ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags6p11
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1dbj|AB022059.1| Aegilops crassa mitochondrial gene for ORF48, OR... 149 1e-33
2emb|X67242.1|TAMITS7 T.aestivum mitochondrial gene for S7 riboso... 141 3e-31
3dbj|AP008982.1| Triticum aestivum mitochondrial DNA, complete ge... 141 3e-31
4emb|Z11889.1|MITTARRNG T.aestivum mitochondrion rrn26 gene for r... 54 5e-05
5gb|M37274.1|WHTMT26SRR Wheat mitochondrial 26S rRNA gene, comple... 54 5e-05
6ref|XM_632242.1| Dictyostelium discoideum hypothetical protein (... 42 0.21
7emb|Z14078.1|MISCREPU2 T.aestivum mitochondrion fMet, 18S, 5S re... 40 0.82
8emb|Z14059.1|MISCREPU3 S.cereale mitochondrion fMet, 18S, 5S rep... 40 0.82
9gb|AC163903.4| Mus musculus BAC clone RP24-314J18 from chromosom... 38 3.2
10gb|DQ490953.1| Zea mays subsp. mays genotype CMS-T mitochondrion... 38 3.2
11gb|AC109364.6| Mus musculus BAC clone RP23-127N24 from chromosom... 38 3.2
12gb|AC093538.2| Homo sapiens chromosome 5 clone RP11-99I23, compl... 38 3.2
13gb|AC010349.7|AC010349 Homo sapiens chromosome 5 clone CTD-2020O... 38 3.2
14emb|AL954231.3|PTB144O12 Pan troglodytes chromosome 22 BAC PTB-1... 38 3.2
15emb|AL954232.2|RP43039B12 Pan troglodytes chromosome 22 BAC RP43... 38 3.2
16emb|AL954233.1|RP43116M22 Pan troglodytes chromosome 22 BAC RP43... 38 3.2
17gb|U38309.1|SBU38309 Sorghum bicolor hypothetical URF107 mRNA, c... 38 3.2 
>dbj|AB022059.1| Aegilops crassa mitochondrial gene for ORF48, ORF25, CLPP
          Length = 2392

 Score =  149 bits (75), Expect = 1e-33
 Identities = 78/79 (98%)
 Strand = Plus / Plus

                                                                       
Query: 1   gtatggtactttttcttcaaatctcgattgtgtgggtgtccgctcatgttcacgttacat 60
           |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 759 gtatggtactttttcttccaatctcgattgtgtgggtgtccgctcatgttcacgttacat 818

                              
Query: 61  gctaaatcaggctttcctt 79
           |||||||||||||||||||
Sbjct: 819 gctaaatcaggctttcctt 837
to top
>emb|X67242.1|TAMITS7 T.aestivum mitochondrial gene for S7 ribosomal protein
          Length = 1538

 Score =  141 bits (71), Expect = 3e-31
 Identities = 77/79 (97%)
 Strand = Plus / Plus

                                                                       
Query: 1   gtatggtactttttcttcaaatctcgattgtgtgggtgtccgctcatgttcacgttacat 60
           |||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||
Sbjct: 271 gtatggtactttttcttcaaatcgagattgtgtgggtgtccgctcatgttcacgttacat 330

                              
Query: 61  gctaaatcaggctttcctt 79
           |||||||||||||||||||
Sbjct: 331 gctaaatcaggctttcctt 349
to top
>dbj|AP008982.1| Triticum aestivum mitochondrial DNA, complete genome
          Length = 452528

 Score =  141 bits (71), Expect = 3e-31
 Identities = 77/79 (97%)
 Strand = Plus / Minus

                                                                          
Query: 1      gtatggtactttttcttcaaatctcgattgtgtgggtgtccgctcatgttcacgttacat 60
              |||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||
Sbjct: 380257 gtatggtactttttcttcaaatcgagattgtgtgggtgtccgctcatgttcacgttacat 380198

                                 
Query: 61     gctaaatcaggctttcctt 79
              |||||||||||||||||||
Sbjct: 380197 gctaaatcaggctttcctt 380179



 Score = 54.0 bits (27), Expect = 5e-05
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                                 
Query: 17     tcaaatctcgattgtgtgggtgtccgctcatgttc 51
              |||||||  ||||||||||||||||||||||||||
Sbjct: 374736 tcaaatcgagattgtgtgggtgtccgctcatgttc 374702



 Score = 54.0 bits (27), Expect = 5e-05
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                                 
Query: 17     tcaaatctcgattgtgtgggtgtccgctcatgttc 51
              |||||||  ||||||||||||||||||||||||||
Sbjct: 262998 tcaaatcgagattgtgtgggtgtccgctcatgttc 262964



 Score = 54.0 bits (27), Expect = 5e-05
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                                 
Query: 17     tcaaatctcgattgtgtgggtgtccgctcatgttc 51
              |||||||  ||||||||||||||||||||||||||
Sbjct: 171101 tcaaatcgagattgtgtgggtgtccgctcatgttc 171067



 Score = 40.1 bits (20), Expect = 0.82
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 12     tttcttcaaatctcgattgtgtgggtgt 39
              |||| ||||||| |||||||||||||||
Sbjct: 393100 tttcatcaaatcccgattgtgtgggtgt 393073



 Score = 40.1 bits (20), Expect = 0.82
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 12     tttcttcaaatctcgattgtgtgggtgt 39
              |||| ||||||| |||||||||||||||
Sbjct: 303464 tttcatcaaatcccgattgtgtgggtgt 303491



 Score = 40.1 bits (20), Expect = 0.82
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 12    tttcttcaaatctcgattgtgtgggtgt 39
             |||| ||||||| |||||||||||||||
Sbjct: 56132 tttcatcaaatcccgattgtgtgggtgt 56105
to top
>emb|Z11889.1|MITTARRNG T.aestivum mitochondrion rrn26 gene for rRNA large subunit (26S)
          Length = 7242

 Score = 54.0 bits (27), Expect = 5e-05
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                               
Query: 17   tcaaatctcgattgtgtgggtgtccgctcatgttc 51
            |||||||  ||||||||||||||||||||||||||
Sbjct: 2771 tcaaatcgagattgtgtgggtgtccgctcatgttc 2805
to top
>gb|M37274.1|WHTMT26SRR Wheat mitochondrial 26S rRNA gene, complete cds
          Length = 4103

 Score = 54.0 bits (27), Expect = 5e-05
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 17  tcaaatctcgattgtgtgggtgtccgctcatgttc 51
           |||||||  ||||||||||||||||||||||||||
Sbjct: 435 tcaaatcgagattgtgtgggtgtccgctcatgttc 469
to top
>ref|XM_632242.1| Dictyostelium discoideum hypothetical protein (DDB0219207), partial
            mRNA
          Length = 2265

 Score = 42.1 bits (21), Expect = 0.21
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 9    ctttttcttcaaatctcgatt 29
            |||||||||||||||||||||
Sbjct: 2210 ctttttcttcaaatctcgatt 2230
to top
>emb|Z14078.1|MISCREPU2 T.aestivum mitochondrion fMet, 18S, 5S repeat unit DNA
          Length = 6251

 Score = 40.1 bits (20), Expect = 0.82
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 12   tttcttcaaatctcgattgtgtgggtgt 39
            |||| ||||||| |||||||||||||||
Sbjct: 3410 tttcatcaaatcccgattgtgtgggtgt 3437
to top
>emb|Z14059.1|MISCREPU3 S.cereale mitochondrion fMet, 18S, 5S repeat unit DNA
          Length = 3389

 Score = 40.1 bits (20), Expect = 0.82
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 12   tttcttcaaatctcgattgtgtgggtgt 39
            |||| ||||||| |||||||||||||||
Sbjct: 3182 tttcatcaaatcccgattgtgtgggtgt 3209
to top
>gb|AC163903.4| Mus musculus BAC clone RP24-314J18 from chromosome 17, complete sequence
          Length = 197522

 Score = 38.2 bits (19), Expect = 3.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 26     gattgtgtgggtgtccgct 44
              |||||||||||||||||||
Sbjct: 154507 gattgtgtgggtgtccgct 154489
to top
>gb|DQ490953.1| Zea mays subsp. mays genotype CMS-T mitochondrion, complete genome
          Length = 535825

 Score = 38.2 bits (19), Expect = 3.2
 Identities = 28/31 (90%)
 Strand = Plus / Plus

                                           
Query: 26   gattgtgtgggtgtccgctcatgttcacgtt 56
            |||||||||||||| |  |||||||||||||
Sbjct: 1912 gattgtgtgggtgttcagtcatgttcacgtt 1942
to top
>gb|AC109364.6| Mus musculus BAC clone RP23-127N24 from chromosome 17, complete sequence
          Length = 198838

 Score = 38.2 bits (19), Expect = 3.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 26     gattgtgtgggtgtccgct 44
              |||||||||||||||||||
Sbjct: 166126 gattgtgtgggtgtccgct 166144
to top
>gb|AC093538.2| Homo sapiens chromosome 5 clone RP11-99I23, complete sequence
          Length = 200500

 Score = 38.2 bits (19), Expect = 3.2
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 54    gttacatgctaaatcaggctttc 76
             |||||||||||| ||||||||||
Sbjct: 18202 gttacatgctaattcaggctttc 18180
to top
>gb|AC010349.7|AC010349 Homo sapiens chromosome 5 clone CTD-2020O7, complete sequence
          Length = 165967

 Score = 38.2 bits (19), Expect = 3.2
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 54    gttacatgctaaatcaggctttc 76
             |||||||||||| ||||||||||
Sbjct: 69335 gttacatgctaattcaggctttc 69313
to top
>emb|AL954231.3|PTB144O12 Pan troglodytes chromosome 22 BAC PTB-144O12, complete sequence
          Length = 180638

 Score = 38.2 bits (19), Expect = 3.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 19     aaatctcgattgtgtgggt 37
              |||||||||||||||||||
Sbjct: 163104 aaatctcgattgtgtgggt 163122
to top
>emb|AL954232.2|RP43039B12 Pan troglodytes chromosome 22 BAC RP43-039B12, complete sequence
          Length = 201761

 Score = 38.2 bits (19), Expect = 3.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 19     aaatctcgattgtgtgggt 37
              |||||||||||||||||||
Sbjct: 171313 aaatctcgattgtgtgggt 171331
to top
>emb|AL954233.1|RP43116M22 Pan troglodytes chromosome 22 BAC RP43-116M22, complete sequence
          Length = 163163

 Score = 38.2 bits (19), Expect = 3.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 19    aaatctcgattgtgtgggt 37
             |||||||||||||||||||
Sbjct: 56663 aaatctcgattgtgtgggt 56681
to top
>gb|U38309.1|SBU38309 Sorghum bicolor hypothetical URF107 mRNA, complete cds
          Length = 1514

 Score = 38.2 bits (19), Expect = 3.2
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 17  tcaaatctcgattgtgtgggtgt 39
           |||||||| ||||||||||||||
Sbjct: 495 tcaaatctagattgtgtgggtgt 517


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 764,812
Number of Sequences: 3902068
Number of extensions: 764812
Number of successful extensions: 50961
Number of sequences better than 10.0: 17
Number of HSP's better than 10.0 without gapping: 17
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 50923
Number of HSP's gapped (non-prelim): 38
length of query: 79
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 58
effective length of database: 17,151,101,840
effective search space: 994763906720
effective search space used: 994763906720
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top