ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags6n19
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY106339.1| Zea mays PCO078628 mRNA sequence 303 4e-79
2gb|BT019121.1| Zea mays clone Contig733.F mRNA sequence 297 2e-77
3ref|XM_474417.1| Oryza sativa (japonica cultivar-group), predic... 258 2e-65
4dbj|AK065262.1| Oryza sativa (japonica cultivar-group) cDNA clon... 258 2e-65
5ref|XM_550620.1| Oryza sativa (japonica cultivar-group), mRNA 198 2e-47
6gb|BT018675.1| Zea mays clone EL01N0510H04.d mRNA sequence 194 2e-46
7dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 113 7e-22
8dbj|AP000399.1| Oryza sativa (japonica cultivar-group) genomic D... 113 7e-22
9dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 94 6e-16
10emb|AL732343.2| Oryza sativa genomic DNA, chromosome 4, BAC clon... 94 6e-16
11emb|AL606651.3|OSJN00092 Oryza sativa genomic DNA, chromosome 4,... 94 6e-16
12ref|NM_129356.2| Arabidopsis thaliana unknown protein AT2G37990 ... 62 2e-06
13dbj|AK222003.1| Arabidopsis thaliana mRNA for hypothetical prote... 62 2e-06
14gb|AY088030.1| Arabidopsis thaliana clone 40538 mRNA, complete s... 62 2e-06
15gb|AC007661.2|AC007661 Arabidopsis thaliana chromosome II sectio... 62 2e-06
16gb|AC003013.1|AC003013 Human PAC clone RP1-205E24 from Xq23, com... 48 0.034
17gb|BC027996.1| Homo sapiens ADAM metallopeptidase domain 9 (melt... 44 0.54
18emb|AL512504.9| Human DNA sequence from clone RP11-325E14 on chr... 44 0.54
19gb|AC163439.3| Mus musculus chromosome 8, clone RP23-390F12, com... 44 0.54
20gb|AC108863.4| Homo sapiens chromosome 8, clone CTD-2544N14, com... 44 0.54
21emb|CR591969.1| full-length cDNA clone CS0DD003YM01 of Neuroblas... 44 0.54
22gb|AC117665.6| Mus musculus chromosome 8, clone RP23-360I9, comp... 44 0.54
23ref|XM_580731.2| PREDICTED: Bos taurus similar to Sperm-associat... 42 2.1
24gb|AC151742.9| Medicago truncatula clone mth2-83e4, complete seq... 42 2.1
25gb|AC138451.15| Medicago truncatula clone mth2-24k1, complete se... 42 2.1
26gb|AC146909.23| Medicago truncatula clone mth2-57e16, complete s... 42 2.1
27gb|DQ133396.1| Elimia olivula isolate CAH-9 cytochrome c oxidase... 42 2.1
28gb|DQ133392.1| Elimia cahawbensis isolate CAH-13 cytochrome c ox... 42 2.1
29gb|DQ133389.1| Elimia annettae isolate CAH-10 cytochrome c oxida... 42 2.1
30ref|XM_783521.1| PREDICTED: Strongylocentrotus purpuratus simila... 42 2.1
31gb|AY161723.1| Cypraea pantherina isolate BJLinnSoc_111 cytochro... 42 2.1
32gb|AC158762.4| Mus musculus chromosome 1, clone RP24-255O19, com... 42 2.1
33emb|AL033522.1|HS451B21 Human DNA sequence from clone RP3-451B21... 42 2.1
34gb|AC110042.12| Mus musculus chromosome 1, clone RP23-278C6, com... 42 2.1
35emb|AL731855.19| Mouse DNA sequence from clone RP23-107N13 on ch... 42 2.1
36gb|DQ207141.1| Cypraea pantherina haplotype Massawa_2854 cytochr... 42 2.1
37gb|AC138587.11| Mus musculus chromosome 9, clone RP24-160H16, co... 42 2.1
38gb|AC171175.1| Mus musculus chromosome 19, clone wi1-1715L8, com... 40 8.4
39gb|AC162379.2| Mus musculus BAC clone RP23-132A15 from chromosom... 40 8.4
40gb|AC135720.8| Mus musculus chromosome 15, clone RP24-298F20, co... 40 8.4
41gb|AF288738.1| Homo sapiens epidermal growth factor receptor (EG... 40 8.4
42gb|AC147557.4| Mus musculus BAC clone RP23-452M8 from chromosome... 40 8.4
43gb|DP000012.1| Macropus eugenii target 1 genomic scaffold 40 8.4
44gb|AC158527.2| Mus musculus BAC clone RP23-266E16 from chromosom... 40 8.4
45ref|XM_846692.1| PREDICTED: Canis familiaris similar to bromodom... 40 8.4
46ref|XM_823468.1| Trypanosoma brucei TREU927 hypothetical protein... 40 8.4
47emb|CT009546.4| Mouse DNA sequence from clone RP23-111H19 on chr... 40 8.4
48gb|AC116319.4| Mus musculus BAC clone RP23-265J2 from chromosome... 40 8.4
49gb|AC127371.3| Mus musculus BAC clone RP23-35D4 from 15, complet... 40 8.4
50gb|AC122191.4| Mus musculus BAC clone RP23-42J4 from 6, complete... 40 8.4
51gb|AC116138.21| Mus musculus chromosome 10, clone RP23-123D17, c... 40 8.4
52ref|XM_718550.1| Plasmodium yoelii yoelii str. 17XNL hypothetica... 40 8.4
53ref|XM_738389.1| Plasmodium chabaudi chabaudi hypothetical prote... 40 8.4
54gb|AY327116.1| Homo sapiens laminin alpha 3 splice variant b2 (L... 40 8.4
55gb|AY327115.1| Homo sapiens laminin alpha 3 splice variant b1 (L... 40 8.4
56gb|AY327114.1| Homo sapiens laminin alpha 3 splice variant a (LA... 40 8.4
57emb|AL451137.8| Human DNA sequence from clone RP11-18A15 on chro... 40 8.4
58emb|AL390776.16| Human DNA sequence from clone RP11-182I23 on ch... 40 8.4
59gb|AY302574.2| Thunnus thynnus thynnus mitochondrion, complete g... 40 8.4
60gb|AC117633.6| Mus musculus, clone RP23-200C8, complete sequence 40 8.4
61gb|AF197152.1| Acanthocybium solandri isolate Bim15B cytochrome ... 40 8.4
62gb|AF197149.1| Acanthocybium solandri isolate Wah65 cytochrome b... 40 8.4
63emb|X85108.1|HSA3BLAMN H.sapiens mRNA for laminin alpha 3b chain 40 8.4
64emb|X85107.1|HSA3ALAMN H.sapiens mRNA for laminin alpha 3a chain 40 8.4
65emb|X84900.1|HSL5A3BC H.sapiens mRNA for laminin-5, alpha3b chain 40 8.4
66gb|AC163356.2| Mus musculus BAC clone RP23-13A21 from chromosome... 40 8.4
67gb|AC108688.5| Homo sapiens 3 BAC RP11-775J23 (Roswell Park Canc... 40 8.4
68gb|AC016587.9| Homo sapiens chromosome 19 clone CTD-2632B17, com... 40 8.4
69gb|AC100860.2| Homo sapiens chromosome 8, clone RP11-128L5, comp... 40 8.4
70gb|AC087224.13| Homo sapiens chromosome 18, clone RP11-52C21, co... 40 8.4
71dbj|AP007162.1| Aspergillus oryzae RIB40 genomic DNA, SC102 40 8.4
72gb|AC107021.4| Homo sapiens 3 BAC RP11-274H2 (Roswell Park Cance... 40 8.4
73gb|AC010614.8| Homo sapiens chromosome 19 clone CTD-2518G19, com... 40 8.4
74gb|AC010754.10| Homo sapiens chromosome 18, clone RP11-403A21, c... 40 8.4
75ref|NM_000227.2| Homo sapiens laminin, alpha 3 (LAMA3), transcri... 40 8.4
76ref|NM_198129.1| Homo sapiens laminin, alpha 3 (LAMA3), transcri... 40 8.4
77gb|CP000254.1| Methanospirillum hungatei JF-1, complete genome 40 8.4
78emb|CR406712.1| Gallus gallus finished cDNA, clone ChEST990p13 40 8.4
79gb|AC159295.2| Mus musculus BAC clone RP23-273L18 from chromosom... 40 8.4
80gb|AC154441.3| Mus musculus BAC clone RP24-176O5 from chromosome... 40 8.4
81gb|AC154824.2| Mus musculus BAC clone RP24-540A17 from chromosom... 40 8.4
82gb|AF330048.1|AF330048 Mus musculus chromosome 13 clone CITB-332... 40 8.4
83dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.4
84dbj|AB107369.1| Homo sapiens LAMA3 gene for laminin alpha 3b cha... 40 8.4
85gb|AC025041.7|AC025041 Homo sapiens chromosome 15 clone RP11-316... 40 8.4
86gb|AC006977.3|AC006977 Homo sapiens PAC clone RP5-1091E12 from 7... 40 8.4
87gb|BC043618.1| Homo sapiens, Similar to laminin, alpha 3, clone ... 40 8.4
88gb|AC145409.3| Macropus eugenii clone ME_KBa-528O13, complete se... 40 8.4
89dbj|AP006060.3| Oryza sativa (japonica cultivar-group) genomic D... 40 8.4
90dbj|AP005775.3| Oryza sativa (japonica cultivar-group) genomic D... 40 8.4
91dbj|AB167978.1| Human coxsackievirus A9 VP1 gene for capsid prot... 40 8.4
92dbj|AB097669.1| Thunnus thynnus thynnus mitochondrial DNA, compl... 40 8.4
93dbj|AB107082.1| Auxis thazard genes for tRNA-Thr, tRNA-Pro, D-lo... 40 8.4
94dbj|AB107081.1| Auxis rochei genes for tRNA-Thr, tRNA-Pro, D-loo... 40 8.4
95dbj|AB107080.1| Auxis rochei genes for tRNA-Thr, tRNA-Pro, D-loo... 40 8.4
96dbj|AB107079.1| Auxis rochei genes for tRNA-Thr, tRNA-Pro, D-loo... 40 8.4
97dbj|AB107078.1| Auxis rochei genes for tRNA-Thr, tRNA-Pro, D-loo... 40 8.4
98dbj|AB107077.1| Auxis rochei genes for tRNA-Thr, tRNA-Pro, D-loo... 40 8.4
99dbj|AB107076.1| Auxis rochei genes for tRNA-Thr, tRNA-Pro, D-loo... 40 8.4
100dbj|AB107075.1| Auxis rochei genes for tRNA-Thr, tRNA-Pro, D-loo... 40 8.4
101dbj|AB107074.1| Auxis rochei genes for tRNA-Thr, tRNA-Pro, D-loo... 40 8.4
102dbj|AB107073.1| Auxis rochei genes for tRNA-Thr, tRNA-Pro, D-loo... 40 8.4
103dbj|AB107072.1| Auxis rochei genes for tRNA-Thr, tRNA-Pro, D-loo... 40 8.4
104dbj|AB107071.1| Auxis rochei genes for tRNA-Thr, tRNA-Pro, D-loo... 40 8.4
105dbj|AB107070.1| Auxis rochei genes for tRNA-Thr, tRNA-Pro, D-loo... 40 8.4
106dbj|AB107069.1| Auxis rochei genes for tRNA-Thr, tRNA-Pro, D-loo... 40 8.4
107dbj|AB107068.1| Auxis rochei genes for tRNA-Thr, tRNA-Pro, D-loo... 40 8.4
108dbj|AB107067.1| Auxis rochei genes for tRNA-Thr, tRNA-Pro, D-loo... 40 8.4
109dbj|AB107066.1| Auxis rochei genes for tRNA-Thr, tRNA-Pro, D-loo... 40 8.4
110dbj|AB107065.1| Auxis rochei genes for tRNA-Thr, tRNA-Pro, D-loo... 40 8.4
111dbj|AB107064.1| Auxis rochei genes for tRNA-Thr, tRNA-Pro, D-loo... 40 8.4
112dbj|AB107063.1| Auxis rochei genes for tRNA-Thr, tRNA-Pro, D-loo... 40 8.4
113dbj|AB107062.1| Auxis rochei genes for tRNA-Thr, tRNA-Pro, D-loo... 40 8.4
114dbj|AB107061.1| Auxis rochei genes for tRNA-Thr, tRNA-Pro, D-loo... 40 8.4
115dbj|AB107060.1| Auxis rochei genes for tRNA-Thr, tRNA-Pro, D-loo... 40 8.4
116dbj|AB107058.1| Auxis rochei genes for tRNA-Thr, tRNA-Pro, D-loo... 40 8.4
117dbj|AB107057.1| Auxis rochei genes for tRNA-Thr, tRNA-Pro, D-loo... 40 8.4
118dbj|AB107056.1| Auxis rochei genes for tRNA-Thr, tRNA-Pro, D-loo... 40 8.4
119dbj|AB107055.1| Auxis rochei genes for tRNA-Thr, tRNA-Pro, D-loo... 40 8.4
120dbj|AB107054.1| Auxis rochei genes for tRNA-Thr, tRNA-Pro, D-loo... 40 8.4
121dbj|AB105447.1| Auxis thazard mitochondrial DNA, complete genome 40 8.4
122dbj|AB105165.1| Auxis rochei mitochondrial DNA, complete genome,... 40 8.4
123dbj|AB103468.1| Auxis rochei mitochondrial DNA, complete genome,... 40 8.4
124dbj|AB103467.1| Auxis rochei mitochondrial DNA, complete genome,... 40 8.4
125dbj|AB101291.1| Thunnus alalunga mitochondrial DNA, complete genome 40 8.4
126dbj|AB101290.1| Katsuwonus pelamis mitochondrial DNA, complete g... 40 8.4
127dbj|AB106311.1| Thunnus thynnus thynnus mitochondrial genes for ... 40 8.4
128dbj|AB106310.1| Thunnus thynnus thynnus mitochondrial genes for ... 40 8.4
129dbj|AB106309.1| Thunnus thynnus thynnus mitochondrial genes for ... 40 8.4
130dbj|AB106308.1| Thunnus thynnus thynnus mitochondrial genes for ... 40 8.4
131dbj|AB106307.1| Thunnus thynnus thynnus mitochondrial genes for ... 40 8.4
132dbj|AB106306.1| Thunnus thynnus thynnus mitochondrial genes for ... 40 8.4
133dbj|AB106305.1| Thunnus thynnus thynnus mitochondrial genes for ... 40 8.4
134dbj|AB106304.1| Thunnus thynnus thynnus mitochondrial genes for ... 40 8.4
135dbj|AB106303.1| Thunnus thynnus thynnus mitochondrial genes for ... 40 8.4
136dbj|AB106302.1| Thunnus thynnus thynnus mitochondrial genes for ... 40 8.4
137dbj|AB106301.1| Thunnus thynnus thynnus mitochondrial genes for ... 40 8.4
138dbj|AB106300.1| Thunnus thynnus thynnus mitochondrial genes for ... 40 8.4
139dbj|AB106299.1| Thunnus thynnus thynnus mitochondrial genes for ... 40 8.4
140dbj|AB106298.1| Thunnus thynnus thynnus mitochondrial genes for ... 40 8.4
141dbj|AB106297.1| Thunnus thynnus thynnus mitochondrial genes for ... 40 8.4
142dbj|AB106296.1| Thunnus thynnus thynnus mitochondrial genes for ... 40 8.4
143dbj|AB106295.1| Thunnus thynnus thynnus mitochondrial genes for ... 40 8.4
144dbj|AB106294.1| Thunnus thynnus thynnus mitochondrial genes for ... 40 8.4
145dbj|AB106293.1| Thunnus thynnus thynnus mitochondrial genes for ... 40 8.4
146dbj|AB106292.1| Thunnus thynnus thynnus mitochondrial genes for ... 40 8.4
147dbj|AB106291.1| Thunnus thynnus thynnus mitochondrial genes for ... 40 8.4
148dbj|AB106290.1| Thunnus thynnus thynnus mitochondrial genes for ... 40 8.4
149dbj|AB106289.1| Thunnus thynnus thynnus mitochondrial genes for ... 40 8.4
150dbj|AB106288.1| Thunnus thynnus thynnus mitochondrial genes for ... 40 8.4
151dbj|AB106287.1| Thunnus thynnus thynnus mitochondrial genes for ... 40 8.4
152dbj|AB106286.1| Thunnus thynnus thynnus mitochondrial genes for ... 40 8.4
153dbj|AB106285.1| Thunnus thynnus thynnus mitochondrial genes for ... 40 8.4
154dbj|AB106284.1| Thunnus thynnus thynnus mitochondrial genes for ... 40 8.4
155dbj|AB106283.1| Thunnus thynnus thynnus mitochondrial genes for ... 40 8.4
156gb|AC004254.1|AC004254 Homo sapiens BAC clone CTB-158K20 from 1p... 40 8.4
157emb|AL442639.2|HS5P15 Homo sapiens chromosome 9 BAC RP11-5P15, c... 40 8.4
158gb|AE001437.1| Clostridium acetobutylicum ATCC 824, complete genome 40 8.4
159dbj|AK064865.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 8.4
160gb|AY193545.1|AY193545S1 Lactuca sativa clone TDM resistance pro... 40 8.4
161gb|AC110216.10| Mus musculus chromosome 18, clone RP24-502I6, co... 40 8.4
162gb|AE015924.1| Porphyromonas gingivalis W83, complete genome 40 8.4
163gb|AC109616.9| Mus musculus chromosome 19, clone RP23-449C1, com... 40 8.4
164dbj|AB099716.1| Euthynnus alletteratus mitochondrial DNA, comple... 40 8.4
165gb|AC148326.2| Mus musculus BAC clone RP24-377D18 from 6, comple... 40 8.4
166dbj|AB208853.1| Homo sapiens mRNA for Laminin alpha 3b chain var... 40 8.4
167gb|U27463.1|CGU27463 Cricetinae gen. sp. CPP-32 mRNA, complete cds 40 8.4
168dbj|AB119171.1| Auxis rochei mitochondrial genes for tRNA-Thr, t... 40 8.4
169dbj|AB119170.1| Auxis rochei mitochondrial genes for tRNA-Thr, t... 40 8.4
170dbj|AB119169.1| Auxis rochei mitochondrial genes for tRNA-Thr, t... 40 8.4
171dbj|AB119168.1| Auxis rochei mitochondrial genes for tRNA-Thr, t... 40 8.4
172dbj|AB119167.1| Auxis rochei mitochondrial genes for tRNA-Thr, t... 40 8.4
173dbj|AB119166.1| Auxis rochei mitochondrial genes for tRNA-Thr, t... 40 8.4
174dbj|AB119165.1| Auxis rochei mitochondrial genes for tRNA-Thr, t... 40 8.4
175dbj|AB119164.1| Auxis rochei mitochondrial genes for tRNA-Thr, t... 40 8.4
176dbj|AB119163.1| Auxis rochei mitochondrial genes for tRNA-Thr, t... 40 8.4
177dbj|AB119162.1| Auxis rochei mitochondrial genes for tRNA-Thr, t... 40 8.4
178dbj|AB119161.1| Auxis rochei mitochondrial genes for tRNA-Thr, t... 40 8.4
179dbj|AB119160.1| Auxis rochei mitochondrial genes for tRNA-Thr, t... 40 8.4
180dbj|AB119159.1| Auxis rochei mitochondrial genes for tRNA-Thr, t... 40 8.4
181dbj|AB119158.1| Auxis rochei mitochondrial genes for tRNA-Thr, t... 40 8.4
182dbj|AB119157.1| Auxis rochei mitochondrial genes for tRNA-Thr, t... 40 8.4
183dbj|AB119156.1| Auxis rochei mitochondrial genes for tRNA-Thr, t... 40 8.4
184dbj|AB119155.1| Auxis rochei mitochondrial genes for tRNA-Thr, t... 40 8.4
185dbj|AB119154.1| Auxis rochei mitochondrial genes for tRNA-Thr, t... 40 8.4
186dbj|AB119153.1| Auxis rochei mitochondrial genes for tRNA-Thr, t... 40 8.4
187dbj|AB119152.1| Auxis rochei mitochondrial genes for tRNA-Thr, t... 40 8.4
188dbj|AB119151.1| Auxis rochei mitochondrial genes for tRNA-Thr, t... 40 8.4
189dbj|AB119150.1| Auxis rochei mitochondrial genes for tRNA-Thr, t... 40 8.4
190dbj|AB119149.1| Auxis rochei mitochondrial genes for tRNA-Thr, t... 40 8.4
191dbj|AB119148.1| Auxis rochei mitochondrial genes for tRNA-Thr, t... 40 8.4
192dbj|AB119147.1| Auxis rochei mitochondrial genes for tRNA-Thr, t... 40 8.4
193dbj|AB119146.1| Auxis rochei mitochondrial genes for tRNA-Thr, t... 40 8.4
194dbj|AB119145.1| Auxis rochei mitochondrial genes for tRNA-Thr, t... 40 8.4
195dbj|AB119144.1| Auxis rochei mitochondrial genes for tRNA-Thr, t... 40 8.4
196dbj|AB119143.1| Auxis rochei mitochondrial genes for tRNA-Thr, t... 40 8.4
197dbj|AB119142.1| Auxis rochei mitochondrial genes for tRNA-Thr, t... 40 8.4
198dbj|AB119141.1| Auxis rochei mitochondrial DNA, D-loop, partial ... 40 8.4
199emb|AL808128.4| Mouse DNA sequence from clone RP23-387C21 on chr... 40 8.4
200gb|L34155.1|HUMLAMAA Homo sapiens laminin-related protein (LamA3... 40 8.4
201emb|AL606969.26| Mouse DNA sequence from clone RP23-331P21 on ch... 40 8.4
202emb|X77598.1|HSLAMIA3 H.sapiens LAM A3 mRNA for laminin alpha 3 ... 40 8.4

>gb|AY106339.1| Zea mays PCO078628 mRNA sequence
          Length = 1415

 Score =  303 bits (153), Expect = 4e-79
 Identities = 448/543 (82%), Gaps = 4/543 (0%)
 Strand = Plus / Plus

                                                                       
Query: 16  gagcaaactaattcctggnaagcggacctatggctatgatcgtgttaatgatgacagcag 75
           ||||||||| | |||||| |||||||| ||||||||||| ||||| |||||||| |  | 
Sbjct: 407 gagcaaactcaatcctgg-aagcggacttatggctatgaccgtgtaaatgatgata--aa 463

                                                                       
Query: 76  natgtccccattattgaagccaaattgacagnacgagcctggtgttgatccttttgctca 135
            | || || ||| ||||||||||| |||| | ||||||||||||||||||| ||||| ||
Sbjct: 464 gacgttccgattcttgaagccaaactgactg-acgagcctggtgttgatccctttgcaca 522

                                                                       
Query: 136 aagaaaggaagagaagaagagcagggtcgataaacaagaaaagaacagtcttgggaattt 195
            |||| ||| ||||||||||  ||||| || || |||||||| | |||  | | ||||||
Sbjct: 523 gagaagggatgagaagaagaagagggttgaaaagcaagaaaaaagcagattagagaattt 582

                                                                       
Query: 196 gaagaatgctgcaaaagttggtgctctgccaagtcatatacagctcgctgccacgtccgt 255
            ||||| |||||||| ||||||||| ||||||||||||||||||| ||||| | | || |
Sbjct: 583 aaagaaagctgcaaaggttggtgctttgccaagtcatatacagcttgctgcgaaggcctt 642

                                                                       
Query: 256 gcccatcacaggaactaaagctgatctgccaagaaaagctaagaaggaagacctcgagaa 315
           |||||||||||||||||||||||| || |||| |||| |||  || || || || |||| 
Sbjct: 643 gcccatcacaggaactaaagctgaccttccaaaaaaatctagaaaagaggatcttgagag 702

                                                                       
Query: 316 tgtcgctggtatggcttctgcagcaacggctagtggtggaaagtttgataaaaagttgcc 375
           ||| | ||| ||||||||  ||||||| || || ||||| ||||||||  | ||||||||
Sbjct: 703 tgttgttggcatggcttcgtcagcaacagcaagcggtgggaagtttgacgagaagttgcc 762

                                                                       
Query: 376 tggcgagaaacctcttaagaaggctggcaaaaacagaaagttcctccctgttgttgaagg 435
           ||||||||||||||  ||| |  |||||||| | |||||||||||||| |||| ||| ||
Sbjct: 763 tggcgagaaacctccaaagcaccctggcaaacatagaaagttcctcccagttgctgaggg 822

                                                                       
Query: 436 gaaaggaatgggcaacctggagaaacagcaaaacgagaagatcctgaacagtctactggc 495
           ||| |||||||||| ||||||||||||||| || || || ||||||| |  |||||| ||
Sbjct: 823 gaagggaatgggcagcctggagaaacagcagaatgacaaaatcctgagctctctacttgc 882

                                                                       
Query: 496 caagaactttgaggaaccgttggatgtcagcaaggcaatcacgatgtacaaggtgaagaa 555
           ||  |||| ||| |||||| | ||||||||||||||||| || |||||||||||||| ||
Sbjct: 883 cagaaactctgatgaaccgcttgatgtcagcaaggcaattacaatgtacaaggtgaaaaa 942

              
Query: 556 gga 558
           |||
Sbjct: 943 gga 945



to top

>gb|BT019121.1| Zea mays clone Contig733.F mRNA sequence
          Length = 976

 Score =  297 bits (150), Expect = 2e-77
 Identities = 432/524 (82%), Gaps = 3/524 (0%)
 Strand = Plus / Plus

                                                                       
Query: 35  aagcggacctatggctatgatcgtgttaatgatgacagcagnatgtccccattattgaag 94
           |||||||| ||||||||||| ||||| |||||||| |  |  | || || ||| ||||||
Sbjct: 2   aagcggacttatggctatgaccgtgtaaatgatgata--aagacgttccgattcttgaag 59

                                                                       
Query: 95  ccaaattgacagnacgagcctggtgttgatccttttgctcaaagaaaggaagagaagaag 154
           ||||| |||| | ||||||||||||||||||| ||||| || |||| ||| |||||||||
Sbjct: 60  ccaaactgactg-acgagcctggtgttgatccctttgcacagagaagggatgagaagaag 118

                                                                       
Query: 155 agcagggtcgataaacaagaaaagaacagtcttgggaatttgaagaatgctgcaaaagtt 214
           |  ||||| || || |||||||| | |||  | | |||||| ||||| |||||||| |||
Sbjct: 119 aagagggttgaaaagcaagaaaaaagcagattagagaatttaaagaaagctgcaaaggtt 178

                                                                       
Query: 215 ggtgctctgccaagtcatatacagctcgctgccacgtccgtgcccatcacaggaactaaa 274
           |||||| ||||||||||||||||||| ||||| | | || ||||||||||||||||||||
Sbjct: 179 ggtgctttgccaagtcatatacagcttgctgcgaaggccttgcccatcacaggaactaaa 238

                                                                       
Query: 275 gctgatctgccaagaaaagctaagaaggaagacctcgagaatgtcgctggtatggcttct 334
           ||||| || |||| |||| |||  || || || || |||| ||| | ||| |||||||| 
Sbjct: 239 gctgaccttccaaaaaaatctagaaaagaggatcttgagagtgttgttggcatggcttcg 298

                                                                       
Query: 335 gcagcaacggctagtggtggaaagtttgataaaaagttgcctggcgagaaacctcttaag 394
            ||||||| || || ||||| ||||||||  | ||||||||||||||||||||||  |||
Sbjct: 299 tcagcaacagcaagcggtgggaagtttgacgagaagttgcctggcgagaaacctccaaag 358

                                                                       
Query: 395 aaggctggcaaaaacagaaagttcctccctgttgttgaagggaaaggaatgggcaacctg 454
            |  |||||||| | |||||||||||||| |||| ||| ||||| |||||||||| ||||
Sbjct: 359 caccctggcaaacatagaaagttcctcccagttgctgaggggaagggaatgggcagcctg 418

                                                                       
Query: 455 gagaaacagcaaaacgagaagatcctgaacagtctactggccaagaactttgaggaaccg 514
           ||||||||||| || || || ||||||| |  |||||| ||||  |||| ||| ||||||
Sbjct: 419 gagaaacagcagaatgacaaaatcctgagctctctacttgccagaaactctgatgaaccg 478

                                                       
Query: 515 ttggatgtcagcaaggcaatcacgatgtacaaggtgaagaagga 558
            | ||||||||||||||||| || |||||||||||||| |||||
Sbjct: 479 cttgatgtcagcaaggcaattacaatgtacaaggtgaaaaagga 522



to top

>ref|XM_474417.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 993

 Score =  258 bits (130), Expect = 2e-65
 Identities = 372/450 (82%), Gaps = 2/450 (0%)
 Strand = Plus / Plus

                                                                       
Query: 110 gagcctggtgttgatccttttgctcaaagaaaggaagagaagaaga-gcagggtcgataa 168
           ||||||||||||||||||||||||||||||| |||||| ||||||| ||| | | || ||
Sbjct: 448 gagcctggtgttgatccttttgctcaaagaagggaagataagaagaagcatgtt-gaaaa 506

                                                                       
Query: 169 acaagaaaagaacagtcttgggaatttgaagaatgctgcaaaagttggtgctctgccaag 228
            |||||||||||||| || |  || ||||| || || || |||||||||||| |||| ||
Sbjct: 507 gcaagaaaagaacagactagaaaacttgaaaaaagcagccaaagttggtgctttgcctag 566

                                                                       
Query: 229 tcatatacagctcgctgccacgtccgtgcccatcacaggaactaaagctgatctgccaag 288
           ||||||||| || ||||| ||  |  |||| ||||| ||||||||||| ||  | || | 
Sbjct: 567 tcatatacaacttgctgcaacagcgttgcctatcacgggaactaaagcagacatacccaa 626

                                                                       
Query: 289 aaaagctaagaaggaagacctcgagaatgtcgctggtatggcttctgcagcaacggctag 348
           |||| |||  ||| |||| |||||| |||| ||||| ||||||||  ||||||| |||||
Sbjct: 627 aaaatctagaaagaaagatctcgaggatgttgctggcatggcttcatcagcaacagctag 686

                                                                       
Query: 349 tggtggaaagtttgataaaaagttgcctggcgagaaacctcttaagaaggctggcaaaaa 408
           |||||| ||||| ||| |||| |||||||||||||||||||  || ||  |||||||| |
Sbjct: 687 tggtgggaagttcgatgaaaaattgcctggcgagaaacctccaaaaaatcctggcaaaca 746

                                                                       
Query: 409 cagaaagttcctccctgttgttgaagggaaaggaatgggcaacctggagaaacagcaaaa 468
            |||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||
Sbjct: 747 tagaaagttcctccctgttgttgaaggaaaaggaatgggcaaccaggagaaacagcaaaa 806

                                                                       
Query: 469 cgagaagatcctgaacagtctactggccaagaactttgaggaaccgttggatgtcagcaa 528
            || || ||| ||||   ||| |||||||| |  | |||||| |   |||||||  ||| 
Sbjct: 807 tgacaaaatcttgaatgctctgctggccaaaagttctgaggatcaaatggatgttggcag 866

                                         
Query: 529 ggcaatcacgatgtacaaggtgaagaagga 558
           |||||| |||||||||||||||||||||||
Sbjct: 867 ggcaattacgatgtacaaggtgaagaagga 896



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 35  aagcggacctatggctatgatcgtgttaatgatga 69
           |||||||| ||||||||||| ||||||||||||||
Sbjct: 376 aagcggacttatggctatgaccgtgttaatgatga 410



to top

>dbj|AK065262.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002J24, full
           insert sequence
          Length = 1265

 Score =  258 bits (130), Expect = 2e-65
 Identities = 372/450 (82%), Gaps = 2/450 (0%)
 Strand = Plus / Plus

                                                                       
Query: 110 gagcctggtgttgatccttttgctcaaagaaaggaagagaagaaga-gcagggtcgataa 168
           ||||||||||||||||||||||||||||||| |||||| ||||||| ||| | | || ||
Sbjct: 516 gagcctggtgttgatccttttgctcaaagaagggaagataagaagaagcatgtt-gaaaa 574

                                                                       
Query: 169 acaagaaaagaacagtcttgggaatttgaagaatgctgcaaaagttggtgctctgccaag 228
            |||||||||||||| || |  || ||||| || || || |||||||||||| |||| ||
Sbjct: 575 gcaagaaaagaacagactagaaaacttgaaaaaagcagccaaagttggtgctttgcctag 634

                                                                       
Query: 229 tcatatacagctcgctgccacgtccgtgcccatcacaggaactaaagctgatctgccaag 288
           ||||||||| || ||||| ||  |  |||| ||||| ||||||||||| ||  | || | 
Sbjct: 635 tcatatacaacttgctgcaacagcgttgcctatcacgggaactaaagcagacatacccaa 694

                                                                       
Query: 289 aaaagctaagaaggaagacctcgagaatgtcgctggtatggcttctgcagcaacggctag 348
           |||| |||  ||| |||| |||||| |||| ||||| ||||||||  ||||||| |||||
Sbjct: 695 aaaatctagaaagaaagatctcgaggatgttgctggcatggcttcatcagcaacagctag 754

                                                                       
Query: 349 tggtggaaagtttgataaaaagttgcctggcgagaaacctcttaagaaggctggcaaaaa 408
           |||||| ||||| ||| |||| |||||||||||||||||||  || ||  |||||||| |
Sbjct: 755 tggtgggaagttcgatgaaaaattgcctggcgagaaacctccaaaaaatcctggcaaaca 814

                                                                       
Query: 409 cagaaagttcctccctgttgttgaagggaaaggaatgggcaacctggagaaacagcaaaa 468
            |||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||
Sbjct: 815 tagaaagttcctccctgttgttgaaggaaaaggaatgggcaaccaggagaaacagcaaaa 874

                                                                       
Query: 469 cgagaagatcctgaacagtctactggccaagaactttgaggaaccgttggatgtcagcaa 528
            || || ||| ||||   ||| |||||||| |  | |||||| |   |||||||  ||| 
Sbjct: 875 tgacaaaatcttgaatgctctgctggccaaaagttctgaggatcaaatggatgttggcag 934

                                         
Query: 529 ggcaatcacgatgtacaaggtgaagaagga 558
           |||||| |||||||||||||||||||||||
Sbjct: 935 ggcaattacgatgtacaaggtgaagaagga 964



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 35  aagcggacctatggctatgatcgtgttaatgatga 69
           |||||||| ||||||||||| ||||||||||||||
Sbjct: 444 aagcggacttatggctatgaccgtgttaatgatga 478



to top

>ref|XM_550620.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2040

 Score =  198 bits (100), Expect = 2e-47
 Identities = 293/356 (82%), Gaps = 6/356 (1%)
 Strand = Plus / Plus

                                                                        
Query: 110  gagcctggtgttgatccttttgctcaaagaaaggaagagaagaagagcagggtcgataaa 169
            |||||||| ||||||||||| || ||||| ||| || |||||||| |   ||| || || 
Sbjct: 1555 gagcctggagttgatcctttcgcacaaaggaagcaaaagaagaagcg---ggtagaaaag 1611

                                                                        
Query: 170  caagaaaagaacagtcttgggaatttgaagaatgctgcaaaagttggtgctctgccaagt 229
            |||| ||| ||||| || | ||| || ||||| |||||||||||||||||| ||||||||
Sbjct: 1612 caaggaaaaaacagactagagaacttaaagaaagctgcaaaagttggtgctttgccaagt 1671

                                                                        
Query: 230  catatacagctcgctgccacgtccgtgcccatcacaggaactaaagctgatctgccaaga 289
            |||||||| || ||||| |||||| |||||||||||||||||||||||||||| || | |
Sbjct: 1672 catatacaacttgctgcaacgtccttgcccatcacaggaactaaagctgatcttccgaaa 1731

                                                                        
Query: 290  aaagctaagaaggaagacctcgagaatgtcgctggtatggcttctgcagcaacggctagt 349
            ||| |||  || || || || |||||||| ||||| ||||  |||   ||||| || |||
Sbjct: 1732 aaatctagaaaagaggatcttgagaatgttgctggcatgggatct---gcaacagcaagt 1788

                                                                        
Query: 350  ggtggaaagtttgataaaaagttgcctggcgagaaacctcttaagaaggctggcaaaaac 409
            ||||| ||||||||| | ||||||||||||||||||||||  ||| |  |||||||| | 
Sbjct: 1789 ggtgggaagtttgatgagaagttgcctggcgagaaacctccaaagcatcctggcaaacat 1848

                                                                    
Query: 410  agaaagttcctccctgttgttgaagggaaaggaatgggcaacctggagaaacagca 465
            | ||||||  |||| |||| ||||||| | |||||||||||||||| |||||||||
Sbjct: 1849 aaaaagtttatcccagttgctgaaggggagggaatgggcaacctggggaaacagca 1904



to top

>gb|BT018675.1| Zea mays clone EL01N0510H04.d mRNA sequence
          Length = 1422

 Score =  194 bits (98), Expect = 2e-46
 Identities = 278/338 (82%)
 Strand = Plus / Plus

                                                                       
Query: 221 ctgccaagtcatatacagctcgctgccacgtccgtgcccatcacaggaactaaagctgat 280
           |||| ||||||||||||||| ||||| | | || ||||||||||||||||||||||||| 
Sbjct: 614 ctgcaaagtcatatacagcttgctgcgaaggccttgcccatcacaggaactaaagctgac 673

                                                                       
Query: 281 ctgccaagaaaagctaagaaggaagacctcgagaatgtcgctggtatggcttctgcagca 340
           || |||| |||| |||  || || || || |||| ||| | ||| ||||||||  |||||
Sbjct: 674 cttccaaaaaaatctagaaaagaggatcttgagagtgttgttggcatggcttcgtcagca 733

                                                                       
Query: 341 acggctagtggtggaaagtttgataaaaagttgcctggcgagaaacctcttaagaaggct 400
           || || || ||||| ||||||||  | ||||||||||||||||||||||  ||| |  ||
Sbjct: 734 acagcaagcggtgggaagtttgacgagaagttgcctggcgagaaacctccaaagcaccct 793

                                                                       
Query: 401 ggcaaaaacagaaagttcctccctgttgttgaagggaaaggaatgggcaacctggagaaa 460
           |||||| | |||||||||||||| |||| ||| ||||| |||||||||| ||||||||||
Sbjct: 794 ggcaaacatagaaagttcctcccagttgctgaggggaagggaatgggcagcctggagaaa 853

                                                                       
Query: 461 cagcaaaacgagaagatcctgaacagtctactggccaagaactttgaggaaccgttggat 520
           ||||| ||  |  | ||||||| |  |||||| ||||  |||| ||| |||||| | |||
Sbjct: 854 cagcagaatcactaaatcctgagctctctacttgccagaaactctgatgaaccgcttgat 913

                                                 
Query: 521 gtcagcaaggcaatcacgatgtacaaggtgaagaagga 558
           |||||||||||||| || |||||||||||||| |||||
Sbjct: 914 gtcagcaaggcaattacaatgtacaaggtgaaaaagga 951



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 159/195 (81%), Gaps = 4/195 (2%)
 Strand = Plus / Plus

                                                                       
Query: 16  gagcaaactaattcctggnaagcggacctatggctatgatcgtgttaatgatgacagcag 75
           ||||||||| | |||||| |||||||| ||||||||||| ||||| |||||||| |  | 
Sbjct: 430 gagcaaactcaatcctgg-aagcggacttatggctatgaccgtgtaaatgatgata--aa 486

                                                                       
Query: 76  natgtccccattattgaagccaaattgacagnacgagcctggtgttgatccttttgctca 135
            | || || ||| ||||||||||| |||| | ||||||||||||||||||| ||||| ||
Sbjct: 487 gacgttccgattcttgaagccaaactgactg-acgagcctggtgttgatccctttgcaca 545

                                                                       
Query: 136 aagaaaggaagagaagaagagcagggtcgataaacaagaaaagaacagtcttgggaattt 195
            |||| ||| ||||||||||  ||||| || || |||||||| | |||  | | ||||||
Sbjct: 546 gagaagggatgagaagaagaagagggttgaaaagcaagaaaaaagcagattagagaattt 605

                          
Query: 196 gaagaatgctgcaaa 210
            ||||| ||||||||
Sbjct: 606 aaagaaagctgcaaa 620



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score =  113 bits (57), Expect = 7e-22
 Identities = 137/163 (84%), Gaps = 3/163 (1%)
 Strand = Plus / Plus

                                                                           
Query: 227     agtcatatacagctcgctgccacgtccgtgcccatcacaggaactaaagctgatctgcca 286
               ||||||||||| || ||||| |||||| |||||||||||||||||||||||||||| || 
Sbjct: 2192871 agtcatatacaacttgctgcaacgtccttgcccatcacaggaactaaagctgatcttccg 2192930

                                                                           
Query: 287     agaaaagctaagaaggaagacctcgagaatgtcgctggtatggcttctgcagcaacggct 346
               | |||| |||  || || || || |||||||| ||||| ||||  |||   ||||| || 
Sbjct: 2192931 aaaaaatctagaaaagaggatcttgagaatgttgctggcatgggatct---gcaacagca 2192987

                                                          
Query: 347     agtggtggaaagtttgataaaaagttgcctggcgagaaacctc 389
               |||||||| ||||||||| | ||||||||||||||||||||||
Sbjct: 2192988 agtggtgggaagtttgatgagaagttgcctggcgagaaacctc 2193030



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 97/119 (81%), Gaps = 3/119 (2%)
 Strand = Plus / Plus

                                                                           
Query: 110     gagcctggtgttgatccttttgctcaaagaaaggaagagaagaagagcagggtcgataaa 169
               |||||||| ||||||||||| || ||||| ||| || |||||||| |   ||| || || 
Sbjct: 2192631 gagcctggagttgatcctttcgcacaaaggaagcaaaagaagaagcg---ggtagaaaag 2192687

                                                                          
Query: 170     caagaaaagaacagtcttgggaatttgaagaatgctgcaaaagttggtgctctgccaag 228
               |||| ||| ||||| || | ||| || ||||| |||||||||||||||||| |||||||
Sbjct: 2192688 caaggaaaaaacagactagagaacttaaagaaagctgcaaaagttggtgctttgccaag 2192746



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                             
Query: 420     tccctgttgttgaagggaaaggaatgggcaacctggagaaacagca 465
               |||| |||| ||||||| | |||||||||||||||| |||||||||
Sbjct: 2193148 tcccagttgctgaaggggagggaatgggcaacctggggaaacagca 2193193



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                              
Query: 528     aggcaatcacgatgtacaaggtgaagaagga 558
               |||||| ||| ||||||||||||||||||||
Sbjct: 2193365 aggcaaacacaatgtacaaggtgaagaagga 2193395



to top

>dbj|AP000399.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6,
             clone:P0535G04
          Length = 154180

 Score =  113 bits (57), Expect = 7e-22
 Identities = 137/163 (84%), Gaps = 3/163 (1%)
 Strand = Plus / Plus

                                                                         
Query: 227   agtcatatacagctcgctgccacgtccgtgcccatcacaggaactaaagctgatctgcca 286
             ||||||||||| || ||||| |||||| |||||||||||||||||||||||||||| || 
Sbjct: 52328 agtcatatacaacttgctgcaacgtccttgcccatcacaggaactaaagctgatcttccg 52387

                                                                         
Query: 287   agaaaagctaagaaggaagacctcgagaatgtcgctggtatggcttctgcagcaacggct 346
             | |||| |||  || || || || |||||||| ||||| ||||  |||   ||||| || 
Sbjct: 52388 aaaaaatctagaaaagaggatcttgagaatgttgctggcatgggatct---gcaacagca 52444

                                                        
Query: 347   agtggtggaaagtttgataaaaagttgcctggcgagaaacctc 389
             |||||||| ||||||||| | ||||||||||||||||||||||
Sbjct: 52445 agtggtgggaagtttgatgagaagttgcctggcgagaaacctc 52487



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 97/119 (81%), Gaps = 3/119 (2%)
 Strand = Plus / Plus

                                                                         
Query: 110   gagcctggtgttgatccttttgctcaaagaaaggaagagaagaagagcagggtcgataaa 169
             |||||||| ||||||||||| || ||||| ||| || |||||||| |   ||| || || 
Sbjct: 52088 gagcctggagttgatcctttcgcacaaaggaagcaaaagaagaagcg---ggtagaaaag 52144

                                                                        
Query: 170   caagaaaagaacagtcttgggaatttgaagaatgctgcaaaagttggtgctctgccaag 228
             |||| ||| ||||| || | ||| || ||||| |||||||||||||||||| |||||||
Sbjct: 52145 caaggaaaaaacagactagagaacttaaagaaagctgcaaaagttggtgctttgccaag 52203



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                           
Query: 420   tccctgttgttgaagggaaaggaatgggcaacctggagaaacagca 465
             |||| |||| ||||||| | |||||||||||||||| |||||||||
Sbjct: 52605 tcccagttgctgaaggggagggaatgggcaacctggggaaacagca 52650



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                            
Query: 528   aggcaatcacgatgtacaaggtgaagaagga 558
             |||||| ||| ||||||||||||||||||||
Sbjct: 52822 aggcaaacacaatgtacaaggtgaagaagga 52852



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 53/55 (96%)
 Strand = Plus / Minus

                                                                       
Query: 414      agttcctccctgttgttgaagggaaaggaatgggcaacctggagaaacagcaaaa 468
                |||||||||||||||||||||| |||||||||||||||| |||||||||||||||
Sbjct: 35027828 agttcctccctgttgttgaaggaaaaggaatgggcaaccaggagaaacagcaaaa 35027774



 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 112/135 (82%)
 Strand = Plus / Minus

                                                                            
Query: 255      tgcccatcacaggaactaaagctgatctgccaagaaaagctaagaaggaagacctcgaga 314
                |||| ||||| ||||||||||| ||  | || | |||| |||  ||| |||| |||||| 
Sbjct: 35028080 tgcctatcacgggaactaaagcagacatacccaaaaaatctagaaagaaagatctcgagg 35028021

                                                                            
Query: 315      atgtcgctggtatggcttctgcagcaacggctagtggtggaaagtttgataaaaagttgc 374
                |||| ||||| ||||||||  ||||||| ||||||||||| ||||| ||| |||| ||||
Sbjct: 35028020 atgttgctggcatggcttcatcagcaacagctagtggtgggaagttcgatgaaaaattgc 35027961

                               
Query: 375      ctggcgagaaacctc 389
                |||||||||||||||
Sbjct: 35027960 ctggcgagaaacctc 35027946



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                              
Query: 110      gagcctggtgttgatccttttgctcaaagaaaggaagagaagaaga 155
                ||||||||||||||||||||||||||||||| |||||| |||||||
Sbjct: 35028380 gagcctggtgttgatccttttgctcaaagaagggaagataagaaga 35028335



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                                   
Query: 35       aagcggacctatggctatgatcgtgttaatgatga 69
                |||||||| ||||||||||| ||||||||||||||
Sbjct: 35028771 aagcggacttatggctatgaccgtgttaatgatga 35028737



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                               
Query: 528      aggcaatcacgatgtacaaggtgaagaagga 558
                ||||||| |||||||||||||||||||||||
Sbjct: 35027602 aggcaattacgatgtacaaggtgaagaagga 35027572



to top

>emb|AL732343.2| Oryza sativa genomic DNA, chromosome 4, BAC clone: H0913C04, complete
             sequence
          Length = 94152

 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 53/55 (96%)
 Strand = Plus / Minus

                                                                    
Query: 414   agttcctccctgttgttgaagggaaaggaatgggcaacctggagaaacagcaaaa 468
             |||||||||||||||||||||| |||||||||||||||| |||||||||||||||
Sbjct: 59541 agttcctccctgttgttgaaggaaaaggaatgggcaaccaggagaaacagcaaaa 59487



 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 112/135 (82%)
 Strand = Plus / Minus

                                                                         
Query: 255   tgcccatcacaggaactaaagctgatctgccaagaaaagctaagaaggaagacctcgaga 314
             |||| ||||| ||||||||||| ||  | || | |||| |||  ||| |||| |||||| 
Sbjct: 59793 tgcctatcacgggaactaaagcagacatacccaaaaaatctagaaagaaagatctcgagg 59734

                                                                         
Query: 315   atgtcgctggtatggcttctgcagcaacggctagtggtggaaagtttgataaaaagttgc 374
             |||| ||||| ||||||||  ||||||| ||||||||||| ||||| ||| |||| ||||
Sbjct: 59733 atgttgctggcatggcttcatcagcaacagctagtggtgggaagttcgatgaaaaattgc 59674

                            
Query: 375   ctggcgagaaacctc 389
             |||||||||||||||
Sbjct: 59673 ctggcgagaaacctc 59659



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 97/116 (83%)
 Strand = Plus / Minus

                                                                         
Query: 110   gagcctggtgttgatccttttgctcaaagaaaggaagagaagaagagcagggtcgataaa 169
             ||||||||||||||||||||||||||||||| |||||| |||||||   | || || || 
Sbjct: 60093 gagcctggtgttgatccttttgctcaaagaagggaagataagaagaagtgtgttgaaaag 60034

                                                                     
Query: 170   caagaaaagaacagtcttgggaatttgaagaatgctgcaaaagttggtgctctgcc 225
             |||||||||||||| || |  || ||||| || || || |||||||||||| ||||
Sbjct: 60033 caagaaaagaacagactagaaaacttgaaaaaagcagccaaagttggtgctttgcc 59978



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                                
Query: 35    aagcggacctatggctatgatcgtgttaatgatga 69
             |||||||| ||||||||||| ||||||||||||||
Sbjct: 60484 aagcggacttatggctatgaccgtgttaatgatga 60450



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                            
Query: 528   aggcaatcacgatgtacaaggtgaagaagga 558
             ||||||| |||||||||||||||||||||||
Sbjct: 59315 aggcaattacgatgtacaaggtgaagaagga 59285



to top

>emb|AL606651.3|OSJN00092 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0088H09,
             complete sequence
          Length = 145391

 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 53/55 (96%)
 Strand = Plus / Minus

                                                                    
Query: 414   agttcctccctgttgttgaagggaaaggaatgggcaacctggagaaacagcaaaa 468
             |||||||||||||||||||||| |||||||||||||||| |||||||||||||||
Sbjct: 86878 agttcctccctgttgttgaaggaaaaggaatgggcaaccaggagaaacagcaaaa 86824



 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 112/135 (82%)
 Strand = Plus / Minus

                                                                         
Query: 255   tgcccatcacaggaactaaagctgatctgccaagaaaagctaagaaggaagacctcgaga 314
             |||| ||||| ||||||||||| ||  | || | |||| |||  ||| |||| |||||| 
Sbjct: 87130 tgcctatcacgggaactaaagcagacatacccaaaaaatctagaaagaaagatctcgagg 87071

                                                                         
Query: 315   atgtcgctggtatggcttctgcagcaacggctagtggtggaaagtttgataaaaagttgc 374
             |||| ||||| ||||||||  ||||||| ||||||||||| ||||| ||| |||| ||||
Sbjct: 87070 atgttgctggcatggcttcatcagcaacagctagtggtgggaagttcgatgaaaaattgc 87011

                            
Query: 375   ctggcgagaaacctc 389
             |||||||||||||||
Sbjct: 87010 ctggcgagaaacctc 86996



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                           
Query: 110   gagcctggtgttgatccttttgctcaaagaaaggaagagaagaaga 155
             ||||||||||||||||||||||||||||||| |||||| |||||||
Sbjct: 87430 gagcctggtgttgatccttttgctcaaagaagggaagataagaaga 87385



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                                
Query: 35    aagcggacctatggctatgatcgtgttaatgatga 69
             |||||||| ||||||||||| ||||||||||||||
Sbjct: 87821 aagcggacttatggctatgaccgtgttaatgatga 87787



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                            
Query: 528   aggcaatcacgatgtacaaggtgaagaagga 558
             ||||||| |||||||||||||||||||||||
Sbjct: 86652 aggcaattacgatgtacaaggtgaagaagga 86622



to top

>ref|NM_129356.2| Arabidopsis thaliana unknown protein AT2G37990 mRNA, complete cds
          Length = 1508

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 339 caacggctagtggtggaaagtttgataaaaagttgcctggcgagaaacctc 389
           |||| |||||||||||||| || ||||||||||||||||| || |||||||
Sbjct: 709 caaccgctagtggtggaaaattcgataaaaagttgcctggagaaaaacctc 759



to top

>dbj|AK222003.1| Arabidopsis thaliana mRNA for hypothetical protein, partial cds,
           clone: RAFL22-64-J22
          Length = 761

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 339 caacggctagtggtggaaagtttgataaaaagttgcctggcgagaaacctc 389
           |||| |||||||||||||| || ||||||||||||||||| || |||||||
Sbjct: 330 caaccgctagtggtggaaaattcgataaaaagttgcctggagaaaaacctc 380



to top

>gb|AY088030.1| Arabidopsis thaliana clone 40538 mRNA, complete sequence
          Length = 1197

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 339 caacggctagtggtggaaagtttgataaaaagttgcctggcgagaaacctc 389
           |||| |||||||||||||| || ||||||||||||||||| || |||||||
Sbjct: 716 caaccgctagtggtggaaaattcgataaaaagttgcctggagaaaaacctc 766



to top

>gb|AC007661.2|AC007661 Arabidopsis thaliana chromosome II section 205 of 255 of the complete
             sequence. Sequence from clones F13M22, T8P21, F16M14
          Length = 95612

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                                
Query: 339   caacggctagtggtggaaagtttgataaaaagttgcctggcgagaaacctc 389
             |||| |||||||||||||| || ||||||||||||||||| || |||||||
Sbjct: 65679 caaccgctagtggtggaaaattcgataaaaagttgcctggagaaaaacctc 65729



to top

>gb|AC003013.1|AC003013 Human PAC clone RP1-205E24 from Xq23, complete sequence
          Length = 173452

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 138    gaaaggaagagaagaagagcaggg 161
              ||||||||||||||||||||||||
Sbjct: 159653 gaaaggaagagaagaagagcaggg 159630



to top

>gb|BC027996.1| Homo sapiens ADAM metallopeptidase domain 9 (meltrin gamma), mRNA
            (cDNA clone IMAGE:5183140), with apparent retained intron
          Length = 2442

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 192  atttgaagaatgctgcaaaagt 213
            ||||||||||||||||||||||
Sbjct: 1176 atttgaagaatgctgcaaaagt 1155



to top

>emb|AL512504.9| Human DNA sequence from clone RP11-325E14 on chromosome X Contains a
             heterogeneous nuclear ribonucleoprotein H3 (2H9) (HNRPH3)
             pseudogene, a WW domain binding protein 11 (WBP11)
             pseudogene, a hexokinase 2 (HK2) pseudogene, a proteasome
             (prosome, macropain) subunit, alpha type, 1 (PSMA1)
             pseudogene, the 3' end of the gene for a novel WD repeat
             domain protein and three CpG islands, complete sequence
          Length = 223078

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 168   aacaagaaaagaacagtcttgg 189
             ||||||||||||||||||||||
Sbjct: 88682 aacaagaaaagaacagtcttgg 88661



to top

>gb|AC163439.3| Mus musculus chromosome 8, clone RP23-390F12, complete sequence
          Length = 205063

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 135   aaagaaaggaagagaagaagag 156
             ||||||||||||||||||||||
Sbjct: 42713 aaagaaaggaagagaagaagag 42692



to top

>gb|AC108863.4| Homo sapiens chromosome 8, clone CTD-2544N14, complete sequence
          Length = 199218

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 192    atttgaagaatgctgcaaaagt 213
              ||||||||||||||||||||||
Sbjct: 119709 atttgaagaatgctgcaaaagt 119688



to top

>emb|CR591969.1| full-length cDNA clone CS0DD003YM01 of Neuroblastoma Cot
           50-normalized of Homo sapiens (human)
          Length = 2053

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 192 atttgaagaatgctgcaaaagt 213
           ||||||||||||||||||||||
Sbjct: 845 atttgaagaatgctgcaaaagt 824



to top

>gb|AC117665.6| Mus musculus chromosome 8, clone RP23-360I9, complete sequence
          Length = 217058

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 135   aaagaaaggaagagaagaagag 156
             ||||||||||||||||||||||
Sbjct: 22853 aaagaaaggaagagaagaagag 22874



to top

>ref|XM_580731.2| PREDICTED: Bos taurus similar to Sperm-associated antigen 5 (Astrin)
            (Mitotic spindle associated protein p126) (MAP126)
            (Deepest) (LOC504585), mRNA
          Length = 3958

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 461  cagcaaaacgagaagatcctg 481
            |||||||||||||||||||||
Sbjct: 3412 cagcaaaacgagaagatcctg 3432



to top

>gb|AC151742.9| Medicago truncatula clone mth2-83e4, complete sequence
          Length = 99595

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 135   aaagaaaggaagagaagaaga 155
             |||||||||||||||||||||
Sbjct: 71967 aaagaaaggaagagaagaaga 71987



to top

>gb|AC138451.15| Medicago truncatula clone mth2-24k1, complete sequence
          Length = 123909

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 135    aaagaaaggaagagaagaaga 155
              |||||||||||||||||||||
Sbjct: 122244 aaagaaaggaagagaagaaga 122264



to top

>gb|AC146909.23| Medicago truncatula clone mth2-57e16, complete sequence
          Length = 121218

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 135   aaagaaaggaagagaagaaga 155
             |||||||||||||||||||||
Sbjct: 77373 aaagaaaggaagagaagaaga 77393



to top

>gb|DQ133396.1| Elimia olivula isolate CAH-9 cytochrome c oxidase subunit I (COI)
           gene, partial cds; mitochondrial
          Length = 658

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 136 aagaaaggaagagaagaagagcagg 160
           ||||||| |||||||||||||||||
Sbjct: 296 aagaaagtaagagaagaagagcagg 272



to top

>gb|DQ133392.1| Elimia cahawbensis isolate CAH-13 cytochrome c oxidase subunit I
           (COI) gene, partial cds; mitochondrial
          Length = 658

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 136 aagaaaggaagagaagaagagcagg 160
           ||||||| |||||||||||||||||
Sbjct: 296 aagaaagtaagagaagaagagcagg 272



to top

>gb|DQ133389.1| Elimia annettae isolate CAH-10 cytochrome c oxidase subunit I (COI)
           gene, partial cds; mitochondrial
          Length = 658

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 136 aagaaaggaagagaagaagagcagg 160
           ||||||| |||||||||||||||||
Sbjct: 296 aagaaagtaagagaagaagagcagg 272



to top

>ref|XM_783521.1| PREDICTED: Strongylocentrotus purpuratus similar to myosin, heavy
           polypeptide 2, skeletal muscle, adult (LOC583619), mRNA
          Length = 1152

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 135 aaagaaaggaagagaagaaga 155
           |||||||||||||||||||||
Sbjct: 450 aaagaaaggaagagaagaaga 470



to top

>gb|AY161723.1| Cypraea pantherina isolate BJLinnSoc_111 cytochrome oxidase subunit
           I (COI) gene, partial cds; mitochondrial gene for
           mitochondrial product
          Length = 596

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 136 aagaaaggaagagaagaagagcagg 160
           ||||||| |||||||||||||||||
Sbjct: 265 aagaaagtaagagaagaagagcagg 241



to top

>gb|AC158762.4| Mus musculus chromosome 1, clone RP24-255O19, complete sequence
          Length = 176468

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 136    aagaaaggaagagaagaagag 156
              |||||||||||||||||||||
Sbjct: 110246 aagaaaggaagagaagaagag 110266



to top

>emb|AL033522.1|HS451B21 Human DNA sequence from clone RP3-451B21 on chromosome 6q24 Contains
             the HSPC228 gene for hypothetical protein HSPC228 and  a
             novel gene, complete sequence
          Length = 135162

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 350   ggtggaaagtttgataaaaag 370
             |||||||||||||||||||||
Sbjct: 71354 ggtggaaagtttgataaaaag 71374



to top

>gb|AC110042.12| Mus musculus chromosome 1, clone RP23-278C6, complete sequence
          Length = 170602

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 136    aagaaaggaagagaagaagag 156
              |||||||||||||||||||||
Sbjct: 159549 aagaaaggaagagaagaagag 159569



to top

>emb|AL731855.19| Mouse DNA sequence from clone RP23-107N13 on chromosome 2, complete
              sequence
          Length = 172215

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 135    aaagaaaggaagagaagaaga 155
              |||||||||||||||||||||
Sbjct: 162473 aaagaaaggaagagaagaaga 162493



to top

>gb|DQ207141.1| Cypraea pantherina haplotype Massawa_2854 cytochrome oxidase
           subunit I (COI) gene, partial cds; mitochondrial
          Length = 614

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 136 aagaaaggaagagaagaagagcagg 160
           ||||||| |||||||||||||||||
Sbjct: 277 aagaaagtaagagaagaagagcagg 253



to top

>gb|AC138587.11| Mus musculus chromosome 9, clone RP24-160H16, complete sequence
          Length = 185915

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 135   aaagaaaggaagagaagaaga 155
             |||||||||||||||||||||
Sbjct: 77831 aaagaaaggaagagaagaaga 77811



to top

>gb|AC171175.1| Mus musculus chromosome 19, clone wi1-1715L8, complete sequence
          Length = 37475

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 136   aagaaaggaagagaagaaga 155
             ||||||||||||||||||||
Sbjct: 11559 aagaaaggaagagaagaaga 11578



to top

>gb|AC162379.2| Mus musculus BAC clone RP23-132A15 from chromosome 12, complete
             sequence
          Length = 238126

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 134   caaagaaaggaagagaagaa 153
             ||||||||||||||||||||
Sbjct: 86239 caaagaaaggaagagaagaa 86220



to top

>gb|AC135720.8| Mus musculus chromosome 15, clone RP24-298F20, complete sequence
          Length = 156107

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 135    aaagaaaggaagagaagaag 154
              ||||||||||||||||||||
Sbjct: 119006 aaagaaaggaagagaagaag 118987



to top

>gb|AF288738.1| Homo sapiens epidermal growth factor receptor (EGFR) gene, complete
            cds, alternatively spliced; and 5S ribosomal RNA gene,
            complete sequence
          Length = 197496

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 135  aaagaaaggaagagaagaagagca 158
            ||||||||||||| ||||||||||
Sbjct: 3024 aaagaaaggaagaaaagaagagca 3047



to top

>gb|AC147557.4| Mus musculus BAC clone RP23-452M8 from chromosome 14, complete
            sequence
          Length = 174133

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 135  aaagaaaggaagagaagaag 154
            ||||||||||||||||||||
Sbjct: 6166 aaagaaaggaagagaagaag 6147



to top

>gb|DP000012.1| Macropus eugenii target 1 genomic scaffold
          Length = 1996640

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 13     aatgagcaaactaattcctg 32
              ||||||||||||||||||||
Sbjct: 108956 aatgagcaaactaattcctg 108937



to top

>gb|AC158527.2| Mus musculus BAC clone RP23-266E16 from chromosome 12, complete sequence
          Length = 218736

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 134    caaagaaaggaagagaagaa 153
              ||||||||||||||||||||
Sbjct: 155870 caaagaaaggaagagaagaa 155851



to top

>ref|XM_846692.1| PREDICTED: Canis familiaris similar to bromodomain containing 9
           isoform 1 (LOC609435), mRNA
          Length = 2434

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 135 aaagaaaggaagagaagaag 154
           ||||||||||||||||||||
Sbjct: 239 aaagaaaggaagagaagaag 258



to top

>ref|XM_823468.1| Trypanosoma brucei TREU927 hypothetical protein (Tb11.02.2470)
           partial mRNA
          Length = 1401

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 522 tcagcaaggcaatcacgatg 541
           ||||||||||||||||||||
Sbjct: 800 tcagcaaggcaatcacgatg 781



to top

>emb|CT009546.4| Mouse DNA sequence from clone RP23-111H19 on chromosome 13, complete
              sequence
          Length = 207769

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 474    agatcctgaacagtctactg 493
              ||||||||||||||||||||
Sbjct: 175180 agatcctgaacagtctactg 175199



to top

>gb|AC116319.4| Mus musculus BAC clone RP23-265J2 from chromosome 14, complete sequence
          Length = 170494

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 135   aaagaaaggaagagaagaag 154
             ||||||||||||||||||||
Sbjct: 68398 aaagaaaggaagagaagaag 68417



to top

>gb|AC127371.3| Mus musculus BAC clone RP23-35D4 from 15, complete sequence
          Length = 210688

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 135  aaagaaaggaagagaagaag 154
            ||||||||||||||||||||
Sbjct: 8126 aaagaaaggaagagaagaag 8107



to top

>gb|AC122191.4| Mus musculus BAC clone RP23-42J4 from 6, complete sequence
          Length = 250147

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 134  caaagaaaggaagagaagaa 153
            ||||||||||||||||||||
Sbjct: 9864 caaagaaaggaagagaagaa 9883



to top

>gb|AC116138.21| Mus musculus chromosome 10, clone RP23-123D17, complete sequence
          Length = 219004

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 144    aagagaagaagagcagggtc 163
              ||||||||||||||||||||
Sbjct: 160492 aagagaagaagagcagggtc 160473



to top

>ref|XM_718550.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY03491)
            partial mRNA
          Length = 5931

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 542  tacaaggtgaagaaggacaa 561
            ||||||||||||||||||||
Sbjct: 3854 tacaaggtgaagaaggacaa 3873



to top

>ref|XM_738389.1| Plasmodium chabaudi chabaudi hypothetical protein (PC001078.02.0)
           partial mRNA
          Length = 2412

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 542 tacaaggtgaagaaggacaa 561
           ||||||||||||||||||||
Sbjct: 338 tacaaggtgaagaaggacaa 357



to top

>gb|AY327116.1| Homo sapiens laminin alpha 3 splice variant b2 (LAMA3) mRNA, complete
            cds; alternatively spliced
          Length = 9834

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 278  gatctgccaagaaaagctaa 297
            ||||||||||||||||||||
Sbjct: 6463 gatctgccaagaaaagctaa 6482



to top

>gb|AY327115.1| Homo sapiens laminin alpha 3 splice variant b1 (LAMA3) mRNA, complete
            cds; alternatively spliced
          Length = 10002

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 278  gatctgccaagaaaagctaa 297
            ||||||||||||||||||||
Sbjct: 6631 gatctgccaagaaaagctaa 6650



to top

>gb|AY327114.1| Homo sapiens laminin alpha 3 splice variant a (LAMA3) mRNA, complete
            cds; alternatively spliced
          Length = 5007

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 278  gatctgccaagaaaagctaa 297
            ||||||||||||||||||||
Sbjct: 1636 gatctgccaagaaaagctaa 1655



to top

>emb|AL451137.8| Human DNA sequence from clone RP11-18A15 on chromosome 9 Contains a CpG
             island, complete sequence
          Length = 162837

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 138   gaaaggaagagaagaagagc 157
             ||||||||||||||||||||
Sbjct: 19518 gaaaggaagagaagaagagc 19537



to top

>emb|AL390776.16| Human DNA sequence from clone RP11-182I23 on chromosome 1 Contains the
             5' end of the PRNPIP gene for prion protein interacting
             protein and a CpG island, complete sequence
          Length = 86428

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 135   aaagaaaggaagagaagaag 154
             ||||||||||||||||||||
Sbjct: 64051 aaagaaaggaagagaagaag 64032



to top

>gb|AY302574.2| Thunnus thynnus thynnus mitochondrion, complete genome
          Length = 16526

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 125   ccttttgctcaaagaaagga 144
             ||||||||||||||||||||
Sbjct: 15584 ccttttgctcaaagaaagga 15603



to top

>gb|AC117633.6| Mus musculus, clone RP23-200C8, complete sequence
          Length = 224221

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 135    aaagaaaggaagagaagaag 154
              ||||||||||||||||||||
Sbjct: 194528 aaagaaaggaagagaagaag 194509



to top

>gb|AF197152.1| Acanthocybium solandri isolate Bim15B cytochrome b (cytb) gene,
           partial cds; tRNA-Thr, tRNA-Pro, control region and
           tRNA-Phe genes, complete sequence; and 12S ribosomal
           RNA, partial sequence; mitochondrial genes for
           mitochondrial products
          Length = 1829

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 381 ccttttgctcaaagaaagga 400



to top

>gb|AF197149.1| Acanthocybium solandri isolate Wah65 cytochrome b (cytb) gene,
           partial cds; tRNA-Thr, tRNA-Pro, control region and
           tRNA-Phe genes, complete sequence; and 12S ribosomal
           RNA, partial sequence; mitochondrial genes for
           mitochondrial products
          Length = 1831

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 382 ccttttgctcaaagaaagga 401



to top

>emb|X85108.1|HSA3BLAMN H.sapiens mRNA for laminin alpha 3b chain
          Length = 3994

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 278  gatctgccaagaaaagctaa 297
            ||||||||||||||||||||
Sbjct: 2050 gatctgccaagaaaagctaa 2069



to top

>emb|X85107.1|HSA3ALAMN H.sapiens mRNA for laminin alpha 3a chain
          Length = 3766

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 278  gatctgccaagaaaagctaa 297
            ||||||||||||||||||||
Sbjct: 1822 gatctgccaagaaaagctaa 1841



to top

>emb|X84900.1|HSL5A3BC H.sapiens mRNA for laminin-5, alpha3b chain
          Length = 5712

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 278  gatctgccaagaaaagctaa 297
            ||||||||||||||||||||
Sbjct: 2050 gatctgccaagaaaagctaa 2069



to top

>gb|AC163356.2| Mus musculus BAC clone RP23-13A21 from chromosome 6, complete sequence
          Length = 212612

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 134    caaagaaaggaagagaagaa 153
              ||||||||||||||||||||
Sbjct: 166193 caaagaaaggaagagaagaa 166212



to top

>gb|AC108688.5| Homo sapiens 3 BAC RP11-775J23 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 183336

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 167   aaacaagaaaagaacagtcttgggaatt 194
             |||||||||||| |||| ||||||||||
Sbjct: 94739 aaacaagaaaagcacaggcttgggaatt 94766



to top

>gb|AC016587.9| Homo sapiens chromosome 19 clone CTD-2632B17, complete sequence
          Length = 155221

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 137    agaaaggaagagaagaagag 156
              ||||||||||||||||||||
Sbjct: 149450 agaaaggaagagaagaagag 149469



to top

>gb|AC100860.2| Homo sapiens chromosome 8, clone RP11-128L5, complete sequence
          Length = 181610

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 134    caaagaaaggaagagaagaa 153
              ||||||||||||||||||||
Sbjct: 139804 caaagaaaggaagagaagaa 139785



to top

>gb|AC087224.13| Homo sapiens chromosome 18, clone RP11-52C21, complete sequence
          Length = 156222

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 134   caaagaaaggaagagaagaa 153
             ||||||||||||||||||||
Sbjct: 78701 caaagaaaggaagagaagaa 78682



to top

>dbj|AP007162.1| Aspergillus oryzae RIB40 genomic DNA, SC102
          Length = 1779707

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 134    caaagaaaggaagagaagaa 153
              ||||||||||||||||||||
Sbjct: 314836 caaagaaaggaagagaagaa 314855



to top

>gb|AC107021.4| Homo sapiens 3 BAC RP11-274H2 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 161731

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 174   aaaagaacagtcttgggaatttga 197
             ||||||||||||||||||| ||||
Sbjct: 66646 aaaagaacagtcttgggaacttga 66669



to top

>gb|AC010614.8| Homo sapiens chromosome 19 clone CTD-2518G19, complete sequence
          Length = 158595

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 137  agaaaggaagagaagaagag 156
            ||||||||||||||||||||
Sbjct: 4133 agaaaggaagagaagaagag 4152



to top

>gb|AC010754.10| Homo sapiens chromosome 18, clone RP11-403A21, complete sequence
          Length = 189752

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 278   gatctgccaagaaaagctaa 297
             ||||||||||||||||||||
Sbjct: 13970 gatctgccaagaaaagctaa 13989



to top

>ref|NM_000227.2| Homo sapiens laminin, alpha 3 (LAMA3), transcript variant 2, mRNA
          Length = 5601

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 278  gatctgccaagaaaagctaa 297
            ||||||||||||||||||||
Sbjct: 1807 gatctgccaagaaaagctaa 1826



to top

>ref|NM_198129.1| Homo sapiens laminin, alpha 3 (LAMA3), transcript variant 1, mRNA
          Length = 10511

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 278  gatctgccaagaaaagctaa 297
            ||||||||||||||||||||
Sbjct: 6717 gatctgccaagaaaagctaa 6736



to top

>gb|CP000254.1| Methanospirillum hungatei JF-1, complete genome
          Length = 3544738

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 350     ggtggaaagtttgataaaaa 369
               ||||||||||||||||||||
Sbjct: 1174325 ggtggaaagtttgataaaaa 1174344



to top

>emb|CR406712.1| Gallus gallus finished cDNA, clone ChEST990p13
          Length = 776

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 5   tgcatgggaatgagcaaact 24
           ||||||||||||||||||||
Sbjct: 431 tgcatgggaatgagcaaact 412



to top

>gb|AC159295.2| Mus musculus BAC clone RP23-273L18 from chromosome 13, complete
             sequence
          Length = 165475

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 137   agaaaggaagagaagaagag 156
             ||||||||||||||||||||
Sbjct: 14385 agaaaggaagagaagaagag 14366



to top

>gb|AC154441.3| Mus musculus BAC clone RP24-176O5 from chromosome 13, complete sequence
          Length = 169507

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 137    agaaaggaagagaagaagag 156
              ||||||||||||||||||||
Sbjct: 161526 agaaaggaagagaagaagag 161507



to top

>gb|AC154824.2| Mus musculus BAC clone RP24-540A17 from chromosome 13, complete sequence
          Length = 164494

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 137    agaaaggaagagaagaagag 156
              ||||||||||||||||||||
Sbjct: 110617 agaaaggaagagaagaagag 110598



to top

>gb|AF330048.1|AF330048 Mus musculus chromosome 13 clone CITB-332O23, partial sequence
          Length = 18611

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 474   agatcctgaacagtctactg 493
             ||||||||||||||||||||
Sbjct: 11505 agatcctgaacagtctactg 11486



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 137      agaaaggaagagaagaagag 156
                ||||||||||||||||||||
Sbjct: 27688916 agaaaggaagagaagaagag 27688935



to top

>dbj|AB107369.1| Homo sapiens LAMA3 gene for laminin alpha 3b chain, complete cds
          Length = 10002

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 278  gatctgccaagaaaagctaa 297
            ||||||||||||||||||||
Sbjct: 6631 gatctgccaagaaaagctaa 6650



to top

>gb|AC025041.7|AC025041 Homo sapiens chromosome 15 clone RP11-316P21 map 15q21.2, complete
              sequence
          Length = 173387

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 136    aagaaaggaagagaagaaga 155
              ||||||||||||||||||||
Sbjct: 135274 aagaaaggaagagaagaaga 135293



to top

>gb|AC006977.3|AC006977 Homo sapiens PAC clone RP5-1091E12 from 7p11.2-p21, complete sequence
          Length = 177998

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 135  aaagaaaggaagagaagaagagca 158
            ||||||||||||| ||||||||||
Sbjct: 3024 aaagaaaggaagaaaagaagagca 3047



to top

>gb|BC043618.1| Homo sapiens, Similar to laminin, alpha 3, clone IMAGE:6154551, mRNA
          Length = 4937

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 278  gatctgccaagaaaagctaa 297
            ||||||||||||||||||||
Sbjct: 1209 gatctgccaagaaaagctaa 1228



to top

>gb|AC145409.3| Macropus eugenii clone ME_KBa-528O13, complete sequence
          Length = 140426

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 13     aatgagcaaactaattcctg 32
              ||||||||||||||||||||
Sbjct: 108956 aatgagcaaactaattcctg 108937



to top

>dbj|AP006060.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0135D07
          Length = 170587

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 137    agaaaggaagagaagaagag 156
              ||||||||||||||||||||
Sbjct: 168585 agaaaggaagagaagaagag 168604



to top

>dbj|AP005775.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OSJNBb0005A04
          Length = 140723

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 137   agaaaggaagagaagaagag 156
             ||||||||||||||||||||
Sbjct: 74782 agaaaggaagagaagaagag 74801



to top

>dbj|AB167978.1| Human coxsackievirus A9 VP1 gene for capsid protein VP1, partial
           cds, isolate:03-132NPR2
          Length = 757

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 273 aagctgatctgccaagaaaa 292
           ||||||||||||||||||||
Sbjct: 82  aagctgatctgccaagaaaa 63



to top

>dbj|AB097669.1| Thunnus thynnus thynnus mitochondrial DNA, complete genome
          Length = 16526

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 125   ccttttgctcaaagaaagga 144
             ||||||||||||||||||||
Sbjct: 16449 ccttttgctcaaagaaagga 16468



to top

>dbj|AB107082.1| Auxis thazard genes for tRNA-Thr, tRNA-Pro, D-loop region,
           tRNA-Phe, 12S rRNA, partial and complete sequence,
           haplotype:ATHcrH-01
          Length = 1263

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 41  ccttttgctcaaagaaagga 60



to top

>dbj|AB107081.1| Auxis rochei genes for tRNA-Thr, tRNA-Pro, D-loop region, tRNA-Phe,
           12S rRNA, partial and complete sequence,
           haplotype:AROcrH2-17
          Length = 1259

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 41  ccttttgctcaaagaaagga 60



to top

>dbj|AB107080.1| Auxis rochei genes for tRNA-Thr, tRNA-Pro, D-loop region, tRNA-Phe,
           12S rRNA, partial and complete sequence,
           haplotype:AROcrH2-16
          Length = 1259

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 41  ccttttgctcaaagaaagga 60



to top

>dbj|AB107079.1| Auxis rochei genes for tRNA-Thr, tRNA-Pro, D-loop region, tRNA-Phe,
           12S rRNA, partial and complete sequence,
           haplotype:AROcrH2-15
          Length = 1259

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 41  ccttttgctcaaagaaagga 60



to top

>dbj|AB107078.1| Auxis rochei genes for tRNA-Thr, tRNA-Pro, D-loop region, tRNA-Phe,
           12S rRNA, partial and complete sequence,
           haplotype:AROcrH2-14
          Length = 1259

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 41  ccttttgctcaaagaaagga 60



to top

>dbj|AB107077.1| Auxis rochei genes for tRNA-Thr, tRNA-Pro, D-loop region, tRNA-Phe,
           12S rRNA, partial and complete sequence,
           haplotype:AROcrH2-13
          Length = 1259

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 41  ccttttgctcaaagaaagga 60



to top

>dbj|AB107076.1| Auxis rochei genes for tRNA-Thr, tRNA-Pro, D-loop region, tRNA-Phe,
           12S rRNA, partial and complete sequence,
           haplotype:AROcrH2-12
          Length = 1259

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 41  ccttttgctcaaagaaagga 60



to top

>dbj|AB107075.1| Auxis rochei genes for tRNA-Thr, tRNA-Pro, D-loop region, tRNA-Phe,
           12S rRNA, partial and complete sequence,
           haplotype:AROcrH2-11
          Length = 1259

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 41  ccttttgctcaaagaaagga 60



to top

>dbj|AB107074.1| Auxis rochei genes for tRNA-Thr, tRNA-Pro, D-loop region, tRNA-Phe,
           12S rRNA, partial and complete sequence,
           haplotype:AROcrH2-10
          Length = 1259

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 41  ccttttgctcaaagaaagga 60



to top

>dbj|AB107073.1| Auxis rochei genes for tRNA-Thr, tRNA-Pro, D-loop region, partial
           and complete sequence, haplotype:AROcrH2-09
          Length = 461

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 41  ccttttgctcaaagaaagga 60



to top

>dbj|AB107072.1| Auxis rochei genes for tRNA-Thr, tRNA-Pro, D-loop region, tRNA-Phe,
           12S rRNA, partial and complete sequence,
           haplotype:AROcrH2-08
          Length = 1258

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 41  ccttttgctcaaagaaagga 60



to top

>dbj|AB107071.1| Auxis rochei genes for tRNA-Thr, tRNA-Pro, D-loop region, tRNA-Phe,
           12S rRNA, partial and complete sequence,
           haplotype:AROcrH2-07
          Length = 1259

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 41  ccttttgctcaaagaaagga 60



to top

>dbj|AB107070.1| Auxis rochei genes for tRNA-Thr, tRNA-Pro, D-loop region, tRNA-Phe,
           12S rRNA, partial and complete sequence,
           haplotype:AROcrH2-06
          Length = 1259

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 41  ccttttgctcaaagaaagga 60



to top

>dbj|AB107069.1| Auxis rochei genes for tRNA-Thr, tRNA-Pro, D-loop region, tRNA-Phe,
           12S rRNA, partial and complete sequence,
           haplotype:AROcrH2-05
          Length = 1259

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 41  ccttttgctcaaagaaagga 60



to top

>dbj|AB107068.1| Auxis rochei genes for tRNA-Thr, tRNA-Pro, D-loop region, tRNA-Phe,
           12S rRNA, partial and complete sequence,
           haplotype:AROcrH2-04
          Length = 1259

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 41  ccttttgctcaaagaaagga 60



to top

>dbj|AB107067.1| Auxis rochei genes for tRNA-Thr, tRNA-Pro, D-loop region, tRNA-Phe,
           12S rRNA, partial and complete sequence,
           haplotype:AROcrH2-03
          Length = 1259

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 41  ccttttgctcaaagaaagga 60



to top

>dbj|AB107066.1| Auxis rochei genes for tRNA-Thr, tRNA-Pro, D-loop region, tRNA-Phe,
           12S rRNA, partial and complete sequence,
           haplotype:AROcrH2-02
          Length = 1259

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 41  ccttttgctcaaagaaagga 60



to top

>dbj|AB107065.1| Auxis rochei genes for tRNA-Thr, tRNA-Pro, D-loop region, tRNA-Phe,
           12S rRNA, partial and complete sequence,
           haplotype:AROcrH2-01
          Length = 1259

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 41  ccttttgctcaaagaaagga 60



to top

>dbj|AB107064.1| Auxis rochei genes for tRNA-Thr, tRNA-Pro, D-loop region, tRNA-Phe,
           12S rRNA, partial and complete sequence,
           haplotype:AROcrH1-11
          Length = 1260

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 41  ccttttgctcaaagaaagga 60



to top

>dbj|AB107063.1| Auxis rochei genes for tRNA-Thr, tRNA-Pro, D-loop region, tRNA-Phe,
           12S rRNA, partial and complete sequence,
           haplotype:AROcrH1-10
          Length = 1260

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 41  ccttttgctcaaagaaagga 60



to top

>dbj|AB107062.1| Auxis rochei genes for tRNA-Thr, tRNA-Pro, D-loop region, tRNA-Phe,
           12S rRNA, partial and complete sequence,
           haplotype:AROcrH1-09
          Length = 1258

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 41  ccttttgctcaaagaaagga 60



to top

>dbj|AB107061.1| Auxis rochei genes for tRNA-Thr, tRNA-Pro, D-loop region, tRNA-Phe,
           12S rRNA, partial and complete sequence,
           haplotype:AROcrH1-08
          Length = 1257

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 41  ccttttgctcaaagaaagga 60



to top

>dbj|AB107060.1| Auxis rochei genes for tRNA-Thr, tRNA-Pro, D-loop region, tRNA-Phe,
           12S rRNA, partial and complete sequence,
           haplotype:AROcrH1-07
          Length = 1258

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 41  ccttttgctcaaagaaagga 60



to top

>dbj|AB107058.1| Auxis rochei genes for tRNA-Thr, tRNA-Pro, D-loop region, tRNA-Phe,
           12S rRNA, partial and complete sequence,
           haplotype:AROcrH1-05
          Length = 1258

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 41  ccttttgctcaaagaaagga 60



to top

>dbj|AB107057.1| Auxis rochei genes for tRNA-Thr, tRNA-Pro, D-loop region, tRNA-Phe,
           12S rRNA, partial and complete sequence,
           haplotype:AROcrH1-04
          Length = 1259

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 41  ccttttgctcaaagaaagga 60



to top

>dbj|AB107056.1| Auxis rochei genes for tRNA-Thr, tRNA-Pro, D-loop region, tRNA-Phe,
           12S rRNA, partial and complete sequence,
           haplotype:AROcrH1-03
          Length = 1257

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 41  ccttttgctcaaagaaagga 60



to top

>dbj|AB107055.1| Auxis rochei genes for tRNA-Thr, tRNA-Pro, D-loop region, tRNA-Phe,
           12S rRNA, partial and complete sequence,
           haplotype:AROcrH1-02
          Length = 1256

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 41  ccttttgctcaaagaaagga 60



to top

>dbj|AB107054.1| Auxis rochei genes for tRNA-Thr, tRNA-Pro, D-loop region, tRNA-Phe,
           12S rRNA, partial and complete sequence,
           haplotype:AROcrH1-01
          Length = 1257

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 41  ccttttgctcaaagaaagga 60



to top

>dbj|AB105447.1| Auxis thazard mitochondrial DNA, complete genome
          Length = 16506

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 125   ccttttgctcaaagaaagga 144
             ||||||||||||||||||||
Sbjct: 16429 ccttttgctcaaagaaagga 16448



to top

>dbj|AB105165.1| Auxis rochei mitochondrial DNA, complete genome, haplotype:II
             Ecuadorian
          Length = 16503

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 125   ccttttgctcaaagaaagga 144
             ||||||||||||||||||||
Sbjct: 16426 ccttttgctcaaagaaagga 16445



to top

>dbj|AB103468.1| Auxis rochei mitochondrial DNA, complete genome, haplotype:II
             Mediterranean
          Length = 16503

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 125   ccttttgctcaaagaaagga 144
             ||||||||||||||||||||
Sbjct: 16426 ccttttgctcaaagaaagga 16445



to top

>dbj|AB103467.1| Auxis rochei mitochondrial DNA, complete genome, haplotype:I
          Length = 16501

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 125   ccttttgctcaaagaaagga 144
             ||||||||||||||||||||
Sbjct: 16424 ccttttgctcaaagaaagga 16443



to top

>dbj|AB101291.1| Thunnus alalunga mitochondrial DNA, complete genome
          Length = 16527

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 125   ccttttgctcaaagaaagga 144
             ||||||||||||||||||||
Sbjct: 16450 ccttttgctcaaagaaagga 16469



to top

>dbj|AB101290.1| Katsuwonus pelamis mitochondrial DNA, complete genome
          Length = 16515

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 125   ccttttgctcaaagaaagga 144
             ||||||||||||||||||||
Sbjct: 16438 ccttttgctcaaagaaagga 16457



to top

>dbj|AB106311.1| Thunnus thynnus thynnus mitochondrial genes for tRNA-Thr, tRNA-Pro,
           D-loop, tRNA-Phe, 12S rRNA, partial and complete
           sequence, haplotype:Tth Hp29
          Length = 1255

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 30  ccttttgctcaaagaaagga 49



to top

>dbj|AB106310.1| Thunnus thynnus thynnus mitochondrial genes for tRNA-Thr, tRNA-Pro,
           D-loop, tRNA-Phe, 12S rRNA, partial and complete
           sequence, haplotype:Tth Hp25
          Length = 1257

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 30  ccttttgctcaaagaaagga 49



to top

>dbj|AB106309.1| Thunnus thynnus thynnus mitochondrial genes for tRNA-Thr, tRNA-Pro,
           D-loop, tRNA-Phe, 12S rRNA, partial and complete
           sequence, haplotype:Tth Hp18
          Length = 1257

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 30  ccttttgctcaaagaaagga 49



to top

>dbj|AB106308.1| Thunnus thynnus thynnus mitochondrial genes for tRNA-Thr, tRNA-Pro,
           D-loop, tRNA-Phe, 12S rRNA, partial and complete
           sequence, haplotype:Tth Hp11
          Length = 1258

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 30  ccttttgctcaaagaaagga 49



to top

>dbj|AB106307.1| Thunnus thynnus thynnus mitochondrial genes for tRNA-Thr, tRNA-Pro,
           D-loop, tRNA-Phe, 12S rRNA, partial and complete
           sequence, haplotype:Tth Hp28
          Length = 1259

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 30  ccttttgctcaaagaaagga 49



to top

>dbj|AB106306.1| Thunnus thynnus thynnus mitochondrial genes for tRNA-Thr, tRNA-Pro,
           D-loop, tRNA-Phe, 12S rRNA, partial and complete
           sequence, haplotype:Tth Hp24
          Length = 1259

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 30  ccttttgctcaaagaaagga 49



to top

>dbj|AB106305.1| Thunnus thynnus thynnus mitochondrial genes for tRNA-Thr, tRNA-Pro,
           D-loop, tRNA-Phe, 12S rRNA, partial and complete
           sequence, haplotype:Tth Hp15
          Length = 1259

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 30  ccttttgctcaaagaaagga 49



to top

>dbj|AB106304.1| Thunnus thynnus thynnus mitochondrial genes for tRNA-Thr, tRNA-Pro,
           D-loop, tRNA-Phe, 12S rRNA, partial and complete
           sequence, haplotype:Tth Hp6
          Length = 1259

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 30  ccttttgctcaaagaaagga 49



to top

>dbj|AB106303.1| Thunnus thynnus thynnus mitochondrial genes for tRNA-Thr, tRNA-Pro,
           D-loop, tRNA-Phe, 12S rRNA, partial and complete
           sequence, haplotype:Tth Hp27
          Length = 1258

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 30  ccttttgctcaaagaaagga 49



to top

>dbj|AB106302.1| Thunnus thynnus thynnus mitochondrial genes for tRNA-Thr, tRNA-Pro,
           D-loop, tRNA-Phe, 12S rRNA, partial and complete
           sequence, haplotype:Tth Hp26
          Length = 1258

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 30  ccttttgctcaaagaaagga 49



to top

>dbj|AB106301.1| Thunnus thynnus thynnus mitochondrial genes for tRNA-Thr, tRNA-Pro,
           D-loop, tRNA-Phe, 12S rRNA, partial and complete
           sequence, haplotype:Tth Hp23
          Length = 1258

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 30  ccttttgctcaaagaaagga 49



to top

>dbj|AB106300.1| Thunnus thynnus thynnus mitochondrial genes for tRNA-Thr, tRNA-Pro,
           D-loop, tRNA-Phe, 12S rRNA, partial and complete
           sequence, haplotype:Tth Hp22
          Length = 1258

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 30  ccttttgctcaaagaaagga 49



to top

>dbj|AB106299.1| Thunnus thynnus thynnus mitochondrial genes for tRNA-Thr, tRNA-Pro,
           D-loop, tRNA-Phe, 12S rRNA, partial and complete
           sequence, haplotype:Tth Hp21
          Length = 1258

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 30  ccttttgctcaaagaaagga 49



to top

>dbj|AB106298.1| Thunnus thynnus thynnus mitochondrial genes for tRNA-Thr, tRNA-Pro,
           D-loop, tRNA-Phe, 12S rRNA, partial and complete
           sequence, haplotype:Tth Hp20
          Length = 1258

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 30  ccttttgctcaaagaaagga 49



to top

>dbj|AB106297.1| Thunnus thynnus thynnus mitochondrial genes for tRNA-Thr, tRNA-Pro,
           D-loop, tRNA-Phe, 12S rRNA, partial and complete
           sequence, haplotype:Tth Hp19
          Length = 1258

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 30  ccttttgctcaaagaaagga 49



to top

>dbj|AB106296.1| Thunnus thynnus thynnus mitochondrial genes for tRNA-Thr, tRNA-Pro,
           D-loop, tRNA-Phe, 12S rRNA, partial and complete
           sequence, haplotype:Tth Hp17
          Length = 1258

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 30  ccttttgctcaaagaaagga 49



to top

>dbj|AB106295.1| Thunnus thynnus thynnus mitochondrial genes for tRNA-Thr, tRNA-Pro,
           D-loop, tRNA-Phe, 12S rRNA, partial and complete
           sequence, haplotype:Tth Hp16
          Length = 1258

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 30  ccttttgctcaaagaaagga 49



to top

>dbj|AB106294.1| Thunnus thynnus thynnus mitochondrial genes for tRNA-Thr, tRNA-Pro,
           D-loop, tRNA-Phe, 12S rRNA, partial and complete
           sequence, haplotype:Tth Hp14
          Length = 1258

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 30  ccttttgctcaaagaaagga 49



to top

>dbj|AB106293.1| Thunnus thynnus thynnus mitochondrial genes for tRNA-Thr, tRNA-Pro,
           D-loop, tRNA-Phe, 12S rRNA, partial and complete
           sequence, haplotype:Tth Hp13
          Length = 1258

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 30  ccttttgctcaaagaaagga 49



to top

>dbj|AB106292.1| Thunnus thynnus thynnus mitochondrial genes for tRNA-Thr, tRNA-Pro,
           D-loop, tRNA-Phe, 12S rRNA, partial and complete
           sequence, haplotype:Tth Hp12
          Length = 1258

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 30  ccttttgctcaaagaaagga 49



to top

>dbj|AB106291.1| Thunnus thynnus thynnus mitochondrial genes for tRNA-Thr, tRNA-Pro,
           D-loop, tRNA-Phe, 12S rRNA, partial and complete
           sequence, haplotype:Tth Hp10
          Length = 1258

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 30  ccttttgctcaaagaaagga 49



to top

>dbj|AB106290.1| Thunnus thynnus thynnus mitochondrial genes for tRNA-Thr, tRNA-Pro,
           D-loop, tRNA-Phe, 12S rRNA, partial and complete
           sequence, haplotype:Tth Hp9
          Length = 1258

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 30  ccttttgctcaaagaaagga 49



to top

>dbj|AB106289.1| Thunnus thynnus thynnus mitochondrial genes for tRNA-Thr, tRNA-Pro,
           D-loop, tRNA-Phe, 12S rRNA, partial and complete
           sequence, haplotype:Tth Hp8
          Length = 1258

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 30  ccttttgctcaaagaaagga 49



to top

>dbj|AB106288.1| Thunnus thynnus thynnus mitochondrial genes for tRNA-Thr, tRNA-Pro,
           D-loop, tRNA-Phe, 12S rRNA, partial and complete
           sequence, haplotype:Tth Hp7
          Length = 1258

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 30  ccttttgctcaaagaaagga 49



to top

>dbj|AB106287.1| Thunnus thynnus thynnus mitochondrial genes for tRNA-Thr, tRNA-Pro,
           D-loop, tRNA-Phe, 12S rRNA, partial and complete
           sequence, haplotype:Tth Hp5
          Length = 1258

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 30  ccttttgctcaaagaaagga 49



to top

>dbj|AB106286.1| Thunnus thynnus thynnus mitochondrial genes for tRNA-Thr, tRNA-Pro,
           D-loop, tRNA-Phe, 12S rRNA, partial and complete
           sequence, haplotype:Tth Hp4
          Length = 1258

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 30  ccttttgctcaaagaaagga 49



to top

>dbj|AB106285.1| Thunnus thynnus thynnus mitochondrial genes for tRNA-Thr, tRNA-Pro,
           D-loop, tRNA-Phe, 12S rRNA, partial and complete
           sequence, haplotype:Tth Hp3
          Length = 1258

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 30  ccttttgctcaaagaaagga 49



to top

>dbj|AB106284.1| Thunnus thynnus thynnus mitochondrial genes for tRNA-Thr, tRNA-Pro,
           D-loop, tRNA-Phe, 12S rRNA, partial and complete
           sequence, haplotype:Tth Hp2
          Length = 1258

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 30  ccttttgctcaaagaaagga 49



to top

>dbj|AB106283.1| Thunnus thynnus thynnus mitochondrial genes for tRNA-Thr, tRNA-Pro,
           D-loop, tRNA-Phe, 12S rRNA, partial and complete
           sequence, haplotype:Tth Hp1
          Length = 1259

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 30  ccttttgctcaaagaaagga 49



to top

>gb|AC004254.1|AC004254 Homo sapiens BAC clone CTB-158K20 from 1p32, complete sequence
          Length = 93821

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 135   aaagaaaggaagagaagaag 154
             ||||||||||||||||||||
Sbjct: 41506 aaagaaaggaagagaagaag 41487



to top

>emb|AL442639.2|HS5P15 Homo sapiens chromosome 9 BAC RP11-5P15, complete sequence
          Length = 165299

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 138    gaaaggaagagaagaagagc 157
              ||||||||||||||||||||
Sbjct: 128710 gaaaggaagagaagaagagc 128729



to top

>gb|AE001437.1| Clostridium acetobutylicum ATCC 824, complete genome
          Length = 3940880

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 175     aaagaacagtcttgggaatt 194
               ||||||||||||||||||||
Sbjct: 1228743 aaagaacagtcttgggaatt 1228762



to top

>dbj|AK064865.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000I09, full
           insert sequence
          Length = 3363

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 137 agaaaggaagagaagaagag 156
           ||||||||||||||||||||
Sbjct: 961 agaaaggaagagaagaagag 942



to top

>gb|AY193545.1|AY193545S1 Lactuca sativa clone TDM resistance protein RGC2 (RGC2) gene,
           partial cds
          Length = 6843

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 199 gaatgctgcaaaagttggtg 218
           ||||||||||||||||||||
Sbjct: 691 gaatgctgcaaaagttggtg 710



to top

>gb|AC110216.10| Mus musculus chromosome 18, clone RP24-502I6, complete sequence
          Length = 201138

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 135    aaagaaaggaagagaagaag 154
              ||||||||||||||||||||
Sbjct: 103562 aaagaaaggaagagaagaag 103543



to top

>gb|AE015924.1| Porphyromonas gingivalis W83, complete genome
          Length = 2343476

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 133     tcaaagaaaggaagagaaga 152
               ||||||||||||||||||||
Sbjct: 1534282 tcaaagaaaggaagagaaga 1534263



 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 133    tcaaagaaaggaagagaaga 152
              ||||||||||||||||||||
Sbjct: 881380 tcaaagaaaggaagagaaga 881399



to top

>gb|AC109616.9| Mus musculus chromosome 19, clone RP23-449C1, complete sequence
          Length = 167801

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 136    aagaaaggaagagaagaaga 155
              ||||||||||||||||||||
Sbjct: 160848 aagaaaggaagagaagaaga 160829



to top

>dbj|AB099716.1| Euthynnus alletteratus mitochondrial DNA, complete genome
          Length = 16520

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 125   ccttttgctcaaagaaagga 144
             ||||||||||||||||||||
Sbjct: 16443 ccttttgctcaaagaaagga 16462



to top

>gb|AC148326.2| Mus musculus BAC clone RP24-377D18 from 6, complete sequence
          Length = 177503

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 134    caaagaaaggaagagaagaa 153
              ||||||||||||||||||||
Sbjct: 104786 caaagaaaggaagagaagaa 104767



to top

>dbj|AB208853.1| Homo sapiens mRNA for Laminin alpha 3b chain variant protein
          Length = 4573

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 278 gatctgccaagaaaagctaa 297
           ||||||||||||||||||||
Sbjct: 857 gatctgccaagaaaagctaa 876



to top

>gb|U27463.1|CGU27463 Cricetinae gen. sp. CPP-32 mRNA, complete cds
          Length = 2395

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 127  ttttgctcaaagaaaggaag 146
            ||||||||||||||||||||
Sbjct: 2217 ttttgctcaaagaaaggaag 2236



to top

>dbj|AB119171.1| Auxis rochei mitochondrial genes for tRNA-Thr, tRNA-Pro, D-loop,
           partial and complete sequence, haplotype:AROcrH2-31
          Length = 591

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 33  ccttttgctcaaagaaagga 52



to top

>dbj|AB119170.1| Auxis rochei mitochondrial genes for tRNA-Thr, tRNA-Pro, D-loop,
           partial and complete sequence, haplotype:AROcrH2-30
          Length = 591

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 33  ccttttgctcaaagaaagga 52



to top

>dbj|AB119169.1| Auxis rochei mitochondrial genes for tRNA-Thr, tRNA-Pro, D-loop,
           partial and complete sequence, haplotype:AROcrH2-29
          Length = 591

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 33  ccttttgctcaaagaaagga 52



to top

>dbj|AB119168.1| Auxis rochei mitochondrial genes for tRNA-Thr, tRNA-Pro, D-loop,
           partial and complete sequence, haplotype:AROcrH2-28
          Length = 591

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 33  ccttttgctcaaagaaagga 52



to top

>dbj|AB119167.1| Auxis rochei mitochondrial genes for tRNA-Thr, tRNA-Pro, D-loop,
           partial and complete sequence, haplotype:AROcrH2-27
          Length = 591

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 33  ccttttgctcaaagaaagga 52



to top

>dbj|AB119166.1| Auxis rochei mitochondrial genes for tRNA-Thr, tRNA-Pro, D-loop,
           partial and complete sequence, haplotype:AROcrH2-26
          Length = 591

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 33  ccttttgctcaaagaaagga 52



to top

>dbj|AB119165.1| Auxis rochei mitochondrial genes for tRNA-Thr, tRNA-Pro, D-loop,
           partial and complete sequence, haplotype:AROcrH2-25
          Length = 591

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 33  ccttttgctcaaagaaagga 52



to top

>dbj|AB119164.1| Auxis rochei mitochondrial genes for tRNA-Thr, tRNA-Pro, D-loop,
           partial and complete sequence, haplotype:AROcrH2-24
          Length = 591

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 33  ccttttgctcaaagaaagga 52



to top

>dbj|AB119163.1| Auxis rochei mitochondrial genes for tRNA-Thr, tRNA-Pro, D-loop,
           partial and complete sequence, haplotype:AROcrH2-23
          Length = 591

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 33  ccttttgctcaaagaaagga 52



to top

>dbj|AB119162.1| Auxis rochei mitochondrial genes for tRNA-Thr, tRNA-Pro, D-loop,
           partial and complete sequence, haplotype:AROcrH2-22
          Length = 590

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 33  ccttttgctcaaagaaagga 52



to top

>dbj|AB119161.1| Auxis rochei mitochondrial genes for tRNA-Thr, tRNA-Pro, D-loop,
           partial and complete sequence, haplotype:AROcrH2-21
          Length = 591

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 33  ccttttgctcaaagaaagga 52



to top

>dbj|AB119160.1| Auxis rochei mitochondrial genes for tRNA-Thr, tRNA-Pro, D-loop,
           partial and complete sequence, haplotype:AROcrH2-20
          Length = 591

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 33  ccttttgctcaaagaaagga 52



to top

>dbj|AB119159.1| Auxis rochei mitochondrial genes for tRNA-Thr, tRNA-Pro, D-loop,
           partial and complete sequence, haplotype:AROcrH2-19
          Length = 591

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 33  ccttttgctcaaagaaagga 52



to top

>dbj|AB119158.1| Auxis rochei mitochondrial genes for tRNA-Thr, tRNA-Pro, D-loop,
           partial and complete sequence, haplotype:AROcrH2-18
          Length = 591

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 33  ccttttgctcaaagaaagga 52



to top

>dbj|AB119157.1| Auxis rochei mitochondrial genes for tRNA-Thr, tRNA-Pro, D-loop,
           partial and complete sequence, haplotype:AROcrH1-28
          Length = 590

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 33  ccttttgctcaaagaaagga 52



to top

>dbj|AB119156.1| Auxis rochei mitochondrial genes for tRNA-Thr, tRNA-Pro, D-loop,
           partial and complete sequence, haplotype:AROcrH1-27
          Length = 590

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 33  ccttttgctcaaagaaagga 52



to top

>dbj|AB119155.1| Auxis rochei mitochondrial genes for tRNA-Thr, tRNA-Pro, D-loop,
           partial and complete sequence, haplotype:AROcrH1-26
          Length = 590

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 33  ccttttgctcaaagaaagga 52



to top

>dbj|AB119154.1| Auxis rochei mitochondrial genes for tRNA-Thr, tRNA-Pro, D-loop,
           partial and complete sequence, haplotype:AROcrH1-25
          Length = 590

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 33  ccttttgctcaaagaaagga 52



to top

>dbj|AB119153.1| Auxis rochei mitochondrial genes for tRNA-Thr, tRNA-Pro, D-loop,
           partial and complete sequence, haplotype:AROcrH1-24
          Length = 589

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 33  ccttttgctcaaagaaagga 52



to top

>dbj|AB119152.1| Auxis rochei mitochondrial genes for tRNA-Thr, tRNA-Pro, D-loop,
           partial and complete sequence, haplotype:AROcrH1-23
          Length = 590

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 33  ccttttgctcaaagaaagga 52



to top

>dbj|AB119151.1| Auxis rochei mitochondrial genes for tRNA-Thr, tRNA-Pro, D-loop,
           partial and complete sequence, haplotype:AROcrH1-22
          Length = 590

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 33  ccttttgctcaaagaaagga 52



to top

>dbj|AB119150.1| Auxis rochei mitochondrial genes for tRNA-Thr, tRNA-Pro, D-loop,
           partial and complete sequence, haplotype:AROcrH1-21
          Length = 591

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 33  ccttttgctcaaagaaagga 52



to top

>dbj|AB119149.1| Auxis rochei mitochondrial genes for tRNA-Thr, tRNA-Pro, D-loop,
           partial and complete sequence, haplotype:AROcrH1-20
          Length = 590

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 33  ccttttgctcaaagaaagga 52



to top

>dbj|AB119148.1| Auxis rochei mitochondrial genes for tRNA-Thr, tRNA-Pro, D-loop,
           partial and complete sequence, haplotype:AROcrH1-19
          Length = 590

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 33  ccttttgctcaaagaaagga 52



to top

>dbj|AB119147.1| Auxis rochei mitochondrial genes for tRNA-Thr, tRNA-Pro, D-loop,
           partial and complete sequence, haplotype:AROcrH1-18
          Length = 590

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 33  ccttttgctcaaagaaagga 52



to top

>dbj|AB119146.1| Auxis rochei mitochondrial genes for tRNA-Thr, tRNA-Pro, D-loop,
           partial and complete sequence, haplotype:AROcrH1-17
          Length = 590

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 33  ccttttgctcaaagaaagga 52



to top

>dbj|AB119145.1| Auxis rochei mitochondrial genes for tRNA-Thr, tRNA-Pro, D-loop,
           partial and complete sequence, haplotype:AROcrH1-16
          Length = 590

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 33  ccttttgctcaaagaaagga 52



to top

>dbj|AB119144.1| Auxis rochei mitochondrial genes for tRNA-Thr, tRNA-Pro, D-loop,
           partial and complete sequence, haplotype:AROcrH1-15
          Length = 590

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 33  ccttttgctcaaagaaagga 52



to top

>dbj|AB119143.1| Auxis rochei mitochondrial genes for tRNA-Thr, tRNA-Pro, D-loop,
           partial and complete sequence, haplotype:AROcrH1-14
          Length = 590

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 33  ccttttgctcaaagaaagga 52



to top

>dbj|AB119142.1| Auxis rochei mitochondrial genes for tRNA-Thr, tRNA-Pro, D-loop,
           partial and complete sequence, haplotype:AROcrH1-13
          Length = 590

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 33  ccttttgctcaaagaaagga 52



to top

>dbj|AB119141.1| Auxis rochei mitochondrial DNA, D-loop, partial sequence,
           haplotype:AROcrH1-12
          Length = 590

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 125 ccttttgctcaaagaaagga 144
           ||||||||||||||||||||
Sbjct: 33  ccttttgctcaaagaaagga 52



to top

>emb|AL808128.4| Mouse DNA sequence from clone RP23-387C21 on chromosome 2, complete
             sequence
          Length = 184736

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 135   aaagaaaggaagagaagaag 154
             ||||||||||||||||||||
Sbjct: 71002 aaagaaaggaagagaagaag 71021



to top

>gb|L34155.1|HUMLAMAA Homo sapiens laminin-related protein (LamA3) mRNA, complete cds
          Length = 5433

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 278  gatctgccaagaaaagctaa 297
            ||||||||||||||||||||
Sbjct: 1771 gatctgccaagaaaagctaa 1790



to top

>emb|AL606969.26| Mouse DNA sequence from clone RP23-331P21 on chromosome 4, complete
             sequence
          Length = 224344

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 136   aagaaaggaagagaagaaga 155
             ||||||||||||||||||||
Sbjct: 85010 aagaaaggaagagaagaaga 84991



to top

>emb|X77598.1|HSLAMIA3 H.sapiens LAM A3 mRNA for laminin alpha 3 chain
          Length = 5203

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 278  gatctgccaagaaaagctaa 297
            ||||||||||||||||||||
Sbjct: 3101 gatctgccaagaaaagctaa 3120


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,108,359
Number of Sequences: 3902068
Number of extensions: 6108359
Number of successful extensions: 139143
Number of sequences better than 10.0: 202
Number of HSP's better than 10.0 without gapping: 202
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 138606
Number of HSP's gapped (non-prelim): 523
length of query: 616
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 593
effective length of database: 17,143,297,704
effective search space: 10165975538472
effective search space used: 10165975538472
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top