ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | bags7h10 |
|---|---|
| Clone Library Name | barley_pub |
>dbj|AK060267.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-005-D04, full insert sequence Length = 742 Score = 260 bits (131), Expect = 2e-66 Identities = 215/243 (88%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggcttccttctccgaggctccccccgggaaccccgacgccggc 92 ||||||||||||| |||||| || ||||| ||||||||||| || |||||| | |||||| Sbjct: 73 gcggcggcggcggagatggcgtcgttctcggaggctcccccgggcaaccccaaggccggc 132 Query: 93 gccaagatcttcaagaccaagtgcgcgcagtgccacaccgtcgacgcgggcgcgggccac 152 | ||||||||||||||||||||||| |||||||||||||||||| |||||| |||||| Sbjct: 133 gagaagatcttcaagaccaagtgcgcccagtgccacaccgtcgacaagggcgccggccac 192 Query: 153 aagcaaggtccaaacttgcatggtctgtttgggaggcagtcgggcaccaccgctggttac 212 |||||||||||||||||| ||||||||||||| |||||||| || |||||| ||||||| Sbjct: 193 aagcaaggtccaaacttgaatggtctgtttggaaggcagtcaggtaccacccctggttat 252 Query: 213 tcctactctgcggcaaacaagaacaaggctgtggagtgggaggagaacactctgtatgac 272 ||||||||| |||| |||||||||| ||||||| |||||||||||||| || |||||| Sbjct: 253 tcctactctacggccaacaagaacatggctgtgatctgggaggagaacacactttatgac 312 Query: 273 tac 275 ||| Sbjct: 313 tac 315
>dbj|D21275.1|RICSS393 Oryza sativa SS393 mRNA for cytochrome c, partial sequence Length = 344 Score = 246 bits (124), Expect = 3e-62 Identities = 215/244 (88%), Gaps = 1/244 (0%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggcttccttctccgaggctccccccgggaaccccgacgccggc 92 ||||||||||||| |||||| || ||||| ||||||||||| || |||||| | |||||| Sbjct: 34 gcggcggcggcggagatggcgtcgttctcggaggctcccccgggcaaccccaaggccggc 93 Query: 93 gccaagatcttcaagaccaagtgcgcgcagtgccacaccgtcgacgcgggcgcgggccac 152 | ||||||||||||||||||||||| |||||||||||||||||| |||||| |||||| Sbjct: 94 gagaagatcttcaagaccaagtgcgcccagtgccacaccgtcgacaagggcgccggccac 153 Query: 153 aagcaaggtccaaacttgcatggtctgtttgggaggcagtcgggcaccaccgctggttac 212 |||||||||||||||||| ||||||||||||| |||||||| || |||||| ||||||| Sbjct: 154 aagcaaggtccaaacttgaatggtctgtttggaaggcagtcaggtaccacccctggttat 213 Query: 213 tcctactctgcggcaaacaagaacaaggct-gtggagtgggaggagaacactctgtatga 271 ||||||||| |||| |||||||||| |||| ||| |||||||||||||| || ||||| Sbjct: 214 tcctactctacggccaacaagaacatggctngtgatctgggaggagaacacactttatga 273 Query: 272 ctac 275 |||| Sbjct: 274 ctac 277
>dbj|D12634.1|RICYCYTC Oryza sativa (japonica cultivar-group) mRNA for cytochrome C, complete cds Length = 654 Score = 240 bits (121), Expect = 2e-60 Identities = 202/229 (88%) Strand = Plus / Plus Query: 47 gatggcttccttctccgaggctccccccgggaaccccgacgccggcgccaagatcttcaa 106 |||||| || ||||| ||||||||||| || |||||| | ||||||| ||||||||||| Sbjct: 5 gatggcgtcgttctcggaggctcccccgggcaaccccaaggccggcgagaagatcttcaa 64 Query: 107 gaccaagtgcgcgcagtgccacaccgtcgacgcgggcgcgggccacaagcaaggtccaaa 166 |||||||||||| |||||||||||||||||| |||||| |||||||||||||||||||| Sbjct: 65 gaccaagtgcgcccagtgccacaccgtcgacaagggcgccggccacaagcaaggtccaaa 124 Query: 167 cttgcatggtctgtttgggaggcagtcgggcaccaccgctggttactcctactctgcggc 226 |||| ||||||||||||| |||||||| || |||||| ||||||| ||||||||| |||| Sbjct: 125 cttgaatggtctgtttggaaggcagtcaggtaccacccctggttattcctactctacggc 184 Query: 227 aaacaagaacaaggctgtggagtgggaggagaacactctgtatgactac 275 |||||||||| ||||||| |||||||||||||| || ||||||||| Sbjct: 185 caacaagaacatggctgtgatctgggaggagaacacactttatgactac 233
>gb|AF017367.1|AF017367 Oryza sativa cytochrome C mRNA, complete cds Length = 609 Score = 222 bits (112), Expect = 5e-55 Identities = 199/228 (87%) Strand = Plus / Plus Query: 48 atggcttccttctccgaggctccccccgggaaccccgacgccggcgccaagatcttcaag 107 |||||||| ||||| ||||||||||| || |||||| | ||||||| ||||||||||| Sbjct: 88 atggcttctttctcggaggctcccccgggcaaccccaaggccggcgagaagatcttcaaa 147 Query: 108 accaagtgcgcgcagtgccacaccgtcgacgcgggcgcgggccacaagcaaggtccaaac 167 ||||||||||| |||||||||||||||||| |||||| ||||||||||||||||||||| Sbjct: 148 accaagtgcgcccagtgccacaccgtcgacaagggcgccggccacaagcaaggtccaaac 207 Query: 168 ttgcatggtctgtttgggaggcagtcgggcaccaccgctggttactcctactctgcggca 227 ||| ||||||||||||| |||||||| || |||||| ||||||| ||||||||| |||| Sbjct: 208 ttgaatggtctgtttggaaggcagtcaggtaccacccctggttattcctactctacggcc 267 Query: 228 aacaagaacaaggctgtggagtgggaggagaacactctgtatgactac 275 |||||||||| ||||||| ||||| || ||||| || ||||||||| Sbjct: 268 aacaagaacatggctgtgatctgggaagaaaacacactttatgactac 315
>dbj|D10421.1|RICT76 Oryza sativa mRNA for cytochrome C (T76 gene), partial sequence Length = 241 Score = 182 bits (92), Expect = 4e-43 Identities = 194/229 (84%), Gaps = 1/229 (0%) Strand = Plus / Plus Query: 47 gatggcttccttctccgaggctccccccgggaaccccgacgccggcgccaagatcttcaa 106 |||||| || ||||| ||||||||||| |||||| | ||||||| ||||||||||| Sbjct: 5 gatggcgtcgttctcggaggctcccccnnncaaccccaaggccggcgagaagatcttcaa 64 Query: 107 gaccaagtgcgcgcagtgccacaccgtcgacgcgggcgcgggccacaagcaaggtccaaa 166 |||||||||||| |||||||||||||||||| |||||| ||| |||||||||||||||| Sbjct: 65 gaccaagtgcgcccagtgccacaccgtcgacaagggcgccggc-acaagcaaggtccaaa 123 Query: 167 cttgcatggtctgtttgggaggcagtcgggcaccaccgctggttactcctactctgcggc 226 |||| || |||||||||| |||||||| | |||||| || |||| ||||||||| | || Sbjct: 124 cttgaattgtctgtttggaaggcagtcangtaccacccctngttattcctactctncngc 183 Query: 227 aaacaagaacaaggctgtggagtgggaggagaacactctgtatgactac 275 |||||||||| ||||||| | |||||||||||| || ||||||||| Sbjct: 184 caacaagaacatggctgtgatcttggaggagaacacactttatgactac 232
>gb|AF031540.1|AF031540 Fritillaria agrestis cytochrome C (cytC) mRNA, complete cds Length = 570 Score = 170 bits (86), Expect = 1e-39 Identities = 158/182 (86%) Strand = Plus / Plus Query: 96 aagatcttcaagaccaagtgcgcgcagtgccacaccgtcgacgcgggcgcgggccacaag 155 |||||||||||||||||||||||||||||||||||||||||| |||||| || |||||| Sbjct: 103 aagatcttcaagaccaagtgcgcgcagtgccacaccgtcgacaagggcgccggtcacaag 162 Query: 156 caaggtccaaacttgcatggtctgtttgggaggcagtcgggcaccaccgctggttactcc 215 |||||||| || ||| | || || || |||||||| |||||||| || ||||| || || Sbjct: 163 caaggtccgaatttgaacgggcttttcgggaggcaatcgggcactacggctgggtattcg 222 Query: 216 tactctgcggcaaacaagaacaaggctgtggagtgggaggagaacactctgtatgactac 275 ||||||||||| || ||||||||||| ||| | ||||| ||||||||||||||||| ||| Sbjct: 223 tactctgcggcgaataagaacaaggcggtgaattgggatgagaacactctgtatgattac 282 Query: 276 tt 277 || Sbjct: 283 tt 284
>gb|M63704.1|RICCYTC Rice cytochrome c (OsCc-1) gene, complete cds Length = 2408 Score = 151 bits (76), Expect = 1e-33 Identities = 118/132 (89%) Strand = Plus / Plus Query: 30 tctgcggcggcggcggcgatggcttccttctccgaggctccccccgggaaccccgacgcc 89 |||||||||||||||| |||||| || ||||| ||||||||||| || |||||| | ||| Sbjct: 302 tctgcggcggcggcggagatggcgtcgttctcggaggctcccccgggcaaccccaaggcc 361 Query: 90 ggcgccaagatcttcaagaccaagtgcgcgcagtgccacaccgtcgacgcgggcgcgggc 149 |||| ||||||||||||||||||||||| |||||||||||||||||| |||||| ||| Sbjct: 362 ggcgagaagatcttcaagaccaagtgcgcccagtgccacaccgtcgacaagggcgccggc 421 Query: 150 cacaagcaaggt 161 |||||||||||| Sbjct: 422 cacaagcaaggt 433 Score = 123 bits (62), Expect = 3e-25 Identities = 104/118 (88%) Strand = Plus / Plus Query: 158 aggtccaaacttgcatggtctgtttgggaggcagtcgggcaccaccgctggttactccta 217 ||||||||||||| ||||||||||||| |||||||| || |||||| ||||||| ||||| Sbjct: 1247 aggtccaaacttgaatggtctgtttggaaggcagtcaggtaccacccctggttattccta 1306 Query: 218 ctctgcggcaaacaagaacaaggctgtggagtgggaggagaacactctgtatgactac 275 |||| |||| |||||||||| ||||||| |||||||||||||| || ||||||||| Sbjct: 1307 ctctacggccaacaagaacatggctgtgatctgggaggagaacacactttatgactac 1364
>gb|AC137623.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0426G01, complete sequence Length = 173074 Score = 145 bits (73), Expect = 9e-32 Identities = 115/129 (89%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggcttccttctccgaggctccccccgggaaccccgacgccggc 92 ||||||||||||| |||||| || ||||| ||||||||||| || |||||| | |||||| Sbjct: 157614 gcggcggcggcggagatggcgtcgttctcggaggctcccccgggcaaccccaaggccggc 157673 Query: 93 gccaagatcttcaagaccaagtgcgcgcagtgccacaccgtcgacgcgggcgcgggccac 152 | ||||||||||||||||||||||| |||||||||||||||||| |||||| |||||| Sbjct: 157674 gagaagatcttcaagaccaagtgcgcccagtgccacaccgtcgacaagggcgccggccac 157733 Query: 153 aagcaaggt 161 ||||||||| Sbjct: 157734 aagcaaggt 157742 Score = 123 bits (62), Expect = 3e-25 Identities = 104/118 (88%) Strand = Plus / Plus Query: 158 aggtccaaacttgcatggtctgtttgggaggcagtcgggcaccaccgctggttactccta 217 ||||||||||||| ||||||||||||| |||||||| || |||||| ||||||| ||||| Sbjct: 158561 aggtccaaacttgaatggtctgtttggaaggcagtcaggtaccacccctggttattccta 158620 Query: 218 ctctgcggcaaacaagaacaaggctgtggagtgggaggagaacactctgtatgactac 275 |||| |||| |||||||||| ||||||| |||||||||||||| || ||||||||| Sbjct: 158621 ctctacggccaacaagaacatggctgtgatctgggaggagaacacactttatgactac 158678
>gb|AC124836.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0092E21, complete sequence Length = 132649 Score = 145 bits (73), Expect = 9e-32 Identities = 115/129 (89%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggcttccttctccgaggctccccccgggaaccccgacgccggc 92 ||||||||||||| |||||| || ||||| ||||||||||| || |||||| | |||||| Sbjct: 29348 gcggcggcggcggagatggcgtcgttctcggaggctcccccgggcaaccccaaggccggc 29407 Query: 93 gccaagatcttcaagaccaagtgcgcgcagtgccacaccgtcgacgcgggcgcgggccac 152 | ||||||||||||||||||||||| |||||||||||||||||| |||||| |||||| Sbjct: 29408 gagaagatcttcaagaccaagtgcgcccagtgccacaccgtcgacaagggcgccggccac 29467 Query: 153 aagcaaggt 161 ||||||||| Sbjct: 29468 aagcaaggt 29476 Score = 123 bits (62), Expect = 3e-25 Identities = 104/118 (88%) Strand = Plus / Plus Query: 158 aggtccaaacttgcatggtctgtttgggaggcagtcgggcaccaccgctggttactccta 217 ||||||||||||| ||||||||||||| |||||||| || |||||| ||||||| ||||| Sbjct: 30295 aggtccaaacttgaatggtctgtttggaaggcagtcaggtaccacccctggttattccta 30354 Query: 218 ctctgcggcaaacaagaacaaggctgtggagtgggaggagaacactctgtatgactac 275 |||| |||| |||||||||| ||||||| |||||||||||||| || ||||||||| Sbjct: 30355 ctctacggccaacaagaacatggctgtgatctgggaggagaacacactttatgactac 30412
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 145 bits (73), Expect = 9e-32 Identities = 115/129 (89%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggcttccttctccgaggctccccccgggaaccccgacgccggc 92 ||||||||||||| |||||| || ||||| ||||||||||| || |||||| | |||||| Sbjct: 20485869 gcggcggcggcggagatggcgtcgttctcggaggctcccccgggcaaccccaaggccggc 20485928 Query: 93 gccaagatcttcaagaccaagtgcgcgcagtgccacaccgtcgacgcgggcgcgggccac 152 | ||||||||||||||||||||||| |||||||||||||||||| |||||| |||||| Sbjct: 20485929 gagaagatcttcaagaccaagtgcgcccagtgccacaccgtcgacaagggcgccggccac 20485988 Query: 153 aagcaaggt 161 ||||||||| Sbjct: 20485989 aagcaaggt 20485997 Score = 123 bits (62), Expect = 3e-25 Identities = 104/118 (88%) Strand = Plus / Plus Query: 158 aggtccaaacttgcatggtctgtttgggaggcagtcgggcaccaccgctggttactccta 217 ||||||||||||| ||||||||||||| |||||||| || |||||| ||||||| ||||| Sbjct: 20486816 aggtccaaacttgaatggtctgtttggaaggcagtcaggtaccacccctggttattccta 20486875 Query: 218 ctctgcggcaaacaagaacaaggctgtggagtgggaggagaacactctgtatgactac 275 |||| |||| |||||||||| ||||||| |||||||||||||| || ||||||||| Sbjct: 20486876 ctctacggccaacaagaacatggctgtgatctgggaggagaacacactttatgactac 20486933 Score = 42.1 bits (21), Expect = 0.91 Identities = 21/21 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggct 53 ||||||||||||||||||||| Sbjct: 2270734 gcggcggcggcggcgatggct 2270754 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggcttcc 56 |||||||||||||||| ||||||| Sbjct: 27934377 gcggcggcggcggcgagggcttcc 27934400 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 25266047 gcggcggcggcggcgatggc 25266028 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 10918765 gcggcggcggcggcgatggc 10918746 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 29 ctctgcggcggcggcggcga 48 |||||||||||||||||||| Sbjct: 10716382 ctctgcggcggcggcggcga 10716363 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 28 tctctgcggcggcggcggcg 47 |||||||||||||||||||| Sbjct: 5915303 tctctgcggcggcggcggcg 5915322 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 2673767 gcggcggcggcggcgatggc 2673748 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 1984705 gcggcggcggcggcgatggc 1984724 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 32 tgcggcggcggcggcgatgg 51 |||||||||||||||||||| Sbjct: 1493426 tgcggcggcggcggcgatgg 1493407
>ref|NM_102130.2| Arabidopsis thaliana electron carrier/ electron transporter AT1G22840 mRNA, complete cds Length = 727 Score = 87.7 bits (44), Expect = 2e-14 Identities = 134/164 (81%) Strand = Plus / Plus Query: 96 aagatcttcaagaccaagtgcgcgcagtgccacaccgtcgacgcgggcgcgggccacaag 155 |||||||||| ||||||||| || ||||| ||||||||||| || ||||| || ||||| Sbjct: 143 aagatcttcaggaccaagtgtgctcagtgtcacaccgtcgaagcaggcgccggtcacaaa 202 Query: 156 caaggtccaaacttgcatggtctgtttgggaggcagtcgggcaccaccgctggttactcc 215 ||||| || || | | ||||| ||||| || || || || || || ||||||||||| Sbjct: 203 caaggacccaatctaaacggtctatttggaagacaatctggtacaactgctggttactct 262 Query: 216 tactctgcggcaaacaagaacaaggctgtggagtgggaggagaa 259 |||||||| || ||||||||||| |||||||| ||||| ||||| Sbjct: 263 tactctgctgctaacaagaacaaagctgtggaatgggaagagaa 306
>gb|AY114580.1| Arabidopsis thaliana cytochrome C (At1g22840) mRNA, complete cds Length = 475 Score = 87.7 bits (44), Expect = 2e-14 Identities = 134/164 (81%) Strand = Plus / Plus Query: 96 aagatcttcaagaccaagtgcgcgcagtgccacaccgtcgacgcgggcgcgggccacaag 155 |||||||||| ||||||||| || ||||| ||||||||||| || ||||| || ||||| Sbjct: 49 aagatcttcaggaccaagtgtgctcagtgtcacaccgtcgaagcaggcgccggtcacaaa 108 Query: 156 caaggtccaaacttgcatggtctgtttgggaggcagtcgggcaccaccgctggttactcc 215 ||||| || || | | ||||| ||||| || || || || || || ||||||||||| Sbjct: 109 caaggacccaatctaaacggtctatttggaagacaatctggtacaactgctggttactct 168 Query: 216 tactctgcggcaaacaagaacaaggctgtggagtgggaggagaa 259 |||||||| || ||||||||||| |||||||| ||||| ||||| Sbjct: 169 tactctgctgctaacaagaacaaagctgtggaatgggaagagaa 212
>gb|AC142095.9| Medicago truncatula clone mth2-14c17, complete sequence Length = 110037 Score = 87.7 bits (44), Expect = 2e-14 Identities = 83/96 (86%) Strand = Plus / Minus Query: 66 gctccccccgggaaccccgacgccggcgccaagatcttcaagaccaagtgcgcgcagtgc 125 ||||| ||||| ||||||| |||||||| |||||||||| ||||||||||| |||||| Sbjct: 59914 gctcctcccggaaaccccgccgccggcgagaagatcttcagaaccaagtgcgctcagtgc 59855 Query: 126 cacaccgtcgacgcgggcgcgggccacaagcaaggt 161 |||||||||||| ||||| |||||||| |||||| Sbjct: 59854 cacaccgtcgacaaaggcgccggccacaaacaaggt 59819 Score = 65.9 bits (33), Expect = 6e-08 Identities = 57/65 (87%) Strand = Plus / Minus Query: 213 tcctactctgcggcaaacaagaacaaggctgtggagtgggaggagaacactctgtatgac 272 ||||| |||||||| |||||||||||||||||||| |||||||| || || ||||||| Sbjct: 58420 tcctattctgcggccaacaagaacaaggctgtggattgggaggaaaagaccttgtatgat 58361 Query: 273 tactt 277 ||||| Sbjct: 58360 tactt 58356
>gb|AY062853.1| Arabidopsis thaliana cytochrome C (At1g22840; F19G10.20) mRNA, complete cds Length = 619 Score = 87.7 bits (44), Expect = 2e-14 Identities = 134/164 (81%) Strand = Plus / Plus Query: 96 aagatcttcaagaccaagtgcgcgcagtgccacaccgtcgacgcgggcgcgggccacaag 155 |||||||||| ||||||||| || ||||| ||||||||||| || ||||| || ||||| Sbjct: 136 aagatcttcaggaccaagtgtgctcagtgtcacaccgtcgaagcaggcgccggtcacaaa 195 Query: 156 caaggtccaaacttgcatggtctgtttgggaggcagtcgggcaccaccgctggttactcc 215 ||||| || || | | ||||| ||||| || || || || || || ||||||||||| Sbjct: 196 caaggacccaatctaaacggtctatttggaagacaatctggtacaactgctggttactct 255 Query: 216 tactctgcggcaaacaagaacaaggctgtggagtgggaggagaa 259 |||||||| || ||||||||||| |||||||| ||||| ||||| Sbjct: 256 tactctgctgctaacaagaacaaagctgtggaatgggaagagaa 299
>gb|AC171534.4| Medicago truncatula chromosome 7 BAC clone mth2-90a20, complete sequence Length = 88903 Score = 87.7 bits (44), Expect = 2e-14 Identities = 83/96 (86%) Strand = Plus / Minus Query: 66 gctccccccgggaaccccgacgccggcgccaagatcttcaagaccaagtgcgcgcagtgc 125 ||||| ||||| ||||||| |||||||| |||||||||| ||||||||||| |||||| Sbjct: 81865 gctcctcccggaaaccccgccgccggcgagaagatcttcagaaccaagtgcgctcagtgc 81806 Query: 126 cacaccgtcgacgcgggcgcgggccacaagcaaggt 161 |||||||||||| ||||| |||||||| |||||| Sbjct: 81805 cacaccgtcgacaaaggcgccggccacaaacaaggt 81770 Score = 65.9 bits (33), Expect = 6e-08 Identities = 57/65 (87%) Strand = Plus / Minus Query: 213 tcctactctgcggcaaacaagaacaaggctgtggagtgggaggagaacactctgtatgac 272 ||||| |||||||| |||||||||||||||||||| |||||||| || || ||||||| Sbjct: 80371 tcctattctgcggccaacaagaacaaggctgtggattgggaggaaaagaccttgtatgat 80312 Query: 273 tactt 277 ||||| Sbjct: 80311 tactt 80307
>gb|AY087108.1| Arabidopsis thaliana clone 31770 mRNA, complete sequence Length = 627 Score = 87.7 bits (44), Expect = 2e-14 Identities = 134/164 (81%) Strand = Plus / Plus Query: 96 aagatcttcaagaccaagtgcgcgcagtgccacaccgtcgacgcgggcgcgggccacaag 155 |||||||||| ||||||||| || ||||| ||||||||||| || ||||| || ||||| Sbjct: 143 aagatcttcaggaccaagtgtgctcagtgtcacaccgtcgaagcaggcgccggtcacaaa 202 Query: 156 caaggtccaaacttgcatggtctgtttgggaggcagtcgggcaccaccgctggttactcc 215 ||||| || || | | ||||| ||||| || || || || || || ||||||||||| Sbjct: 203 caaggacccaatctaaacggtctatttggaagacaatctggtacaactgctggttactct 262 Query: 216 tactctgcggcaaacaagaacaaggctgtggagtgggaggagaa 259 |||||||| || ||||||||||| |||||||| ||||| ||||| Sbjct: 263 tactctgctgctaacaagaacaaagctgtggaatgggaagagaa 306
>gb|AY466606.1| Helianthus annuus cytochrome c mRNA, complete cds Length = 684 Score = 83.8 bits (42), Expect = 3e-13 Identities = 147/182 (80%) Strand = Plus / Plus Query: 96 aagatcttcaagaccaagtgcgcgcagtgccacaccgtcgacgcgggcgcgggccacaag 155 |||||||||||||| |||||||| || || ||||||||||| ||||| || ||||| Sbjct: 167 aagatcttcaagacaaagtgcgctcaatgtcacaccgtcgagaaaggcgctggtcacaaa 226 Query: 156 caaggtccaaacttgcatggtctgtttgggaggcagtcgggcaccaccgctggttactcc 215 ||||| || ||| | |||| |||||||| |||||||| || ||||| ||||| || || Sbjct: 227 caaggacccaacctaaatggactgtttggaaggcagtctggaaccactgctggatattct 286 Query: 216 tactctgcggcaaacaagaacaaggctgtggagtgggaggagaacactctgtatgactac 275 |||||||| | |||||||||||||| || |||||||| |||||| |||| |||||| Sbjct: 287 tactctgctggtaacaagaacaaggcagttatctgggaggaaaacactttgtacgactac 346 Query: 276 tt 277 || Sbjct: 347 tt 348
>gb|L77113.1|HNNCYTC Helianthus annuus L. cytochrome c (cytc1) mRNA, complete cds Length = 559 Score = 83.8 bits (42), Expect = 3e-13 Identities = 147/182 (80%) Strand = Plus / Plus Query: 96 aagatcttcaagaccaagtgcgcgcagtgccacaccgtcgacgcgggcgcgggccacaag 155 |||||||||||||| |||||||| || || ||||||||||| ||||| || ||||| Sbjct: 59 aagatcttcaagacaaagtgcgctcaatgtcacaccgtcgagaaaggcgctggtcacaaa 118 Query: 156 caaggtccaaacttgcatggtctgtttgggaggcagtcgggcaccaccgctggttactcc 215 ||||| || ||| | |||| |||||||| |||||||| || ||||| ||||| || || Sbjct: 119 caagggcccaacctaaatggactgtttggaaggcagtctggaaccactgctggatattct 178 Query: 216 tactctgcggcaaacaagaacaaggctgtggagtgggaggagaacactctgtatgactac 275 |||||||| | |||||||||||||| || |||||||| |||||| |||| |||||| Sbjct: 179 tactctgctggtaacaagaacaaggcagttatctgggaggaaaacactttgtacgactac 238 Query: 276 tt 277 || Sbjct: 239 tt 240
>ref|XM_463549.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 336 Score = 79.8 bits (40), Expect = 4e-12 Identities = 88/104 (84%) Strand = Plus / Plus Query: 87 gccggcgccaagatcttcaagaccaagtgcgcgcagtgccacaccgtcgacgcgggcgcg 146 ||||||| |||||||||| ||||||||||||| | ||||| |||||||| || ||| Sbjct: 40 gccggcgagaagatcttcaggaccaagtgcgcgtactgccatgccgtcgacaaggccgcc 99 Query: 147 ggccacaagcaaggtccaaacttgcatggtctgtttgggaggca 190 ||||||||||| || ||||||||| | ||| ||||||||||||| Sbjct: 100 ggccacaagcatgggccaaacttgaacggtttgtttgggaggca 143
>dbj|AK121662.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033064H20, full insert sequence Length = 696 Score = 79.8 bits (40), Expect = 4e-12 Identities = 88/104 (84%) Strand = Plus / Plus Query: 87 gccggcgccaagatcttcaagaccaagtgcgcgcagtgccacaccgtcgacgcgggcgcg 146 ||||||| |||||||||| ||||||||||||| | ||||| |||||||| || ||| Sbjct: 113 gccggcgagaagatcttcaggaccaagtgcgcgtactgccatgccgtcgacaaggccgcc 172 Query: 147 ggccacaagcaaggtccaaacttgcatggtctgtttgggaggca 190 ||||||||||| || ||||||||| | ||| ||||||||||||| Sbjct: 173 ggccacaagcatgggccaaacttgaacggtttgtttgggaggca 216
>gb|AC155340.1| Brassica rapa subsp. pekinensis chromosome Cytogenetic chromosome 1 clone KBrH020D15, complete sequence Length = 143633 Score = 75.8 bits (38), Expect = 7e-11 Identities = 74/86 (86%) Strand = Plus / Minus Query: 174 ggtctgtttgggaggcagtcgggcaccaccgctggttactcctactctgcggcaaacaag 233 ||||||||||| || ||||| || || || ||||||||||| |||||||| || |||||| Sbjct: 103124 ggtctgtttggaagacagtctggaacaacagctggttactcttactctgctgctaacaag 103065 Query: 234 aacaaggctgtggagtgggaggagaa 259 ||||| |||||||| ||||| ||||| Sbjct: 103064 aacaaagctgtggaatgggaagagaa 103039 Score = 52.0 bits (26), Expect = 0.001 Identities = 38/42 (90%) Strand = Plus / Minus Query: 96 aagatcttcaagaccaagtgcgcgcagtgccacaccgtcgac 137 |||||||||| ||||||||| || ||||| |||||||||||| Sbjct: 103514 aagatcttcaggaccaagtgtgctcagtgtcacaccgtcgac 103473
>gb|AF000657.1|ATAF000657 Arabidopsis thaliana BAC F19G10, complete sequence Length = 92948 Score = 63.9 bits (32), Expect = 2e-07 Identities = 50/56 (89%) Strand = Plus / Minus Query: 204 gctggttactcctactctgcggcaaacaagaacaaggctgtggagtgggaggagaa 259 ||||||||||| |||||||| || ||||||||||| |||||||| ||||| ||||| Sbjct: 91022 gctggttactcttactctgctgctaacaagaacaaagctgtggaatgggaagagaa 90967 Score = 60.0 bits (30), Expect = 4e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 96 aagatcttcaagaccaagtgcgcgcagtgccacaccgtcgacgcgggcgcgggccacaag 155 |||||||||| ||||||||| || ||||| ||||||||||| || ||||| || ||||| Sbjct: 91609 aagatcttcaggaccaagtgtgctcagtgtcacaccgtcgaagcaggcgccggtcacaaa 91550 Query: 156 caaggt 161 |||||| Sbjct: 91549 caaggt 91544
>emb|AJ539068.1|NTA539068 Nicotiana tabacum cDNA-AFLP-fragment BT42-M1-010 Length = 450 Score = 56.0 bits (28), Expect = 6e-05 Identities = 76/92 (82%) Strand = Plus / Plus Query: 180 tttgggaggcagtcgggcaccaccgctggttactcctactctgcggcaaacaagaacaag 239 ||||| |||||||| || || || |||||||||||||||||||| || || ||||| | | Sbjct: 79 tttggaaggcagtctggaactactgctggttactcctactctgctgccaataagaatatg 138 Query: 240 gctgtggagtgggaggagaacactctgtatga 271 |||||| |||||| || || ||| ||||||| Sbjct: 139 gctgtgatgtgggaagaaaagactttgtatga 170
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 54.0 bits (27), Expect = 2e-04 Identities = 60/71 (84%) Strand = Plus / Plus Query: 87 gccggcgccaagatcttcaagaccaagtgcgcgcagtgccacaccgtcgacgcgggcgcg 146 ||||||| |||||||||| ||||||||||||| | ||||| |||||||| || ||| Sbjct: 38436997 gccggcgagaagatcttcaggaccaagtgcgcgtactgccatgccgtcgacaaggccgcc 38437056 Query: 147 ggccacaagca 157 ||||||||||| Sbjct: 38437057 ggccacaagca 38437067 Score = 42.1 bits (21), Expect = 0.91 Identities = 21/21 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggct 53 ||||||||||||||||||||| Sbjct: 37522974 gcggcggcggcggcgatggct 37522994 Score = 42.1 bits (21), Expect = 0.91 Identities = 21/21 (100%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggct 53 ||||||||||||||||||||| Sbjct: 4287665 gcggcggcggcggcgatggct 4287645 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 43181549 gcggcggcggcggcgatggc 43181568 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 38987004 gcggcggcggcggcgatggc 38986985 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 38953398 gcggcggcggcggcgatggc 38953379 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 24330612 gcggcggcggcggcgatggc 24330593 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 22994316 gcggcggcggcggcgatggc 22994297 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 15005699 gcggcggcggcggcgatggc 15005718 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 13328178 gcggcggcggcggcgatggc 13328159 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 5492572 gcggcggcggcggcgatggc 5492591
>gb|AF229199.1|AF229199 Oryza sativa chromosome 1 clone OSJNBa0048I01, complete sequence Length = 193444 Score = 54.0 bits (27), Expect = 2e-04 Identities = 60/71 (84%) Strand = Plus / Plus Query: 87 gccggcgccaagatcttcaagaccaagtgcgcgcagtgccacaccgtcgacgcgggcgcg 146 ||||||| |||||||||| ||||||||||||| | ||||| |||||||| || ||| Sbjct: 30094 gccggcgagaagatcttcaggaccaagtgcgcgtactgccatgccgtcgacaaggccgcc 30153 Query: 147 ggccacaagca 157 ||||||||||| Sbjct: 30154 ggccacaagca 30164
>dbj|AP003379.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0408G07 Length = 126631 Score = 54.0 bits (27), Expect = 2e-04 Identities = 60/71 (84%) Strand = Plus / Plus Query: 87 gccggcgccaagatcttcaagaccaagtgcgcgcagtgccacaccgtcgacgcgggcgcg 146 ||||||| |||||||||| ||||||||||||| | ||||| |||||||| || ||| Sbjct: 22412 gccggcgagaagatcttcaggaccaagtgcgcgtactgccatgccgtcgacaaggccgcc 22471 Query: 147 ggccacaagca 157 ||||||||||| Sbjct: 22472 ggccacaagca 22482
>dbj|AK121277.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023108A04, full insert sequence Length = 781 Score = 54.0 bits (27), Expect = 2e-04 Identities = 33/35 (94%) Strand = Plus / Plus Query: 96 aagatcttcaagaccaagtgcgcgcagtgccacac 130 ||||||||| |||||||||||||||||||||||| Sbjct: 168 aagatcttccggaccaagtgcgcgcagtgccacac 202
>ref|NM_117072.2| Arabidopsis thaliana electron carrier/ electron transporter AT4G10040 mRNA, complete cds Length = 647 Score = 50.1 bits (25), Expect = 0.004 Identities = 37/41 (90%) Strand = Plus / Plus Query: 96 aagatcttcaagaccaagtgcgcgcagtgccacaccgtcga 136 |||||||||| ||||||||||| ||||| ||||||||||| Sbjct: 134 aagatcttcagaaccaagtgcgctcagtgtcacaccgtcga 174
>emb|AJ416378.1|PSP416378 Polytomella sp. 'Pringsheim 198.80' mRNA for mitochondrial cytochrome c (cyc gene) Length = 643 Score = 50.1 bits (25), Expect = 0.004 Identities = 31/33 (93%) Strand = Plus / Plus Query: 96 aagatcttcaagaccaagtgcgcgcagtgccac 128 ||||| ||||||||||||||||| ||||||||| Sbjct: 86 aagattttcaagaccaagtgcgctcagtgccac 118
>emb|Z99829.1|CRCYC1GEN Chlamydomonas reinhardtii CYC1 gene encoding cytochrome c Length = 3078 Score = 50.1 bits (25), Expect = 0.004 Identities = 31/33 (93%) Strand = Plus / Plus Query: 96 aagatcttcaagaccaagtgcgcgcagtgccac 128 ||||| |||||||||||||||||||| |||||| Sbjct: 1884 aagattttcaagaccaagtgcgcgcaatgccac 1916
>gb|AY079373.1| Arabidopsis thaliana putative cytochrome c protein (At4g10040) mRNA, complete cds Length = 370 Score = 50.1 bits (25), Expect = 0.004 Identities = 37/41 (90%) Strand = Plus / Plus Query: 96 aagatcttcaagaccaagtgcgcgcagtgccacaccgtcga 136 |||||||||| ||||||||||| ||||| ||||||||||| Sbjct: 49 aagatcttcagaaccaagtgcgctcagtgtcacaccgtcga 89
>gb|AY045944.1| Arabidopsis thaliana putative cytochrome c protein (At4g10040) mRNA, complete cds Length = 664 Score = 50.1 bits (25), Expect = 0.004 Identities = 37/41 (90%) Strand = Plus / Plus Query: 96 aagatcttcaagaccaagtgcgcgcagtgccacaccgtcga 136 |||||||||| ||||||||||| ||||| ||||||||||| Sbjct: 134 aagatcttcagaaccaagtgcgctcagtgtcacaccgtcga 174
>emb|AL161516.2|ATCHRIV28 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 28 Length = 198005 Score = 50.1 bits (25), Expect = 0.004 Identities = 37/41 (90%) Strand = Plus / Plus Query: 96 aagatcttcaagaccaagtgcgcgcagtgccacaccgtcga 136 |||||||||| ||||||||||| ||||| ||||||||||| Sbjct: 102365 aagatcttcagaaccaagtgcgctcagtgtcacaccgtcga 102405
>emb|AL049487.1|ATF28M11 Arabidopsis thaliana DNA chromosome 4, BAC clone F28M11 (ESSA project) Length = 85907 Score = 50.1 bits (25), Expect = 0.004 Identities = 37/41 (90%) Strand = Plus / Plus Query: 96 aagatcttcaagaccaagtgcgcgcagtgccacaccgtcga 136 |||||||||| ||||||||||| ||||| ||||||||||| Sbjct: 4005 aagatcttcagaaccaagtgcgctcagtgtcacaccgtcga 4045
>emb|AL049481.1|ATT5L19 Arabidopsis thaliana DNA chromosome 4, BAC clone T5L19 (ESSA project) Length = 92495 Score = 50.1 bits (25), Expect = 0.004 Identities = 37/41 (90%) Strand = Plus / Plus Query: 96 aagatcttcaagaccaagtgcgcgcagtgccacaccgtcga 136 |||||||||| ||||||||||| ||||| ||||||||||| Sbjct: 62937 aagatcttcagaaccaagtgcgctcagtgtcacaccgtcga 62977
>gb|AF399666.1| Oryza sativa cytochrome C (Cc1) gene, promoter, 5'UTR and partial cds Length = 1882 Score = 50.1 bits (25), Expect = 0.004 Identities = 37/41 (90%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggcttccttctccgaggctccccc 73 ||||||||||||| |||||| || ||||| ||||||||||| Sbjct: 1839 gcggcggcggcggagatggcgtcgttctcggaggctccccc 1879
>gb|DQ122874.1| Chlamydomonas incerta mitochondrial apocytochrome c (CYC) mRNA, complete cds; nuclear gene for mitochondrial product Length = 609 Score = 50.1 bits (25), Expect = 0.004 Identities = 31/33 (93%) Strand = Plus / Plus Query: 96 aagatcttcaagaccaagtgcgcgcagtgccac 128 ||||| |||||||||||||||||||| |||||| Sbjct: 64 aagattttcaagaccaagtgcgcgcaatgccac 96
>emb|BX826474.1|CNS0A37Z Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB2ZB01 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 540 Score = 50.1 bits (25), Expect = 0.004 Identities = 37/41 (90%) Strand = Plus / Plus Query: 96 aagatcttcaagaccaagtgcgcgcagtgccacaccgtcga 136 |||||||||| ||||||||||| ||||| ||||||||||| Sbjct: 28 aagatcttcagaaccaagtgcgcacagtgtcacaccgtcga 68
>emb|BX828516.1|CNS0A2QS Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL10ZG07 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 580 Score = 50.1 bits (25), Expect = 0.004 Identities = 37/41 (90%) Strand = Plus / Plus Query: 96 aagatcttcaagaccaagtgcgcgcagtgccacaccgtcga 136 |||||||||| ||||||||||| ||||| ||||||||||| Sbjct: 88 aagatcttcagaaccaagtgcgctcagtgtcacaccgtcga 128
>gb|AY087056.1| Arabidopsis thaliana clone 31115 mRNA, complete sequence Length = 616 Score = 50.1 bits (25), Expect = 0.004 Identities = 37/41 (90%) Strand = Plus / Plus Query: 96 aagatcttcaagaccaagtgcgcgcagtgccacaccgtcga 136 |||||||||| ||||||||||| ||||| ||||||||||| Sbjct: 127 aagatcttcagaaccaagtgcgctcagtgtcacaccgtcga 167
>gb|M35173.1|CRECYCA C.reinhardtii mitochondrial apocytochrome c (cyc) mRNA, complete cds Length = 662 Score = 50.1 bits (25), Expect = 0.004 Identities = 31/33 (93%) Strand = Plus / Plus Query: 96 aagatcttcaagaccaagtgcgcgcagtgccac 128 ||||| |||||||||||||||||||| |||||| Sbjct: 90 aagattttcaagaccaagtgcgcgcaatgccac 122
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 46.1 bits (23), Expect = 0.059 Identities = 23/23 (100%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggcttc 55 ||||||||||||||||||||||| Sbjct: 8432962 gcggcggcggcggcgatggcttc 8432940 Score = 42.1 bits (21), Expect = 0.91 Identities = 21/21 (100%) Strand = Plus / Minus Query: 31 ctgcggcggcggcggcgatgg 51 ||||||||||||||||||||| Sbjct: 33471190 ctgcggcggcggcggcgatgg 33471170 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 31450346 gcggcggcggcggcgatggc 31450365 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 26197029 gcggcggcggcggcgatggc 26197048 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 31 ctgcggcggcggcggcgatg 50 |||||||||||||||||||| Sbjct: 22176775 ctgcggcggcggcggcgatg 22176794 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 956720 gcggcggcggcggcgatggc 956701
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 46.1 bits (23), Expect = 0.059 Identities = 23/23 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggcttc 55 ||||||||||||||||||||||| Sbjct: 5079061 gcggcggcggcggcgatggcttc 5079083 Score = 42.1 bits (21), Expect = 0.91 Identities = 21/21 (100%) Strand = Plus / Plus Query: 31 ctgcggcggcggcggcgatgg 51 ||||||||||||||||||||| Sbjct: 23122057 ctgcggcggcggcggcgatgg 23122077 Score = 42.1 bits (21), Expect = 0.91 Identities = 21/21 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggct 53 ||||||||||||||||||||| Sbjct: 5370560 gcggcggcggcggcgatggct 5370580 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 29765787 gcggcggcggcggcgatggc 29765768 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 27464041 gcggcggcggcggcgatggc 27464060 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 21301570 gcggcggcggcggcgatggc 21301589 Score = 40.1 bits (20), Expect = 3.6 Identities = 26/28 (92%) Strand = Plus / Plus Query: 35 ggcggcggcggcgatggcttccttctcc 62 ||||||||||||| ||||||||||||| Sbjct: 21107486 ggcggcggcggcggcggcttccttctcc 21107513 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 19494666 gcggcggcggcggcgatggc 19494647 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 5649166 gcggcggcggcggcgatggc 5649185
>dbj|AP003946.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OJ1147_D11 Length = 138444 Score = 46.1 bits (23), Expect = 0.059 Identities = 23/23 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggcttc 55 ||||||||||||||||||||||| Sbjct: 38099 gcggcggcggcggcgatggcttc 38121
>dbj|AP006056.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:B1172G12 Length = 171974 Score = 46.1 bits (23), Expect = 0.059 Identities = 23/23 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggcttc 55 ||||||||||||||||||||||| Sbjct: 121175 gcggcggcggcggcgatggcttc 121197
>dbj|AK119282.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-130-C07, full insert sequence Length = 2708 Score = 46.1 bits (23), Expect = 0.059 Identities = 23/23 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggcttc 55 ||||||||||||||||||||||| Sbjct: 1148 gcggcggcggcggcgatggcttc 1170
>ref|XM_463951.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1161 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggctt 54 |||||||||||||||||||||| Sbjct: 75 gcggcggcggcggcgatggctt 54
>ref|XM_370188.1| Magnaporthe grisea 70-15 chromosome II hypothetical protein (MG06685.4) partial mRNA Length = 654 Score = 44.1 bits (22), Expect = 0.23 Identities = 25/26 (96%) Strand = Plus / Plus Query: 114 tgcgcgcagtgccacaccgtcgacgc 139 |||| ||||||||||||||||||||| Sbjct: 382 tgcgagcagtgccacaccgtcgacgc 407
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggctt 54 |||||||||||||||||||||| Sbjct: 1302347 gcggcggcggcggcgatggctt 1302326 Score = 42.1 bits (21), Expect = 0.91 Identities = 21/21 (100%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggct 53 ||||||||||||||||||||| Sbjct: 34071708 gcggcggcggcggcgatggct 34071688 Score = 42.1 bits (21), Expect = 0.91 Identities = 21/21 (100%) Strand = Plus / Minus Query: 27 gtctctgcggcggcggcggcg 47 ||||||||||||||||||||| Sbjct: 6187827 gtctctgcggcggcggcggcg 6187807 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 35261988 gcggcggcggcggcgatggc 35262007 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 32343766 gcggcggcggcggcgatggc 32343785 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 26708413 gcggcggcggcggcgatggc 26708432 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 23536829 gcggcggcggcggcgatggc 23536810 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 18545984 gcggcggcggcggcgatggc 18546003 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 12489434 gcggcggcggcggcgatggc 12489453 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 2037595 gcggcggcggcggcgatggc 2037576 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 887642 gcggcggcggcggcgatggc 887623 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggcttcc 56 |||||||||||||||| ||||||| Sbjct: 819047 gcggcggcggcggcgaaggcttcc 819024
>dbj|AP004885.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0575F10 Length = 150462 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggctt 54 |||||||||||||||||||||| Sbjct: 133438 gcggcggcggcggcgatggctt 133417
>dbj|AP006754.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0018H03, complete sequence Length = 94450 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggctt 54 |||||||||||||||||||||| Sbjct: 76376 gcggcggcggcggcgatggctt 76355
>dbj|AK105873.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-204-B05, full insert sequence Length = 1161 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggctt 54 |||||||||||||||||||||| Sbjct: 75 gcggcggcggcggcgatggctt 54
>gb|AY849644.1| Magnaporthe grisea cytochrome c-like protein mRNA, complete cds Length = 1016 Score = 44.1 bits (22), Expect = 0.23 Identities = 25/26 (96%) Strand = Plus / Plus Query: 114 tgcgcgcagtgccacaccgtcgacgc 139 |||| ||||||||||||||||||||| Sbjct: 524 tgcgagcagtgccacaccgtcgacgc 549
>emb|AL117264.3| Oryza sativa genomic DNA, chromosome 4, BAC clone: H0313F03, complete sequence Length = 131195 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 31 ctgcggcggcggcggcgatggc 52 |||||||||||||||||||||| Sbjct: 70179 ctgcggcggcggcggcgatggc 70200
>gb|CP000002.2| Bacillus licheniformis ATCC 14580, complete genome Length = 4222334 Score = 42.1 bits (21), Expect = 0.91 Identities = 21/21 (100%) Strand = Plus / Plus Query: 32 tgcggcggcggcggcgatggc 52 ||||||||||||||||||||| Sbjct: 3975835 tgcggcggcggcggcgatggc 3975855
>ref|XM_474971.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2541 Score = 42.1 bits (21), Expect = 0.91 Identities = 21/21 (100%) Strand = Plus / Plus Query: 35 ggcggcggcggcgatggcttc 55 ||||||||||||||||||||| Sbjct: 1039 ggcggcggcggcgatggcttc 1059
>ref|XM_474174.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 420 Score = 42.1 bits (21), Expect = 0.91 Identities = 21/21 (100%) Strand = Plus / Plus Query: 31 ctgcggcggcggcggcgatgg 51 ||||||||||||||||||||| Sbjct: 317 ctgcggcggcggcggcgatgg 337
>ref|NM_190755.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 873 Score = 42.1 bits (21), Expect = 0.91 Identities = 21/21 (100%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggct 53 ||||||||||||||||||||| Sbjct: 741 gcggcggcggcggcgatggct 721
>ref|XM_476432.1| Oryza sativa (japonica cultivar-group), mRNA Length = 246 Score = 42.1 bits (21), Expect = 0.91 Identities = 21/21 (100%) Strand = Plus / Plus Query: 31 ctgcggcggcggcggcgatgg 51 ||||||||||||||||||||| Sbjct: 126 ctgcggcggcggcggcgatgg 146
>gb|AC119670.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBb0007H22, complete sequence Length = 160938 Score = 42.1 bits (21), Expect = 0.91 Identities = 24/25 (96%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggcttcct 57 |||||||||||||||| |||||||| Sbjct: 37940 gcggcggcggcggcgagggcttcct 37916
>gb|AE017333.1| Bacillus licheniformis DSM 13, complete genome Length = 4222645 Score = 42.1 bits (21), Expect = 0.91 Identities = 21/21 (100%) Strand = Plus / Plus Query: 32 tgcggcggcggcggcgatggc 52 ||||||||||||||||||||| Sbjct: 3975949 tgcggcggcggcggcgatggc 3975969
>gb|AC137621.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0111O13, complete sequence Length = 126332 Score = 42.1 bits (21), Expect = 0.91 Identities = 21/21 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggct 53 ||||||||||||||||||||| Sbjct: 103165 gcggcggcggcggcgatggct 103185
>gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome Length = 4403837 Score = 42.1 bits (21), Expect = 0.91 Identities = 21/21 (100%) Strand = Plus / Minus Query: 32 tgcggcggcggcggcgatggc 52 ||||||||||||||||||||| Sbjct: 3759150 tgcggcggcggcggcgatggc 3759130 Score = 42.1 bits (21), Expect = 0.91 Identities = 21/21 (100%) Strand = Plus / Minus Query: 32 tgcggcggcggcggcgatggc 52 ||||||||||||||||||||| Sbjct: 3745240 tgcggcggcggcggcgatggc 3745220 Score = 42.1 bits (21), Expect = 0.91 Identities = 21/21 (100%) Strand = Plus / Minus Query: 32 tgcggcggcggcggcgatggc 52 ||||||||||||||||||||| Sbjct: 3526621 tgcggcggcggcggcgatggc 3526601 Score = 42.1 bits (21), Expect = 0.91 Identities = 21/21 (100%) Strand = Plus / Minus Query: 32 tgcggcggcggcggcgatggc 52 ||||||||||||||||||||| Sbjct: 3524472 tgcggcggcggcggcgatggc 3524452 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 32 tgcggcggcggcggcgatgg 51 |||||||||||||||||||| Sbjct: 2636678 tgcggcggcggcggcgatgg 2636659 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 32 tgcggcggcggcggcgatgg 51 |||||||||||||||||||| Sbjct: 2634096 tgcggcggcggcggcgatgg 2634077
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 42.1 bits (21), Expect = 0.91 Identities = 21/21 (100%) Strand = Plus / Minus Query: 31 ctgcggcggcggcggcgatgg 51 ||||||||||||||||||||| Sbjct: 5947924 ctgcggcggcggcggcgatgg 5947904 Score = 42.1 bits (21), Expect = 0.91 Identities = 21/21 (100%) Strand = Plus / Plus Query: 27 gtctctgcggcggcggcggcg 47 ||||||||||||||||||||| Sbjct: 714925 gtctctgcggcggcggcggcg 714945 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 28 tctctgcggcggcggcggcg 47 |||||||||||||||||||| Sbjct: 32685390 tctctgcggcggcggcggcg 32685409 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 32237349 gcggcggcggcggcgatggc 32237330 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 22140574 gcggcggcggcggcgatggc 22140555 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggcttcc 56 ||||||||||||||||||| |||| Sbjct: 21048696 gcggcggcggcggcgatggtttcc 21048673 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 9168121 gcggcggcggcggcgatggc 9168140 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 71 ccccgggaaccccgacgccg 90 |||||||||||||||||||| Sbjct: 3296919 ccccgggaaccccgacgccg 3296900 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 3097752 gcggcggcggcggcgatggc 3097771 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 3073600 gcggcggcggcggcgatggc 3073619 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 31 ctgcggcggcggcggcgatg 50 |||||||||||||||||||| Sbjct: 919073 ctgcggcggcggcggcgatg 919092
>gb|AC137744.2| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone OSJNBa0074L11, complete sequence Length = 180703 Score = 42.1 bits (21), Expect = 0.91 Identities = 24/25 (96%) Strand = Plus / Plus Query: 32 tgcggcggcggcggcgatggcttcc 56 |||||||||||||||| |||||||| Sbjct: 98975 tgcggcggcggcggcggtggcttcc 98999
>gb|CP000270.1| Burkholderia xenovorans LB400 chromosome 1, complete sequence Length = 4895836 Score = 42.1 bits (21), Expect = 0.91 Identities = 24/25 (96%) Strand = Plus / Plus Query: 35 ggcggcggcggcgatggcttccttc 59 |||||||||||||||||| |||||| Sbjct: 1218914 ggcggcggcggcgatggcctccttc 1218938
>emb|AL034405.16|HS537K23 Human DNA sequence from clone RP4-537K23 on chromosome Xq25-26.1 Contains the 3' end of the ZDHHC9 gene for zinc finger, DHHC domain containing 9 (CGI-89, ZNF379), a novel gene, a sal-like family pseudogene, the SDCCAG16 gene for serologically defined colon cancer antigen 16 (NY-CO-16), the 5' UTR of a novel gene (FLHJ11362) and seven CpG islands, complete sequence Length = 156589 Score = 42.1 bits (21), Expect = 0.91 Identities = 21/21 (100%) Strand = Plus / Minus Query: 239 ggctgtggagtgggaggagaa 259 ||||||||||||||||||||| Sbjct: 109828 ggctgtggagtgggaggagaa 109808
>emb|BX842582.1| Mycobacterium tuberculosis H37Rv complete genome; segment 11/13 Length = 349563 Score = 42.1 bits (21), Expect = 0.91 Identities = 21/21 (100%) Strand = Plus / Minus Query: 32 tgcggcggcggcggcgatggc 52 ||||||||||||||||||||| Sbjct: 299263 tgcggcggcggcggcgatggc 299243 Score = 42.1 bits (21), Expect = 0.91 Identities = 21/21 (100%) Strand = Plus / Minus Query: 32 tgcggcggcggcggcgatggc 52 ||||||||||||||||||||| Sbjct: 285345 tgcggcggcggcggcgatggc 285325 Score = 42.1 bits (21), Expect = 0.91 Identities = 21/21 (100%) Strand = Plus / Minus Query: 32 tgcggcggcggcggcgatggc 52 ||||||||||||||||||||| Sbjct: 61324 tgcggcggcggcggcgatggc 61304
>emb|BX248345.1| Mycobacterium bovis subsp. bovis AF2122/97 complete genome; segment 12/14 Length = 308050 Score = 42.1 bits (21), Expect = 0.91 Identities = 21/21 (100%) Strand = Plus / Minus Query: 32 tgcggcggcggcggcgatggc 52 ||||||||||||||||||||| Sbjct: 277452 tgcggcggcggcggcgatggc 277432 Score = 42.1 bits (21), Expect = 0.91 Identities = 21/21 (100%) Strand = Plus / Minus Query: 32 tgcggcggcggcggcgatggc 52 ||||||||||||||||||||| Sbjct: 263541 tgcggcggcggcggcgatggc 263521
>emb|AL662993.3|OSJN00195 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0015G09, complete sequence Length = 123375 Score = 42.1 bits (21), Expect = 0.91 Identities = 21/21 (100%) Strand = Plus / Minus Query: 35 ggcggcggcggcgatggcttc 55 ||||||||||||||||||||| Sbjct: 46335 ggcggcggcggcgatggcttc 46315
>emb|AL606446.1|OSJN00016 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0022F16, complete sequence Length = 119535 Score = 42.1 bits (21), Expect = 0.91 Identities = 21/21 (100%) Strand = Plus / Minus Query: 31 ctgcggcggcggcggcgatgg 51 ||||||||||||||||||||| Sbjct: 117069 ctgcggcggcggcggcgatgg 117049
>dbj|AP008932.1| Rhodococcus erythropolis PR4 plasmid pREC1, complete sequence Length = 104014 Score = 42.1 bits (21), Expect = 0.91 Identities = 24/25 (96%) Strand = Plus / Plus Query: 132 gtcgacgcgggcgcgggccacaagc 156 |||||||| |||||||||||||||| Sbjct: 78258 gtcgacgccggcgcgggccacaagc 78282
>gb|AC158240.5| Pan troglodytes BAC clone CH251-542M19 from chromosome unknown, complete sequence Length = 217064 Score = 42.1 bits (21), Expect = 0.91 Identities = 21/21 (100%) Strand = Plus / Plus Query: 29 ctctgcggcggcggcggcgat 49 ||||||||||||||||||||| Sbjct: 109781 ctctgcggcggcggcggcgat 109801
>gb|AC134241.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBb0085F02, complete sequence Length = 128535 Score = 42.1 bits (21), Expect = 0.91 Identities = 21/21 (100%) Strand = Plus / Minus Query: 31 ctgcggcggcggcggcgatgg 51 ||||||||||||||||||||| Sbjct: 97546 ctgcggcggcggcggcgatgg 97526
>gb|AC135158.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1193C08, complete sequence Length = 111961 Score = 42.1 bits (21), Expect = 0.91 Identities = 21/21 (100%) Strand = Plus / Minus Query: 31 ctgcggcggcggcggcgatgg 51 ||||||||||||||||||||| Sbjct: 6459 ctgcggcggcggcggcgatgg 6439
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 42.1 bits (21), Expect = 0.91 Identities = 24/25 (96%) Strand = Plus / Plus Query: 32 tgcggcggcggcggcgatggcttcc 56 |||||||||||||||| |||||||| Sbjct: 21746922 tgcggcggcggcggcggtggcttcc 21746946 Score = 42.1 bits (21), Expect = 0.91 Identities = 24/25 (96%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggcttcct 57 |||||||||||||||| |||||||| Sbjct: 6848911 gcggcggcggcggcgagggcttcct 6848935 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 11809089 gcggcggcggcggcgatggc 11809070 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 3338102 gcggcggcggcggcgatggc 3338121 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 2473849 gcggcggcggcggcgatggc 2473830
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 42.1 bits (21), Expect = 0.91 Identities = 24/25 (96%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggcttcct 57 ||||||||||||||||| ||||||| Sbjct: 16711475 gcggcggcggcggcgattgcttcct 16711499 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 13124267 gcggcggcggcggcgatggc 13124286 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 28 tctctgcggcggcggcggcgatgg 51 |||| ||||||||||||||||||| Sbjct: 5977093 tctcggcggcggcggcggcgatgg 5977070 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 855404 gcggcggcggcggcgatggc 855385
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 42.1 bits (21), Expect = 0.91 Identities = 21/21 (100%) Strand = Plus / Plus Query: 31 ctgcggcggcggcggcgatgg 51 ||||||||||||||||||||| Sbjct: 1163742 ctgcggcggcggcggcgatgg 1163762 Score = 42.1 bits (21), Expect = 0.91 Identities = 21/21 (100%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggct 53 ||||||||||||||||||||| Sbjct: 532954 gcggcggcggcggcgatggct 532934 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 29 ctctgcggcggcggcggcgatggc 52 ||||||||||||||||||| |||| Sbjct: 26938375 ctctgcggcggcggcggcggtggc 26938352 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 28 tctctgcggcggcggcggcg 47 |||||||||||||||||||| Sbjct: 24985472 tctctgcggcggcggcggcg 24985453 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 23155267 gcggcggcggcggcgatggc 23155248 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 14479781 gcggcggcggcggcgatggc 14479800 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 8369700 gcggcggcggcggcgatggc 8369681 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 3151044 gcggcggcggcggcgatggc 3151063
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 42.1 bits (21), Expect = 0.91 Identities = 21/21 (100%) Strand = Plus / Minus Query: 31 ctgcggcggcggcggcgatgg 51 ||||||||||||||||||||| Sbjct: 5947137 ctgcggcggcggcggcgatgg 5947117 Score = 42.1 bits (21), Expect = 0.91 Identities = 21/21 (100%) Strand = Plus / Plus Query: 27 gtctctgcggcggcggcggcg 47 ||||||||||||||||||||| Sbjct: 714923 gtctctgcggcggcggcggcg 714943 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 28 tctctgcggcggcggcggcg 47 |||||||||||||||||||| Sbjct: 32775900 tctctgcggcggcggcggcg 32775919 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 32327861 gcggcggcggcggcgatggc 32327842 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 22133603 gcggcggcggcggcgatggc 22133584 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggcttcc 56 ||||||||||||||||||| |||| Sbjct: 21041725 gcggcggcggcggcgatggtttcc 21041702 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 9165954 gcggcggcggcggcgatggc 9165973 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 71 ccccgggaaccccgacgccg 90 |||||||||||||||||||| Sbjct: 3297030 ccccgggaaccccgacgccg 3297011 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 3097863 gcggcggcggcggcgatggc 3097882 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 3073711 gcggcggcggcggcgatggc 3073730 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 31 ctgcggcggcggcggcgatg 50 |||||||||||||||||||| Sbjct: 919071 ctgcggcggcggcggcgatg 919090
>gb|AC134237.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0090O10, complete sequence Length = 162132 Score = 42.1 bits (21), Expect = 0.91 Identities = 21/21 (100%) Strand = Plus / Plus Query: 27 gtctctgcggcggcggcggcg 47 ||||||||||||||||||||| Sbjct: 10470 gtctctgcggcggcggcggcg 10490
>gb|AC121490.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBb0005F16, complete sequence Length = 160053 Score = 42.1 bits (21), Expect = 0.91 Identities = 21/21 (100%) Strand = Plus / Plus Query: 27 gtctctgcggcggcggcggcg 47 ||||||||||||||||||||| Sbjct: 100806 gtctctgcggcggcggcggcg 100826
>dbj|AP003270.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0505D12 Length = 146951 Score = 42.1 bits (21), Expect = 0.91 Identities = 21/21 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggct 53 ||||||||||||||||||||| Sbjct: 117511 gcggcggcggcggcgatggct 117531
>dbj|AP005295.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1695_D07 Length = 110585 Score = 42.1 bits (21), Expect = 0.91 Identities = 21/21 (100%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggct 53 ||||||||||||||||||||| Sbjct: 98983 gcggcggcggcggcgatggct 98963
>dbj|AP003118.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OJ1174_D05 Length = 128525 Score = 42.1 bits (21), Expect = 0.91 Identities = 21/21 (100%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggct 53 ||||||||||||||||||||| Sbjct: 125632 gcggcggcggcggcgatggct 125612
>dbj|AP003047.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0666G04 Length = 141983 Score = 42.1 bits (21), Expect = 0.91 Identities = 21/21 (100%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggct 53 ||||||||||||||||||||| Sbjct: 67435 gcggcggcggcggcgatggct 67415
>dbj|AP005308.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0047B10 Length = 158798 Score = 42.1 bits (21), Expect = 0.91 Identities = 24/25 (96%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggcttcct 57 ||||||||||||||||| ||||||| Sbjct: 60169 gcggcggcggcggcgattgcttcct 60193
>dbj|AP005575.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OJ1596_C06 Length = 124721 Score = 42.1 bits (21), Expect = 0.91 Identities = 24/25 (96%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggcttcct 57 ||||||||||||||||| ||||||| Sbjct: 119614 gcggcggcggcggcgattgcttcct 119638
>dbj|AP005652.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJNBb0015B15 Length = 123083 Score = 42.1 bits (21), Expect = 0.91 Identities = 21/21 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggct 53 ||||||||||||||||||||| Sbjct: 112072 gcggcggcggcggcgatggct 112092
>dbj|AP004754.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0529B09 Length = 138188 Score = 42.1 bits (21), Expect = 0.91 Identities = 21/21 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggct 53 ||||||||||||||||||||| Sbjct: 1494 gcggcggcggcggcgatggct 1514
>dbj|AP004236.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0417D05 Length = 165752 Score = 42.1 bits (21), Expect = 0.91 Identities = 21/21 (100%) Strand = Plus / Plus Query: 31 ctgcggcggcggcggcgatgg 51 ||||||||||||||||||||| Sbjct: 72705 ctgcggcggcggcggcgatgg 72725
>dbj|AP004342.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0585H11 Length = 149371 Score = 42.1 bits (21), Expect = 0.91 Identities = 21/21 (100%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggct 53 ||||||||||||||||||||| Sbjct: 135118 gcggcggcggcggcgatggct 135098
>dbj|AP005165.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJNBa0057M23 Length = 168029 Score = 42.1 bits (21), Expect = 0.91 Identities = 21/21 (100%) Strand = Plus / Plus Query: 31 ctgcggcggcggcggcgatgg 51 ||||||||||||||||||||| Sbjct: 65349 ctgcggcggcggcggcgatgg 65369
>dbj|AP003977.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1006_A02 Length = 175153 Score = 42.1 bits (21), Expect = 0.91 Identities = 21/21 (100%) Strand = Plus / Minus Query: 27 gtctctgcggcggcggcggcg 47 ||||||||||||||||||||| Sbjct: 153309 gtctctgcggcggcggcggcg 153289
>dbj|AK121282.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023108L12, full insert sequence Length = 2972 Score = 42.1 bits (21), Expect = 0.91 Identities = 21/21 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggct 53 ||||||||||||||||||||| Sbjct: 151 gcggcggcggcggcgatggct 171
>dbj|AK099498.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013028A11, full insert sequence Length = 2906 Score = 42.1 bits (21), Expect = 0.91 Identities = 21/21 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggct 53 ||||||||||||||||||||| Sbjct: 85 gcggcggcggcggcgatggct 105
>dbj|AK070996.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023080K08, full insert sequence Length = 1521 Score = 42.1 bits (21), Expect = 0.91 Identities = 21/21 (100%) Strand = Plus / Plus Query: 31 ctgcggcggcggcggcgatgg 51 ||||||||||||||||||||| Sbjct: 114 ctgcggcggcggcggcgatgg 134
>dbj|AK068779.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013158G10, full insert sequence Length = 1281 Score = 42.1 bits (21), Expect = 0.91 Identities = 21/21 (100%) Strand = Plus / Plus Query: 27 gtctctgcggcggcggcggcg 47 ||||||||||||||||||||| Sbjct: 385 gtctctgcggcggcggcggcg 405
>dbj|AK066124.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013057I21, full insert sequence Length = 1284 Score = 42.1 bits (21), Expect = 0.91 Identities = 21/21 (100%) Strand = Plus / Plus Query: 27 gtctctgcggcggcggcggcg 47 ||||||||||||||||||||| Sbjct: 397 gtctctgcggcggcggcggcg 417
>dbj|AK063942.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-123-E05, full insert sequence Length = 1827 Score = 42.1 bits (21), Expect = 0.91 Identities = 21/21 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggct 53 ||||||||||||||||||||| Sbjct: 385 gcggcggcggcggcgatggct 405
>dbj|AK063712.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-120-B12, full insert sequence Length = 609 Score = 42.1 bits (21), Expect = 0.91 Identities = 21/21 (100%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggct 53 ||||||||||||||||||||| Sbjct: 34 gcggcggcggcggcgatggct 14
>dbj|AK060582.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-023-H05, full insert sequence Length = 2221 Score = 42.1 bits (21), Expect = 0.91 Identities = 21/21 (100%) Strand = Plus / Minus Query: 31 ctgcggcggcggcggcgatgg 51 ||||||||||||||||||||| Sbjct: 50 ctgcggcggcggcggcgatgg 30
>dbj|AP003759.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1567_G09 Length = 121388 Score = 42.1 bits (21), Expect = 0.91 Identities = 21/21 (100%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggct 53 ||||||||||||||||||||| Sbjct: 86866 gcggcggcggcggcgatggct 86846
>gb|AF066050.1|AF066050 Oryza sativa thymidine kinase (TK) mRNA, complete cds Length = 1037 Score = 42.1 bits (21), Expect = 0.91 Identities = 21/21 (100%) Strand = Plus / Plus Query: 27 gtctctgcggcggcggcggcg 47 ||||||||||||||||||||| Sbjct: 128 gtctctgcggcggcggcggcg 148
>gb|AF101422.1|AF101422 Cichorium intybus cytochrome mRNA, partial cds Length = 336 Score = 42.1 bits (21), Expect = 0.91 Identities = 36/41 (87%) Strand = Plus / Plus Query: 96 aagatcttcaagaccaagtgcgcgcagtgccacaccgtcga 136 |||||||||||||| || ||||| || || ||||||||||| Sbjct: 49 aagatcttcaagactaaatgcgctcaatgtcacaccgtcga 89
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 42.1 bits (21), Expect = 0.91 Identities = 24/25 (96%) Strand = Plus / Plus Query: 32 tgcggcggcggcggcgatggcttcc 56 |||||||||||||||| |||||||| Sbjct: 22057121 tgcggcggcggcggcggtggcttcc 22057145 Score = 42.1 bits (21), Expect = 0.91 Identities = 24/25 (96%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggcttcct 57 |||||||||||||||| |||||||| Sbjct: 6915378 gcggcggcggcggcgagggcttcct 6915402 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 11887500 gcggcggcggcggcgatggc 11887481 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 3346807 gcggcggcggcggcgatggc 3346826 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 2481585 gcggcggcggcggcgatggc 2481566
>emb|AL606685.3|OSJN00090 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0071I13, complete sequence Length = 152264 Score = 42.1 bits (21), Expect = 0.91 Identities = 21/21 (100%) Strand = Plus / Minus Query: 31 ctgcggcggcggcggcgatgg 51 ||||||||||||||||||||| Sbjct: 47379 ctgcggcggcggcggcgatgg 47359
>gb|AE014295.3| Bifidobacterium longum NCC2705, complete genome Length = 2256640 Score = 42.1 bits (21), Expect = 0.91 Identities = 21/21 (100%) Strand = Plus / Minus Query: 40 cggcggcgatggcttccttct 60 ||||||||||||||||||||| Sbjct: 1857400 cggcggcgatggcttccttct 1857380
>gb|AC134236.4| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0056G13, complete sequence Length = 148011 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 31 ctgcggcggcggcggcgatg 50 |||||||||||||||||||| Sbjct: 74270 ctgcggcggcggcggcgatg 74289
>gb|AY633767.1| Bos taurus relaxin-3/INSL7 receptor 2 (GPCR142) mRNA, complete cds Length = 1122 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 693 gcggcggcggcggcgatggc 712
>gb|BC002822.2| Homo sapiens PHD finger protein 20-like 1, mRNA (cDNA clone IMAGE:3659595) Length = 1895 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 12 gcggcggcggcggcgatggc 31
>gb|BC106125.1| Mus musculus Nedd4 family interacting protein 2, mRNA (cDNA clone IMAGE:4457780), partial cds Length = 1715 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 29 ctctgcggcggcggcggcga 48 |||||||||||||||||||| Sbjct: 119 ctctgcggcggcggcggcga 138
>ref|NM_188289.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2106 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 184 gcggcggcggcggcgatggc 203
>gb|AC130604.4| Oryza sativa (japonica cultivar-group) chromosome 5 clone B1155G07, complete sequence Length = 146712 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 128888 gcggcggcggcggcgatggc 128869
>ref|XM_480940.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2141 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 56 gcggcggcggcggcgatggc 75
>ref|XM_475707.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1251 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 67 gcggcggcggcggcgatggc 86
>ref|XM_471040.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 900 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 17 gcggcggcggcggcgatggc 36
>ref|XM_469959.1| Oryza sativa (japonica cultivar-group), mRNA Length = 882 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 28 tctctgcggcggcggcggcg 47 |||||||||||||||||||| Sbjct: 602 tctctgcggcggcggcggcg 583
>ref|NM_185019.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1389 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 1079 gcggcggcggcggcgatggc 1098
>ref|XM_467971.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1023 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 800 gcggcggcggcggcgatggc 819
>ref|XM_467152.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1475 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 495 gcggcggcggcggcgatggc 514
>ref|XM_466580.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1068 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 14 gcggcggcggcggcgatggc 33
>ref|XM_465954.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2120 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 200 gcggcggcggcggcgatggc 219
>ref|XM_465236.1| Oryza sativa (japonica cultivar-group), mRNA Length = 852 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 565 gcggcggcggcggcgatggc 546
>ref|XM_464072.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2109 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 67 gcggcggcggcggcgatggc 48
>ref|XM_463879.1| Oryza sativa (japonica cultivar-group), mRNA Length = 3356 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 3319 gcggcggcggcggcgatggc 3300
>ref|XM_463868.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2734 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggcttcc 56 |||||||||||||||| ||||||| Sbjct: 70 gcggcggcggcggcgaaggcttcc 47
>ref|XM_518924.1| PREDICTED: Pan troglodytes similar to RIKEN cDNA 1110007L15 (LOC463209), mRNA Length = 1871 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 81 gcggcggcggcggcgatggc 100
>ref|XM_450842.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1543 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 146 gcggcggcggcggcgatggc 127
>ref|NM_197031.1| Oryza sativa (japonica cultivar-group) putative extensin (OSJNBa0093B11.1), mRNA Length = 2045 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 31 ctgcggcggcggcggcgatg 50 |||||||||||||||||||| Sbjct: 149 ctgcggcggcggcggcgatg 168
>ref|NM_183924.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1716 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 29 gcggcggcggcggcgatggc 48
>ref|NM_192768.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1728 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 122 gcggcggcggcggcgatggc 103
>ref|XM_478806.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1803 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 1670 gcggcggcggcggcgatggc 1689
>ref|NM_186849.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1317 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 305 gcggcggcggcggcgatggc 324
>ref|XM_506167.1| PREDICTED Oryza sativa (japonica cultivar-group), P0455F03.23 mRNA Length = 1205 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 78 gcggcggcggcggcgatggc 97
>ref|XM_476682.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1205 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 78 gcggcggcggcggcgatggc 97
>ref|XM_472644.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 648 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 31 ctgcggcggcggcggcgatg 50 |||||||||||||||||||| Sbjct: 17 ctgcggcggcggcggcgatg 36
>gb|AC136522.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0037H03, complete sequence Length = 185881 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 29 ctctgcggcggcggcggcga 48 |||||||||||||||||||| Sbjct: 100982 ctctgcggcggcggcggcga 100963
>gb|AC125735.1| Leishmania major strain Friedlin chromosome 3, complete sequence Length = 384518 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 309011 gcggcggcggcggcgatggc 308992
>gb|BT016049.1| Drosophila melanogaster LP18465 full insert cDNA Length = 3711 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 232 agaacaaggctgtggagtgg 251 |||||||||||||||||||| Sbjct: 1439 agaacaaggctgtggagtgg 1458
>gb|AY521594.1| Pemphigus bursarius microsatellite Pb86 sequence Length = 158 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 85 gcggcggcggcggcgatggc 104
>gb|AY016020.1| Gallus gallus alpha globin gene cluster, complete sequence Length = 103190 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 59771 gcggcggcggcggcgatggc 59790
>gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, complete genome Length = 3188609 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 2765359 gcggcggcggcggcgatggc 2765340
>gb|AC137922.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0046A04, complete sequence Length = 141001 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 10820 gcggcggcggcggcgatggc 10801
>gb|AC135558.6| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0007C02, complete sequence Length = 148265 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 85796 gcggcggcggcggcgatggc 85815
>gb|AC138196.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0032M21 map C83B, complete sequence Length = 48636 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 6951 gcggcggcggcggcgatggc 6932
>gb|AC116949.11| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0040B10 map R2918, complete sequence Length = 149132 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 125946 gcggcggcggcggcgatggc 125927
>gb|AC147812.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0073K23 map near R10571S, complete sequence Length = 161073 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 76192 gcggcggcggcggcgatggc 76173
>gb|AF247675.1| Gallus gallus bHLH transcription factor neuroAB mRNA, complete cds Length = 1575 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 52 gcggcggcggcggcgatggc 71
>gb|AC132493.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0636E04, complete sequence Length = 141171 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 28 tctctgcggcggcggcggcg 47 |||||||||||||||||||| Sbjct: 52877 tctctgcggcggcggcggcg 52896
>gb|AC132485.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0022D06, complete sequence Length = 142068 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 653 gcggcggcggcggcgatggc 634
>gb|AC120986.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1781_H11, complete sequence Length = 204649 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggcttcc 56 |||||||||||||||| ||||||| Sbjct: 14542 gcggcggcggcggcgagggcttcc 14565
>gb|AC087552.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0519E07, complete sequence Length = 151399 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 77582 gcggcggcggcggcgatggc 77601
>gb|AC148814.1| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0077J22, complete sequence Length = 173903 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 120287 gcggcggcggcggcgatggc 120268
>gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete genome Length = 2584158 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 1054321 gcggcggcggcggcgatggc 1054340
>gb|AC137002.2| Oryza sativa (japonica cultivar-group) chromosome 5 BAC clone OSJNBb0061M13, complete sequence Length = 174910 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 87969 gcggcggcggcggcgatggc 87950
>gb|AC147962.1| Oryza sativa chromosome 3 BAC OSJNBa0083K01 genomic sequence, complete sequence Length = 167239 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggcttcc 56 ||||||||||||||||||| |||| Sbjct: 36582 gcggcggcggcggcgatggtttcc 36605
>gb|AC090871.11| Oryza sativa chromosome 3 BAC OSJNBb0060J21 genomic sequence, complete sequence Length = 162497 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 28 tctctgcggcggcggcggcg 47 |||||||||||||||||||| Sbjct: 58517 tctctgcggcggcggcggcg 58498
>ref|NM_204504.2| Gallus gallus basic helix-loop-helix domain containing, class B, 4 (BHLHB4), mRNA Length = 4093 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 62 gcggcggcggcggcgatggc 81
>ref|XM_954448.1| Neurospora crassa OR74A hypothetical protein (NCU02413.1) partial mRNA Length = 1668 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 1258 gcggcggcggcggcgatggc 1277
>gb|BC003550.1| Homo sapiens chromosome 7 open reading frame 20, mRNA (cDNA clone MGC:1181 IMAGE:3546669), complete cds Length = 1313 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 38 gcggcggcggcggcgatggc 57
>ref|XM_331188.1| Neurospora crassa OR74A hypothetical protein (NCU02413.1) partial mRNA Length = 1668 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 1258 gcggcggcggcggcgatggc 1277
>gb|AY214355.1| Strumigenys formosensis isolate Sf93-3-26 internal transcribed spacer 2, complete sequence Length = 901 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 28 tctctgcggcggcggcggcg 47 |||||||||||||||||||| Sbjct: 298 tctctgcggcggcggcggcg 279
>ref|NM_026269.1| Mus musculus RIKEN cDNA 1110007L15 gene (1110007L15Rik), mRNA Length = 2055 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 94 gcggcggcggcggcgatggc 113
>ref|NM_198513.1| Homo sapiens PHD finger protein 20-like 1 (PHF20L1), transcript variant 3, mRNA Length = 3256 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 54 gcggcggcggcggcgatggc 73
>ref|NM_016018.3| Homo sapiens PHD finger protein 20-like 1 (PHF20L1), transcript variant 1, mRNA Length = 5454 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 54 gcggcggcggcggcgatggc 73
>ref|NM_032205.2| Homo sapiens PHD finger protein 20-like 1 (PHF20L1), transcript variant 2, mRNA Length = 2281 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 54 gcggcggcggcggcgatggc 73
>ref|XM_986309.1| PREDICTED: Mus musculus RIKEN cDNA 2810436B12 gene (2810436B12Rik), mRNA Length = 1448 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 29 ctctgcggcggcggcggcga 48 |||||||||||||||||||| Sbjct: 192 ctctgcggcggcggcggcga 211
>gb|AC113125.8| Mus musculus chromosome 14, clone RP23-350B18, complete sequence Length = 220629 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 29 ctctgcggcggcggcggcga 48 |||||||||||||||||||| Sbjct: 202857 ctctgcggcggcggcggcga 202876
>gb|AC125065.3| Mus musculus BAC clone RP23-430G6 from chromosome 5, complete sequence Length = 205734 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 179867 gcggcggcggcggcgatggc 179886
>gb|AC165343.3| Mus musculus BAC clone RP23-476C24 from chromosome 17, complete sequence Length = 190724 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 96 aagatcttcaagaccaagtg 115 |||||||||||||||||||| Sbjct: 85837 aagatcttcaagaccaagtg 85818
>emb|CR647282.2|CNS0EYEW Tetraodon nigroviridis full-length cDNA Length = 1171 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 27 gtctctgcggcggcggcggcgatg 50 ||||| |||||||||||||||||| Sbjct: 1023 gtctcggcggcggcggcggcgatg 1046
>emb|CR646555.2|CNS0EXUP Tetraodon nigroviridis full-length cDNA Length = 1195 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 27 gtctctgcggcggcggcggcgatg 50 ||||| |||||||||||||||||| Sbjct: 1033 gtctcggcggcggcggcggcgatg 1056
>emb|CR640597.2|CNS0ET97 Tetraodon nigroviridis full-length cDNA Length = 935 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 27 gtctctgcggcggcggcggcgatg 50 ||||| |||||||||||||||||| Sbjct: 790 gtctcggcggcggcggcggcgatg 813
>emb|CR639910.1|CNS0ESQ4 Tetraodon nigroviridis full-length cDNA Length = 1049 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 27 gtctctgcggcggcggcggcgatg 50 ||||| |||||||||||||||||| Sbjct: 901 gtctcggcggcggcggcggcgatg 924
>emb|CR636655.2|CNS0EQ7P Tetraodon nigroviridis full-length cDNA Length = 827 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 27 gtctctgcggcggcggcggcgatg 50 ||||| |||||||||||||||||| Sbjct: 681 gtctcggcggcggcggcggcgatg 704
>emb|CR634707.2|CNS0EOPL Tetraodon nigroviridis full-length cDNA Length = 1045 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 27 gtctctgcggcggcggcggcgatg 50 ||||| |||||||||||||||||| Sbjct: 883 gtctcggcggcggcggcggcgatg 906
>gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome Length = 4892717 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 29 ctctgcggcggcggcggcgatggc 52 ||||||||||||||||||| |||| Sbjct: 3235945 ctctgcggcggcggcggcgttggc 3235922
>emb|AL109825.23|HSJ148H17 Human DNA sequence from clone RP1-148H17 on chromosome 20 Contains a novel gene, complete sequence Length = 83840 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 238 aggctgtggagtgggaggag 257 |||||||||||||||||||| Sbjct: 52216 aggctgtggagtgggaggag 52197
>gb|AF479038.1| Triticum aestivum holocarboxylase synthetase mRNA, partial cds Length = 627 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 10 gcggcggcggcggcgatggc 29
>emb|CR954985.1| Human DNA sequence from clone XX-HCC1954_35K08, complete sequence Length = 164576 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 33 gcggcggcggcggcgatggc 52 |||||||||||||||||||| Sbjct: 100755 gcggcggcggcggcgatggc 100736
>emb|BX053421.1|CNS09DDT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC31AC11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 864 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 131 gtgcgcccagtgccacaccgtcga 154
>gb|AC096781.6| Oryza sativa chromosome 10 BAC OSJNBa0013H08 genomic sequence, complete sequence Length = 58293 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 34 cggcggcggcggcgatggcttcct 57 |||||||||||||||| ||||||| Sbjct: 56995 cggcggcggcggcgatcgcttcct 56972
>emb|BX071915.1|CNS09RNJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9CE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1011 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 985 gtgcgcccagtgccacaccgtcga 962
>emb|BX071914.1|CNS09RNI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9CE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1035 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 146 gtgcgcccagtgccacaccgtcga 169
>emb|BX070969.1|CNS09QX9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8BC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 718 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 90 gtgcgcccagtgccacaccgtcga 113
>emb|BX069282.1|CNS09PME Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53DE06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1030 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 1000 gtgcgcccagtgccacaccgtcga 977
>emb|BX069281.1|CNS09PMD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53DE06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1053 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 167 gtgcgcccagtgccacaccgtcga 190
>emb|BX068624.1|CNS09P44 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52DH06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 913 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 87 gtgcgcccagtgccacaccgtcga 110
>emb|BX068475.1|CNS09OZZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52DA07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 898 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 84 gtgcgcccagtgccacaccgtcga 107
>emb|BX068183.1|CNS09ORV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52BB02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 921 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 148 gtgcgcccagtgccacaccgtcga 171
>emb|BX068177.1|CNS09ORP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52BA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1036 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 167 gtgcgcccagtgccacaccgtcga 190
>emb|BX067682.1|CNS09ODY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC51BH09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1039 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 973 gtgcgcccagtgccacaccgtcga 950
>emb|BX067681.1|CNS09ODX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51BH09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 833 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 143 gtgcgcccagtgccacaccgtcga 166
>emb|BX067077.1|CNS09NX5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50CD11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 929 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 173 gtgcgcccagtgccacaccgtcga 196
>emb|BX066876.1|CNS09NRK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50BD03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 361 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 110 gtgcgcccagtgccacaccgtcga 133
>emb|BX066631.1|CNS09NKR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50AA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 872 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 102 gtgcgcccagtgccacaccgtcga 125
>emb|BX066462.1|CNS09NG2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5DB08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 952 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 203 gtgcgcccagtgccacaccgtcga 226
>ref|XM_971011.1| PREDICTED: Tribolium castaneum similar to CG17903-PA, transcript variant 2 (LOC659690), mRNA Length = 685 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||||||||||||||| ||||| Sbjct: 103 gtgcgcgcagtgccacactgtcga 126
>ref|XM_962134.1| PREDICTED: Tribolium castaneum similar to CG17903-PA, transcript variant 1 (LOC659690), mRNA Length = 823 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||||||||||||||| ||||| Sbjct: 241 gtgcgcgcagtgccacactgtcga 264
>emb|BX064776.1|CNS09M58 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC48BD10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 963 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 85 gtgcgcccagtgccacaccgtcga 108
>emb|BX064702.1|CNS09M36 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC48AH01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 541 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 96 gtgcgcccagtgccacaccgtcga 119
>emb|BX063948.1|CNS09LI8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46AB08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 927 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 177 gtgcgcccagtgccacaccgtcga 200
>emb|BX062870.1|CNS09KOA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44BE02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 218 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 141 gtgcgcccagtgccacaccgtcga 164
>emb|BX062556.1|CNS09KFK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43DF02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1024 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 111 gtgcgcccagtgccacaccgtcga 134
>emb|BX062444.1|CNS09KCG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43DA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 126 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 86 gtgcgcccagtgccacaccgtcga 109
>emb|BX060540.1|CNS09IVK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40DH01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 962 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 89 gtgcgcccagtgccacaccgtcga 112
>emb|BX060187.1|CNS09ILR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40BH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 993 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 96 gtgcgcccagtgccacaccgtcga 119
>emb|BX059922.1|CNS09IEE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40AC11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 873 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 160 gtgcgcccagtgccacaccgtcga 183
>emb|BX058941.1|CNS09HN5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC39CC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1008 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 974 gtgcgcccagtgccacaccgtcga 951
>emb|BX058940.1|CNS09HN4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39CC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1075 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 99 gtgcgcccagtgccacaccgtcga 122
>emb|BX058044.1|CNS09GY8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC38BA05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 995 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 86 gtgcgcccagtgccacaccgtcga 109
>emb|BX056581.1|CNS09FTL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC36AA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 604 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 141 gtgcgcccagtgccacaccgtcga 164
>emb|BX057319.1|CNS09GE3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC37AH05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 901 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 171 gtgcgcccagtgccacaccgtcga 194
>emb|BX057317.1|CNS09GE1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC37AH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 651 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 142 gtgcgcccagtgccacaccgtcga 165
>emb|BX056311.1|CNS09FM3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC35CB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 497 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 145 gtgcgcccagtgccacaccgtcga 168
>emb|BX056281.1|CNS09FL9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC35CA06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 945 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 153 gtgcgcccagtgccacaccgtcga 176
>emb|BX055389.1|CNS09EWH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC34AA03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 960 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 136 gtgcgcccagtgccacaccgtcga 159
>emb|BX053158.1|CNS09D6I Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC30CG08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 639 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 86 gtgcgcccagtgccacaccgtcga 109
>emb|BX053121.1|CNS09D5H Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC30CE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 438 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 79 gtgcgcccagtgccacaccgtcga 102
>emb|BX054542.1|CNS09E8Y Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC32DA04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 560 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 88 gtgcgcccagtgccacaccgtcga 111
>emb|BX050064.1|CNS09ASK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC26BB12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 751 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 85 gtgcgcccagtgccacaccgtcga 108
>emb|BX049798.1|CNS09AL6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC25DF06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 922 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 91 gtgcgcccagtgccacaccgtcga 114
>emb|BX030986.1|CNS08W2M Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA46BA05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1010 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 153 gtgcgcccagtgccacaccgtcga 176
>emb|BX047063.1|CNS098H7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC21AC06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 451 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 127 gtgcgcccagtgccacaccgtcga 150
>emb|BX045298.1|CNS09746 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC19BE09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1016 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 166 gtgcgcccagtgccacaccgtcga 189
>emb|BX044250.1|CNS096B2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC17CH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1007 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 67 gtgcgcccagtgccacaccgtcga 90
>emb|BX043389.1|CNS095N5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC15DH05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1013 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 167 gtgcgcccagtgccacaccgtcga 190
>emb|BX043131.1|CNS095FZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC15CB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 804 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 130 gtgcgcccagtgccacaccgtcga 153
>emb|BX042263.1|CNS094RV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC14BA01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 432 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 135 gtgcgcccagtgccacaccgtcga 158
>emb|BX040807.1|CNS093NF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC11DD02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 681 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 44 gtgcgcccagtgccacaccgtcga 67
>emb|BX040776.1|CNS093MK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC11DB09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 149 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 87 gtgcgcccagtgccacaccgtcga 110
>emb|BX040505.1|CNS093F1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC11BE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 870 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 73 gtgcgcccagtgccacaccgtcga 96
>emb|BX036756.1|CNS090IW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA8DF07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1038 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 151 gtgcgcccagtgccacaccgtcga 174
>emb|BX036716.1|CNS090HS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA8DD11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1083 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 151 gtgcgcccagtgccacaccgtcga 174
>emb|BX036850.1|CNS090LI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA9AC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 983 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 975 gtgcgcccagtgccacaccgtcga 952
>emb|BX036849.1|CNS090LH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA9AC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 984 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 151 gtgcgcccagtgccacaccgtcga 174
>emb|BX036068.1|CNS08ZZS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA7CH09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 973 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 47 gtgcgcccagtgccacaccgtcga 70
>emb|BX036055.1|CNS08ZZF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA7CG11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 836 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 145 gtgcgcccagtgccacaccgtcga 168
>emb|BX035092.1|CNS08Z8O Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA6BB08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 890 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 140 gtgcgcccagtgccacaccgtcga 163
>emb|BX033449.1|CNS08XZ1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA49DG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 935 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 925 gtgcgcccagtgccacaccgtcga 902
>emb|BX032226.1|CNS08X12 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA48AA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1002 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 995 gtgcgcccagtgccacaccgtcga 972
>emb|BX032225.1|CNS08X11 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA48AA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 932 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 100 gtgcgcccagtgccacaccgtcga 123
>emb|BX031974.1|CNS08WU2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA47CE09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 987 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 97 gtgcgcccagtgccacaccgtcga 120
>emb|BX030339.1|CNS08VKN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA45BB11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1000 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 92 gtgcgcccagtgccacaccgtcga 115
>emb|BX027834.1|CNS08TN2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA41CF03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 904 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 85 gtgcgcccagtgccacaccgtcga 108
>emb|BX027739.1|CNS08TKF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA41CA05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 976 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 972 gtgcgcccagtgccacaccgtcga 949
>emb|BX027738.1|CNS08TKE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA41CA05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 896 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 147 gtgcgcccagtgccacaccgtcga 170
>emb|BX026467.1|CNS08SL3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA4DA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 896 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 141 gtgcgcccagtgccacaccgtcga 164
>emb|BX026219.1|CNS08SE7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA4BF11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 833 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 92 gtgcgcccagtgccacaccgtcga 115
>emb|BX025595.1|CNS08RWV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA39BA04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 955 Score = 40.1 bits (20), Expect = 3.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 gtgcgcgcagtgccacaccgtcga 136 |||||| ||||||||||||||||| Sbjct: 144 gtgcgcccagtgccacaccgtcga 167 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,907,598 Number of Sequences: 3902068 Number of extensions: 2907598 Number of successful extensions: 232263 Number of sequences better than 10.0: 461 Number of HSP's better than 10.0 without gapping: 511 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 197209 Number of HSP's gapped (non-prelim): 34960 length of query: 277 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 255 effective length of database: 17,147,199,772 effective search space: 4372535941860 effective search space used: 4372535941860 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
