|CR662677.2|CNS0FAAJ Tetraodon nigroviridis full-length cDNA
          Length = 1425

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                        
Query: 1   ggttatgcccctgtgctggactgccncac 29
           ||||| ||||| ||||||||||||| |||
Sbjct: 891 ggttacgccccggtgctggactgccacac 919
to top
>emb|CR662215.2|CNS0F9XP Tetraodon nigroviridis full-length cDNA
          Length = 1677

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                         
Query: 1    ggttatgcccctgtgctggactgccncac 29
            ||||| ||||| ||||||||||||| |||
Sbjct: 1129 ggttacgccccggtgctggactgccacac 1157
to top
>emb|CR661799.2|CNS0F9M5 Tetraodon nigroviridis full-length cDNA
          Length = 1654

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                         
Query: 1    ggttatgcccctgtgctggactgccncac 29
            ||||| ||||| ||||||||||||| |||
Sbjct: 1116 ggttacgccccggtgctggactgccacac 1144
to top
>emb|CR661408.2|CNS0F9BA Tetraodon nigroviridis full-length cDNA
          Length = 1235

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                        
Query: 1   ggttatgcccctgtgctggactgccncac 29
           ||||| ||||| ||||||||||||| |||
Sbjct: 706 ggttacgccccggtgctggactgccacac 734
to top
>emb|CR657956.1|CNS0F6NE Tetraodon nigroviridis full-length cDNA
          Length = 1578

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                         
Query: 1    ggttatgcccctgtgctggactgccncac 29
            ||||| ||||| ||||||||||||| |||
Sbjct: 1034 ggttacgccccggtgctggactgccacac 1062
to top
>emb|CR660271.2|CNS0F8FP Tetraodon nigroviridis full-length cDNA
          Length = 1675

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                         
Query: 1    ggttatgcccctgtgctggactgccncac 29
            ||||| ||||| ||||||||||||| |||
Sbjct: 1127 ggttacgccccggtgctggactgccacac 1155
to top
>emb|CR659772.2|CNS0F81U Tetraodon nigroviridis full-length cDNA
          Length = 1668

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                         
Query: 1    ggttatgcccctgtgctggactgccncac 29
            ||||| ||||| ||||||||||||| |||
Sbjct: 1125 ggttacgccccggtgctggactgccacac 1153
to top
>emb|CR657394.2|CNS0F67S Tetraodon nigroviridis full-length cDNA
          Length = 662

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                        
Query: 1   ggttatgcccctgtgctggactgccncac 29
           ||||| ||||| ||||||||||||| |||
Sbjct: 113 ggttacgccccggtgctggactgccacac 141
to top
>emb|AJ132534.1|PAB132534 Picea abies mRNA for translation elongation factor-1 alpha, partial
          Length = 1747

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                         
Query: 1    ggttatgcccctgtgctggactgccncac 29
            ||||||||||||||| |||| |||| |||
Sbjct: 1021 ggttatgcccctgtgttggattgccacac 1049
to top
>gb|AF321836.1| Salmo salar elongation factor 1 alpha mRNA, complete cds
          Length = 1445

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                  
Query: 4    tatgcccctgtgctggactgcc 25
            ||||||||||||||||| ||||
Sbjct: 1124 tatgcccctgtgctggattgcc 1145
to top
>dbj|AB124568.1| Pelodiscus sinensis PsEF1a mRNA for elongation factor-1 alpha
            (EF-1alpha), complete cds
          Length = 1766

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                         
Query: 1    ggttatgcccctgtgctggactgccncac 29
            |||||||||||||| ||||| |||| |||
Sbjct: 1148 ggttatgcccctgtactggattgccacac 1176
to top
>gb|AC021636.16| Homo sapiens chromosome 8, clone RP11-637F16, complete sequence
          Length = 148687

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 6      tgcccctgtgctggactg 23
              ||||||||||||||||||
Sbjct: 103335 tgcccctgtgctggactg 103318
to top
>gb|AY879117.1| Calostoma cinnabarinum isolate AFTOL-ID 439 translation elongation
           factor 1-alpha (tef1) gene, partial cds
          Length = 1091

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                        
Query: 1   ggttatgcccctgtgctggactgccncac 29
           |||||||||||||| || ||||||| |||
Sbjct: 885 ggttatgcccctgttcttgactgccacac 913
to top
>dbj|AB073629.1| Bruguiera sexangula bsef-1A mRNA for eukaryotic elongation factor 1A,
            complete cds
          Length = 1664

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                         
Query: 1    ggttatgcccctgtgctggactgccncac 29
            |||||||||||||| ||||| |||| |||
Sbjct: 1063 ggttatgcccctgttctggattgccacac 1091
to top
>dbj|AB032900.1| Seriola quinqueradiata mRNA for elongation factor 1 alpha, complete
            cds
          Length = 1386

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                         
Query: 1    ggttatgcccctgtgctggactgccncac 29
            ||||||||||| |||||||| |||| |||
Sbjct: 1066 ggttatgccccagtgctggattgccacac 1094


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 114,139
Number of Sequences: 3902068
Number of extensions: 114139
Number of successful extensions: 30307
Number of sequences better than 10.0: 227
Number of HSP's better than 10.0 without gapping: 227
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 30074
Number of HSP's gapped (non-prelim): 233
length of query: 34
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 14
effective length of database: 17,155,003,908
effective search space: 240170054712
effective search space used: 240170054712
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)
to top