ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags6k03
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AK109403.2| Oryza sativa (japonica cultivar-group) cDNA clon... 795 0.0
2dbj|AK112020.1| Oryza sativa (japonica cultivar-group) cDNA clon... 795 0.0
3dbj|AK111763.1| Oryza sativa (japonica cultivar-group) cDNA clon... 795 0.0
4ref|NM_188020.1| Oryza sativa (japonica cultivar-group), Ozsa844... 743 0.0
5dbj|AK099455.1| Oryza sativa (japonica cultivar-group) cDNA clon... 743 0.0
6dbj|AB037152.1| Oryza sativa (japonica cultivar-group) OsRPN11 m... 743 0.0
7gb|BT009132.1| Triticum aestivum clone wl1n.pk0036.c3:fis, full ... 636 e-179
8gb|AY104261.1| Zea mays PCO099067 mRNA sequence 636 e-179
9gb|AC104707.2| Oryza sativa (japonica cultivar-group) chromosome... 301 1e-78
10dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 301 1e-78
11dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 270 5e-69
12dbj|AP000969.1| Oryza sativa (japonica cultivar-group) genomic D... 270 5e-69
13ref|NM_122261.2| Arabidopsis thaliana unknown protein AT5G23540 ... 210 4e-51
14gb|AY230845.1| Arabidopsis thaliana 26S proteasome subunit RPN11... 210 4e-51
15gb|AY230844.1| Arabidopsis thaliana 26S proteasome subunit RPN11... 210 4e-51
16gb|AY230843.1| Arabidopsis thaliana 26S proteasome subunit RPN11... 210 4e-51
17gb|AY091329.1| Arabidopsis thaliana putative 26S proteasome, non... 210 4e-51
18gb|AY070073.1| Arabidopsis thaliana putative 26S proteasome, non... 210 4e-51
19emb|BX830953.1|CNS09YRU Arabidopsis thaliana Full-length cDNA Co... 210 4e-51
20gb|AY086277.1| Arabidopsis thaliana clone 23276 mRNA, complete s... 202 9e-49
21dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 194 2e-46
22dbj|AP004324.2| Oryza sativa (japonica cultivar-group) genomic D... 194 2e-46
23dbj|AK112072.1| Oryza sativa (japonica cultivar-group) cDNA clon... 194 2e-46
24dbj|AK110999.1| Oryza sativa (japonica cultivar-group) cDNA clon... 194 2e-46
25gb|BT013130.1| Lycopersicon esculentum clone 114422R, mRNA sequence 188 1e-44
26emb|AM260494.1| Platanus acerifolia partial mRNA for 26S proteas... 182 8e-43
27ref|NM_135061.2| Drosophila melanogaster Rpn11 CG18174-RA (Rpn11... 178 1e-41
28gb|AY070977.1| Drosophila melanogaster RE07468 full length cDNA 178 1e-41
29gb|AC008233.3|AC008233 Drosophila melanogaster, chromosome 2L, r... 178 1e-41
30gb|AF145313.1|AF145313 Drosophila melanogaster 26S proteasome re... 178 1e-41
31gb|AE003608.5| Drosophila melanogaster chromosome 2L, section 17... 178 1e-41
32ref|XM_752595.1| Ustilago maydis 521 hypothetical protein (UM015... 155 2e-34
33emb|AJ249917.1|SDO249917 Aphrocallistes vastus mRNA for putative... 149 1e-32
34emb|AJ245813.1|AVA245813 Aphrocallistes vastus mRNA for potentia... 149 1e-32
35ref|XM_380957.1| Gibberella zeae PH-1 chromosome 1 conserved hyp... 139 1e-29
36ref|XM_959273.1| Neurospora crassa OR74A hypothetical protein (N... 131 3e-27
37ref|XM_325002.1| Neurospora crassa OR74A hypothetical protein (N... 131 3e-27
38ref|NM_062311.2| Caenorhabditis elegans proteasome Regulatory Pa... 127 4e-26
39gb|BT018364.1| Zea mays clone EL01N0311E01.c mRNA sequence 117 4e-23
40ref|XM_961333.1| PREDICTED: Tribolium castaneum similar to CG181... 101 2e-18
41emb|AJ249916.1|GCY249916 Geodia cydonium mRNA for putative multi... 101 2e-18
42gb|AE016820.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 92 2e-15
43ref|NM_211733.1| Eremothecium gossypii AGR006Wp (AGR006W), mRNA 92 2e-15
44ref|XM_744382.1| Aspergillus fumigatus Af293 proteasome regulato... 88 4e-14
45gb|AF195189.1|AF195189 Drosophila melanogaster yippee interactin... 88 4e-14
46dbj|AP006080.1| Lotus japonicus genomic DNA, chromosome 6, clone... 88 4e-14
47gb|AF077534.2| Caenorhabditis elegans cosmid K07D4, complete seq... 86 1e-13
48emb|CT032525.1| Platynereis dumerilii EST IB0AAA36DF08EM1 80 9e-12
49emb|CT032524.1| Platynereis dumerilii EST IB0AAA36DF08FM1 80 9e-12
50dbj|AP006364.1| Lotus japonicus genomic DNA, chromosome 4, clone... 80 9e-12
51ref|XM_369606.1| Magnaporthe grisea 70-15 chromosome III hypothe... 78 4e-11
52gb|DQ440392.1| Aedes aegypti clone AET-5254 26S proteasome regul... 76 1e-10
53gb|BC045094.1| Xenopus laevis 26S proteasome-associated pad1 hom... 76 1e-10
54gb|AY022700.1| Oryza sativa microsatellite MRG5025 containing (C... 74 6e-10
55emb|BX031535.1|CNS08WHV Single read from an extremity of a full-... 74 6e-10
56emb|BX031534.1|CNS08WHU Single read from an extremity of a full-... 74 6e-10
57emb|BX008172.1|CNS08EGW Single read from an extremity of a full-... 74 6e-10
58ref|XM_314713.2| Anopheles gambiae str. PEST ENSANGP00000013055 ... 74 6e-10
59dbj|AB025633.2| Arabidopsis thaliana genomic DNA, chromosome 5, ... 72 2e-09
60emb|CT025430.2| Xenopus tropicalis finished cDNA, clone TGas117j07 68 3e-08
61ref|XM_566594.1| Cryptococcus neoformans var. neoformans JEC21 m... 68 3e-08
62gb|BC091596.1| Xenopus tropicalis MGC97603 protein, mRNA (cDNA c... 68 3e-08
63ref|NM_001030465.1| Xenopus tropicalis MGC97603 protein (MGC9760... 68 3e-08
64gb|BC073436.1| Xenopus laevis MGC80929 protein, mRNA (cDNA clone... 64 5e-07
65ref|XM_615793.2| PREDICTED: Bos taurus similar to 26S proteasome... 62 2e-06
66ref|XM_852348.1| PREDICTED: Canis familiaris similar to proteaso... 62 2e-06
67ref|XM_535931.2| PREDICTED: Canis familiaris similar to proteaso... 62 2e-06
68emb|AJ010592.2|GTAJ10592 Guillardia theta DNA for complete seque... 62 2e-06
69gb|AY610219.1| Sus scrofa clone Clu_9918.scr.msk.p1.Contig2, mRN... 62 2e-06
70gb|AY812783.1| Schistosoma japonicum SJCHGC06520 protein mRNA, c... 58 3e-05
71emb|CR675316.2|CNS0FK1M Tetraodon nigroviridis full-length cDNA 58 3e-05
72gb|AC140547.18| Medicago truncatula clone mth2-17p16, complete s... 58 3e-05
73emb|BX056616.1|CNS09FUK Single read from an extremity of a full-... 58 3e-05
74emb|BX057197.1|CNS09GAP Single read from an extremity of a full-... 58 3e-05
75emb|BX008173.1|CNS08EGX Single read from an extremity of a full-... 58 3e-05
76ref|NM_001031256.1| Gallus gallus proteasome (prosome, macropain... 58 3e-05
77emb|AJ720599.1| Gallus gallus mRNA for hypothetical protein, clo... 58 3e-05
78gb|AC145022.28| Medicago truncatula clone mth2-8m24, complete se... 58 3e-05
79emb|CR387677.1| Gallus gallus finished cDNA, clone ChEST73p15 58 3e-05
80ref|XM_515855.1| PREDICTED: Pan troglodytes similar to 26S prote... 54 5e-04
81ref|NM_005805.2| Homo sapiens proteasome (prosome, macropain) 26... 54 5e-04
82emb|CR450841.7| Zebrafish DNA sequence from clone DKEY-16N9 in l... 54 5e-04
83emb|CR712625.2|CNS0GCT9 Tetraodon nigroviridis full-length cDNA 54 5e-04
84ref|XM_759673.1| Theileria parva strain Muguga proteasome regula... 54 5e-04
85ref|XM_947427.1| Theileria annulata strain Ankara proteasome reg... 54 5e-04
86gb|BC097427.1| Rattus norvegicus similar to T-Brain-1, mRNA (cDN... 54 5e-04
87gb|BC066336.1| Homo sapiens proteasome (prosome, macropain) 26S ... 54 5e-04
88emb|CR615752.1| full-length cDNA clone CS0DI002YC21 of Placenta ... 54 5e-04
89emb|CR617325.1| full-length cDNA clone CS0DF011YP17 of Fetal bra... 54 5e-04
90emb|CR606475.1| full-length cDNA clone CS0DM002YB05 of Fetal liv... 54 5e-04
91emb|CR595585.1| full-length cDNA clone CS0DI058YD16 of Placenta ... 54 5e-04
92dbj|AK055128.1| Homo sapiens cDNA FLJ30566 fis, clone BRAWH20050... 54 5e-04
93gb|AC009299.5| Homo sapiens BAC clone RP11-26B22 from 2, complet... 54 5e-04
94gb|U86782.1|HSU86782 Human 26S proteasome-associated pad1 homolo... 54 5e-04
95ref|XM_505906.1| Yarrowia lipolytica CLIB122, YALI0F26411g predi... 52 0.002
96ref|NM_208154.1| Eremothecium gossypii ABL146Cp (ABL146C), mRNA 52 0.002
97gb|AE016815.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 52 0.002
98gb|DQ214693.1| Taeniopygia guttata clone 0061P0025H01 26S protea... 50 0.008
99gb|DQ214692.1| Taeniopygia guttata clone 0061P0016E01 26S protea... 50 0.008
100gb|DQ214691.1| Taeniopygia guttata clone 0061P0006D06 26S protea... 50 0.008
101emb|CR719774.2|CNS0GIBO Tetraodon nigroviridis full-length cDNA 50 0.008
102emb|CR702360.2|CNS0G4W4 Tetraodon nigroviridis full-length cDNA 50 0.008
103emb|CR702327.2|CNS0G4V7 Tetraodon nigroviridis full-length cDNA 50 0.008
104emb|CR698457.2|CNS0G1VP Tetraodon nigroviridis full-length cDNA 50 0.008
105emb|CR698218.2|CNS0G1P2 Tetraodon nigroviridis full-length cDNA 50 0.008
106emb|CR696910.2|CNS0G0OQ Tetraodon nigroviridis full-length cDNA 50 0.008
107emb|CR692972.2|CNS0FXNC Tetraodon nigroviridis full-length cDNA 50 0.008
108emb|CR691509.2|CNS0FWIP Tetraodon nigroviridis full-length cDNA 50 0.008
109emb|CR690951.2|CNS0FW37 Tetraodon nigroviridis full-length cDNA 50 0.008
110emb|CR689076.1|CNS0FUN4 Tetraodon nigroviridis full-length cDNA 50 0.008
111emb|CR688795.2|CNS0FUFB Tetraodon nigroviridis full-length cDNA 50 0.008
112emb|CR686556.1|CNS0FSP4 Tetraodon nigroviridis full-length cDNA 50 0.008
113emb|CR685176.2|CNS0FRMS Tetraodon nigroviridis full-length cDNA 50 0.008
114emb|CR684478.2|CNS0FR3E Tetraodon nigroviridis full-length cDNA 50 0.008
115emb|CR682368.2|CNS0FPGS Tetraodon nigroviridis full-length cDNA 50 0.008
116emb|CR679559.2|CNS0FNAR Tetraodon nigroviridis full-length cDNA 50 0.008
117emb|CR678444.2|CNS0FMFV Tetraodon nigroviridis full-length cDNA 50 0.008
118emb|CR676746.1|CNS0FL52 Tetraodon nigroviridis full-length cDNA 50 0.008
119emb|CR676595.2|CNS0FL0V Tetraodon nigroviridis full-length cDNA 50 0.008
120emb|CR675180.1|CNS0FJXU Tetraodon nigroviridis full-length cDNA 50 0.008
121emb|CR674318.2|CNS0FJ9W Tetraodon nigroviridis full-length cDNA 50 0.008
122emb|CR674265.2|CNS0FJ8F Tetraodon nigroviridis full-length cDNA 50 0.008
123emb|CR672566.1|CNS0FHX8 Tetraodon nigroviridis full-length cDNA 50 0.008
124emb|CR669565.1|CNS0FFLV Tetraodon nigroviridis full-length cDNA 50 0.008
125emb|CR669132.2|CNS0FF9U Tetraodon nigroviridis full-length cDNA 50 0.008
126emb|CR667241.2|CNS0FDTB Tetraodon nigroviridis full-length cDNA 50 0.008
127emb|CR665456.2|CNS0FCFQ Tetraodon nigroviridis full-length cDNA 50 0.008
128emb|CR665024.2|CNS0FC3Q Tetraodon nigroviridis full-length cDNA 50 0.008
129emb|CR664253.1|CNS0FBIB Tetraodon nigroviridis full-length cDNA 50 0.008
130emb|CR664229.1|CNS0FBHN Tetraodon nigroviridis full-length cDNA 50 0.008
131emb|CR664067.2|CNS0FBD5 Tetraodon nigroviridis full-length cDNA 50 0.008
132emb|CR660170.2|CNS0F8CW Tetraodon nigroviridis full-length cDNA 50 0.008
133emb|CR658518.2|CNS0F730 Tetraodon nigroviridis full-length cDNA 50 0.008
134emb|CR653521.2|CNS0F387 Tetraodon nigroviridis full-length cDNA 50 0.008
135emb|CR648165.2|CNS0EZ3F Tetraodon nigroviridis full-length cDNA 50 0.008
136emb|CR647310.1|CNS0EYFO Tetraodon nigroviridis full-length cDNA 50 0.008
137emb|CR647437.2|CNS0EYJ7 Tetraodon nigroviridis full-length cDNA 50 0.008
138emb|CR646589.2|CNS0EXVN Tetraodon nigroviridis full-length cDNA 50 0.008
139emb|CR645283.2|CNS0EWVD Tetraodon nigroviridis full-length cDNA 50 0.008
140emb|CR641289.2|CNS0ETSF Tetraodon nigroviridis full-length cDNA 50 0.008
141emb|CR638316.1|CNS0ERHU Tetraodon nigroviridis full-length cDNA 50 0.008
142emb|CR636358.2|CNS0EPZG Tetraodon nigroviridis full-length cDNA 50 0.008
143ref|XM_774934.1| PREDICTED: Strongylocentrotus purpuratus simila... 50 0.008
144gb|AF014465.1|AF014465 Schistosoma mansoni Pad1 homolog (SmPOH) ... 50 0.008
145gb|AF014466.1|AF014466 Schistosoma mansoni trans-spliced variant... 50 0.008
146ref|XM_657004.1| Aspergillus nidulans FGSC A4 hypothetical prote... 48 0.032
147gb|AF349677.1| Cochliobolus carbonum histone deacetylase 2 (HDC2... 48 0.032
148dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 48 0.032
149gb|AY152546.1| Saccharomyces cerevisiae 26S proteasome regulator... 48 0.032
150dbj|AP005526.3| Oryza sativa (japonica cultivar-group) genomic D... 48 0.032
151dbj|AP005506.3| Oryza sativa (japonica cultivar-group) genomic D... 48 0.032
152gb|BC003742.1| Mus musculus proteasome (prosome, macropain) 26S ... 46 0.13
153ref|NM_021526.1| Mus musculus proteasome (prosome, macropain) 26... 46 0.13
154ref|XM_454588.1| Kluyveromyces lactis NRRL Y-1140, KLLA0E14190g ... 46 0.13
155emb|CR382125.1| Kluyveromyces lactis strain NRRL Y-1140 chromoso... 46 0.13
156emb|BX538352.1| Cryptosporidium parvum chromosome 6, complete se... 46 0.13
157emb|AL590450.1|CNS07EGH chromosome XI of strain GB-M1 of Encepha... 46 0.13
158dbj|AK151733.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 46 0.13
159dbj|AK150280.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 46 0.13
160dbj|AK151104.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 46 0.13
161ref|XM_627672.1| Cryptosporidium parvum Iowa II 26S proteasome-a... 46 0.13
162dbj|AK078134.1| Mus musculus adult male medulla oblongata cDNA, ... 46 0.13
163dbj|AK031863.1| Mus musculus adult male medulla oblongata cDNA, ... 46 0.13
164dbj|AK012013.1| Mus musculus 10 days embryo whole body cDNA, RIK... 46 0.13
165dbj|AK011974.1| Mus musculus 10 days embryo whole body cDNA, RIK... 46 0.13
166gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, co... 46 0.13
167emb|AL845291.5| Mouse DNA sequence from clone RP23-1O11 on chrom... 46 0.13
168emb|Y13071.1|MM26SPROT Mus musculus mRNA for 26S proteasome non-... 46 0.13
169ref|XM_567446.1| Cryptococcus neoformans var. neoformans JEC21 h... 44 0.50
170gb|U00032.2| Caenorhabditis elegans cosmid F37A4, complete sequence 44 0.50
171emb|AJ719811.1| Gallus gallus mRNA for hypothetical protein, clo... 44 0.50
172dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete ... 44 0.50
173ref|NM_066069.1| Caenorhabditis elegans F37A4.5 (F37A4.5) mRNA, ... 44 0.50
174ref|XM_393559.2| PREDICTED: Apis mellifera similar to ENSANGP000... 44 0.50
175ref|NM_001039311.1| Gallus gallus similar to 38 kDa Mov34 homolo... 44 0.50
176gb|AC007478.1|AC007478 Arabidopsis thaliana BAC F15A18 from chro... 44 0.50
177gb|AY692755.1| Saccharomyces cerevisiae clone FLH112885.01X YFR0... 42 2.0
178ref|XM_709968.1| Candida albicans SC5314 putative 26S proteasome... 42 2.0
179dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ... 42 2.0
180emb|X79561.1|SCMTP S.cerevisiae (GRF88) mpr1 gene 42 2.0
181dbj|D50617.1|YSCCHRVIN Saccharomyces cerevisiae chromosome VI co... 42 2.0
182gb|AY787218.1| Boletellus projectellus isolate AFTOL-ID 713 RNA ... 40 7.8
183ref|XM_468296.1| Oryza sativa (japonica cultivar-group), mRNA 40 7.8
184gb|AF488414.1| Pennisetum glaucum BAC 311G2 complete sequence 40 7.8
185gb|AC149290.1| Solanum demissum chromosome 5 clone PGEC093P17 ma... 40 7.8
186gb|AY590263.1| Synthetic construct mutant collagen alpha 1(I) ch... 40 7.8
187gb|CP000285.1| Chromohalobacter salexigens DSM 3043, complete ge... 40 7.8
188ref|XM_453441.1| Kluyveromyces lactis NRRL Y-1140, KLLA0D08503g ... 40 7.8
189gb|CP000352.1| Ralstonia metallidurans CH34, complete genome 40 7.8
190emb|X98705.1|HSCOLPDGF H.sapiens DNA sequence of COL1A1 gene fus... 40 7.8
191gb|AC015909.14| Homo sapiens chromosome 17, clone RP11-893F2, co... 40 7.8
192ref|XM_773477.1| Giardia lamblia ATCC 50803 multidrug resistance... 40 7.8
193emb|AL672311.26| Human DNA sequence from clone RP13-167H21 on ch... 40 7.8
194emb|AL135939.12| Human DNA sequence from clone RP3-481F12 on chr... 40 7.8
195ref|XM_970644.1| PREDICTED: Tribolium castaneum similar to CG181... 40 7.8
196ref|XM_970158.1| PREDICTED: Tribolium castaneum similar to CG745... 40 7.8
197gb|CP000088.1| Thermobifida fusca YX, complete genome 40 7.8
198emb|CR382124.1| Kluyveromyces lactis strain NRRL Y-1140 chromoso... 40 7.8
199gb|AC097273.3| Genomic sequence for Mus musculus, clone RP23-118... 40 7.8
200gb|AC119676.2| Homo sapiens chromosome 1 clone RP5-820O16, compl... 40 7.8
201ref|XM_688172.1| PREDICTED: Danio rerio similar to LOC495492 pro... 40 7.8
202gb|AC154451.2| Mus musculus BAC clone RP24-171K15 from chromosom... 40 7.8
203gb|AC069158.6| Genomic Sequence for Oryza sativa, Nipponbare str... 40 7.8
204gb|DQ366280.1| Boletellus shichianus isolate AFTOL-ID 532 RNA po... 40 7.8
205gb|DQ366279.1| Aureoboletus thibetanus isolate AFTOL-ID 450 RNA ... 40 7.8
206gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome 40 7.8
207gb|AF017178.2|AF017178 Homo sapiens pro alpha 1(I) collagen (COL... 40 7.8
208gb|AE010299.1| Methanosarcina acetivorans str. C2A, complete genome 40 7.8
209dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 40 7.8
210gb|AC154541.2| Mus musculus BAC clone RP23-458N20 from chromosom... 40 7.8
211gb|AC104326.20| Mus musculus strain C57BL/6J chromosome 2 clone ... 40 7.8
212dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co... 40 7.8
213gb|AC099066.3| Homo sapiens chromosome 1 clone RP11-145A3, compl... 40 7.8
214dbj|AP004153.3| Oryza sativa (japonica cultivar-group) genomic D... 40 7.8
215gb|AE015451.1| Pseudomonas putida KT2440 complete genome 40 7.8
216emb|BX927385.15| Zebrafish DNA sequence from clone DKEY-76P7 in ... 40 7.8
217gb|M20789.1|HUMC1A1 Human, alpha 1 collagen type I gene, exons 1... 40 7.8
218gb|J03559.1|HUMCOLAI1A Human alpha-1 collagen type I gene, exon ... 40 7.8
219gb|J02829.1|HUMCG1A1P Human alpha-1(I) collagen gene, exons 1 an... 40 7.8
220emb|AJ297367.1|GLA297367 Giardia lamblia mpr1 gene for non-ATPas... 40 7.8

>dbj|AK109403.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-302-D04, full
           insert sequence
          Length = 1212

 Score =  795 bits (401), Expect = 0.0
 Identities = 488/517 (94%)
 Strand = Plus / Plus

                                                                       
Query: 50  ccgggatggggcagccggggaccgactcgccgctgctcgactcctccgagcaggtctaca 109
           |||| ||||||||||||  | | |||||||||||||||||||||||||||||||||||||
Sbjct: 112 ccggcatggggcagccgccgtcggactcgccgctgctcgactcctccgagcaggtctaca 171

                                                                       
Query: 110 tctcctccctcgccctcctcaagatgctcaagcacgggagggccggcgtgcccatggagg 169
           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 172 tctcctccctcgccctcctcaagatgctcaagcacgggagggccggcgtgccgatggagg 231

                                                                       
Query: 170 tgatgggcctgatgctgggcgagttcgtcgacgactacacggtcagggtggtggatgtct 229
           ||||||| ||||||||||| |||||||||||||||||||||||||||||||| || ||||
Sbjct: 232 tgatggggctgatgctgggggagttcgtcgacgactacacggtcagggtggtcgacgtct 291

                                                                       
Query: 230 tcgccatgccgcagagcgggaccggggtcagcgtcgaggccgtcgaccacgtcttccaga 289
           ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 292 tcgccatgccgcagagcgggaccggggtcagcgtcgaggccgtcgaccatgtcttccaga 351

                                                                       
Query: 290 ccaacatgctcgacatgctcaagcagaccggaagacctgaaatggtggtaggctggtacc 349
           ||||||||||||||||||||||||||||||| || || |||||||||||||| |||||||
Sbjct: 352 ccaacatgctcgacatgctcaagcagaccgggaggccagaaatggtggtaggttggtacc 411

                                                                       
Query: 350 actcgcatcctggatttggttgctggctttcaggagttgacatcaatactcagcagagtt 409
           | || ||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 412 attcccatcctggatttggttgctggctttcaggagttgacatcaatactcaacagagtt 471

                                                                       
Query: 410 ttgaagcgttaaaccccagggcagttgctgttgtgatagatcccatccagagtgtcaagg 469
           ||||||| |||||||||||||||||||| || ||||||||||||||||| ||||||||||
Sbjct: 472 ttgaagctttaaaccccagggcagttgccgtcgtgatagatcccatccaaagtgtcaagg 531

                                                                       
Query: 470 ggaaagtggtcattgatgcattccgtctcattaaccctcagaccatgatgcttggccagg 529
           ||||||| |||||||||||||| || || |||||||||||||||||||||||||| ||||
Sbjct: 532 ggaaagttgtcattgatgcatttcgccttattaaccctcagaccatgatgcttggtcagg 591

                                                
Query: 530 agccacggcagacaacatcgaatgttgggcacctaaa 566
           ||||||| ||||||||||| |||||||||||||||||
Sbjct: 592 agccacgacagacaacatcaaatgttgggcacctaaa 628



to top

>dbj|AK112020.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-B06, full
           insert sequence
          Length = 1142

 Score =  795 bits (401), Expect = 0.0
 Identities = 488/517 (94%)
 Strand = Plus / Plus

                                                                       
Query: 50  ccgggatggggcagccggggaccgactcgccgctgctcgactcctccgagcaggtctaca 109
           |||| ||||||||||||  | | |||||||||||||||||||||||||||||||||||||
Sbjct: 110 ccggcatggggcagccgccgtcggactcgccgctgctcgactcctccgagcaggtctaca 169

                                                                       
Query: 110 tctcctccctcgccctcctcaagatgctcaagcacgggagggccggcgtgcccatggagg 169
           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 170 tctcctccctcgccctcctcaagatgctcaagcacgggagggccggcgtgccgatggagg 229

                                                                       
Query: 170 tgatgggcctgatgctgggcgagttcgtcgacgactacacggtcagggtggtggatgtct 229
           ||||||| ||||||||||| |||||||||||||||||||||||||||||||| || ||||
Sbjct: 230 tgatggggctgatgctgggggagttcgtcgacgactacacggtcagggtggtcgacgtct 289

                                                                       
Query: 230 tcgccatgccgcagagcgggaccggggtcagcgtcgaggccgtcgaccacgtcttccaga 289
           ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 290 tcgccatgccgcagagcgggaccggggtcagcgtcgaggccgtcgaccatgtcttccaga 349

                                                                       
Query: 290 ccaacatgctcgacatgctcaagcagaccggaagacctgaaatggtggtaggctggtacc 349
           ||||||||||||||||||||||||||||||| || || |||||||||||||| |||||||
Sbjct: 350 ccaacatgctcgacatgctcaagcagaccgggaggccagaaatggtggtaggttggtacc 409

                                                                       
Query: 350 actcgcatcctggatttggttgctggctttcaggagttgacatcaatactcagcagagtt 409
           | || ||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 410 attcccatcctggatttggttgctggctttcaggagttgacatcaatactcaacagagtt 469

                                                                       
Query: 410 ttgaagcgttaaaccccagggcagttgctgttgtgatagatcccatccagagtgtcaagg 469
           ||||||| |||||||||||||||||||| || ||||||||||||||||| ||||||||||
Sbjct: 470 ttgaagctttaaaccccagggcagttgccgtcgtgatagatcccatccaaagtgtcaagg 529

                                                                       
Query: 470 ggaaagtggtcattgatgcattccgtctcattaaccctcagaccatgatgcttggccagg 529
           ||||||| |||||||||||||| || || |||||||||||||||||||||||||| ||||
Sbjct: 530 ggaaagttgtcattgatgcatttcgccttattaaccctcagaccatgatgcttggtcagg 589

                                                
Query: 530 agccacggcagacaacatcgaatgttgggcacctaaa 566
           ||||||| ||||||||||| |||||||||||||||||
Sbjct: 590 agccacgacagacaacatcaaatgttgggcacctaaa 626



to top

>dbj|AK111763.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023062E06, full
           insert sequence
          Length = 1115

 Score =  795 bits (401), Expect = 0.0
 Identities = 488/517 (94%)
 Strand = Plus / Plus

                                                                       
Query: 50  ccgggatggggcagccggggaccgactcgccgctgctcgactcctccgagcaggtctaca 109
           |||| ||||||||||||  | | |||||||||||||||||||||||||||||||||||||
Sbjct: 109 ccggcatggggcagccgccgtcggactcgccgctgctcgactcctccgagcaggtctaca 168

                                                                       
Query: 110 tctcctccctcgccctcctcaagatgctcaagcacgggagggccggcgtgcccatggagg 169
           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 169 tctcctccctcgccctcctcaagatgctcaagcacgggagggccggcgtgccgatggagg 228

                                                                       
Query: 170 tgatgggcctgatgctgggcgagttcgtcgacgactacacggtcagggtggtggatgtct 229
           ||||||| ||||||||||| |||||||||||||||||||||||||||||||| || ||||
Sbjct: 229 tgatggggctgatgctgggggagttcgtcgacgactacacggtcagggtggtcgacgtct 288

                                                                       
Query: 230 tcgccatgccgcagagcgggaccggggtcagcgtcgaggccgtcgaccacgtcttccaga 289
           ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 289 tcgccatgccgcagagcgggaccggggtcagcgtcgaggccgtcgaccatgtcttccaga 348

                                                                       
Query: 290 ccaacatgctcgacatgctcaagcagaccggaagacctgaaatggtggtaggctggtacc 349
           ||||||||||||||||||||||||||||||| || || |||||||||||||| |||||||
Sbjct: 349 ccaacatgctcgacatgctcaagcagaccgggaggccagaaatggtggtaggttggtacc 408

                                                                       
Query: 350 actcgcatcctggatttggttgctggctttcaggagttgacatcaatactcagcagagtt 409
           | || ||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 409 attcccatcctggatttggttgctggctttcaggagttgacatcaatactcaacagagtt 468

                                                                       
Query: 410 ttgaagcgttaaaccccagggcagttgctgttgtgatagatcccatccagagtgtcaagg 469
           ||||||| |||||||||||||||||||| || ||||||||||||||||| ||||||||||
Sbjct: 469 ttgaagctttaaaccccagggcagttgccgtcgtgatagatcccatccaaagtgtcaagg 528

                                                                       
Query: 470 ggaaagtggtcattgatgcattccgtctcattaaccctcagaccatgatgcttggccagg 529
           ||||||| |||||||||||||| || || |||||||||||||||||||||||||| ||||
Sbjct: 529 ggaaagttgtcattgatgcatttcgccttattaaccctcagaccatgatgcttggtcagg 588

                                                
Query: 530 agccacggcagacaacatcgaatgttgggcacctaaa 566
           ||||||| ||||||||||| |||||||||||||||||
Sbjct: 589 agccacgacagacaacatcaaatgttgggcacctaaa 625



to top

>ref|NM_188020.1| Oryza sativa (japonica cultivar-group), Ozsa8440 predicted mRNA
          Length = 924

 Score =  743 bits (375), Expect = 0.0
 Identities = 486/523 (92%)
 Strand = Plus / Plus

                                                                       
Query: 52  gggatggggcagccggggaccgactcgccgctgctcgactcctccgagcaggtctacatc 111
           |||||||||||||||  ||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 34  gggatggggcagccgccgacggactcgccgctgctcgactcctccgagcaggtctacatc 93

                                                                       
Query: 112 tcctccctcgccctcctcaagatgctcaagcacgggagggccggcgtgcccatggaggtg 171
           |||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||
Sbjct: 94  tcctccctcgccctcctcaagatgctcaagcacgggcgggccggcgtgccgatggaggtg 153

                                                                       
Query: 172 atgggcctgatgctgggcgagttcgtcgacgactacacggtcagggtggtggatgtcttc 231
           ||||| |||||||| || |||||||||||||||||||| ||||||||||| || ||||||
Sbjct: 154 atggggctgatgctcggggagttcgtcgacgactacaccgtcagggtggtcgacgtcttc 213

                                                                       
Query: 232 gccatgccgcagagcgggaccggggtcagcgtcgaggccgtcgaccacgtcttccagacc 291
           |||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||
Sbjct: 214 gccatgccgcagagcgggacgggcgtcagcgtcgaggccgtcgaccacgtcttccagacc 273

                                                                       
Query: 292 aacatgctcgacatgctcaagcagaccggaagacctgaaatggtggtaggctggtaccac 351
           ||||||||||||||||||||||||||||| ||||| ||||||||||| |||||||| |||
Sbjct: 274 aacatgctcgacatgctcaagcagaccgggagaccagaaatggtggtgggctggtatcac 333

                                                                       
Query: 352 tcgcatcctggatttggttgctggctttcaggagttgacatcaatactcagcagagtttt 411
           || |||||||||||||| || ||||||||||| ||||| ||||| |||||||||||||||
Sbjct: 334 tcccatcctggatttggatgttggctttcaggtgttgatatcaacactcagcagagtttt 393

                                                                       
Query: 412 gaagcgttaaaccccagggcagttgctgttgtgatagatcccatccagagtgtcaagggg 471
           ||||| ||||| |||||||| ||||| ||||||||||| || ||||||||||||||||||
Sbjct: 394 gaagctttaaatcccagggctgttgcagttgtgatagacccaatccagagtgtcaagggg 453

                                                                       
Query: 472 aaagtggtcattgatgcattccgtctcattaaccctcagaccatgatgcttggccaggag 531
           || ||||||||||||||||| ||||||||||| |||||||||||||||||||||||||| 
Sbjct: 454 aaggtggtcattgatgcatttcgtctcattaatcctcagaccatgatgcttggccaggaa 513

                                                      
Query: 532 ccacggcagacaacatcgaatgttgggcacctaaacaaaccat 574
           || || ||||||||||| ||||||||||| |||||||||||||
Sbjct: 514 ccgcgacagacaacatcaaatgttgggcatctaaacaaaccat 556



to top

>dbj|AK099455.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013022M19, full
           insert sequence
          Length = 1220

 Score =  743 bits (375), Expect = 0.0
 Identities = 486/523 (92%)
 Strand = Plus / Plus

                                                                       
Query: 52  gggatggggcagccggggaccgactcgccgctgctcgactcctccgagcaggtctacatc 111
           |||||||||||||||  ||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 120 gggatggggcagccgccgacggactcgccgctgctcgactcctccgagcaggtctacatc 179

                                                                       
Query: 112 tcctccctcgccctcctcaagatgctcaagcacgggagggccggcgtgcccatggaggtg 171
           |||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||
Sbjct: 180 tcctccctcgccctcctcaagatgctcaagcacgggcgggccggcgtgccgatggaggtg 239

                                                                       
Query: 172 atgggcctgatgctgggcgagttcgtcgacgactacacggtcagggtggtggatgtcttc 231
           ||||| |||||||| || |||||||||||||||||||| ||||||||||| || ||||||
Sbjct: 240 atggggctgatgctcggggagttcgtcgacgactacaccgtcagggtggtcgacgtcttc 299

                                                                       
Query: 232 gccatgccgcagagcgggaccggggtcagcgtcgaggccgtcgaccacgtcttccagacc 291
           |||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||
Sbjct: 300 gccatgccgcagagcgggacgggcgtcagcgtcgaggccgtcgaccacgtcttccagacc 359

                                                                       
Query: 292 aacatgctcgacatgctcaagcagaccggaagacctgaaatggtggtaggctggtaccac 351
           ||||||||||||||||||||||||||||| ||||| ||||||||||| |||||||| |||
Sbjct: 360 aacatgctcgacatgctcaagcagaccgggagaccagaaatggtggtgggctggtatcac 419

                                                                       
Query: 352 tcgcatcctggatttggttgctggctttcaggagttgacatcaatactcagcagagtttt 411
           || |||||||||||||| || ||||||||||| ||||| ||||| |||||||||||||||
Sbjct: 420 tcccatcctggatttggatgttggctttcaggtgttgatatcaacactcagcagagtttt 479

                                                                       
Query: 412 gaagcgttaaaccccagggcagttgctgttgtgatagatcccatccagagtgtcaagggg 471
           ||||| ||||| |||||||| ||||| ||||||||||| || ||||||||||||||||||
Sbjct: 480 gaagctttaaatcccagggctgttgcagttgtgatagacccaatccagagtgtcaagggg 539

                                                                       
Query: 472 aaagtggtcattgatgcattccgtctcattaaccctcagaccatgatgcttggccaggag 531
           || ||||||||||||||||| ||||||||||| |||||||||||||||||||||||||| 
Sbjct: 540 aaggtggtcattgatgcatttcgtctcattaatcctcagaccatgatgcttggccaggaa 599

                                                      
Query: 532 ccacggcagacaacatcgaatgttgggcacctaaacaaaccat 574
           || || ||||||||||| ||||||||||| |||||||||||||
Sbjct: 600 ccgcgacagacaacatcaaatgttgggcatctaaacaaaccat 642



to top

>dbj|AB037152.1| Oryza sativa (japonica cultivar-group) OsRPN11 mRNA for 26S
           proteasome regulatory particle non-ATPase subunit11,
           complete cds
          Length = 1129

 Score =  743 bits (375), Expect = 0.0
 Identities = 486/523 (92%)
 Strand = Plus / Plus

                                                                       
Query: 52  gggatggggcagccggggaccgactcgccgctgctcgactcctccgagcaggtctacatc 111
           |||||||||||||||  ||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 73  gggatggggcagccgccgacggactcgccgctgctcgactcctccgagcaggtctacatc 132

                                                                       
Query: 112 tcctccctcgccctcctcaagatgctcaagcacgggagggccggcgtgcccatggaggtg 171
           |||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||
Sbjct: 133 tcctccctcgccctcctcaagatgctcaagcacgggcgggccggcgtgccgatggaggtg 192

                                                                       
Query: 172 atgggcctgatgctgggcgagttcgtcgacgactacacggtcagggtggtggatgtcttc 231
           ||||| |||||||| || |||||||||||||||||||| ||||||||||| || ||||||
Sbjct: 193 atggggctgatgctcggggagttcgtcgacgactacaccgtcagggtggtcgacgtcttc 252

                                                                       
Query: 232 gccatgccgcagagcgggaccggggtcagcgtcgaggccgtcgaccacgtcttccagacc 291
           |||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||
Sbjct: 253 gccatgccgcagagcgggacgggcgtcagcgtcgaggccgtcgaccacgtcttccagacc 312

                                                                       
Query: 292 aacatgctcgacatgctcaagcagaccggaagacctgaaatggtggtaggctggtaccac 351
           ||||||||||||||||||||||||||||| ||||| ||||||||||| |||||||| |||
Sbjct: 313 aacatgctcgacatgctcaagcagaccgggagaccagaaatggtggtgggctggtatcac 372

                                                                       
Query: 352 tcgcatcctggatttggttgctggctttcaggagttgacatcaatactcagcagagtttt 411
           || |||||||||||||| || ||||||||||| ||||| ||||| |||||||||||||||
Sbjct: 373 tcccatcctggatttggatgttggctttcaggtgttgatatcaacactcagcagagtttt 432

                                                                       
Query: 412 gaagcgttaaaccccagggcagttgctgttgtgatagatcccatccagagtgtcaagggg 471
           ||||| ||||| |||||||| ||||| ||||||||||| || ||||||||||||||||||
Sbjct: 433 gaagctttaaatcccagggctgttgcagttgtgatagacccaatccagagtgtcaagggg 492

                                                                       
Query: 472 aaagtggtcattgatgcattccgtctcattaaccctcagaccatgatgcttggccaggag 531
           || ||||||||||||||||| ||||||||||| |||||||||||||||||||||||||| 
Sbjct: 493 aaggtggtcattgatgcatttcgtctcattaatcctcagaccatgatgcttggccaggaa 552

                                                      
Query: 532 ccacggcagacaacatcgaatgttgggcacctaaacaaaccat 574
           || || ||||||||||| ||||||||||| |||||||||||||
Sbjct: 553 ccgcgacagacaacatcaaatgttgggcatctaaacaaaccat 595



to top

>gb|BT009132.1| Triticum aestivum clone wl1n.pk0036.c3:fis, full insert mRNA
           sequence
          Length = 1318

 Score =  636 bits (321), Expect = e-179
 Identities = 468/517 (90%)
 Strand = Plus / Plus

                                                                       
Query: 50  ccgggatggggcagccggggaccgactcgccgctgctcgactcctccgagcaggtctaca 109
           |||| ||||||||||||  ||| ||||||||||||||||| |||||||||||||||||||
Sbjct: 124 ccggcatggggcagccgccgacggactcgccgctgctcgattcctccgagcaggtctaca 183

                                                                       
Query: 110 tctcctccctcgccctcctcaagatgctcaagcacgggagggccggcgtgcccatggagg 169
           |||||||||| || || |||||||||||||||||||||||||| || |||||||||||||
Sbjct: 184 tctcctccctagcgcttctcaagatgctcaagcacgggagggctggggtgcccatggagg 243

                                                                       
Query: 170 tgatgggcctgatgctgggcgagttcgtcgacgactacacggtcagggtggtggatgtct 229
           | |||||||| ||||| ||||||||||||||||||||||| |||||||| || || ||||
Sbjct: 244 tcatgggcctcatgctcggcgagttcgtcgacgactacaccgtcagggtcgtcgacgtct 303

                                                                       
Query: 230 tcgccatgccgcagagcgggaccggggtcagcgtcgaggccgtcgaccacgtcttccaga 289
           |||||||||||||||||||||| || ||||||||||||||||| ||||||||||||||||
Sbjct: 304 tcgccatgccgcagagcgggactggtgtcagcgtcgaggccgtagaccacgtcttccaga 363

                                                                       
Query: 290 ccaacatgctcgacatgctcaagcagaccggaagacctgaaatggtggtaggctggtacc 349
           | |||||||| |||||||| ||||||||||| || || |||||||| ||||| ||||| |
Sbjct: 364 caaacatgcttgacatgcttaagcagaccggcaggccagaaatggttgtaggttggtatc 423

                                                                       
Query: 350 actcgcatcctggatttggttgctggctttcaggagttgacatcaatactcagcagagtt 409
           |||| |||||||| || || |||||||| ||||| || || |||||||||||||||||||
Sbjct: 424 actcacatcctggcttcggatgctggctatcaggcgtcgatatcaatactcagcagagtt 483

                                                                       
Query: 410 ttgaagcgttaaaccccagggcagttgctgttgtgatagatcccatccagagtgtcaagg 469
           ||||||| || |||||||| || ||||||||||||||||| |||||||||||||| ||||
Sbjct: 484 ttgaagctttgaaccccagagccgttgctgttgtgatagaccccatccagagtgtgaagg 543

                                                                       
Query: 470 ggaaagtggtcattgatgcattccgtctcattaaccctcagaccatgatgcttggccagg 529
           |||| ||||| |||||||||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 544 ggaaggtggttattgatgcattccgcctcattaatcctcagaccatgatgcttggccagg 603

                                                
Query: 530 agccacggcagacaacatcgaatgttgggcacctaaa 566
           ||||||| ||||||||||| |||||||||||||||||
Sbjct: 604 agccacgtcagacaacatcaaatgttgggcacctaaa 640



to top

>gb|AY104261.1| Zea mays PCO099067 mRNA sequence
          Length = 1282

 Score =  636 bits (321), Expect = e-179
 Identities = 468/517 (90%)
 Strand = Plus / Plus

                                                                       
Query: 50  ccgggatggggcagccggggaccgactcgccgctgctcgactcctccgagcaggtctaca 109
           |||| ||||||||||||  ||| ||||||||||||||||| |||||||||||||||||||
Sbjct: 100 ccggcatggggcagccgccgacggactcgccgctgctcgattcctccgagcaggtctaca 159

                                                                       
Query: 110 tctcctccctcgccctcctcaagatgctcaagcacgggagggccggcgtgcccatggagg 169
           |||||||||| || || |||||||||||||||||||||||||| || |||||||||||||
Sbjct: 160 tctcctccctagcgcttctcaagatgctcaagcacgggagggctggggtgcccatggagg 219

                                                                       
Query: 170 tgatgggcctgatgctgggcgagttcgtcgacgactacacggtcagggtggtggatgtct 229
           | |||||||| ||||| ||||||||||| ||||||||||| |||||||| || || ||||
Sbjct: 220 tcatgggcctcatgctcggcgagttcgttgacgactacaccgtcagggtcgtcgacgtct 279

                                                                       
Query: 230 tcgccatgccgcagagcgggaccggggtcagcgtcgaggccgtcgaccacgtcttccaga 289
           |||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||
Sbjct: 280 tcgccatgccgcagagcgggactggtgtcagcgtcgaggccgtcgaccacgtcttccaga 339

                                                                       
Query: 290 ccaacatgctcgacatgctcaagcagaccggaagacctgaaatggtggtaggctggtacc 349
           | |||||||| |||||||| ||||||||||| || || |||||||| ||||| ||||| |
Sbjct: 340 caaacatgcttgacatgcttaagcagaccggcaggccagaaatggttgtaggttggtatc 399

                                                                       
Query: 350 actcgcatcctggatttggttgctggctttcaggagttgacatcaatactcagcagagtt 409
           |||| |||||||| || || |||||||| ||||| || || |||||||||||||||||||
Sbjct: 400 actcacatcctggcttcggatgctggctatcaggcgtcgatatcaatactcagcagagtt 459

                                                                       
Query: 410 ttgaagcgttaaaccccagggcagttgctgttgtgatagatcccatccagagtgtcaagg 469
           ||||||| || |||||||| || ||||||||||||||||| |||||||||||||| ||||
Sbjct: 460 ttgaagctttgaaccccagagccgttgctgttgtgatagaccccatccagagtgtgaagg 519

                                                                       
Query: 470 ggaaagtggtcattgatgcattccgtctcattaaccctcagaccatgatgcttggccagg 529
           |||| ||||| |||||||||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 520 ggaaggtggttattgatgcattccgcctcattaatcctcagaccatgatgcttggccagg 579

                                                
Query: 530 agccacggcagacaacatcgaatgttgggcacctaaa 566
           ||||||| ||||||||||| |||||||||||||||||
Sbjct: 580 agccacgtcagacaacatcaaatgttgggcacctaaa 616



to top

>gb|AC104707.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1118_F06,
              complete sequence
          Length = 136143

 Score =  301 bits (152), Expect = 1e-78
 Identities = 170/176 (96%)
 Strand = Plus / Plus

                                                                          
Query: 145    gggagggccggcgtgcccatggaggtgatgggcctgatgctgggcgagttcgtcgacgac 204
              ||||||||||||||||| |||||||||||||| ||||||||||| |||||||||||||||
Sbjct: 102885 gggagggccggcgtgccgatggaggtgatggggctgatgctgggggagttcgtcgacgac 102944

                                                                          
Query: 205    tacacggtcagggtggtggatgtcttcgccatgccgcagagcgggaccggggtcagcgtc 264
              ||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||
Sbjct: 102945 tacacggtcagggtggtcgacgtcttcgccatgccgcagagcgggaccggggtcagcgtc 103004

                                                                      
Query: 265    gaggccgtcgaccacgtcttccagaccaacatgctcgacatgctcaagcagaccgg 320
              |||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 103005 gaggccgtcgaccatgtcttccagaccaacatgctcgacatgctcaagcagaccgg 103060



 Score =  240 bits (121), Expect = 4e-60
 Identities = 154/165 (93%)
 Strand = Plus / Plus

                                                                          
Query: 402    gcagagttttgaagcgttaaaccccagggcagttgctgttgtgatagatcccatccagag 461
              ||||||||||||||| |||||||||||||||||||| || ||||||||||||||||| ||
Sbjct: 105254 gcagagttttgaagctttaaaccccagggcagttgccgtcgtgatagatcccatccaaag 105313

                                                                          
Query: 462    tgtcaaggggaaagtggtcattgatgcattccgtctcattaaccctcagaccatgatgct 521
              ||||||||||||||| |||||||||||||| || || |||||||||||||||||||||||
Sbjct: 105314 tgtcaaggggaaagttgtcattgatgcatttcgccttattaaccctcagaccatgatgct 105373

                                                           
Query: 522    tggccaggagccacggcagacaacatcgaatgttgggcacctaaa 566
              ||| ||||||||||| ||||||||||| |||||||||||||||||
Sbjct: 105374 tggtcaggagccacgacagacaacatcaaatgttgggcacctaaa 105418



 Score =  153 bits (77), Expect = 8e-34
 Identities = 92/97 (94%)
 Strand = Plus / Plus

                                                                          
Query: 50     ccgggatggggcagccggggaccgactcgccgctgctcgactcctccgagcaggtctaca 109
              |||| ||||||||||||  | | |||||||||||||||||||||||||||||||||||||
Sbjct: 102720 ccggcatggggcagccgccgtcggactcgccgctgctcgactcctccgagcaggtctaca 102779

                                                   
Query: 110    tctcctccctcgccctcctcaagatgctcaagcacgg 146
              |||||||||||||||||||||||||||||||||||||
Sbjct: 102780 tctcctccctcgccctcctcaagatgctcaagcacgg 102816



 Score =  123 bits (62), Expect = 7e-25
 Identities = 71/74 (95%)
 Strand = Plus / Plus

                                                                          
Query: 328    gaaatggtggtaggctggtaccactcgcatcctggatttggttgctggctttcaggagtt 387
              |||||||||||||| |||||||| || |||||||||||||||||||||||||||||||||
Sbjct: 103704 gaaatggtggtaggttggtaccattcccatcctggatttggttgctggctttcaggagtt 103763

                            
Query: 388    gacatcaatactca 401
              ||||||||||||||
Sbjct: 103764 gacatcaatactca 103777



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  301 bits (152), Expect = 1e-78
 Identities = 170/176 (96%)
 Strand = Plus / Plus

                                                                            
Query: 145      gggagggccggcgtgcccatggaggtgatgggcctgatgctgggcgagttcgtcgacgac 204
                ||||||||||||||||| |||||||||||||| ||||||||||| |||||||||||||||
Sbjct: 17726127 gggagggccggcgtgccgatggaggtgatggggctgatgctgggggagttcgtcgacgac 17726186

                                                                            
Query: 205      tacacggtcagggtggtggatgtcttcgccatgccgcagagcgggaccggggtcagcgtc 264
                ||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||
Sbjct: 17726187 tacacggtcagggtggtcgacgtcttcgccatgccgcagagcgggaccggggtcagcgtc 17726246

                                                                        
Query: 265      gaggccgtcgaccacgtcttccagaccaacatgctcgacatgctcaagcagaccgg 320
                |||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 17726247 gaggccgtcgaccatgtcttccagaccaacatgctcgacatgctcaagcagaccgg 17726302



 Score =  240 bits (121), Expect = 4e-60
 Identities = 154/165 (93%)
 Strand = Plus / Plus

                                                                            
Query: 402      gcagagttttgaagcgttaaaccccagggcagttgctgttgtgatagatcccatccagag 461
                ||||||||||||||| |||||||||||||||||||| || ||||||||||||||||| ||
Sbjct: 17728496 gcagagttttgaagctttaaaccccagggcagttgccgtcgtgatagatcccatccaaag 17728555

                                                                            
Query: 462      tgtcaaggggaaagtggtcattgatgcattccgtctcattaaccctcagaccatgatgct 521
                ||||||||||||||| |||||||||||||| || || |||||||||||||||||||||||
Sbjct: 17728556 tgtcaaggggaaagttgtcattgatgcatttcgccttattaaccctcagaccatgatgct 17728615

                                                             
Query: 522      tggccaggagccacggcagacaacatcgaatgttgggcacctaaa 566
                ||| ||||||||||| ||||||||||| |||||||||||||||||
Sbjct: 17728616 tggtcaggagccacgacagacaacatcaaatgttgggcacctaaa 17728660



 Score =  153 bits (77), Expect = 8e-34
 Identities = 92/97 (94%)
 Strand = Plus / Plus

                                                                            
Query: 50       ccgggatggggcagccggggaccgactcgccgctgctcgactcctccgagcaggtctaca 109
                |||| ||||||||||||  | | |||||||||||||||||||||||||||||||||||||
Sbjct: 17725962 ccggcatggggcagccgccgtcggactcgccgctgctcgactcctccgagcaggtctaca 17726021

                                                     
Query: 110      tctcctccctcgccctcctcaagatgctcaagcacgg 146
                |||||||||||||||||||||||||||||||||||||
Sbjct: 17726022 tctcctccctcgccctcctcaagatgctcaagcacgg 17726058



 Score =  123 bits (62), Expect = 7e-25
 Identities = 71/74 (95%)
 Strand = Plus / Plus

                                                                            
Query: 328      gaaatggtggtaggctggtaccactcgcatcctggatttggttgctggctttcaggagtt 387
                |||||||||||||| |||||||| || |||||||||||||||||||||||||||||||||
Sbjct: 17726946 gaaatggtggtaggttggtaccattcccatcctggatttggttgctggctttcaggagtt 17727005

                              
Query: 388      gacatcaatactca 401
                ||||||||||||||
Sbjct: 17727006 gacatcaatactca 17727019



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
               sequence
          Length = 43261740

 Score =  270 bits (136), Expect = 5e-69
 Identities = 163/172 (94%)
 Strand = Plus / Plus

                                                                           
Query: 149     gggccggcgtgcccatggaggtgatgggcctgatgctgggcgagttcgtcgacgactaca 208
               ||||||||||||| |||||||||||||| |||||||| || |||||||||||||||||||
Sbjct: 9165661 gggccggcgtgccgatggaggtgatggggctgatgctcggggagttcgtcgacgactaca 9165720

                                                                           
Query: 209     cggtcagggtggtggatgtcttcgccatgccgcagagcgggaccggggtcagcgtcgagg 268
               | ||||||||||| || |||||||||||||||||||||||||| || |||||||||||||
Sbjct: 9165721 ccgtcagggtggtcgacgtcttcgccatgccgcagagcgggacgggcgtcagcgtcgagg 9165780

                                                                   
Query: 269     ccgtcgaccacgtcttccagaccaacatgctcgacatgctcaagcagaccgg 320
               ||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 9165781 ccgtcgaccacgtcttccagaccaacatgctcgacatgctcaagcagaccgg 9165832



 Score =  232 bits (117), Expect = 1e-57
 Identities = 159/173 (91%)
 Strand = Plus / Plus

                                                                           
Query: 402     gcagagttttgaagcgttaaaccccagggcagttgctgttgtgatagatcccatccagag 461
               ||||||||||||||| ||||| |||||||| ||||| ||||||||||| || ||||||||
Sbjct: 9167903 gcagagttttgaagctttaaatcccagggctgttgcagttgtgatagacccaatccagag 9167962

                                                                           
Query: 462     tgtcaaggggaaagtggtcattgatgcattccgtctcattaaccctcagaccatgatgct 521
               |||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||||||
Sbjct: 9167963 tgtcaaggggaaggtggtcattgatgcatttcgtctcattaatcctcagaccatgatgct 9168022

                                                                    
Query: 522     tggccaggagccacggcagacaacatcgaatgttgggcacctaaacaaaccat 574
               ||||||||| || || ||||||||||| ||||||||||| |||||||||||||
Sbjct: 9168023 tggccaggaaccgcgacagacaacatcaaatgttgggcatctaaacaaaccat 9168075



 Score =  165 bits (83), Expect = 2e-37
 Identities = 92/95 (96%)
 Strand = Plus / Plus

                                                                           
Query: 52      gggatggggcagccggggaccgactcgccgctgctcgactcctccgagcaggtctacatc 111
               |||||||||||||||  ||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 9165487 gggatggggcagccgccgacggactcgccgctgctcgactcctccgagcaggtctacatc 9165546

                                                  
Query: 112     tcctccctcgccctcctcaagatgctcaagcacgg 146
               |||||||||||||||||||||||||||||||||||
Sbjct: 9165547 tcctccctcgccctcctcaagatgctcaagcacgg 9165581



 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 75/84 (89%)
 Strand = Plus / Plus

                                                                           
Query: 322     agacctgaaatggtggtaggctggtaccactcgcatcctggatttggttgctggctttca 381
               ||||| ||||||||||| |||||||| ||||| |||||||||||||| || |||||||||
Sbjct: 9167254 agaccagaaatggtggtgggctggtatcactcccatcctggatttggatgttggctttca 9167313

                                       
Query: 382     ggagttgacatcaatactcagcag 405
               || ||||| ||||| |||||||||
Sbjct: 9167314 ggtgttgatatcaacactcagcag 9167337



to top

>dbj|AP000969.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1,
             clone:P0011D01
          Length = 168655

 Score =  270 bits (136), Expect = 5e-69
 Identities = 163/172 (94%)
 Strand = Plus / Plus

                                                                         
Query: 149   gggccggcgtgcccatggaggtgatgggcctgatgctgggcgagttcgtcgacgactaca 208
             ||||||||||||| |||||||||||||| |||||||| || |||||||||||||||||||
Sbjct: 66043 gggccggcgtgccgatggaggtgatggggctgatgctcggggagttcgtcgacgactaca 66102

                                                                         
Query: 209   cggtcagggtggtggatgtcttcgccatgccgcagagcgggaccggggtcagcgtcgagg 268
             | ||||||||||| || |||||||||||||||||||||||||| || |||||||||||||
Sbjct: 66103 ccgtcagggtggtcgacgtcttcgccatgccgcagagcgggacgggcgtcagcgtcgagg 66162

                                                                 
Query: 269   ccgtcgaccacgtcttccagaccaacatgctcgacatgctcaagcagaccgg 320
             ||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 66163 ccgtcgaccacgtcttccagaccaacatgctcgacatgctcaagcagaccgg 66214



 Score =  232 bits (117), Expect = 1e-57
 Identities = 159/173 (91%)
 Strand = Plus / Plus

                                                                         
Query: 402   gcagagttttgaagcgttaaaccccagggcagttgctgttgtgatagatcccatccagag 461
             ||||||||||||||| ||||| |||||||| ||||| ||||||||||| || ||||||||
Sbjct: 68285 gcagagttttgaagctttaaatcccagggctgttgcagttgtgatagacccaatccagag 68344

                                                                         
Query: 462   tgtcaaggggaaagtggtcattgatgcattccgtctcattaaccctcagaccatgatgct 521
             |||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||||||
Sbjct: 68345 tgtcaaggggaaggtggtcattgatgcatttcgtctcattaatcctcagaccatgatgct 68404

                                                                  
Query: 522   tggccaggagccacggcagacaacatcgaatgttgggcacctaaacaaaccat 574
             ||||||||| || || ||||||||||| ||||||||||| |||||||||||||
Sbjct: 68405 tggccaggaaccgcgacagacaacatcaaatgttgggcatctaaacaaaccat 68457



 Score =  165 bits (83), Expect = 2e-37
 Identities = 92/95 (96%)
 Strand = Plus / Plus

                                                                         
Query: 52    gggatggggcagccggggaccgactcgccgctgctcgactcctccgagcaggtctacatc 111
             |||||||||||||||  ||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 65869 gggatggggcagccgccgacggactcgccgctgctcgactcctccgagcaggtctacatc 65928

                                                
Query: 112   tcctccctcgccctcctcaagatgctcaagcacgg 146
             |||||||||||||||||||||||||||||||||||
Sbjct: 65929 tcctccctcgccctcctcaagatgctcaagcacgg 65963



 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 75/84 (89%)
 Strand = Plus / Plus

                                                                         
Query: 322   agacctgaaatggtggtaggctggtaccactcgcatcctggatttggttgctggctttca 381
             ||||| ||||||||||| |||||||| ||||| |||||||||||||| || |||||||||
Sbjct: 67636 agaccagaaatggtggtgggctggtatcactcccatcctggatttggatgttggctttca 67695

                                     
Query: 382   ggagttgacatcaatactcagcag 405
             || ||||| ||||| |||||||||
Sbjct: 67696 ggtgttgatatcaacactcagcag 67719



to top

>ref|NM_122261.2| Arabidopsis thaliana unknown protein AT5G23540 mRNA, complete cds
          Length = 1266

 Score =  210 bits (106), Expect = 4e-51
 Identities = 385/478 (80%)
 Strand = Plus / Plus

                                                                       
Query: 97  gagcaggtctacatctcctccctcgccctcctcaagatgctcaagcacgggagggccggc 156
           |||||||| |||||||| || ||||| |||||||||||||| |||||||| || || || 
Sbjct: 185 gagcaggtttacatctcttctctcgctctcctcaagatgcttaagcacggaagagctggt 244

                                                                       
Query: 157 gtgcccatggaggtgatgggcctgatgctgggcgagttcgtcgacgactacacggtcagg 216
           || || ||||| || |||||  ||||||| || ||||| || || || ||||| || |||
Sbjct: 245 gttcctatggaagtcatgggattgatgcttggagagtttgtggatgaatacactgttagg 304

                                                                       
Query: 217 gtggtggatgtcttcgccatgccgcagagcgggaccggggtcagcgtcgaggccgtcgac 276
           || |||||||| || || ||||| ||||| || || || || || || || || || || 
Sbjct: 305 gttgtggatgtttttgcgatgcctcagagtggtactggtgttagtgttgaagctgttgat 364

                                                                       
Query: 277 cacgtcttccagaccaacatgctcgacatgctcaagcagaccggaagacctgaaatggtg 336
           || || |||||||| || |||||||||||||| || ||||||||||||||||| ||||||
Sbjct: 365 catgttttccagactaatatgctcgacatgcttaaacagaccggaagacctgagatggtg 424

                                                                       
Query: 337 gtaggctggtaccactcgcatcctggatttggttgctggctttcaggagttgacatcaat 396
           || || ||||| || || ||||||||||| || ||||||||||| || |||||||| |||
Sbjct: 425 gttggttggtatcattcacatcctggattcggctgctggctttctggggttgacattaat 484

                                                                       
Query: 397 actcagcagagttttgaagcgttaaaccccagggcagttgctgttgtgatagatcccatc 456
           ||||| |||||||||||||| || || |   | || || || || ||| ||||||| || 
Sbjct: 485 actcaacagagttttgaagctttgaatcagcgagctgtagcagtggtggtagatccgatt 544

                                                                       
Query: 457 cagagtgtcaaggggaaagtggtcattgatgcattccgtctcattaaccctcagaccatg 516
           |||||||| || || || ||||| |||||||| |||||   ||| || || |||||||| 
Sbjct: 545 cagagtgtgaaaggaaaggtggtgattgatgcgttccgctccataaatccacagaccatt 604

                                                                     
Query: 517 atgcttggccaggagccacggcagacaacatcgaatgttgggcacctaaacaaaccat 574
           |||||||| ||||| || || || |||||||||||  |||||||| | ||||||||||
Sbjct: 605 atgcttgggcaggaaccccgtcaaacaacatcgaaccttgggcacttgaacaaaccat 662



to top

>gb|AY230845.1| Arabidopsis thaliana 26S proteasome subunit RPN11 (RPN11) mRNA,
           RPN11-2 allele, complete cds
          Length = 1199

 Score =  210 bits (106), Expect = 4e-51
 Identities = 385/478 (80%)
 Strand = Plus / Plus

                                                                       
Query: 97  gagcaggtctacatctcctccctcgccctcctcaagatgctcaagcacgggagggccggc 156
           |||||||| |||||||| || ||||| |||||||||||||| |||||||| || || || 
Sbjct: 148 gagcaggtttacatctcttctctcgctctcctcaagatgcttaagcacggaagagctggt 207

                                                                       
Query: 157 gtgcccatggaggtgatgggcctgatgctgggcgagttcgtcgacgactacacggtcagg 216
           || || ||||| || |||||  ||||||| || ||||| || || || ||||| || |||
Sbjct: 208 gttcctatggaagtcatgggattgatgcttggagagtttgtggatgagtacactgttagg 267

                                                                       
Query: 217 gtggtggatgtcttcgccatgccgcagagcgggaccggggtcagcgtcgaggccgtcgac 276
           || |||||||| || || ||||| ||||| || || || || || || || || || || 
Sbjct: 268 gttgtggatgtttttgcgatgcctcagagtggtactggtgttagtgttgaagctgttgat 327

                                                                       
Query: 277 cacgtcttccagaccaacatgctcgacatgctcaagcagaccggaagacctgaaatggtg 336
           || || |||||||| || |||||||||||||| || ||||||||||||||||| ||||||
Sbjct: 328 catgttttccagactaatatgctcgacatgcttaaacagaccggaagacctgagatggtg 387

                                                                       
Query: 337 gtaggctggtaccactcgcatcctggatttggttgctggctttcaggagttgacatcaat 396
           || || ||||| || || ||||||||||| || ||||||||||| || |||||||| |||
Sbjct: 388 gttggttggtatcattcacatcctggattcggctgctggctttctggggttgacattaat 447

                                                                       
Query: 397 actcagcagagttttgaagcgttaaaccccagggcagttgctgttgtgatagatcccatc 456
           ||||| |||||||||||||| || || |   | || || || || ||| ||||||| || 
Sbjct: 448 actcaacagagttttgaagctttgaatcagcgagctgtagcagtggtggtagatccgatt 507

                                                                       
Query: 457 cagagtgtcaaggggaaagtggtcattgatgcattccgtctcattaaccctcagaccatg 516
           |||||||| || || || ||||| |||||||| |||||   ||| || || |||||||| 
Sbjct: 508 cagagtgtgaaaggaaaggtggtgattgatgcgttccgctccataaatccacagaccatt 567

                                                                     
Query: 517 atgcttggccaggagccacggcagacaacatcgaatgttgggcacctaaacaaaccat 574
           |||||||| ||||| || || || |||||||||||  |||||||| | ||||||||||
Sbjct: 568 atgcttgggcaggaaccccgtcaaacaacatcgaaccttgggcacttgaacaaaccat 625



to top

>gb|AY230844.1| Arabidopsis thaliana 26S proteasome subunit RPN11a (RPN11a) mRNA,
           RPN11a-1 allele, complete cds
          Length = 1163

 Score =  210 bits (106), Expect = 4e-51
 Identities = 385/478 (80%)
 Strand = Plus / Plus

                                                                       
Query: 97  gagcaggtctacatctcctccctcgccctcctcaagatgctcaagcacgggagggccggc 156
           |||||||| |||||||| || ||||| |||||||||||||| |||||||| || || || 
Sbjct: 139 gagcaggtttacatctcttctctcgctctcctcaagatgcttaagcacggaagagctggt 198

                                                                       
Query: 157 gtgcccatggaggtgatgggcctgatgctgggcgagttcgtcgacgactacacggtcagg 216
           || || ||||| || |||||  ||||||| || ||||| || || || ||||| || |||
Sbjct: 199 gttcctatggaagtcatgggattgatgcttggagagtttgtggatgaatacactgttagg 258

                                                                       
Query: 217 gtggtggatgtcttcgccatgccgcagagcgggaccggggtcagcgtcgaggccgtcgac 276
           || |||||||| || || ||||| ||||| || || || || || || || || || || 
Sbjct: 259 gttgtggatgtttttgcgatgcctcagagtggtactggtgttagtgttgaagctgttgat 318

                                                                       
Query: 277 cacgtcttccagaccaacatgctcgacatgctcaagcagaccggaagacctgaaatggtg 336
           || || |||||||| || |||||||||||||| || ||||||||||||||||| ||||||
Sbjct: 319 catgttttccagactaatatgctcgacatgcttaaacagaccggaagacctgagatggtg 378

                                                                       
Query: 337 gtaggctggtaccactcgcatcctggatttggttgctggctttcaggagttgacatcaat 396
           || || ||||| || || ||||||||||| || ||||||||||| || |||||||| |||
Sbjct: 379 gttggttggtatcattcacatcctggattcggctgctggctttctggggttgacattaat 438

                                                                       
Query: 397 actcagcagagttttgaagcgttaaaccccagggcagttgctgttgtgatagatcccatc 456
           ||||| |||||||||||||| || || |   | || || || || ||| ||||||| || 
Sbjct: 439 actcaacagagttttgaagctttgaatcagcgagctgtagcagtggtggtagatccgatt 498

                                                                       
Query: 457 cagagtgtcaaggggaaagtggtcattgatgcattccgtctcattaaccctcagaccatg 516
           |||||||| || || || ||||| |||||||| |||||   ||| || || |||||||| 
Sbjct: 499 cagagtgtgaaaggaaaggtggtgattgatgcgttccgctccataaatccacagaccatt 558

                                                                     
Query: 517 atgcttggccaggagccacggcagacaacatcgaatgttgggcacctaaacaaaccat 574
           |||||||| ||||| || || || |||||||||||  |||||||| | ||||||||||
Sbjct: 559 atgcttgggcaggaaccccgtcaaacaacatcgaaccttgggcacttgaacaaaccat 616



to top

>gb|AY230843.1| Arabidopsis thaliana 26S proteasome subunit RPN11A (RPN11a) mRNA,
           RPN11a-1 allele, complete cds
          Length = 1235

 Score =  210 bits (106), Expect = 4e-51
 Identities = 385/478 (80%)
 Strand = Plus / Plus

                                                                       
Query: 97  gagcaggtctacatctcctccctcgccctcctcaagatgctcaagcacgggagggccggc 156
           |||||||| |||||||| || ||||| |||||||||||||| |||||||| || || || 
Sbjct: 172 gagcaggtttacatctcttctctcgctctcctcaagatgcttaagcacggaagagctggt 231

                                                                       
Query: 157 gtgcccatggaggtgatgggcctgatgctgggcgagttcgtcgacgactacacggtcagg 216
           || || ||||| || |||||  ||||||| || ||||| || || || ||||| || |||
Sbjct: 232 gttcctatggaagtcatgggattgatgcttggagagtttgtggatgaatacactgttagg 291

                                                                       
Query: 217 gtggtggatgtcttcgccatgccgcagagcgggaccggggtcagcgtcgaggccgtcgac 276
           || |||||||| || || ||||| ||||| || || || || || || || || || || 
Sbjct: 292 gttgtggatgtttttgcgatgcctcagagtggtactggtgttagtgttgaagctgttgat 351

                                                                       
Query: 277 cacgtcttccagaccaacatgctcgacatgctcaagcagaccggaagacctgaaatggtg 336
           || || |||||||| || |||||||||||||| || ||||||||||||||||| ||||||
Sbjct: 352 catgttttccagactaatatgctcgacatgcttaaacagaccggaagacctgagatggtg 411

                                                                       
Query: 337 gtaggctggtaccactcgcatcctggatttggttgctggctttcaggagttgacatcaat 396
           || || ||||| || || ||||||||||| || ||||||||||| || |||||||| |||
Sbjct: 412 gttggttggtatcattcacatcctggattcggctgctggctttctggggttgacattaat 471

                                                                       
Query: 397 actcagcagagttttgaagcgttaaaccccagggcagttgctgttgtgatagatcccatc 456
           ||||| |||||||||||||| || || |   | || || || || ||| ||||||| || 
Sbjct: 472 actcaacagagttttgaagctttgaatcagcgagctgtagcagtggtggtagatccgatt 531

                                                                       
Query: 457 cagagtgtcaaggggaaagtggtcattgatgcattccgtctcattaaccctcagaccatg 516
           |||||||| || || || ||||| |||||||| |||||   ||| || || |||||||| 
Sbjct: 532 cagagtgtgaaaggaaaggtggtgattgatgcgttccgctccataaatccacagaccatt 591

                                                                     
Query: 517 atgcttggccaggagccacggcagacaacatcgaatgttgggcacctaaacaaaccat 574
           |||||||| ||||| || || || |||||||||||  |||||||| | ||||||||||
Sbjct: 592 atgcttgggcaggaaccccgtcaaacaacatcgaaccttgggcacttgaacaaaccat 649



to top

>gb|AY091329.1| Arabidopsis thaliana putative 26S proteasome, non-ATPase regulatory
           subunit (At5g23540) mRNA, complete cds
          Length = 958

 Score =  210 bits (106), Expect = 4e-51
 Identities = 385/478 (80%)
 Strand = Plus / Plus

                                                                       
Query: 97  gagcaggtctacatctcctccctcgccctcctcaagatgctcaagcacgggagggccggc 156
           |||||||| |||||||| || ||||| |||||||||||||| |||||||| || || || 
Sbjct: 82  gagcaggtttacatctcttctctcgctctcctcaagatgcttaagcacggaagagctggt 141

                                                                       
Query: 157 gtgcccatggaggtgatgggcctgatgctgggcgagttcgtcgacgactacacggtcagg 216
           || || ||||| || |||||  ||||||| || ||||| || || || ||||| || |||
Sbjct: 142 gttcctatggaagtcatgggattgatgcttggagagtttgtggatgaatacactgttagg 201

                                                                       
Query: 217 gtggtggatgtcttcgccatgccgcagagcgggaccggggtcagcgtcgaggccgtcgac 276
           || |||||||| || || ||||| ||||| || || || || || || || || || || 
Sbjct: 202 gttgtggatgtttttgcgatgcctcagagtggtactggtgttagtgttgaagctgttgat 261

                                                                       
Query: 277 cacgtcttccagaccaacatgctcgacatgctcaagcagaccggaagacctgaaatggtg 336
           || || |||||||| || |||||||||||||| || ||||||||||||||||| ||||||
Sbjct: 262 catgttttccagactaatatgctcgacatgcttaaacagaccggaagacctgagatggtg 321

                                                                       
Query: 337 gtaggctggtaccactcgcatcctggatttggttgctggctttcaggagttgacatcaat 396
           || || ||||| || || ||||||||||| || ||||||||||| || |||||||| |||
Sbjct: 322 gttggttggtatcattcacatcctggattcggctgctggctttctggggttgacattaat 381

                                                                       
Query: 397 actcagcagagttttgaagcgttaaaccccagggcagttgctgttgtgatagatcccatc 456
           ||||| |||||||||||||| || || |   | || || || || ||| ||||||| || 
Sbjct: 382 actcaacagagttttgaagctttgaatcagcgagctgtagcagtggtggtagatccgatt 441

                                                                       
Query: 457 cagagtgtcaaggggaaagtggtcattgatgcattccgtctcattaaccctcagaccatg 516
           |||||||| || || || ||||| |||||||| |||||   ||| || || |||||||| 
Sbjct: 442 cagagtgtgaaaggaaaggtggtgattgatgcgttccgctccataaatccacagaccatt 501

                                                                     
Query: 517 atgcttggccaggagccacggcagacaacatcgaatgttgggcacctaaacaaaccat 574
           |||||||| ||||| || || || |||||||||||  |||||||| | ||||||||||
Sbjct: 502 atgcttgggcaggaaccccgtcaaacaacatcgaaccttgggcacttgaacaaaccat 559



to top

>gb|AY070073.1| Arabidopsis thaliana putative 26S proteasome, non-ATPase regulatory
           subunit (At5g23540) mRNA, complete cds
          Length = 1227

 Score =  210 bits (106), Expect = 4e-51
 Identities = 385/478 (80%)
 Strand = Plus / Plus

                                                                       
Query: 97  gagcaggtctacatctcctccctcgccctcctcaagatgctcaagcacgggagggccggc 156
           |||||||| |||||||| || ||||| |||||||||||||| |||||||| || || || 
Sbjct: 128 gagcaggtttacatctcttctctcgctctcctcaagatgcttaagcacggaagagctggt 187

                                                                       
Query: 157 gtgcccatggaggtgatgggcctgatgctgggcgagttcgtcgacgactacacggtcagg 216
           || || ||||| || |||||  ||||||| || ||||| || || || ||||| || |||
Sbjct: 188 gttcctatggaagtcatgggattgatgcttggagagtttgtggatgaatacactgttagg 247

                                                                       
Query: 217 gtggtggatgtcttcgccatgccgcagagcgggaccggggtcagcgtcgaggccgtcgac 276
           || |||||||| || || ||||| ||||| || || || || || || || || || || 
Sbjct: 248 gttgtggatgtttttgcgatgcctcagagtggtactggtgttagtgttgaagctgttgat 307

                                                                       
Query: 277 cacgtcttccagaccaacatgctcgacatgctcaagcagaccggaagacctgaaatggtg 336
           || || |||||||| || |||||||||||||| || ||||||||||||||||| ||||||
Sbjct: 308 catgttttccagactaatatgctcgacatgcttaaacagaccggaagacctgagatggtg 367

                                                                       
Query: 337 gtaggctggtaccactcgcatcctggatttggttgctggctttcaggagttgacatcaat 396
           || || ||||| || || ||||||||||| || ||||||||||| || |||||||| |||
Sbjct: 368 gttggttggtatcattcacatcctggattcggctgctggctttctggggttgacattaat 427

                                                                       
Query: 397 actcagcagagttttgaagcgttaaaccccagggcagttgctgttgtgatagatcccatc 456
           ||||| |||||||||||||| || || |   | || || || || ||| ||||||| || 
Sbjct: 428 actcaacagagttttgaagctttgaatcagcgagctgtagcagtggtggtagatccgatt 487

                                                                       
Query: 457 cagagtgtcaaggggaaagtggtcattgatgcattccgtctcattaaccctcagaccatg 516
           |||||||| || || || ||||| |||||||| |||||   ||| || || |||||||| 
Sbjct: 488 cagagtgtgaaaggaaaggtggtgattgatgcgttccgctccataaatccacagaccatt 547

                                                                     
Query: 517 atgcttggccaggagccacggcagacaacatcgaatgttgggcacctaaacaaaccat 574
           |||||||| ||||| || || || |||||||||||  |||||||| | ||||||||||
Sbjct: 548 atgcttgggcaggaaccccgtcaaacaacatcgaaccttgggcacttgaacaaaccat 605



to top

>emb|BX830953.1|CNS09YRU Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS41ZB02 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 898

 Score =  210 bits (106), Expect = 4e-51
 Identities = 385/478 (80%)
 Strand = Plus / Plus

                                                                       
Query: 97  gagcaggtctacatctcctccctcgccctcctcaagatgctcaagcacgggagggccggc 156
           |||||||| |||||||| || ||||| |||||||||||||| |||||||| || || || 
Sbjct: 122 gagcaggtttacatctcttctctcgctctcctcaagatgcttaagcacggaagagctggt 181

                                                                       
Query: 157 gtgcccatggaggtgatgggcctgatgctgggcgagttcgtcgacgactacacggtcagg 216
           || || ||||| || |||||  ||||||| || ||||| || || || ||||| || |||
Sbjct: 182 gttcctatggaagtcatgggattgatgcttggagagtttgtggatgaatacactgttagg 241

                                                                       
Query: 217 gtggtggatgtcttcgccatgccgcagagcgggaccggggtcagcgtcgaggccgtcgac 276
           || |||||||| || || ||||| ||||| || || || || || || || || || || 
Sbjct: 242 gttgtggatgtttttgcgatgcctcagagtggtactggtgttagtgttgaagctgttgat 301

                                                                       
Query: 277 cacgtcttccagaccaacatgctcgacatgctcaagcagaccggaagacctgaaatggtg 336
           || || |||||||| || |||||||||||||| || ||||||||||||||||| ||||||
Sbjct: 302 catgttttccagactaatatgctcgacatgcttaaacagaccggaagacctgagatggtg 361

                                                                       
Query: 337 gtaggctggtaccactcgcatcctggatttggttgctggctttcaggagttgacatcaat 396
           || || ||||| || || ||||||||||| || ||||||||||| || |||||||| |||
Sbjct: 362 gttggttggtatcattcacatcctggattcggctgctggctttctggggttgacattaat 421

                                                                       
Query: 397 actcagcagagttttgaagcgttaaaccccagggcagttgctgttgtgatagatcccatc 456
           ||||| |||||||||||||| || || |   | || || || || ||| ||||||| || 
Sbjct: 422 actcaacagagttttgaagctttgaatcagcgagctgtagcagtggtggtagatccgatt 481

                                                                       
Query: 457 cagagtgtcaaggggaaagtggtcattgatgcattccgtctcattaaccctcagaccatg 516
           |||||||| || || || ||||| |||||||| |||||   ||| || || |||||||| 
Sbjct: 482 cagagtgtgaaaggaaaggtggtgattgatgcgttccgctccataaatccacagaccatt 541

                                                                     
Query: 517 atgcttggccaggagccacggcagacaacatcgaatgttgggcacctaaacaaaccat 574
           |||||||| ||||| || || || |||||||||||  |||||||| | ||||||||||
Sbjct: 542 atgcttgggcaggaaccccgtcaaacaacatcgaaccttgggcacttgaacaaaccat 599



to top

>gb|AY086277.1| Arabidopsis thaliana clone 23276 mRNA, complete sequence
          Length = 1185

 Score =  202 bits (102), Expect = 9e-49
 Identities = 384/478 (80%)
 Strand = Plus / Plus

                                                                       
Query: 97  gagcaggtctacatctcctccctcgccctcctcaagatgctcaagcacgggagggccggc 156
           |||||||| |||||||| || ||||| |||||||||||||| |||||||| || || || 
Sbjct: 188 gagcaggtttacatctcttctctcgctctcctcaagatgcttaagcacggaagagctggt 247

                                                                       
Query: 157 gtgcccatggaggtgatgggcctgatgctgggcgagttcgtcgacgactacacggtcagg 216
           || || ||||| || |||||  ||||||| || ||||| || || || ||||| || |||
Sbjct: 248 gttcctatggaagtcatgggattgatgcttggagagtttgtggatgagtacactgttagg 307

                                                                       
Query: 217 gtggtggatgtcttcgccatgccgcagagcgggaccggggtcagcgtcgaggccgtcgac 276
           || |||||||| || || ||||| ||||| || || || || || || || || || || 
Sbjct: 308 gttgtggatgtttttgcgatgcctcagagtggtactggtgttagtgttgaagctgttgat 367

                                                                       
Query: 277 cacgtcttccagaccaacatgctcgacatgctcaagcagaccggaagacctgaaatggtg 336
           || || |||||||| || |||||||||||||| || ||||||||||||||||| ||||||
Sbjct: 368 catgttttccagactaatatgctcgacatgcttaaacagaccggaagacctgagatggtg 427

                                                                       
Query: 337 gtaggctggtaccactcgcatcctggatttggttgctggctttcaggagttgacatcaat 396
           || || ||||| || || ||||||||||| || ||||||||||| || |||||||| |||
Sbjct: 428 gttggttggtatcattcacatcctggattcggctgctggctttctggggttgacattaat 487

                                                                       
Query: 397 actcagcagagttttgaagcgttaaaccccagggcagttgctgttgtgatagatcccatc 456
           ||||| |||||||||||||| || || |   | || || || || ||| ||||||| || 
Sbjct: 488 actcaacagagttttgaagctttgaatcagcgagctgtagcagtggtggtagatccgatt 547

                                                                       
Query: 457 cagagtgtcaaggggaaagtggtcattgatgcattccgtctcattaaccctcagaccatg 516
           |||||||| || || || ||||| |||||||| |||||   ||| || || |||||||| 
Sbjct: 548 cagagtgtgaaaggaaaggtggtgattgatgcgttccgctccataaatccacagaccatt 607

                                                                     
Query: 517 atgcttggccaggagccacggcagacaacatcgaatgttgggcacctaaacaaaccat 574
           |||||||| || || || || || |||||||||||  |||||||| | ||||||||||
Sbjct: 608 atgcttgggcacgaaccccgtcaaacaacatcgaaccttgggcacttgaacaaaccat 665



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score =  194 bits (98), Expect = 2e-46
 Identities = 203/238 (85%)
 Strand = Plus / Minus

                                                                            
Query: 116      ccctcgccctcctcaagatgctcaagcacgggagggccggcgtgcccatggaggtgatgg 175
                |||||||||||||||||||||||||||||||| | ||||||||||| |||||||||||||
Sbjct: 29196476 ccctcgccctcctcaagatgctcaagcacgggcgagccggcgtgccgatggaggtgatgg 29196417

                                                                            
Query: 176      gcctgatgctgggcgagttcgtcgacgactacacggtcagggtggtggatgtcttcgcca 235
                | |||||||||||||||||||||||||| |||||||| | ||| |  || || |||||||
Sbjct: 29196416 ggctgatgctgggcgagttcgtcgacgagtacacggtgacggtcgccgacgtgttcgcca 29196357

                                                                            
Query: 236      tgccgcagagcgggaccggggtcagcgtcgaggccgtcgaccacgtcttccagaccaaca 295
                ||||||||||||| ||||| || ||||| ||||| || |||||||  ||||||| | | |
Sbjct: 29196356 tgccgcagagcggcaccggcgtgagcgtggaggcggtggaccacgcgttccagagcgaga 29196297

                                                                          
Query: 296      tgctcgacatgctcaagcagaccggaagacctgaaatggtggtaggctggtaccactc 353
                |||| || ||||||  |||||| ||  | || || |||||||| || |||||||||||
Sbjct: 29196296 tgctggagatgctccggcagacggggcggccggagatggtggtggggtggtaccactc 29196239



to top

>dbj|AP004324.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
             clone:OJ1215_E11
          Length = 105301

 Score =  194 bits (98), Expect = 2e-46
 Identities = 203/238 (85%)
 Strand = Plus / Minus

                                                                         
Query: 116   ccctcgccctcctcaagatgctcaagcacgggagggccggcgtgcccatggaggtgatgg 175
             |||||||||||||||||||||||||||||||| | ||||||||||| |||||||||||||
Sbjct: 63763 ccctcgccctcctcaagatgctcaagcacgggcgagccggcgtgccgatggaggtgatgg 63704

                                                                         
Query: 176   gcctgatgctgggcgagttcgtcgacgactacacggtcagggtggtggatgtcttcgcca 235
             | |||||||||||||||||||||||||| |||||||| | ||| |  || || |||||||
Sbjct: 63703 ggctgatgctgggcgagttcgtcgacgagtacacggtgacggtcgccgacgtgttcgcca 63644

                                                                         
Query: 236   tgccgcagagcgggaccggggtcagcgtcgaggccgtcgaccacgtcttccagaccaaca 295
             ||||||||||||| ||||| || ||||| ||||| || |||||||  ||||||| | | |
Sbjct: 63643 tgccgcagagcggcaccggcgtgagcgtggaggcggtggaccacgcgttccagagcgaga 63584

                                                                       
Query: 296   tgctcgacatgctcaagcagaccggaagacctgaaatggtggtaggctggtaccactc 353
             |||| || ||||||  |||||| ||  | || || |||||||| || |||||||||||
Sbjct: 63583 tgctggagatgctccggcagacggggcggccggagatggtggtggggtggtaccactc 63526



to top

>dbj|AK112072.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-120-G01, full
           insert sequence
          Length = 1137

 Score =  194 bits (98), Expect = 2e-46
 Identities = 203/238 (85%)
 Strand = Plus / Minus

                                                                       
Query: 116 ccctcgccctcctcaagatgctcaagcacgggagggccggcgtgcccatggaggtgatgg 175
           |||||||||||||||||||||||||||||||| | ||||||||||| |||||||||||||
Sbjct: 799 ccctcgccctcctcaagatgctcaagcacgggcgagccggcgtgccgatggaggtgatgg 740

                                                                       
Query: 176 gcctgatgctgggcgagttcgtcgacgactacacggtcagggtggtggatgtcttcgcca 235
           | |||||||||||||||||||||||||| |||||||| | ||| |  || || |||||||
Sbjct: 739 ggctgatgctgggcgagttcgtcgacgagtacacggtgacggtcgccgacgtgttcgcca 680

                                                                       
Query: 236 tgccgcagagcgggaccggggtcagcgtcgaggccgtcgaccacgtcttccagaccaaca 295
           ||||||||||||| ||||| || ||||| ||||| || |||||||  ||||||| | | |
Sbjct: 679 tgccgcagagcggcaccggcgtgagcgtggaggcggtggaccacgcgttccagagcgaga 620

                                                                     
Query: 296 tgctcgacatgctcaagcagaccggaagacctgaaatggtggtaggctggtaccactc 353
           |||| || ||||||  |||||| ||  | || || |||||||| || |||||||||||
Sbjct: 619 tgctggagatgctccggcagacggggcggccggagatggtggtggggtggtaccactc 562



to top

>dbj|AK110999.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-174-E09, full
           insert sequence
          Length = 1274

 Score =  194 bits (98), Expect = 2e-46
 Identities = 203/238 (85%)
 Strand = Plus / Plus

                                                                       
Query: 116 ccctcgccctcctcaagatgctcaagcacgggagggccggcgtgcccatggaggtgatgg 175
           |||||||||||||||||||||||||||||||| | ||||||||||| |||||||||||||
Sbjct: 239 ccctcgccctcctcaagatgctcaagcacgggcgagccggcgtgccgatggaggtgatgg 298

                                                                       
Query: 176 gcctgatgctgggcgagttcgtcgacgactacacggtcagggtggtggatgtcttcgcca 235
           | |||||||||||||||||||||||||| |||||||| | ||| |  || || |||||||
Sbjct: 299 ggctgatgctgggcgagttcgtcgacgagtacacggtgacggtcgccgacgtgttcgcca 358

                                                                       
Query: 236 tgccgcagagcgggaccggggtcagcgtcgaggccgtcgaccacgtcttccagaccaaca 295
           ||||||||||||| ||||| || ||||| ||||| || |||||||  ||||||| | | |
Sbjct: 359 tgccgcagagcggcaccggcgtgagcgtggaggcggtggaccacgcgttccagagcgaga 418

                                                                     
Query: 296 tgctcgacatgctcaagcagaccggaagacctgaaatggtggtaggctggtaccactc 353
           |||| || ||||||  |||||| ||  | || || |||||||| || |||||||||||
Sbjct: 419 tgctggagatgctccggcagacggggcggccggagatggtggtggggtggtaccactc 476



to top

>gb|BT013130.1| Lycopersicon esculentum clone 114422R, mRNA sequence
          Length = 1181

 Score =  188 bits (95), Expect = 1e-44
 Identities = 389/487 (79%)
 Strand = Plus / Plus

                                                                       
Query: 88  gactcctccgagcaggtctacatctcctccctcgccctcctcaagatgctcaagcacggg 147
           ||||| || ||||| ||||||||||| || || |||||||| |||||||| || ||||||
Sbjct: 150 gactcttctgagcaagtctacatctcttctcttgccctcctaaagatgcttaaacacggg 209

                                                                       
Query: 148 agggccggcgtgcccatggaggtgatgggcctgatgctgggcgagttcgtcgacgactac 207
           ||||| || || || ||||||||||||||  ||||| | || || |||||||| || || 
Sbjct: 210 agggctggagttcctatggaggtgatgggattgatgttaggggatttcgtcgatgagtat 269

                                                                       
Query: 208 acggtcagggtggtggatgtcttcgccatgccgcagagcgggaccggggtcagcgtcgag 267
           || ||  | || || ||||| || || ||||| ||||| || || || || || || || 
Sbjct: 270 acagtgcgtgtagttgatgtgtttgcaatgcctcagagtggtactggtgtgagtgttgaa 329

                                                                       
Query: 268 gccgtcgaccacgtcttccagaccaacatgctcgacatgctcaagcagaccggaagacct 327
           || || || || || || || ||||| ||||| |||||||||||||| || || ||||||
Sbjct: 330 gctgttgatcatgtttttcaaaccaatatgcttgacatgctcaagcaaactgggagacct 389

                                                                       
Query: 328 gaaatggtggtaggctggtaccactcgcatcctggatttggttgctggctttcaggagtt 387
           || ||||| || || ||||| ||||| |||||||||||||| ||||||||||| || |||
Sbjct: 390 gagatggttgttggttggtatcactcacatcctggatttggctgctggctttctggtgtt 449

                                                                       
Query: 388 gacatcaatactcagcagagttttgaagcgttaaaccccagggcagttgctgttgtgata 447
           ||||||||||| |||||||||||||||||  | || |   | ||||| ||||| ||| | 
Sbjct: 450 gacatcaatacacagcagagttttgaagcactgaatcaacgagcagtggctgtggtggtg 509

                                                                       
Query: 448 gatcccatccagagtgtcaaggggaaagtggtcattgatgcattccgtctcattaaccct 507
           ||||| || |||||||| || ||||| ||||| |||||||| || ||  | || || || 
Sbjct: 510 gatcctattcagagtgttaaagggaaggtggtaattgatgcctttcgcttgatcaatccc 569

                                                                       
Query: 508 cagaccatgatgcttggccaggagccacggcagacaacatcgaatgttgggcacctaaac 567
           || || |||||||||||||| |||||||| ||||||||||| ||| | || || || |||
Sbjct: 570 caaactatgatgcttggccaagagccacgtcagacaacatcaaatctgggacatctgaac 629

                  
Query: 568 aaaccat 574
           |||||||
Sbjct: 630 aaaccat 636



to top

>emb|AM260494.1| Platanus acerifolia partial mRNA for 26S proteasome subunit 11
           (26S-11 gene)
          Length = 846

 Score =  182 bits (92), Expect = 8e-43
 Identities = 264/320 (82%), Gaps = 1/320 (0%)
 Strand = Plus / Plus

                                                                       
Query: 256 gtcagcgtcgaggccgtcgaccacgtcttcc-agaccaacatgctcgacatgctcaagca 314
           ||||| ||||||||||| || || ||||||| |||| || |||||||| |||||||||||
Sbjct: 7   gtcagtgtcgaggccgttgatcatgtcttcccagactaatatgctcgatatgctcaagca 66

                                                                       
Query: 315 gaccggaagacctgaaatggtggtaggctggtaccactcgcatcctggatttggttgctg 374
            || || ||||| || ||||||||||| ||||| || || |||||||||||||| |||||
Sbjct: 67  aactggtagaccagagatggtggtaggatggtatcattcacatcctggatttggctgctg 126

                                                                       
Query: 375 gctttcaggagttgacatcaatactcagcagagttttgaagcgttaaaccccagggcagt 434
           |||||| || || || || ||||| || ||||| ||||||||  |||| |   | || ||
Sbjct: 127 gctttcgggtgtggatattaatacacaacagagctttgaagctctaaatcaacgagctgt 186

                                                                       
Query: 435 tgctgttgtgatagatcccatccagagtgtcaaggggaaagtggtcattgatgcattccg 494
           ||| | |||| | || || ||||||||||| || || || ||||| |||||||| |||||
Sbjct: 187 tgcagctgtggttgacccaatccagagtgtaaaaggaaaggtggttattgatgccttccg 246

                                                                       
Query: 495 tctcattaaccctcagaccatgatgcttggccaggagccacggcagacaacatcgaatgt 554
             | |||||||| || |||||||||| |||||| |||||||||||||||||||| |||||
Sbjct: 247 attgattaacccacaaaccatgatgcctggccaagagccacggcagacaacatccaatgt 306

                               
Query: 555 tgggcacctaaacaaaccat 574
           |||||| || ||||||||||
Sbjct: 307 tgggcatctgaacaaaccat 326



to top

>ref|NM_135061.2| Drosophila melanogaster Rpn11 CG18174-RA (Rpn11), mRNA
          Length = 1242

 Score =  178 bits (90), Expect = 1e-41
 Identities = 255/310 (82%)
 Strand = Plus / Plus

                                                                       
Query: 95  ccgagcaggtctacatctcctccctcgccctcctcaagatgctcaagcacgggagggccg 154
           |||||||||| |||||||| ||| | ||||| ||||||||||| ||||||||  ||||||
Sbjct: 273 ccgagcaggtgtacatctcgtccttggccctgctcaagatgcttaagcacggacgggccg 332

                                                                       
Query: 155 gcgtgcccatggaggtgatgggcctgatgctgggcgagttcgtcgacgactacacggtca 214
           |||||||||||||||||||||| |||||| ||||||| ||||| ||||||||||||||  
Sbjct: 333 gcgtgcccatggaggtgatgggtctgatgttgggcgaattcgtggacgactacacggtgc 392

                                                                       
Query: 215 gggtggtggatgtcttcgccatgccgcagagcgggaccggggtcagcgtcgaggccgtcg 274
            |||  | ||||| |||||||||||||| |  || || || ||   ||| |||||||| |
Sbjct: 393 aggtcatcgatgtgttcgccatgccgcaaacgggtactggagtatccgtagaggccgtgg 452

                                                                       
Query: 275 accacgtcttccagaccaacatgctcgacatgctcaagcagaccggaagacctgaaatgg 334
           | | |||||| ||| | || ||| | |||||||| |||||||| ||  |||| |||||||
Sbjct: 453 atcccgtctttcaggcgaagatgttggacatgctgaagcagacgggtcgacccgaaatgg 512

                                                                       
Query: 335 tggtaggctggtaccactcgcatcctggatttggttgctggctttcaggagttgacatca 394
           | || |||||||| ||||||||||| || || || |||||||| || || || |||||||
Sbjct: 513 tcgtcggctggtatcactcgcatcccggtttcggctgctggctgtccggcgtggacatca 572

                     
Query: 395 atactcagca 404
           |||| |||||
Sbjct: 573 atacgcagca 582



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 448 gatcccatccagagtgtcaaggggaaagtggtcattgatgcattccg 494
           |||||||| |||  ||||||||| ||||||||||| ||||| |||||
Sbjct: 626 gatcccattcagtctgtcaagggcaaagtggtcatcgatgccttccg 672



to top

>gb|AY070977.1| Drosophila melanogaster RE07468 full length cDNA
          Length = 1249

 Score =  178 bits (90), Expect = 1e-41
 Identities = 255/310 (82%)
 Strand = Plus / Plus

                                                                       
Query: 95  ccgagcaggtctacatctcctccctcgccctcctcaagatgctcaagcacgggagggccg 154
           |||||||||| |||||||| ||| | ||||| ||||||||||| ||||||||  ||||||
Sbjct: 273 ccgagcaggtgtacatctcgtccttggccctgctcaagatgcttaagcacggacgggccg 332

                                                                       
Query: 155 gcgtgcccatggaggtgatgggcctgatgctgggcgagttcgtcgacgactacacggtca 214
           |||||||||||||||||||||| |||||| ||||||| ||||| ||||||||||||||  
Sbjct: 333 gcgtgcccatggaggtgatgggtctgatgttgggcgaattcgtggacgactacacggtgc 392

                                                                       
Query: 215 gggtggtggatgtcttcgccatgccgcagagcgggaccggggtcagcgtcgaggccgtcg 274
            |||  | ||||| |||||||||||||| |  || || || ||   ||| |||||||| |
Sbjct: 393 aggtcatcgatgtgttcgccatgccgcaaacgggtactggagtatccgtagaggccgtgg 452

                                                                       
Query: 275 accacgtcttccagaccaacatgctcgacatgctcaagcagaccggaagacctgaaatgg 334
           | | |||||| ||| | || ||| | |||||||| |||||||| ||  |||| |||||||
Sbjct: 453 atcccgtctttcaggcgaagatgttggacatgctgaagcagacgggtcgacccgaaatgg 512

                                                                       
Query: 335 tggtaggctggtaccactcgcatcctggatttggttgctggctttcaggagttgacatca 394
           | || |||||||| ||||||||||| || || || |||||||| || || || |||||||
Sbjct: 513 tcgtcggctggtatcactcgcatcccggtttcggctgctggctgtccggcgtggacatca 572

                     
Query: 395 atactcagca 404
           |||| |||||
Sbjct: 573 atacgcagca 582



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 448 gatcccatccagagtgtcaaggggaaagtggtcattgatgcattccg 494
           |||||||| |||  ||||||||| ||||||||||| ||||| |||||
Sbjct: 626 gatcccattcagtctgtcaagggcaaagtggtcatcgatgccttccg 672



to top

>gb|AC008233.3|AC008233 Drosophila melanogaster, chromosome 2L, region 25C-25C, BAC clone
              BACR13M11, complete sequence
          Length = 162387

 Score =  178 bits (90), Expect = 1e-41
 Identities = 255/310 (82%)
 Strand = Plus / Minus

                                                                          
Query: 95     ccgagcaggtctacatctcctccctcgccctcctcaagatgctcaagcacgggagggccg 154
              |||||||||| |||||||| ||| | ||||| ||||||||||| ||||||||  ||||||
Sbjct: 115777 ccgagcaggtgtacatctcgtccttggccctgctcaagatgcttaagcacggacgggccg 115718

                                                                          
Query: 155    gcgtgcccatggaggtgatgggcctgatgctgggcgagttcgtcgacgactacacggtca 214
              |||||||||||||||||||||| |||||| ||||||| ||||| ||||||||||||||  
Sbjct: 115717 gcgtgcccatggaggtgatgggtctgatgttgggcgaattcgtggacgactacacggtgc 115658

                                                                          
Query: 215    gggtggtggatgtcttcgccatgccgcagagcgggaccggggtcagcgtcgaggccgtcg 274
               |||  | ||||| |||||||||||||| |  || || || ||   ||| |||||||| |
Sbjct: 115657 aggtcatcgatgtgttcgccatgccgcaaacgggtactggagtatccgtagaggccgtgg 115598

                                                                          
Query: 275    accacgtcttccagaccaacatgctcgacatgctcaagcagaccggaagacctgaaatgg 334
              | | |||||| ||| | || ||| | |||||||| |||||||| ||  |||| |||||||
Sbjct: 115597 atcccgtctttcaggcgaagatgttggacatgctgaagcagacgggtcgacccgaaatgg 115538

                                                                          
Query: 335    tggtaggctggtaccactcgcatcctggatttggttgctggctttcaggagttgacatca 394
              | || |||||||| ||||||||||| || || || |||||||| || || || |||||||
Sbjct: 115537 tcgtcggctggtatcactcgcatcccggtttcggctgctggctgtccggcgtggacatca 115478

                        
Query: 395    atactcagca 404
              |||| |||||
Sbjct: 115477 atacgcagca 115468



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                             
Query: 448    gatcccatccagagtgtcaaggggaaagtggtcattgatgcattccg 494
              |||||||| |||  ||||||||| ||||||||||| ||||| |||||
Sbjct: 115424 gatcccattcagtctgtcaagggcaaagtggtcatcgatgccttccg 115378



to top

>gb|AF145313.1|AF145313 Drosophila melanogaster 26S proteasome regulatory complex subunit
           p37B mRNA, complete cds
          Length = 927

 Score =  178 bits (90), Expect = 1e-41
 Identities = 255/310 (82%)
 Strand = Plus / Plus

                                                                       
Query: 95  ccgagcaggtctacatctcctccctcgccctcctcaagatgctcaagcacgggagggccg 154
           |||||||||| |||||||| ||| | ||||| ||||||||||| ||||||||  ||||||
Sbjct: 77  ccgagcaggtgtacatctcgtccttggccctgctcaagatgcttaagcacggacgggccg 136

                                                                       
Query: 155 gcgtgcccatggaggtgatgggcctgatgctgggcgagttcgtcgacgactacacggtca 214
           |||||||||||||||||||||| |||||| ||||||| ||||| ||||||||||||||  
Sbjct: 137 gcgtgcccatggaggtgatgggtctgatgttgggcgaattcgtggacgactacacggtgc 196

                                                                       
Query: 215 gggtggtggatgtcttcgccatgccgcagagcgggaccggggtcagcgtcgaggccgtcg 274
            |||  | ||||| |||||||||||||| |  || || || ||   ||| |||||||| |
Sbjct: 197 aggtcatcgatgtgttcgccatgccgcaaacgggtactggagtatccgtagaggccgtgg 256

                                                                       
Query: 275 accacgtcttccagaccaacatgctcgacatgctcaagcagaccggaagacctgaaatgg 334
           | | |||||| ||| | || ||| | |||||||| |||||||| ||  |||| |||||||
Sbjct: 257 atcccgtctttcaggcgaagatgttggacatgctgaagcagacgggtcgacccgaaatgg 316

                                                                       
Query: 335 tggtaggctggtaccactcgcatcctggatttggttgctggctttcaggagttgacatca 394
           | || |||||||| ||||||||||| || || || |||||||| || || || |||||||
Sbjct: 317 tcgtcggctggtatcactcgcatcccggtttcggctgctggctgtccggcgtggacatca 376

                     
Query: 395 atactcagca 404
           |||| |||||
Sbjct: 377 atacgcagca 386



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 448 gatcccatccagagtgtcaaggggaaagtggtcattgatgcattccg 494
           |||||||| |||  ||||||||| ||||||||||| ||||| |||||
Sbjct: 430 gatcccattcagtctgtcaagggcaaagtggtcatcgatgccttccg 476



to top

>gb|AE003608.5| Drosophila melanogaster chromosome 2L, section 17 of 83 of the complete
              sequence
          Length = 174887

 Score =  178 bits (90), Expect = 1e-41
 Identities = 255/310 (82%)
 Strand = Plus / Minus

                                                                          
Query: 95     ccgagcaggtctacatctcctccctcgccctcctcaagatgctcaagcacgggagggccg 154
              |||||||||| |||||||| ||| | ||||| ||||||||||| ||||||||  ||||||
Sbjct: 118050 ccgagcaggtgtacatctcgtccttggccctgctcaagatgcttaagcacggacgggccg 117991

                                                                          
Query: 155    gcgtgcccatggaggtgatgggcctgatgctgggcgagttcgtcgacgactacacggtca 214
              |||||||||||||||||||||| |||||| ||||||| ||||| ||||||||||||||  
Sbjct: 117990 gcgtgcccatggaggtgatgggtctgatgttgggcgaattcgtggacgactacacggtgc 117931

                                                                          
Query: 215    gggtggtggatgtcttcgccatgccgcagagcgggaccggggtcagcgtcgaggccgtcg 274
               |||  | ||||| |||||||||||||| |  || || || ||   ||| |||||||| |
Sbjct: 117930 aggtcatcgatgtgttcgccatgccgcaaacgggtactggagtatccgtagaggccgtgg 117871

                                                                          
Query: 275    accacgtcttccagaccaacatgctcgacatgctcaagcagaccggaagacctgaaatgg 334
              | | |||||| ||| | || ||| | |||||||| |||||||| ||  |||| |||||||
Sbjct: 117870 atcccgtctttcaggcgaagatgttggacatgctgaagcagacgggtcgacccgaaatgg 117811

                                                                          
Query: 335    tggtaggctggtaccactcgcatcctggatttggttgctggctttcaggagttgacatca 394
              | || |||||||| ||||||||||| || || || |||||||| || || || |||||||
Sbjct: 117810 tcgtcggctggtatcactcgcatcccggtttcggctgctggctgtccggcgtggacatca 117751

                        
Query: 395    atactcagca 404
              |||| |||||
Sbjct: 117750 atacgcagca 117741



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                             
Query: 448    gatcccatccagagtgtcaaggggaaagtggtcattgatgcattccg 494
              |||||||| |||  ||||||||| ||||||||||| ||||| |||||
Sbjct: 117697 gatcccattcagtctgtcaagggcaaagtggtcatcgatgccttccg 117651



to top

>ref|XM_752595.1| Ustilago maydis 521 hypothetical protein (UM01541.1) partial mRNA
          Length = 864

 Score =  155 bits (78), Expect = 2e-34
 Identities = 222/270 (82%)
 Strand = Plus / Plus

                                                                       
Query: 102 ggtctacatctcctccctcgccctcctcaagatgctcaagcacgggagggccggcgtgcc 161
           |||||||||||| || ||||| ||| |||||||||||||||||||  | || || || ||
Sbjct: 66  ggtctacatctcatcgctcgcgctcatcaagatgctcaagcacggtcgagcaggtgtacc 125

                                                                       
Query: 162 catggaggtgatgggcctgatgctgggcgagttcgtcgacgactacacggtcagggtggt 221
            |||||||||||||| || ||||| |||  |||| ||||||||||||| |||  |||| |
Sbjct: 126 gatggaggtgatgggactcatgctcggctcgttcatcgacgactacactgtctcggtgat 185

                                                                       
Query: 222 ggatgtcttcgccatgccgcagagcgggaccggggtcagcgtcgaggccgtcgaccacgt 281
            || || ||||||||||| |||  ||| ||||| ||    || || ||||||||||  ||
Sbjct: 186 tgacgttttcgccatgcctcagtccggaaccggtgtgtcggtagaagccgtcgaccctgt 245

                                                                       
Query: 282 cttccagaccaacatgctcgacatgctcaagcagaccggaagacctgaaatggtggtagg 341
            ||||| || || ||||||||||||||||||||||||||| | || || |||||||| ||
Sbjct: 246 tttccaaacaaaaatgctcgacatgctcaagcagaccggacgtcccgagatggtggtggg 305

                                         
Query: 342 ctggtaccactcgcatcctggatttggttg 371
           ||||||||| |||||||| |||||||||||
Sbjct: 306 ctggtaccattcgcatcccggatttggttg 335



to top

>emb|AJ249917.1|SDO249917 Aphrocallistes vastus mRNA for putative multidrug resistance
           protein (pohl gene)
          Length = 1068

 Score =  149 bits (75), Expect = 1e-32
 Identities = 252/311 (81%)
 Strand = Plus / Plus

                                                                       
Query: 97  gagcaggtctacatctcctccctcgccctcctcaagatgctcaagcacgggagggccggc 156
           |||||||| ||||| ||||| ||||| || || || ||||| || ||||| ||||| || 
Sbjct: 125 gagcaggtgtacatatcctcactcgcactgctgaaaatgctgaaacacggtagggctggg 184

                                                                       
Query: 157 gtgcccatggaggtgatgggcctgatgctgggcgagttcgtcgacgactacacggtcagg 216
           ||||| |||||||| ||||| |||||| | || || ||||| ||||||||||| ||||  
Sbjct: 185 gtgccaatggaggtcatggggctgatgttaggagatttcgttgacgactacaccgtcaaa 244

                                                                       
Query: 217 gtggtggatgtcttcgccatgccgcagagcgggaccggggtcagcgtcgaggccgtcgac 276
           ||| | ||||||||||| ||||| ||    || || |||||||| ||||| || || |||
Sbjct: 245 gtgatcgatgtcttcgcgatgcctcaatcaggcacgggggtcagtgtcgaagcggtggac 304

                                                                       
Query: 277 cacgtcttccagaccaacatgctcgacatgctcaagcagaccggaagacctgaaatggtg 336
           | |||||||||  | || ||||| |||||||| |||||||| ||| | ||||||||||||
Sbjct: 305 cccgtcttccaagcgaagatgctagacatgctgaagcagacgggacggcctgaaatggtg 364

                                                                       
Query: 337 gtaggctggtaccactcgcatcctggatttggttgctggctttcaggagttgacatcaat 396
           || |||||||||||||| ||||||||||| || || ||||| || || || || ||||| 
Sbjct: 365 gtcggctggtaccactcacatcctggattcgggtgttggctctccggggtggatatcaac 424

                      
Query: 397 actcagcagag 407
           || ||||||||
Sbjct: 425 acccagcagag 435



to top

>emb|AJ245813.1|AVA245813 Aphrocallistes vastus mRNA for potential multidrug resistance
           protein (POHL gene)
          Length = 1068

 Score =  149 bits (75), Expect = 1e-32
 Identities = 252/311 (81%)
 Strand = Plus / Plus

                                                                       
Query: 97  gagcaggtctacatctcctccctcgccctcctcaagatgctcaagcacgggagggccggc 156
           |||||||| ||||| ||||| ||||| || || || ||||| || ||||| ||||| || 
Sbjct: 125 gagcaggtgtacatatcctcactcgcactgctgaaaatgctgaaacacggtagggctggg 184

                                                                       
Query: 157 gtgcccatggaggtgatgggcctgatgctgggcgagttcgtcgacgactacacggtcagg 216
           ||||| |||||||| ||||| |||||| | || || ||||| ||||||||||| ||||  
Sbjct: 185 gtgccaatggaggtcatggggctgatgttaggagatttcgttgacgactacaccgtcaaa 244

                                                                       
Query: 217 gtggtggatgtcttcgccatgccgcagagcgggaccggggtcagcgtcgaggccgtcgac 276
           ||| | ||||||||||| ||||| ||    || || |||||||| ||||| || || |||
Sbjct: 245 gtgatcgatgtcttcgcgatgcctcaatcaggcacgggggtcagtgtcgaagcggtggac 304

                                                                       
Query: 277 cacgtcttccagaccaacatgctcgacatgctcaagcagaccggaagacctgaaatggtg 336
           | |||||||||  | || ||||| |||||||| |||||||| ||| | ||||||||||||
Sbjct: 305 cccgtcttccaagcgaagatgctagacatgctgaagcagacgggacggcctgaaatggtg 364

                                                                       
Query: 337 gtaggctggtaccactcgcatcctggatttggttgctggctttcaggagttgacatcaat 396
           || |||||||||||||| ||||||||||| || || ||||| || || || || ||||| 
Sbjct: 365 gtcggctggtaccactcacatcctggattcgggtgttggctctccggggtggatatcaac 424

                      
Query: 397 actcagcagag 407
           || ||||||||
Sbjct: 425 acccagcagag 435



to top

>ref|XM_380957.1| Gibberella zeae PH-1 chromosome 1 conserved hypothetical protein
           (FG00781.1) partial mRNA
          Length = 1014

 Score =  139 bits (70), Expect = 1e-29
 Identities = 226/278 (81%)
 Strand = Plus / Plus

                                                                       
Query: 103 gtctacatctcctccctcgccctcctcaagatgctcaagcacgggagggccggcgtgccc 162
           ||||||||||||||||||||||||||||| |||||    |||||  | || || ||||||
Sbjct: 100 gtctacatctcctccctcgccctcctcaaaatgcttcgacacggccgcgcaggtgtgccc 159

                                                                       
Query: 163 atggaggtgatgggcctgatgctgggcgagttcgtcgacgactacacggtcagggtggtg 222
           ||||| || ||||| |||||||||||||||||||| |||||||  || |||| |||  ||
Sbjct: 160 atggaagtcatgggtctgatgctgggcgagttcgtggacgactttaccgtcaaggttatg 219

                                                                       
Query: 223 gatgtcttcgccatgccgcagagcgggaccggggtcagcgtcgaggccgtcgaccacgtc 282
           ||||| || |||||||| ||||| || ||||| || || |||||||||||||| |  || 
Sbjct: 220 gatgtgtttgccatgccccagagtggtaccggtgttagtgtcgaggccgtcgatcctgtt 279

                                                                       
Query: 283 ttccagaccaacatgctcgacatgctcaagcagaccggaagacctgaaatggtggtaggc 342
           |||||||| || ||| | || |||||    ||||| |||||||| ||   ||| || || 
Sbjct: 280 ttccagacgaagatgatggatatgcttcgacagacaggaagacccgagtcggttgtcgga 339

                                                 
Query: 343 tggtaccactcgcatcctggatttggttgctggctttc 380
           ||||||||||||||||| || || ||||||||||||||
Sbjct: 340 tggtaccactcgcatcccggtttcggttgctggctttc 377



to top

>ref|XM_959273.1| Neurospora crassa OR74A hypothetical protein (NCU00823.1) partial
           mRNA
          Length = 1263

 Score =  131 bits (66), Expect = 3e-27
 Identities = 225/278 (80%)
 Strand = Plus / Plus

                                                                       
Query: 103 gtctacatctcctccctcgccctcctcaagatgctcaagcacgggagggccggcgtgccc 162
           |||||||| |||||||| ||||||||||||||| |    |||||  | || || ||||||
Sbjct: 346 gtctacatttcctccctagccctcctcaagatgttgcgccacggtcgcgctggtgtgccc 405

                                                                       
Query: 163 atggaggtgatgggcctgatgctgggcgagttcgtcgacgactacacggtcagggtggtg 222
           ||||| || ||||||||||||||||||||||| ||||| ||||  || ||  | || || 
Sbjct: 406 atggaagtcatgggcctgatgctgggcgagtttgtcgatgactttaccgttcgcgtcgtc 465

                                                                       
Query: 223 gatgtcttcgccatgccgcagagcgggaccggggtcagcgtcgaggccgtcgaccacgtc 282
           ||||| || |||||||| || ||||| || || ||||| || ||||| ||||||| ||||
Sbjct: 466 gatgtgtttgccatgccccaaagcggtactggtgtcagtgtagaggctgtcgaccccgtc 525

                                                                       
Query: 283 ttccagaccaacatgctcgacatgctcaagcagaccggaagacctgaaatggtggtaggc 342
           |||||||  |||||| | |||||||||| ||| || ||||| || ||    || || |||
Sbjct: 526 ttccagatgaacatgatggacatgctcaggcaaacgggaaggcccgaggccgtcgttggc 585

                                                 
Query: 343 tggtaccactcgcatcctggatttggttgctggctttc 380
           ||||||||||||||||| || ||||| |||||||||||
Sbjct: 586 tggtaccactcgcatcccggttttggctgctggctttc 623



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 70/86 (81%)
 Strand = Plus / Plus

                                                                       
Query: 463 gtcaaggggaaagtggtcattgatgcattccgtctcattaaccctcagaccatgatgctt 522
           |||||||| || || || |||||||| ||||||||||| ||||| ||| |  | ||||| 
Sbjct: 706 gtcaagggcaaggttgtgattgatgctttccgtctcatcaacccccagtcgctcatgctg 765

                                     
Query: 523 ggccaggagccacggcagacaacatc 548
           || |||||||| || ||||| |||||
Sbjct: 766 ggtcaggagccccgccagacgacatc 791



to top

>ref|XM_325002.1| Neurospora crassa OR74A hypothetical protein (NCU00823.1) partial
           mRNA
          Length = 1263

 Score =  131 bits (66), Expect = 3e-27
 Identities = 225/278 (80%)
 Strand = Plus / Plus

                                                                       
Query: 103 gtctacatctcctccctcgccctcctcaagatgctcaagcacgggagggccggcgtgccc 162
           |||||||| |||||||| ||||||||||||||| |    |||||  | || || ||||||
Sbjct: 346 gtctacatttcctccctagccctcctcaagatgttgcgccacggtcgcgctggtgtgccc 405

                                                                       
Query: 163 atggaggtgatgggcctgatgctgggcgagttcgtcgacgactacacggtcagggtggtg 222
           ||||| || ||||||||||||||||||||||| ||||| ||||  || ||  | || || 
Sbjct: 406 atggaagtcatgggcctgatgctgggcgagtttgtcgatgactttaccgttcgcgtcgtc 465

                                                                       
Query: 223 gatgtcttcgccatgccgcagagcgggaccggggtcagcgtcgaggccgtcgaccacgtc 282
           ||||| || |||||||| || ||||| || || ||||| || ||||| ||||||| ||||
Sbjct: 466 gatgtgtttgccatgccccaaagcggtactggtgtcagtgtagaggctgtcgaccccgtc 525

                                                                       
Query: 283 ttccagaccaacatgctcgacatgctcaagcagaccggaagacctgaaatggtggtaggc 342
           |||||||  |||||| | |||||||||| ||| || ||||| || ||    || || |||
Sbjct: 526 ttccagatgaacatgatggacatgctcaggcaaacgggaaggcccgaggccgtcgttggc 585

                                                 
Query: 343 tggtaccactcgcatcctggatttggttgctggctttc 380
           ||||||||||||||||| || ||||| |||||||||||
Sbjct: 586 tggtaccactcgcatcccggttttggctgctggctttc 623



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 70/86 (81%)
 Strand = Plus / Plus

                                                                       
Query: 463 gtcaaggggaaagtggtcattgatgcattccgtctcattaaccctcagaccatgatgctt 522
           |||||||| || || || |||||||| ||||||||||| ||||| ||| |  | ||||| 
Sbjct: 706 gtcaagggcaaggttgtgattgatgctttccgtctcatcaacccccagtcgctcatgctg 765

                                     
Query: 523 ggccaggagccacggcagacaacatc 548
           || |||||||| || ||||| |||||
Sbjct: 766 ggtcaggagccccgccagacgacatc 791



to top

>ref|NM_062311.2| Caenorhabditis elegans proteasome Regulatory Particle,
           Non-ATPase-like family member (rpn-11) (rpn-11) mRNA,
           complete cds
          Length = 1108

 Score =  127 bits (64), Expect = 4e-26
 Identities = 223/276 (80%)
 Strand = Plus / Plus

                                                                       
Query: 130 aagatgctcaagcacgggagggccggcgtgcccatggaggtgatgggcctgatgctgggc 189
           ||||||||||| ||||| || ||||| || |||||||| |||||||| |||||||| || 
Sbjct: 137 aagatgctcaaacacggaagagccggagttcccatggaagtgatggggctgatgcttgga 196

                                                                       
Query: 190 gagttcgtcgacgactacacggtcagggtggtggatgtcttcgccatgccgcagagcggg 249
           || ||||||||||||||||| ||||  ||| | || || ||||| ||||| |||   || 
Sbjct: 197 gaattcgtcgacgactacaccgtcaatgtgatcgacgttttcgctatgccacagtctgga 256

                                                                       
Query: 250 accggggtcagcgtcgaggccgtcgaccacgtcttccagaccaacatgctcgacatgctc 309
           ||||| |||   ||||| || ||||| |  || |||||| | || |||||||||||||||
Sbjct: 257 accggagtctcagtcgaagcggtcgatccagtattccaggcgaagatgctcgacatgctc 316

                                                                       
Query: 310 aagcagaccggaagacctgaaatggtggtaggctggtaccactcgcatcctggatttggt 369
           || |||||||||||||| || ||||| || || |||||||| || ||||| ||||| || 
Sbjct: 317 aaacagaccggaagacccgagatggtcgtcggatggtaccattcccatccaggattcgga 376

                                               
Query: 370 tgctggctttcaggagttgacatcaatactcagcag 405
           || ||||| || || || |||||||| |||||||||
Sbjct: 377 tgttggctctccggcgtcgacatcaacactcagcag 412



to top

>gb|BT018364.1| Zea mays clone EL01N0311E01.c mRNA sequence
          Length = 603

 Score =  117 bits (59), Expect = 4e-23
 Identities = 77/83 (92%)
 Strand = Plus / Plus

                                                                       
Query: 484 gatgcattccgtctcattaaccctcagaccatgatgcttggccaggagccacggcagaca 543
           ||||||||||| || ||||| |||||||||||||||||||| ||||||||||||||||| 
Sbjct: 8   gatgcattccgcctaattaatcctcagaccatgatgcttggtcaggagccacggcagacg 67

                                  
Query: 544 acatcgaatgttgggcacctaaa 566
           ||||| |||||||||||||||||
Sbjct: 68  acatcaaatgttgggcacctaaa 90



to top

>ref|XM_961333.1| PREDICTED: Tribolium castaneum similar to CG18174-PA, transcript
           variant 1 (LOC657072), mRNA
          Length = 936

 Score =  101 bits (51), Expect = 2e-18
 Identities = 123/147 (83%)
 Strand = Plus / Plus

                                                                       
Query: 160 cccatggaggtgatgggcctgatgctgggcgagttcgtcgacgactacacggtcagggtg 219
           |||||||| || |||||||||||| |||| || ||||| || |||||||| || ||||||
Sbjct: 151 cccatggaagtcatgggcctgatgttgggtgaattcgttgatgactacaccgtgagggtg 210

                                                                       
Query: 220 gtggatgtcttcgccatgccgcagagcgggaccggggtcagcgtcgaggccgtcgaccac 279
            | || || ||||| ||||| |||| |||||| |||||||| || |||||||| |||| |
Sbjct: 211 atcgacgtgttcgcgatgccccagaccgggactggggtcagtgtggaggccgtggacccc 270

                                      
Query: 280 gtcttccagaccaacatgctcgacatg 306
           ||||||||| |||| ||||| ||||||
Sbjct: 271 gtcttccaggccaaaatgctggacatg 297



to top

>emb|AJ249916.1|GCY249916 Geodia cydonium mRNA for putative multidrug resistance protein
           (pohl gene)
          Length = 1011

 Score =  101 bits (51), Expect = 2e-18
 Identities = 246/311 (79%)
 Strand = Plus / Plus

                                                                       
Query: 103 gtctacatctcctccctcgccctcctcaagatgctcaagcacgggagggccggcgtgccc 162
           |||||||| || ||||||||||| ||||||||| | ||||| ||  | || ||||| |||
Sbjct: 110 gtctacatatcttccctcgcccttctcaagatgttgaagcatggccgtgcgggcgtcccc 169

                                                                       
Query: 163 atggaggtgatgggcctgatgctgggcgagttcgtcgacgactacacggtcagggtggtg 222
           ||||| |||||||| || ||| |||| ||||| || || ||||| || || |  ||| | 
Sbjct: 170 atggaagtgatggggctcatgttgggggagtttgtggatgactataccgtgactgtgatt 229

                                                                       
Query: 223 gatgtcttcgccatgccgcagagcgggaccggggtcagcgtcgaggccgtcgaccacgtc 282
           |||||||| |||||||| |||||||| || || || || || ||||| || || |  || 
Sbjct: 230 gatgtctttgccatgccacagagcggaactggtgtgagtgtggaggcagttgatccggta 289

                                                                       
Query: 283 ttccagaccaacatgctcgacatgctcaagcagaccggaagacctgaaatggtggtaggc 342
           || ||| |||| ||| | |||||| | |||||||| ||  | || || ||||| || || 
Sbjct: 290 tttcaggccaaaatgttggacatgttgaagcagacggggcgtcccgagatggtagttggg 349

                                                                       
Query: 343 tggtaccactcgcatcctggatttggttgctggctttcaggagttgacatcaatactcag 402
           ||||||||||| || ||||||||||| |||||||| || ||||||||||| || ||||| 
Sbjct: 350 tggtaccactcccaccctggatttggatgctggctgtccggagttgacataaacactcaa 409

                      
Query: 403 cagagttttga 413
           ||||| |||||
Sbjct: 410 cagagctttga 420



to top

>gb|AE016820.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome VII,
              complete sequence
          Length = 1476513

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 97/114 (85%)
 Strand = Plus / Plus

                                                                          
Query: 130    aagatgctcaagcacgggagggccggcgtgcccatggaggtgatgggcctgatgctgggc 189
              |||||||| || ||| | ||||| ||||||||||||||||||||||| ||||||||||| 
Sbjct: 730339 aagatgctgaaacacagcagggcgggcgtgcccatggaggtgatggggctgatgctgggg 730398

                                                                    
Query: 190    gagttcgtcgacgactacacggtcagggtggtggatgtcttcgccatgccgcag 243
              || || || || || ||||||||||  |||||||| || || ||||||||||||
Sbjct: 730399 gactttgtggatgagtacacggtcaatgtggtggacgtgtttgccatgccgcag 730452



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                             
Query: 331    atggtggtaggctggtaccactcgcatcctggatttggttgctggct 377
              ||||| || ||||||||||||||||| || || ||||| ||||||||
Sbjct: 730540 atggtagttggctggtaccactcgcacccgggttttgggtgctggct 730586



to top

>ref|NM_211733.1| Eremothecium gossypii AGR006Wp (AGR006W), mRNA
          Length = 936

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 97/114 (85%)
 Strand = Plus / Plus

                                                                       
Query: 130 aagatgctcaagcacgggagggccggcgtgcccatggaggtgatgggcctgatgctgggc 189
           |||||||| || ||| | ||||| ||||||||||||||||||||||| ||||||||||| 
Sbjct: 121 aagatgctgaaacacagcagggcgggcgtgcccatggaggtgatggggctgatgctgggg 180

                                                                 
Query: 190 gagttcgtcgacgactacacggtcagggtggtggatgtcttcgccatgccgcag 243
           || || || || || ||||||||||  |||||||| || || ||||||||||||
Sbjct: 181 gactttgtggatgagtacacggtcaatgtggtggacgtgtttgccatgccgcag 234



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 331 atggtggtaggctggtaccactcgcatcctggatttggttgctggct 377
           ||||| || ||||||||||||||||| || || ||||| ||||||||
Sbjct: 322 atggtagttggctggtaccactcgcacccgggttttgggtgctggct 368



to top

>ref|XM_744382.1| Aspergillus fumigatus Af293 proteasome regulatory particle subunit
           RpnK (Afu2g03400) partial mRNA
          Length = 1008

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 179/224 (79%)
 Strand = Plus / Plus

                                                                       
Query: 157 gtgcccatggaggtgatgggcctgatgctgggcgagttcgtcgacgactacacggtcagg 216
           ||||| ||||| || ||||||||||||||||| || |||||||| || ||||| ||  | 
Sbjct: 157 gtgcctatggaagtcatgggcctgatgctgggagaattcgtcgatgaatacacagttcgt 216

                                                                       
Query: 217 gtggtggatgtcttcgccatgccgcagagcgggaccggggtcagcgtcgaggccgtcgac 276
           ||||| ||||| || |||||||| |||||||| || || ||||| || |||||||| |||
Sbjct: 217 gtggttgatgtttttgccatgccccagagcggtactggtgtcagtgttgaggccgtggac 276

                                                                       
Query: 277 cacgtcttccagaccaacatgctcgacatgctcaagcagaccggaagacctgaaatggtg 336
           | ||| || |||||||| ||| | || |||||   ||| || ||| | || ||||  || 
Sbjct: 277 cccgtttttcagaccaagatgatggagatgcttcggcaaactggacggccggaaacagtc 336

                                                       
Query: 337 gtaggctggtaccactcgcatcctggatttggttgctggctttc 380
           || || ||||| ||||| |||||||| ||||| |||||||||||
Sbjct: 337 gttggatggtatcactcccatcctggttttggctgctggctttc 380



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                               
Query: 523 ggccaggagccacggcagacaacatcgaatgttgggcacctaaacaaaccat 574
           ||||||||||| |||||||| ||||| ||| | || ||||| ||||| ||||
Sbjct: 523 ggccaggagccccggcagacgacatctaatttgggtcacctgaacaagccat 574



to top

>gb|AF195189.1|AF195189 Drosophila melanogaster yippee interacting protein 5 (yip5) mRNA,
           partial cds
          Length = 824

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 116/140 (82%)
 Strand = Plus / Plus

                                                                       
Query: 265 gaggccgtcgaccacgtcttccagaccaacatgctcgacatgctcaagcagaccggaaga 324
           |||||||| || | |||||||||| |||| ||| | |||||||| |||||||| ||  ||
Sbjct: 11  gaggccgtggatcccgtcttccaggccaagatgttggacatgctgaagcagacgggtcga 70

                                                                       
Query: 325 cctgaaatggtggtaggctggtaccactcgcatcctggatttggttgctggctttcagga 384
           || |||||||| || |||||||| ||||||||||| || || || |||||||| || || 
Sbjct: 71  cccgaaatggtcgtcggctggtatcactcgcatcccggtttcggctgctggctgtccggc 130

                               
Query: 385 gttgacatcaatactcagca 404
           || ||||||||||| |||||
Sbjct: 131 gtggacatcaatacgcagca 150



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 462 tgtcaaggggaaagtggtcattgatgcattccg 494
           ||||||||| ||||||||||| ||||| |||||
Sbjct: 208 tgtcaagggcaaagtggtcatcgatgccttccg 240



to top

>dbj|AP006080.1| Lotus japonicus genomic DNA, chromosome 6, clone:LjT48M22, TM0118c,
             complete sequence
          Length = 91116

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 74/84 (88%)
 Strand = Plus / Minus

                                                                         
Query: 322   agacctgaaatggtggtaggctggtaccactcgcatcctggatttggttgctggctttca 381
             |||||||| |||||||| ||||||||||| || |||||||||||||| || ||||| || 
Sbjct: 70551 agacctgagatggtggttggctggtaccattcacatcctggatttggatgttggctgtct 70492

                                     
Query: 382   ggagttgacatcaatactcagcag 405
             || |||||||||||||| ||||||
Sbjct: 70491 ggtgttgacatcaatacacagcag 70468



 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                         
Query: 85    ctcgactcctccgagcaggtctacatctcctccctcgccctcctcaagatgctcaagcac 144
             ||||| ||||||||||||||||||||||| || ||||| || ||||||||||||||||||
Sbjct: 71037 ctcgattcctccgagcaggtctacatctcttcgctcgcacttctcaagatgctcaagcac 70978

               
Query: 145   gg 146
             ||
Sbjct: 70977 gg 70976



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 105/129 (81%)
 Strand = Plus / Minus

                                                                         
Query: 446   tagatcccatccagagtgtcaaggggaaagtggtcattgatgcattccgtctcattaacc 505
             ||||||| || |||||||| || || |||||||| |||||||| || ||  | || || |
Sbjct: 68054 tagatccaatacagagtgttaaaggaaaagtggtgattgatgcttttcgattgatcaatc 67995

                                                                         
Query: 506   ctcagaccatgatgcttggccaggagccacggcagacaacatcgaatgttgggcacctaa 565
             | ||||| ||||||||||| || || ||| ||||||||||||| ||| | ||||| || |
Sbjct: 67994 cccagacaatgatgcttggtcaagaaccaaggcagacaacatccaatttggggcatctta 67935

                      
Query: 566   acaaaccat 574
             |||||||||
Sbjct: 67934 acaaaccat 67926



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 128/161 (79%)
 Strand = Plus / Minus

                                                                         
Query: 163   atggaggtgatgggcctgatgctgggcgagttcgtcgacgactacacggtcagggtggtg 222
             |||||||||||||| |||||| |||| |||||||| || || ||||| ||  | || || 
Sbjct: 70857 atggaggtgatgggtctgatgttgggggagttcgtggatgagtacactgttcgtgttgtt 70798

                                                                         
Query: 223   gatgtcttcgccatgccgcagagcgggaccggggtcagcgtcgaggccgtcgaccacgtc 282
             |||||||| || ||||||||||| || || || || || || || || || || || || 
Sbjct: 70797 gatgtctttgcaatgccgcagagtggaactggtgttagtgttgaagctgttgatcatgtt 70738

                                                      
Query: 283   ttccagaccaacatgctcgacatgctcaagcagaccggaag 323
             |||||||| || ||||| |||||||| ||||| || |||||
Sbjct: 70737 ttccagactaatatgcttgacatgcttaagcaaactggaag 70697



to top

>gb|AF077534.2| Caenorhabditis elegans cosmid K07D4, complete sequence
          Length = 44334

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 94/111 (84%)
 Strand = Plus / Minus

                                                                         
Query: 295   atgctcgacatgctcaagcagaccggaagacctgaaatggtggtaggctggtaccactcg 354
             ||||||||||||||||| |||||||||||||| || ||||| || || |||||||| || 
Sbjct: 38980 atgctcgacatgctcaaacagaccggaagacccgagatggtcgtcggatggtaccattcc 38921

                                                                
Query: 355   catcctggatttggttgctggctttcaggagttgacatcaatactcagcag 405
             ||||| ||||| || || ||||| || || || |||||||| |||||||||
Sbjct: 38920 catccaggattcggatgttggctctccggcgtcgacatcaacactcagcag 38870



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 74/85 (87%)
 Strand = Plus / Minus

                                                                         
Query: 130   aagatgctcaagcacgggagggccggcgtgcccatggaggtgatgggcctgatgctgggc 189
             ||||||||||| ||||| || ||||| || |||||||| |||||||| |||||||| || 
Sbjct: 39203 aagatgctcaaacacggaagagccggagttcccatggaagtgatggggctgatgcttgga 39144

                                      
Query: 190   gagttcgtcgacgactacacggtca 214
             || ||||||||||||||||| ||||
Sbjct: 39143 gaattcgtcgacgactacaccgtca 39119



to top

>emb|CT032525.1| Platynereis dumerilii EST IB0AAA36DF08EM1
          Length = 889

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 301 gacatgctcaagcagaccggaagacctgaaatggtggtaggctggtaccactcgcatcct 360
           ||||||||||| ||||| ||||| || || |||||||| ||||||||||| || ||||||
Sbjct: 360 gacatgctcaaacagactggaaggccggagatggtggtgggctggtaccattcccatcct 419

                                                                   
Query: 361 ggatttggttgctggctttcaggagttgacatcaatactcagcagagttttgaagc 416
           || || || |||||| | ||||| || || ||||| || || ||||||||||||||
Sbjct: 420 gggttcggctgctggttgtcaggcgtagatatcaacacccaacagagttttgaagc 475



 Score = 48.1 bits (24), Expect = 0.032
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 451 cccatccagagtgtcaaggggaaagtggtcattgatgcattccg 494
           ||||||||||||||||| || || || || ||||||||||||||
Sbjct: 510 cccatccagagtgtcaaaggaaaggttgtgattgatgcattccg 553



to top

>emb|CT032524.1| Platynereis dumerilii EST IB0AAA36DF08FM1
          Length = 883

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 97/116 (83%)
 Strand = Plus / Minus

                                                                       
Query: 301 gacatgctcaagcagaccggaagacctgaaatggtggtaggctggtaccactcgcatcct 360
           ||||||||||| ||||| ||||| || || |||||||| ||||||||||| || ||||||
Sbjct: 776 gacatgctcaaacagactggaaggccggagatggtggtgggctggtaccattcccatcct 717

                                                                   
Query: 361 ggatttggttgctggctttcaggagttgacatcaatactcagcagagttttgaagc 416
           || || || |||||| | ||||| || || ||||| || || ||||||||||||||
Sbjct: 716 gggttcggctgctggttgtcaggcgtagatatcaacacccaacagagttttgaagc 661



 Score = 48.1 bits (24), Expect = 0.032
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 451 cccatccagagtgtcaaggggaaagtggtcattgatgcattccg 494
           ||||||||||||||||| || || || || ||||||||||||||
Sbjct: 626 cccatccagagtgtcaaaggaaaggttgtgattgatgcattccg 583



to top

>dbj|AP006364.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT28B04, TM0170,
             complete sequence
          Length = 101172

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 52/56 (92%)
 Strand = Plus / Minus

                                                                     
Query: 85    ctcgactcctccgagcaggtctacatctcctccctcgccctcctcaagatgctcaa 140
             ||||| |||||||||||||| |||||||||||||||||||| ||||| ||||||||
Sbjct: 37554 ctcgattcctccgagcaggtttacatctcctccctcgcccttctcaaaatgctcaa 37499



to top

>ref|XM_369606.1| Magnaporthe grisea 70-15 chromosome III hypothetical protein
           (MG05858.4) partial mRNA
          Length = 1008

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 132/163 (80%)
 Strand = Plus / Plus

                                                                       
Query: 115 tccctcgccctcctcaagatgctcaagcacgggagggccggcgtgcccatggaggtgatg 174
           ||||| |||||||| ||||||||   ||||||  | ||||| ||||||||||| || |||
Sbjct: 97  tcccttgccctcctaaagatgctgcggcacggccgcgccggtgtgcccatggaagtcatg 156

                                                                       
Query: 175 ggcctgatgctgggcgagttcgtcgacgactacacggtcagggtggtggatgtcttcgcc 234
           || || |||||||||||||| ||||| |||| ||| ||  | || || ||||| || |||
Sbjct: 157 ggacttatgctgggcgagtttgtcgatgacttcacagtacgcgtcgttgatgtttttgcc 216

                                                      
Query: 235 atgccgcagagcgggaccggggtcagcgtcgaggccgtcgacc 277
           ||||| || ||||| || || ||||| |||||||| |||||||
Sbjct: 217 atgccacaaagcggtactggagtcagtgtcgaggcagtcgacc 259



to top

>gb|DQ440392.1| Aedes aegypti clone AET-5254 26S proteasome regulatory complex
           subunit  RPN11 mRNA, complete cds
          Length = 936

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 68/78 (87%)
 Strand = Plus / Plus

                                                                       
Query: 328 gaaatggtggtaggctggtaccactcgcatcctggatttggttgctggctttcaggagtt 387
           ||||||||||| || ||||| ||||||||||| || |||||||||||||| ||||| || 
Sbjct: 319 gaaatggtggtcggatggtatcactcgcatccgggctttggttgctggctctcaggtgtg 378

                             
Query: 388 gacatcaatactcagcag 405
           || ||||| |||||||||
Sbjct: 379 gatatcaacactcagcag 396



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 96/118 (81%)
 Strand = Plus / Plus

                                                                       
Query: 95  ccgagcaggtctacatctcctccctcgccctcctcaagatgctcaagcacgggagggccg 154
           |||||||||||||||| ||||| || || || || |||||||| || |||||  | || |
Sbjct: 86  ccgagcaggtctacatttcctcgctggcactgctgaagatgcttaaacacggtcgcgctg 145

                                                                     
Query: 155 gcgtgcccatggaggtgatgggcctgatgctgggcgagttcgtcgacgactacacggt 212
           | || ||||||||||| ||||| |||||| |||| || || || || |||||||||||
Sbjct: 146 gagttcccatggaggttatgggactgatgttgggggaatttgtggatgactacacggt 203



to top

>gb|BC045094.1| Xenopus laevis 26S proteasome-associated pad1 homolog, mRNA (cDNA
           clone MGC:53911 IMAGE:5569802), complete cds
          Length = 1227

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 251/322 (77%)
 Strand = Plus / Plus

                                                                       
Query: 95  ccgagcaggtctacatctcctccctcgccctcctcaagatgctcaagcacgggagggccg 154
           |||| ||||| || ||||||||||| ||  | || |||||||| || |||||| | || |
Sbjct: 126 ccgaacaggtttatatctcctccctggctttgcttaagatgctaaaacacgggcgagctg 185

                                                                       
Query: 155 gcgtgcccatggaggtgatgggcctgatgctgggcgagttcgtcgacgactacacggtca 214
           | || || ||||| || ||||| ||||||||||| ||||| || || || ||||| ||||
Sbjct: 186 gtgtcccaatggaagtcatgggactgatgctgggagagtttgtggatgattacacagtca 245

                                                                       
Query: 215 gggtggtggatgtcttcgccatgccgcagagcgggaccggggtcagcgtcgaggccgtcg 274
           ||||  | ||||| || || |||||||||   || || || || || || ||||| || |
Sbjct: 246 gggtcattgatgtttttgctatgccgcagtctggaactggtgttagtgtggaggctgtgg 305

                                                                       
Query: 275 accacgtcttccagaccaacatgctcgacatgctcaagcagaccggaagacctgaaatgg 334
           | | ||| |||||| | || ||| | || ||| | || ||||| ||||| ||||||||||
Sbjct: 306 atcccgttttccaggctaaaatgttggatatgttaaaacagactggaaggcctgaaatgg 365

                                                                       
Query: 335 tggtaggctggtaccactcgcatcctggatttggttgctggctttcaggagttgacatca 394
           | || || ||||| |||   || ||||| ||||| ||||||||||| || |||||||| |
Sbjct: 366 tagtcggttggtatcacagccaccctggctttggctgctggctttctggcgttgacatta 425

                                 
Query: 395 atactcagcagagttttgaagc 416
           |||| |||||||| ||||||||
Sbjct: 426 atacccagcagagctttgaagc 447



to top

>gb|AY022700.1| Oryza sativa microsatellite MRG5025 containing (CCG)X8, genomic
           sequence
          Length = 224

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 52/57 (91%)
 Strand = Plus / Minus

                                                                    
Query: 50  ccgggatggggcagccggggaccgactcgccgctgctcgactcctccgagcaggtct 106
           |||| ||||||||||||  | | ||||||||||||||||||||||||||||||||||
Sbjct: 57  ccggcatggggcagccgccgtcggactcgccgctgctcgactcctccgagcaggtct 1



to top

>emb|BX031535.1|CNS08WHV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA47AA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1005

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 85/101 (84%)
 Strand = Plus / Minus

                                                                       
Query: 106 tacatctcctccctcgccctcctcaagatgctcaagcacgggagggccggcgtgcccatg 165
           ||||||||||| ||||| ||| | |||||||| || |||||  | ||||| ||||| |||
Sbjct: 987 tacatctcctcgctcgctctcttgaagatgctgaaacacggccgtgccggagtgccgatg 928

                                                    
Query: 166 gaggtgatgggcctgatgctgggcgagttcgtcgacgacta 206
           || ||||||||||||||| |||| || ||||| ||||||||
Sbjct: 927 gaagtgatgggcctgatgttgggtgaattcgtggacgacta 887



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                       
Query: 301 gacatgctcaagcagaccggaagacctgaaatggtggtaggctggtaccactcgcatcct 360
           |||||||||||||| |||||  | || || |||||||| || ||||||||||| ||||| 
Sbjct: 792 gacatgctcaagcaaaccggtcggccggagatggtggtcggatggtaccactcccatccg 733

                            
Query: 361 ggatttggttgctggct 377
           || ||||| ||||||||
Sbjct: 732 ggctttggatgctggct 716



to top

>emb|BX031534.1|CNS08WHU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA47AA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1061

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 85/101 (84%)
 Strand = Plus / Plus

                                                                       
Query: 106 tacatctcctccctcgccctcctcaagatgctcaagcacgggagggccggcgtgcccatg 165
           ||||||||||| ||||| ||| | |||||||| || |||||  | ||||| ||||| |||
Sbjct: 315 tacatctcctcgctcgctctcttgaagatgctgaaacacggccgtgccggagtgccgatg 374

                                                    
Query: 166 gaggtgatgggcctgatgctgggcgagttcgtcgacgacta 206
           || ||||||||||||||| |||| || ||||| ||||||||
Sbjct: 375 gaagtgatgggcctgatgttgggtgaattcgtggacgacta 415



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                       
Query: 301 gacatgctcaagcagaccggaagacctgaaatggtggtaggctggtaccactcgcatcct 360
           |||||||||||||| |||||  | || || |||||||| || ||||||||||| ||||| 
Sbjct: 510 gacatgctcaagcaaaccggtcggccggagatggtggtcggatggtaccactcccatccg 569

                            
Query: 361 ggatttggttgctggct 377
           || ||||| ||||||||
Sbjct: 570 ggctttggatgctggct 586



to top

>emb|BX008172.1|CNS08EGW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA13CB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 965

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 85/101 (84%)
 Strand = Plus / Plus

                                                                       
Query: 106 tacatctcctccctcgccctcctcaagatgctcaagcacgggagggccggcgtgcccatg 165
           ||||||||||| ||||| ||| | |||||||| || |||||  | ||||| ||||| |||
Sbjct: 294 tacatctcctcgctcgctctcttgaagatgctgaaacacggccgtgccggagtgccgatg 353

                                                    
Query: 166 gaggtgatgggcctgatgctgggcgagttcgtcgacgacta 206
           || ||||||||||||||| |||| || ||||| ||||||||
Sbjct: 354 gaagtgatgggcctgatgttgggtgaattcgtggacgacta 394



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                       
Query: 301 gacatgctcaagcagaccggaagacctgaaatggtggtaggctggtaccactcgcatcct 360
           |||||||||||||| |||||  | || || |||||||| || ||||||||||| ||||| 
Sbjct: 489 gacatgctcaagcaaaccggtcggccggagatggtggtcggatggtaccactcccatccg 548

                            
Query: 361 ggatttggttgctggct 377
           || ||||| ||||||||
Sbjct: 549 ggctttggatgctggct 565



to top

>ref|XM_314713.2| Anopheles gambiae str. PEST ENSANGP00000013055
           (ENSANGG00000010566), mRNA
          Length = 1404

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 85/101 (84%)
 Strand = Plus / Plus

                                                                       
Query: 106 tacatctcctccctcgccctcctcaagatgctcaagcacgggagggccggcgtgcccatg 165
           ||||||||||| ||||| ||| | |||||||| || |||||  | ||||| ||||| |||
Sbjct: 311 tacatctcctcgctcgctctcttgaagatgctgaaacacggccgtgccggagtgccgatg 370

                                                    
Query: 166 gaggtgatgggcctgatgctgggcgagttcgtcgacgacta 206
           || ||||||||||||||| |||| || ||||| ||||||||
Sbjct: 371 gaagtgatgggcctgatgttgggtgaattcgtggacgacta 411



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                       
Query: 301 gacatgctcaagcagaccggaagacctgaaatggtggtaggctggtaccactcgcatcct 360
           |||||||||||||| |||||  | || || |||||||| || ||||||||||| ||||| 
Sbjct: 506 gacatgctcaagcaaaccggtcggccggagatggtggtcggatggtaccactcccatccg 565

                            
Query: 361 ggatttggttgctggct 377
           || ||||| ||||||||
Sbjct: 566 ggctttggatgctggct 582



to top

>dbj|AB025633.2| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MQM1
          Length = 81365

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Plus

                                                                         
Query: 322   agacctgaaatggtggtaggctggtaccactcgcatcctggatttggttgctggctttca 381
             |||||||| |||||||| || ||||| || || ||||||||||| || ||||||||||| 
Sbjct: 17410 agacctgagatggtggttggttggtatcattcacatcctggattcggctgctggctttct 17469

                                 
Query: 382   ggagttgacatcaatactca 401
             || |||||||| ||||||||
Sbjct: 17470 ggggttgacattaatactca 17489



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 105/129 (81%)
 Strand = Plus / Plus

                                                                         
Query: 446   tagatcccatccagagtgtcaaggggaaagtggtcattgatgcattccgtctcattaacc 505
             ||||||| || |||||||| || || || ||||| |||||||| |||||   ||| || |
Sbjct: 17715 tagatccgattcagagtgtgaaaggaaaggtggtgattgatgcgttccgctccataaatc 17774

                                                                         
Query: 506   ctcagaccatgatgcttggccaggagccacggcagacaacatcgaatgttgggcacctaa 565
             | |||||||| |||||||| ||||| || || || |||||||||||  |||||||| | |
Sbjct: 17775 cacagaccattatgcttgggcaggaaccccgtcaaacaacatcgaaccttgggcacttga 17834

                      
Query: 566   acaaaccat 574
             |||||||||
Sbjct: 17835 acaaaccat 17843



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                               
Query: 97    gagcaggtctacatctcctccctcgccctcctcaagatgctcaagcacgg 146
             |||||||| |||||||| || ||||| |||||||||||||| ||||||||
Sbjct: 16904 gagcaggtttacatctcttctctcgctctcctcaagatgcttaagcacgg 16953



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                      
Query: 283   ttccagaccaacatgctcgacatgctcaagcagaccggaag 323
             |||||||| || |||||||||||||| || |||||||||||
Sbjct: 17280 ttccagactaatatgctcgacatgcttaaacagaccggaag 17320



to top

>emb|CT025430.2| Xenopus tropicalis finished cDNA, clone TGas117j07
          Length = 1734

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 199/254 (78%)
 Strand = Plus / Plus

                                                                       
Query: 163 atggaggtgatgggcctgatgctgggcgagttcgtcgacgactacacggtcagggtggtg 222
           ||||| || ||||| ||||||||||| ||||| || || || ||||| ||||||||  | 
Sbjct: 216 atggaagtcatgggactgatgctgggagagtttgtggatgattacacagtcagggttatt 275

                                                                       
Query: 223 gatgtcttcgccatgccgcagagcgggaccggggtcagcgtcgaggccgtcgaccacgtc 282
           |||||||| || ||||| |||  ||| || || || || || ||||| || || | ||| 
Sbjct: 276 gatgtctttgctatgccacagtccggaactggtgttagtgtggaggctgtggatcccgtt 335

                                                                       
Query: 283 ttccagaccaacatgctcgacatgctcaagcagaccggaagacctgaaatggtggtaggc 342
           |||||| | || ||| | || ||| | || ||||| ||||| |||||||||||||| || 
Sbjct: 336 ttccaggctaaaatgttggatatgttaaaacagactggaaggcctgaaatggtggtcggt 395

                                                                       
Query: 343 tggtaccactcgcatcctggatttggttgctggctttcaggagttgacatcaatactcag 402
           ||||| |||   || ||||| ||||| |||||||| || || |||||||| ||||| |||
Sbjct: 396 tggtatcacagccaccctggctttggctgctggctctccggcgttgacattaatacccag 455

                         
Query: 403 cagagttttgaagc 416
           ||||| || |||||
Sbjct: 456 cagagcttcgaagc 469



to top

>ref|XM_566594.1| Cryptococcus neoformans var. neoformans JEC21 multidrug resistance
           protein (CNA02100) partial mRNA
          Length = 933

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 73/86 (84%)
 Strand = Plus / Plus

                                                                       
Query: 262 gtcgaggccgtcgaccacgtcttccagaccaacatgctcgacatgctcaagcagaccgga 321
           |||||| |||| ||||| |||||||| ||||| ||||| |||||||| || |||||||| 
Sbjct: 256 gtcgagtccgtggaccatgtcttccaaaccaaaatgctggacatgctgaaacagaccggg 315

                                     
Query: 322 agacctgaaatggtggtaggctggta 347
            | ||||||||||| || ||||||||
Sbjct: 316 cggcctgaaatggttgtcggctggta 341



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 52/62 (83%)
 Strand = Plus / Plus

                                                                       
Query: 130 aagatgctcaagcacgggagggccggcgtgcccatggaggtgatgggcctgatgctgggc 189
           ||||||||||| || ||  |||| ||||| || |||||||| ||||| |||||||| |||
Sbjct: 124 aagatgctcaaacatggtcgggcgggcgttccaatggaggttatgggtctgatgctaggc 183

             
Query: 190 ga 191
           ||
Sbjct: 184 ga 185



to top

>gb|BC091596.1| Xenopus tropicalis MGC97603 protein, mRNA (cDNA clone MGC:97603
           IMAGE:6978091), complete cds
          Length = 1717

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 199/254 (78%)
 Strand = Plus / Plus

                                                                       
Query: 163 atggaggtgatgggcctgatgctgggcgagttcgtcgacgactacacggtcagggtggtg 222
           ||||| || ||||| ||||||||||| ||||| || || || ||||| ||||||||  | 
Sbjct: 184 atggaagtcatgggactgatgctgggagagtttgtggatgattacacagtcagggttatt 243

                                                                       
Query: 223 gatgtcttcgccatgccgcagagcgggaccggggtcagcgtcgaggccgtcgaccacgtc 282
           |||||||| || ||||| |||  ||| || || || || || ||||| || || | ||| 
Sbjct: 244 gatgtctttgctatgccacagtccggaactggtgttagtgtggaggctgtggatcccgtt 303

                                                                       
Query: 283 ttccagaccaacatgctcgacatgctcaagcagaccggaagacctgaaatggtggtaggc 342
           |||||| | || ||| | || ||| | || ||||| ||||| |||||||||||||| || 
Sbjct: 304 ttccaggctaaaatgttggatatgttaaaacagactggaaggcctgaaatggtggtcggt 363

                                                                       
Query: 343 tggtaccactcgcatcctggatttggttgctggctttcaggagttgacatcaatactcag 402
           ||||| |||   || ||||| ||||| |||||||| || || |||||||| ||||| |||
Sbjct: 364 tggtatcacagccaccctggctttggctgctggctctccggcgttgacattaatacccag 423

                         
Query: 403 cagagttttgaagc 416
           ||||| || |||||
Sbjct: 424 cagagcttcgaagc 437



to top

>ref|NM_001030465.1| Xenopus tropicalis MGC97603 protein (MGC97603), mRNA
          Length = 1717

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 199/254 (78%)
 Strand = Plus / Plus

                                                                       
Query: 163 atggaggtgatgggcctgatgctgggcgagttcgtcgacgactacacggtcagggtggtg 222
           ||||| || ||||| ||||||||||| ||||| || || || ||||| ||||||||  | 
Sbjct: 184 atggaagtcatgggactgatgctgggagagtttgtggatgattacacagtcagggttatt 243

                                                                       
Query: 223 gatgtcttcgccatgccgcagagcgggaccggggtcagcgtcgaggccgtcgaccacgtc 282
           |||||||| || ||||| |||  ||| || || || || || ||||| || || | ||| 
Sbjct: 244 gatgtctttgctatgccacagtccggaactggtgttagtgtggaggctgtggatcccgtt 303

                                                                       
Query: 283 ttccagaccaacatgctcgacatgctcaagcagaccggaagacctgaaatggtggtaggc 342
           |||||| | || ||| | || ||| | || ||||| ||||| |||||||||||||| || 
Sbjct: 304 ttccaggctaaaatgttggatatgttaaaacagactggaaggcctgaaatggtggtcggt 363

                                                                       
Query: 343 tggtaccactcgcatcctggatttggttgctggctttcaggagttgacatcaatactcag 402
           ||||| |||   || ||||| ||||| |||||||| || || |||||||| ||||| |||
Sbjct: 364 tggtatcacagccaccctggctttggctgctggctctccggcgttgacattaatacccag 423

                         
Query: 403 cagagttttgaagc 416
           ||||| || |||||
Sbjct: 424 cagagcttcgaagc 437



to top

>gb|BC073436.1| Xenopus laevis MGC80929 protein, mRNA (cDNA clone MGC:80929
           IMAGE:5516050), complete cds
          Length = 1219

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 86/104 (82%)
 Strand = Plus / Plus

                                                                       
Query: 313 cagaccggaagacctgaaatggtggtaggctggtaccactcgcatcctggatttggttgc 372
           ||||||||||| || ||||||||||| || ||||| |||   || ||||| ||||| |||
Sbjct: 345 cagaccggaaggcccgaaatggtggtcggttggtatcacagccaccctggctttggctgc 404

                                                       
Query: 373 tggctttcaggagttgacatcaatactcagcagagttttgaagc 416
           |||||||| || ||||| || ||||| |||||||| || |||||
Sbjct: 405 tggctttccggcgttgatattaatacccagcagagcttcgaagc 448



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 88/110 (80%)
 Strand = Plus / Plus

                                                                       
Query: 109 atctcctccctcgccctcctcaagatgctcaagcacgggagggccggcgtgcccatggag 168
           ||||||||||| ||  | || |||||||| || |||||| | || || || || ||||| 
Sbjct: 141 atctcctccctggctttgcttaagatgctaaaacacgggcgagctggtgtcccaatggaa 200

                                                             
Query: 169 gtgatgggcctgatgctgggcgagttcgtcgacgactacacggtcagggt 218
           || ||||| ||||||||||| ||||| || || || ||||| ||||||||
Sbjct: 201 gtcatggggctgatgctgggagagtttgtggatgattacacagtcagggt 250



to top

>ref|XM_615793.2| PREDICTED: Bos taurus similar to 26S proteasome non-ATPase
           regulatory subunit 14 (26S proteasome regulatory subunit
           rpn11) (MAD1) (LOC535683), mRNA
          Length = 1272

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 88/107 (82%)
 Strand = Plus / Plus

                                                                       
Query: 310 aagcagaccggaagacctgaaatggtggtaggctggtaccactcgcatcctggatttggt 369
           |||||||| ||||| ||||| ||||| || || ||||| |||   || ||||| ||||||
Sbjct: 328 aagcagacaggaaggcctgagatggttgttggttggtatcacagtcaccctggctttggt 387

                                                          
Query: 370 tgctggctttcaggagttgacatcaatactcagcagagttttgaagc 416
           || |||||||| || || || ||||| ||||||||||| ||||||||
Sbjct: 388 tgttggctttctggtgtggatatcaacactcagcagagctttgaagc 434



to top

>ref|XM_852348.1| PREDICTED: Canis familiaris similar to proteasome (prosome,
           macropain) 26S subunit, non-ATPase, 14, transcript
           variant 4 (LOC478765), mRNA
          Length = 1331

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 88/107 (82%)
 Strand = Plus / Plus

                                                                       
Query: 310 aagcagaccggaagacctgaaatggtggtaggctggtaccactcgcatcctggatttggt 369
           |||||||| ||||| ||||| ||||| || || ||||| |||   || ||||| ||||||
Sbjct: 366 aagcagacaggaaggcctgagatggttgttggttggtatcacagtcaccctggttttggt 425

                                                          
Query: 370 tgctggctttcaggagttgacatcaatactcagcagagttttgaagc 416
           || |||||||| || || || ||||| ||||||||||| ||||||||
Sbjct: 426 tgttggctttctggtgtggatatcaacactcagcagagctttgaagc 472



to top

>ref|XM_535931.2| PREDICTED: Canis familiaris similar to proteasome (prosome,
           macropain) 26S subunit, non-ATPase, 14, transcript
           variant 2 (LOC478765), mRNA
          Length = 1356

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 88/107 (82%)
 Strand = Plus / Plus

                                                                       
Query: 310 aagcagaccggaagacctgaaatggtggtaggctggtaccactcgcatcctggatttggt 369
           |||||||| ||||| ||||| ||||| || || ||||| |||   || ||||| ||||||
Sbjct: 391 aagcagacaggaaggcctgagatggttgttggttggtatcacagtcaccctggttttggt 450

                                                          
Query: 370 tgctggctttcaggagttgacatcaatactcagcagagttttgaagc 416
           || |||||||| || || || ||||| ||||||||||| ||||||||
Sbjct: 451 tgttggctttctggtgtggatatcaacactcagcagagctttgaagc 497



to top

>emb|AJ010592.2|GTAJ10592 Guillardia theta DNA for complete sequence of nucleomorph chromosome 2
          Length = 180915

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 64/75 (85%)
 Strand = Plus / Minus

                                                                          
Query: 340    ggctggtaccactcgcatcctggatttggttgctggctttcaggagttgacatcaatact 399
              ||||||||||| || ||||| || |||||||||||||| || ||||| || || ||||||
Sbjct: 117349 ggctggtaccattctcatccaggttttggttgctggctgtctggagtagatattaatact 117290

                             
Query: 400    cagcagagttttgaa 414
              ||||| | |||||||
Sbjct: 117289 cagcaaaattttgaa 117275



to top

>gb|AY610219.1| Sus scrofa clone Clu_9918.scr.msk.p1.Contig2, mRNA sequence
          Length = 1442

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 88/107 (82%)
 Strand = Plus / Plus

                                                                       
Query: 310 aagcagaccggaagacctgaaatggtggtaggctggtaccactcgcatcctggatttggt 369
           |||||||| ||||| ||||| ||||| || || ||||| |||   || ||||| ||||||
Sbjct: 472 aagcagacaggaaggcctgagatggttgttggttggtatcacagtcaccctggctttggt 531

                                                          
Query: 370 tgctggctttcaggagttgacatcaatactcagcagagttttgaagc 416
           || |||||||| || || || ||||| ||||||||||| ||||||||
Sbjct: 532 tgttggctttctggtgtggatatcaacactcagcagagctttgaagc 578



to top

>gb|AY812783.1| Schistosoma japonicum SJCHGC06520 protein mRNA, complete cds
          Length = 1005

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 92/113 (81%)
 Strand = Plus / Plus

                                                                       
Query: 304 atgctcaagcagaccggaagacctgaaatggtggtaggctggtaccactcgcatcctgga 363
           |||||||| || || ||| | ||||| ||||| || || ||||| ||||| |||||||||
Sbjct: 336 atgctcaaacaaacgggacgtcctgagatggttgtcggatggtatcactcacatcctgga 395

                                                                
Query: 364 tttggttgctggctttcaggagttgacatcaatactcagcagagttttgaagc 416
           |||||||||||| | || || || || || ||||| || || |||||||||||
Sbjct: 396 tttggttgctggttatcgggtgtagatatgaatacacaacaaagttttgaagc 448



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 52/62 (83%)
 Strand = Plus / Plus

                                                                       
Query: 430 gcagttgctgttgtgatagatcccatccagagtgtcaaggggaaagtggtcattgatgca 489
           ||||| ||||||||  | ||||| || |||||||| || || ||||| ||||||||||||
Sbjct: 462 gcagtagctgttgttgttgatcctatacagagtgtgaaaggcaaagttgtcattgatgca 521

             
Query: 490 tt 491
           ||
Sbjct: 522 tt 523



to top

>emb|CR675316.2|CNS0FK1M Tetraodon nigroviridis full-length cDNA
          Length = 1106

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 92/113 (81%)
 Strand = Plus / Plus

                                                                       
Query: 301 gacatgctcaagcagaccggaagacctgaaatggtggtaggctggtaccactcgcatcct 360
           ||||||||||||||||| || ||||| || |||||||| || |||||||||   || || 
Sbjct: 386 gacatgctcaagcagactggcagaccagagatggtggtgggatggtaccacagtcacccc 445

                                                                
Query: 361 ggatttggttgctggctttcaggagttgacatcaatactcagcagagttttga 413
           || || || |||||| | || || || |||||||| || ||||||||||||||
Sbjct: 446 gggttcggctgctggttgtctggcgtggacatcaacacgcagcagagttttga 498



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 86/107 (80%)
 Strand = Plus / Plus

                                                                       
Query: 106 tacatctcctccctcgccctcctcaagatgctcaagcacgggagggccggcgtgcccatg 165
           ||||||||||| || ||||| || |||||||| ||||| ||| | || || || || |||
Sbjct: 191 tacatctcctctctggccctacttaagatgctgaagcatgggcgtgctggtgtaccaatg 250

                                                          
Query: 166 gaggtgatgggcctgatgctgggcgagttcgtcgacgactacacggt 212
           || || |||||  |||||||||| || || || || |||||||||||
Sbjct: 251 gaagttatgggtttgatgctgggagaatttgttgatgactacacggt 297



to top

>gb|AC140547.18| Medicago truncatula clone mth2-17p16, complete sequence
          Length = 123189

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                         
Query: 322   agacctgaaatggtggtaggctggtaccactcgcatcctggatttggttgctggctttca 381
             |||||||| ||||| || || |||||||| || |||||||||||||| || ||| | || 
Sbjct: 47248 agacctgagatggttgttggttggtaccattcacatcctggatttggctgttggttgtct 47307

                              
Query: 382   ggagttgacatcaatac 398
             || ||||||||||||||
Sbjct: 47308 ggtgttgacatcaatac 47324



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                  
Query: 94    tccgagcaggtctacatctcctccctcgccctcctcaagatgctcaagcacgg 146
             ||||| || |||||||||||||||||||| || ||||||||||| || |||||
Sbjct: 46261 tccgaacaagtctacatctcctccctcgctcttctcaagatgcttaaacacgg 46313



to top

>emb|BX056616.1|CNS09FUK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36AB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 817

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                       
Query: 301 gacatgctcaagcagaccggaagacctgaaatggtggtaggctggtaccactcgcatcct 360
           |||||||||||||| |||||  | || || |||||||| || ||||||||||| ||||| 
Sbjct: 485 gacatgctcaagcacaccggtcggccggagatggtggtcggatggtaccactcccatccg 544

                            
Query: 361 ggatttggttgctggct 377
           || ||||| ||||||||
Sbjct: 545 ggctttggatgctggct 561



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 84/101 (83%), Gaps = 1/101 (0%)
 Strand = Plus / Plus

                                                                       
Query: 106 tacatctcctccctcgccctcctcaagatgctcaagcacgggagggccggcgtgcccatg 165
           ||||||||||| ||||| ||| | |||||||| || |||||  | || || ||||| |||
Sbjct: 291 tacatctcctcgctcgctctcttgaagatgctgaaacacggccgtgc-ggagtgccgatg 349

                                                    
Query: 166 gaggtgatgggcctgatgctgggcgagttcgtcgacgacta 206
           || ||||||||||||||| |||| || ||||| ||||||||
Sbjct: 350 gaagtgatgggcctgatgttgggtgaattcgtggacgacta 390



to top

>emb|BX057197.1|CNS09GAP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37AB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 620

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                       
Query: 301 gacatgctcaagcagaccggaagacctgaaatggtggtaggctggtaccactcgcatcct 360
           |||||||||||||| |||||  | || || |||||||| || ||||||||||| ||||| 
Sbjct: 473 gacatgctcaagcaaaccggtcggccggagatggtggtcggatggtaccactcccatccg 532

                            
Query: 361 ggatttggttgctggct 377
           || ||||| ||||||||
Sbjct: 533 ggctttggatgctggct 549



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 84/101 (83%), Gaps = 1/101 (0%)
 Strand = Plus / Plus

                                                                       
Query: 106 tacatctcctccctcgccctcctcaagatgctcaagcacgggagggccggcgtgcccatg 165
           ||||||||||| ||||| ||| | |||||||| || |||||  | || || ||||| |||
Sbjct: 279 tacatctcctcgctcgctctcttgaagatgctgaaacacggccgtgc-ggagtgccgatg 337

                                                    
Query: 166 gaggtgatgggcctgatgctgggcgagttcgtcgacgacta 206
           || ||||||||||||||| |||| || ||||| ||||||||
Sbjct: 338 gaagtgatgggcctgatgttgggtgaattcgtggacgacta 378



to top

>emb|BX008173.1|CNS08EGX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA13CB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 965

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                       
Query: 301 gacatgctcaagcagaccggaagacctgaaatggtggtaggctggtaccactcgcatcct 360
           |||||||||||||| |||||  | || || |||||||| || ||||||||||| ||||| 
Sbjct: 772 gacatgctcaagcaaaccggtcggccggagatggtggtcggatggtaccactcccatccg 713

                            
Query: 361 ggatttggttgctggct 377
           || ||||| ||||||||
Sbjct: 712 ggctttggatgctggct 696



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 151 gccggcgtgcccatggaggtgatgggcctgatgctgggcgagttcgtcgacgacta 206
           ||||| ||||| ||||| ||||||||||||||| |||| || ||||| ||||||||
Sbjct: 922 gccggagtgccgatggaagtgatgggcctgatgttgggtgaattcgtggacgacta 867



to top

>ref|NM_001031256.1| Gallus gallus proteasome (prosome, macropain) 26S subunit,
           non-ATPase, 14 (PSMD14), mRNA
          Length = 5247

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 92/113 (81%)
 Strand = Plus / Plus

                                                                       
Query: 304 atgctcaagcagaccggaagacctgaaatggtggtaggctggtaccactcgcatcctgga 363
           ||||| || ||||| ||||||||||| ||||| || || ||||| |||   |||||||| 
Sbjct: 469 atgctgaaacagacaggaagacctgagatggttgttggttggtatcacagtcatcctggc 528

                                                                
Query: 364 tttggttgctggctttcaggagttgacatcaatactcagcagagttttgaagc 416
           ||||| || ||| | || || || || ||||||||||||||||| ||||||||
Sbjct: 529 tttggctgttggttgtctggtgtagatatcaatactcagcagagctttgaagc 581



to top

>emb|AJ720599.1| Gallus gallus mRNA for hypothetical protein, clone 20p24
          Length = 5247

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 92/113 (81%)
 Strand = Plus / Plus

                                                                       
Query: 304 atgctcaagcagaccggaagacctgaaatggtggtaggctggtaccactcgcatcctgga 363
           ||||| || ||||| ||||||||||| ||||| || || ||||| |||   |||||||| 
Sbjct: 469 atgctgaaacagacaggaagacctgagatggttgttggttggtatcacagtcatcctggc 528

                                                                
Query: 364 tttggttgctggctttcaggagttgacatcaatactcagcagagttttgaagc 416
           ||||| || ||| | || || || || ||||||||||||||||| ||||||||
Sbjct: 529 tttggctgttggttgtctggtgtagatatcaatactcagcagagctttgaagc 581



to top

>gb|AC145022.28| Medicago truncatula clone mth2-8m24, complete sequence
          Length = 108548

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                 
Query: 94   tccgagcaggtctacatctcctccctcgccctcctcaagatgctcaagcacgg 146
            ||||| || |||||||||||||||||||| || ||||||||||| || |||||
Sbjct: 5041 tccgaacaagtctacatctcctccctcgctcttctcaagatgcttaaacacgg 5093



to top

>emb|CR387677.1| Gallus gallus finished cDNA, clone ChEST73p15
          Length = 1446

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 92/113 (81%)
 Strand = Plus / Plus

                                                                       
Query: 304 atgctcaagcagaccggaagacctgaaatggtggtaggctggtaccactcgcatcctgga 363
           ||||| || ||||| ||||||||||| ||||| || || ||||| |||   |||||||| 
Sbjct: 474 atgctgaaacagacaggaagacctgagatggttgttggttggtatcacagtcatcctggc 533

                                                                
Query: 364 tttggttgctggctttcaggagttgacatcaatactcagcagagttttgaagc 416
           ||||| || ||| | || || || || ||||||||||||||||| ||||||||
Sbjct: 534 tttggctgttggttgtctggtgtagatatcaatactcagcagagctttgaagc 586



to top

>ref|XM_515855.1| PREDICTED: Pan troglodytes similar to 26S proteasome-associated
           pad1 homolog (LOC459686), mRNA
          Length = 906

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 358 cctggatttggttgctggctttcaggagttgacatcaatactcagcagagttttgaagc 416
           ||||| |||||||| |||||||| || || || ||||| ||||||||||| ||||||||
Sbjct: 319 cctggctttggttgttggctttctggtgtggatatcaacactcagcagagctttgaagc 377



to top

>ref|NM_005805.2| Homo sapiens proteasome (prosome, macropain) 26S subunit,
           non-ATPase, 14 (PSMD14), mRNA
          Length = 1278

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 358 cctggatttggttgctggctttcaggagttgacatcaatactcagcagagttttgaagc 416
           ||||| |||||||| |||||||| || || || ||||| ||||||||||| ||||||||
Sbjct: 659 cctggctttggttgttggctttctggtgtggatatcaacactcagcagagctttgaagc 717



to top

>emb|CR450841.7| Zebrafish DNA sequence from clone DKEY-16N9 in linkage group 11, complete
              sequence
          Length = 263287

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 72/87 (82%)
 Strand = Plus / Minus

                                                                          
Query: 157    gtgcccatggaggtgatgggcctgatgctgggcgagttcgtcgacgactacacggtcagg 216
              ||||||||||| || ||||| ||||||||||| ||||| || ||||| ||||| ||  | 
Sbjct: 252585 gtgcccatggaagtcatgggtctgatgctgggagagtttgtggacgattacacagtacgc 252526

                                         
Query: 217    gtggtggatgtcttcgccatgccgcag 243
              ||| | ||||| || ||||||||||||
Sbjct: 252525 gtgattgatgtgtttgccatgccgcag 252499



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 70/86 (81%)
 Strand = Plus / Minus

                                                                          
Query: 325    cctgaaatggtggtaggctggtaccactcgcatcctggatttggttgctggctttcagga 384
              ||||| |||||||| ||||||||||||   || ||||| || || |||||| | ||||| 
Sbjct: 251077 cctgagatggtggtgggctggtaccacagtcaccctggtttcggctgctggttgtcaggt 251018

                                        
Query: 385    gttgacatcaatactcagcagagttt 410
              || ||||| || || |||||||||||
Sbjct: 251017 gtggacattaacacacagcagagttt 250992



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                    
Query: 433    gttgctgttgtgatagatcccatccagagtgtcaaggg 470
              ||||| |||||| | |||||||||||||| ||||||||
Sbjct: 250969 gttgccgttgtggtcgatcccatccagagcgtcaaggg 250932



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                               
Query: 100    caggtctacatctcctccctcgccctcctcaag 132
              ||||| ||||||||||||||||| || ||||||
Sbjct: 254063 caggtgtacatctcctccctcgctctgctcaag 254031



to top

>emb|CR712625.2|CNS0GCT9 Tetraodon nigroviridis full-length cDNA
          Length = 1106

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                              
Query: 301 gacatgctcaagcagaccggaagacctgaaatggtggtaggctggtaccac 351
           ||||||||||||||||| || ||||| || |||||||| || |||||||||
Sbjct: 386 gacatgctcaagcagactggcagaccagagatggtggtgggatggtaccac 436



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 86/107 (80%)
 Strand = Plus / Plus

                                                                       
Query: 106 tacatctcctccctcgccctcctcaagatgctcaagcacgggagggccggcgtgcccatg 165
           ||||||||||| || ||||| || |||||||| ||||| ||| | || || || || |||
Sbjct: 191 tacatctcctctctggccctacttaagatgctgaagcatgggcgtgctggtgtaccaatg 250

                                                          
Query: 166 gaggtgatgggcctgatgctgggcgagttcgtcgacgactacacggt 212
           || || |||||  |||||||||| || || || || |||||||||||
Sbjct: 251 gaagttatgggtttgatgctgggagaatttgttgatgactacacggt 297



to top

>ref|XM_759673.1| Theileria parva strain Muguga proteasome regulatory subunit
           (TP02_0201) partial mRNA
          Length = 1115

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 343 tggtaccactcgcatcctggatttggttgctggctttcaggagttgacatcaatactcag 402
           ||||| ||||| ||||| || ||||| |||||| ||||||||  |||  | |||||||||
Sbjct: 516 tggtatcactcacatccgggctttggatgctggttttcaggaactgatgtgaatactcag 575

                      
Query: 403 cagagttttga 413
           |||||||||||
Sbjct: 576 cagagttttga 586



to top

>ref|XM_947427.1| Theileria annulata strain Ankara proteasome regulatory subunit
           (TA11850) partial mRNA
          Length = 939

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 343 tggtaccactcgcatcctggatttggttgctggctttcaggagttgacatcaatactcag 402
           ||||||||||| ||||| || ||||| || ||| ||||||||  |||  | |||||||||
Sbjct: 340 tggtaccactcacatccaggctttggatgttggttttcaggaactgatgtgaatactcag 399

                      
Query: 403 cagagttttga 413
           |||||||||||
Sbjct: 400 cagagttttga 410



to top

>gb|BC097427.1| Rattus norvegicus similar to T-Brain-1, mRNA (cDNA clone
           IMAGE:7455230), complete cds
          Length = 1535

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 358 cctggatttggttgctggctttcaggagttgacatcaatactcagcagagttttgaagc 416
           ||||| ||||| || |||||||| || || |||||||| ||||||||||| ||||||||
Sbjct: 627 cctggctttggctgttggctttctggtgtggacatcaacactcagcagagctttgaagc 685



to top

>gb|BC066336.1| Homo sapiens proteasome (prosome, macropain) 26S subunit,
           non-ATPase, 14, mRNA (cDNA clone MGC:87397
           IMAGE:5296432), complete cds
          Length = 1278

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 358 cctggatttggttgctggctttcaggagttgacatcaatactcagcagagttttgaagc 416
           ||||| |||||||| |||||||| || || || ||||| ||||||||||| ||||||||
Sbjct: 659 cctggctttggttgttggctttctggtgtggatatcaacactcagcagagctttgaagc 717



to top

>emb|CR615752.1| full-length cDNA clone CS0DI002YC21 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1492

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 358 cctggatttggttgctggctttcaggagttgacatcaatactcagcagagttttgaagc 416
           ||||| |||||||| |||||||| || || || ||||| ||||||||||| ||||||||
Sbjct: 617 cctggctttggttgttggctttctggtgtggatatcaacactcagcagagctttgaagc 675



to top

>emb|CR617325.1| full-length cDNA clone CS0DF011YP17 of Fetal brain of Homo sapiens
           (human)
          Length = 1527

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 358 cctggatttggttgctggctttcaggagttgacatcaatactcagcagagttttgaagc 416
           ||||| |||||||| |||||||| || || || ||||| ||||||||||| ||||||||
Sbjct: 668 cctggctttggttgttggctttctggtgtggatatcaacactcagcagagctttgaagc 726



to top

>emb|CR606475.1| full-length cDNA clone CS0DM002YB05 of Fetal liver of Homo sapiens
           (human)
          Length = 1481

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 358 cctggatttggttgctggctttcaggagttgacatcaatactcagcagagttttgaagc 416
           ||||| |||||||| |||||||| || || || ||||| ||||||||||| ||||||||
Sbjct: 617 cctggctttggttgttggctttctggtgtggatatcaacactcagcagagctttgaagc 675



to top

>emb|CR595585.1| full-length cDNA clone CS0DI058YD16 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1522

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 358 cctggatttggttgctggctttcaggagttgacatcaatactcagcagagttttgaagc 416
           ||||| |||||||| |||||||| || || || ||||| ||||||||||| ||||||||
Sbjct: 644 cctggctttggttgttggctttctggtgtggatatcaacactcagcagagctttgaagc 702



to top

>dbj|AK055128.1| Homo sapiens cDNA FLJ30566 fis, clone BRAWH2005068, highly similar to
            Human 26S proteasome-associated pad1 homolog (POH1) mRNA
          Length = 1951

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                       
Query: 358  cctggatttggttgctggctttcaggagttgacatcaatactcagcagagttttgaagc 416
            ||||| |||||||| |||||||| || || || ||||| ||||||||||| ||||||||
Sbjct: 1050 cctggctttggttgttggctttctggtgtggatatcaacactcagcagagctttgaagc 1108



to top

>gb|AC009299.5| Homo sapiens BAC clone RP11-26B22 from 2, complete sequence
          Length = 169697

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                         
Query: 358    cctggatttggttgctggctttcaggagttgacatcaatactcagcagagttttgaagc 416
              ||||| |||||||| |||||||| || || || ||||| ||||||||||| ||||||||
Sbjct: 167819 cctggctttggttgttggctttctggtgtggatatcaacactcagcagagctttgaagc 167877



to top

>gb|U86782.1|HSU86782 Human 26S proteasome-associated pad1 homolog (POH1) mRNA, complete
           cds
          Length = 1132

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 358 cctggatttggttgctggctttcaggagttgacatcaatactcagcagagttttgaagc 416
           ||||| |||||||| |||||||| || || || ||||| ||||||||||| ||||||||
Sbjct: 545 cctggctttggttgttggctttctggtgtggatatcaacactcagcagagctttgaagc 603



to top

>ref|XM_505906.1| Yarrowia lipolytica CLIB122, YALI0F26411g predicted mRNA
          Length = 939

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 160 cccatggaggtgatgggcctgatgctgggcgagttcgtcgacgactacac 209
           |||||||| |||||||| || |||||||| ||||| || |||||||||||
Sbjct: 151 cccatggaagtgatgggacttatgctgggagagtttgtggacgactacac 200



to top

>ref|NM_208154.1| Eremothecium gossypii ABL146Cp (ABL146C), mRNA
          Length = 1263

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 340 ggctggtaccactcgcatcctggatttggttgctggct 377
           |||||||||||||||||||| |||| ||| ||||||||
Sbjct: 451 ggctggtaccactcgcatccgggatatggatgctggct 488



to top

>gb|AE016815.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome II,
              complete sequence
          Length = 867699

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                    
Query: 340    ggctggtaccactcgcatcctggatttggttgctggct 377
              |||||||||||||||||||| |||| ||| ||||||||
Sbjct: 124127 ggctggtaccactcgcatccgggatatggatgctggct 124090



to top

>gb|DQ214693.1| Taeniopygia guttata clone 0061P0025H01 26S proteasome-associated
           pad1-like variant 2-like mRNA, complete sequence
          Length = 1419

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 91/113 (80%)
 Strand = Plus / Plus

                                                                       
Query: 304 atgctcaagcagaccggaagacctgaaatggtggtaggctggtaccactcgcatcctgga 363
           ||||| || ||||| ||||||||||| ||||| || || ||||| ||    |||||||| 
Sbjct: 446 atgctgaaacagacgggaagacctgagatggtagttggttggtatcatagtcatcctggc 505

                                                                
Query: 364 tttggttgctggctttcaggagttgacatcaatactcagcagagttttgaagc 416
           ||||| || ||| | || || || || ||||||||||||||||| ||||||||
Sbjct: 506 tttggctgttggttgtctggtgtagatatcaatactcagcagagctttgaagc 558



to top

>gb|DQ214692.1| Taeniopygia guttata clone 0061P0016E01 26S proteasome-associated
           pad1-like variant 2-like mRNA, complete sequence
          Length = 1424

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 91/113 (80%)
 Strand = Plus / Plus

                                                                       
Query: 304 atgctcaagcagaccggaagacctgaaatggtggtaggctggtaccactcgcatcctgga 363
           ||||| || ||||| ||||||||||| ||||| || || ||||| ||    |||||||| 
Sbjct: 450 atgctgaaacagacgggaagacctgagatggtagttggttggtatcatagtcatcctggc 509

                                                                
Query: 364 tttggttgctggctttcaggagttgacatcaatactcagcagagttttgaagc 416
           ||||| || ||| | || || || || ||||||||||||||||| ||||||||
Sbjct: 510 tttggctgttggttgtctggtgtagatatcaatactcagcagagctttgaagc 562



to top

>gb|DQ214691.1| Taeniopygia guttata clone 0061P0006D06 26S proteasome-associated
           pad1-like variant 1-like mRNA, complete sequence
          Length = 1463

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 91/113 (80%)
 Strand = Plus / Plus

                                                                       
Query: 304 atgctcaagcagaccggaagacctgaaatggtggtaggctggtaccactcgcatcctgga 363
           ||||| || ||||| ||||||||||| ||||| || || ||||| ||    |||||||| 
Sbjct: 482 atgctgaaacagacgggaagacctgagatggtagttggttggtatcatagtcatcctggc 541

                                                                
Query: 364 tttggttgctggctttcaggagttgacatcaatactcagcagagttttgaagc 416
           ||||| || ||| | || || || || ||||||||||||||||| ||||||||
Sbjct: 542 tttggctgttggttgtctggtgtagatatcaatactcagcagagctttgaagc 594



to top

>emb|CR719774.2|CNS0GIBO Tetraodon nigroviridis full-length cDNA
          Length = 1237

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 164 tggaggtgatgggcctgatgctggg 188
           |||||||||||||||||||||||||
Sbjct: 296 tggaggtgatgggcctgatgctggg 320



to top

>emb|CR702360.2|CNS0G4W4 Tetraodon nigroviridis full-length cDNA
          Length = 1270

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 164 tggaggtgatgggcctgatgctggg 188
           |||||||||||||||||||||||||
Sbjct: 338 tggaggtgatgggcctgatgctggg 362



to top

>emb|CR702327.2|CNS0G4V7 Tetraodon nigroviridis full-length cDNA
          Length = 1303

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 164 tggaggtgatgggcctgatgctggg 188
           |||||||||||||||||||||||||
Sbjct: 360 tggaggtgatgggcctgatgctggg 384



to top

>emb|CR698457.2|CNS0G1VP Tetraodon nigroviridis full-length cDNA
          Length = 1114

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 164 tggaggtgatgggcctgatgctggg 188
           |||||||||||||||||||||||||
Sbjct: 177 tggaggtgatgggcctgatgctggg 201



to top

>emb|CR698218.2|CNS0G1P2 Tetraodon nigroviridis full-length cDNA
          Length = 1292

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 164 tggaggtgatgggcctgatgctggg 188
           |||||||||||||||||||||||||
Sbjct: 356 tggaggtgatgggcctgatgctggg 380



to top

>emb|CR696910.2|CNS0G0OQ Tetraodon nigroviridis full-length cDNA
          Length = 1282

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 164 tggaggtgatgggcctgatgctggg 188
           |||||||||||||||||||||||||
Sbjct: 347 tggaggtgatgggcctgatgctggg 371



to top

>emb|CR692972.2|CNS0FXNC Tetraodon nigroviridis full-length cDNA
          Length = 1287

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 164 tggaggtgatgggcctgatgctggg 188
           |||||||||||||||||||||||||
Sbjct: 360 tggaggtgatgggcctgatgctggg 384



to top

>emb|CR691509.2|CNS0FWIP Tetraodon nigroviridis full-length cDNA
          Length = 1295

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 164 tggaggtgatgggcctgatgctggg 188
           |||||||||||||||||||||||||
Sbjct: 353 tggaggtgatgggcctgatgctggg 377



to top

>emb|CR690951.2|CNS0FW37 Tetraodon nigroviridis full-length cDNA
          Length = 1294

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 164 tggaggtgatgggcctgatgctggg 188
           |||||||||||||||||||||||||
Sbjct: 354 tggaggtgatgggcctgatgctggg 378



to top

>emb|CR689076.1|CNS0FUN4 Tetraodon nigroviridis full-length cDNA
          Length = 1293

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 164 tggaggtgatgggcctgatgctggg 188
           |||||||||||||||||||||||||
Sbjct: 353 tggaggtgatgggcctgatgctggg 377



to top

>emb|CR688795.2|CNS0FUFB Tetraodon nigroviridis full-length cDNA
          Length = 1098

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 164 tggaggtgatgggcctgatgctggg 188
           |||||||||||||||||||||||||
Sbjct: 156 tggaggtgatgggcctgatgctggg 180



to top

>emb|CR686556.1|CNS0FSP4 Tetraodon nigroviridis full-length cDNA
          Length = 1270

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 164 tggaggtgatgggcctgatgctggg 188
           |||||||||||||||||||||||||
Sbjct: 347 tggaggtgatgggcctgatgctggg 371



to top

>emb|CR685176.2|CNS0FRMS Tetraodon nigroviridis full-length cDNA
          Length = 1270

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 164 tggaggtgatgggcctgatgctggg 188
           |||||||||||||||||||||||||
Sbjct: 347 tggaggtgatgggcctgatgctggg 371



to top

>emb|CR684478.2|CNS0FR3E Tetraodon nigroviridis full-length cDNA
          Length = 1299

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 164 tggaggtgatgggcctgatgctggg 188
           |||||||||||||||||||||||||
Sbjct: 360 tggaggtgatgggcctgatgctggg 384



to top

>emb|CR682368.2|CNS0FPGS Tetraodon nigroviridis full-length cDNA
          Length = 1298

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 164 tggaggtgatgggcctgatgctggg 188
           |||||||||||||||||||||||||
Sbjct: 359 tggaggtgatgggcctgatgctggg 383



to top

>emb|CR679559.2|CNS0FNAR Tetraodon nigroviridis full-length cDNA
          Length = 1232

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 164 tggaggtgatgggcctgatgctggg 188
           |||||||||||||||||||||||||
Sbjct: 305 tggaggtgatgggcctgatgctggg 329



to top

>emb|CR678444.2|CNS0FMFV Tetraodon nigroviridis full-length cDNA
          Length = 1301

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 164 tggaggtgatgggcctgatgctggg 188
           |||||||||||||||||||||||||
Sbjct: 361 tggaggtgatgggcctgatgctggg 385



to top

>emb|CR676746.1|CNS0FL52 Tetraodon nigroviridis full-length cDNA
          Length = 1268

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 164 tggaggtgatgggcctgatgctggg 188
           |||||||||||||||||||||||||
Sbjct: 338 tggaggtgatgggcctgatgctggg 362



to top

>emb|CR676595.2|CNS0FL0V Tetraodon nigroviridis full-length cDNA
          Length = 1303

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 164 tggaggtgatgggcctgatgctggg 188
           |||||||||||||||||||||||||
Sbjct: 359 tggaggtgatgggcctgatgctggg 383



to top

>emb|CR675180.1|CNS0FJXU Tetraodon nigroviridis full-length cDNA
          Length = 1264

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 164 tggaggtgatgggcctgatgctggg 188
           |||||||||||||||||||||||||
Sbjct: 341 tggaggtgatgggcctgatgctggg 365



to top

>emb|CR674318.2|CNS0FJ9W Tetraodon nigroviridis full-length cDNA
          Length = 1305

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 164 tggaggtgatgggcctgatgctggg 188
           |||||||||||||||||||||||||
Sbjct: 361 tggaggtgatgggcctgatgctggg 385



to top

>emb|CR674265.2|CNS0FJ8F Tetraodon nigroviridis full-length cDNA
          Length = 1281

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 164 tggaggtgatgggcctgatgctggg 188
           |||||||||||||||||||||||||
Sbjct: 347 tggaggtgatgggcctgatgctggg 371



to top

>emb|CR672566.1|CNS0FHX8 Tetraodon nigroviridis full-length cDNA
          Length = 1299

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 164 tggaggtgatgggcctgatgctggg 188
           |||||||||||||||||||||||||
Sbjct: 359 tggaggtgatgggcctgatgctggg 383



to top

>emb|CR669565.1|CNS0FFLV Tetraodon nigroviridis full-length cDNA
          Length = 1301

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 164 tggaggtgatgggcctgatgctggg 188
           |||||||||||||||||||||||||
Sbjct: 360 tggaggtgatgggcctgatgctggg 384



to top

>emb|CR669132.2|CNS0FF9U Tetraodon nigroviridis full-length cDNA
          Length = 1295

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 164 tggaggtgatgggcctgatgctggg 188
           |||||||||||||||||||||||||
Sbjct: 348 tggaggtgatgggcctgatgctggg 372



to top

>emb|CR667241.2|CNS0FDTB Tetraodon nigroviridis full-length cDNA
          Length = 1282

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 164 tggaggtgatgggcctgatgctggg 188
           |||||||||||||||||||||||||
Sbjct: 338 tggaggtgatgggcctgatgctggg 362



to top

>emb|CR665456.2|CNS0FCFQ Tetraodon nigroviridis full-length cDNA
          Length = 1305

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 164 tggaggtgatgggcctgatgctggg 188
           |||||||||||||||||||||||||
Sbjct: 359 tggaggtgatgggcctgatgctggg 383



to top

>emb|CR665024.2|CNS0FC3Q Tetraodon nigroviridis full-length cDNA
          Length = 1285

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 164 tggaggtgatgggcctgatgctggg 188
           |||||||||||||||||||||||||
Sbjct: 348 tggaggtgatgggcctgatgctggg 372



to top

>emb|CR664253.1|CNS0FBIB Tetraodon nigroviridis full-length cDNA
          Length = 1197

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 164 tggaggtgatgggcctgatgctggg 188
           |||||||||||||||||||||||||
Sbjct: 311 tggaggtgatgggcctgatgctggg 335



to top

>emb|CR664229.1|CNS0FBHN Tetraodon nigroviridis full-length cDNA
          Length = 1284

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 164 tggaggtgatgggcctgatgctggg 188
           |||||||||||||||||||||||||
Sbjct: 352 tggaggtgatgggcctgatgctggg 376



to top

>emb|CR664067.2|CNS0FBD5 Tetraodon nigroviridis full-length cDNA
          Length = 1292

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 164 tggaggtgatgggcctgatgctggg 188
           |||||||||||||||||||||||||
Sbjct: 348 tggaggtgatgggcctgatgctggg 372



to top

>emb|CR660170.2|CNS0F8CW Tetraodon nigroviridis full-length cDNA
          Length = 1300

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 164 tggaggtgatgggcctgatgctggg 188
           |||||||||||||||||||||||||
Sbjct: 356 tggaggtgatgggcctgatgctggg 380



to top

>emb|CR658518.2|CNS0F730 Tetraodon nigroviridis full-length cDNA
          Length = 1301

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 164 tggaggtgatgggcctgatgctggg 188
           |||||||||||||||||||||||||
Sbjct: 360 tggaggtgatgggcctgatgctggg 384



to top

>emb|CR653521.2|CNS0F387 Tetraodon nigroviridis full-length cDNA
          Length = 1555

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 164 tggaggtgatgggcctgatgctggg 188
           |||||||||||||||||||||||||
Sbjct: 337 tggaggtgatgggcctgatgctggg 361



to top

>emb|CR648165.2|CNS0EZ3F Tetraodon nigroviridis full-length cDNA
          Length = 1276

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 164 tggaggtgatgggcctgatgctggg 188
           |||||||||||||||||||||||||
Sbjct: 336 tggaggtgatgggcctgatgctggg 360



to top

>emb|CR647310.1|CNS0EYFO Tetraodon nigroviridis full-length cDNA
          Length = 1266

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 164 tggaggtgatgggcctgatgctggg 188
           |||||||||||||||||||||||||
Sbjct: 339 tggaggtgatgggcctgatgctggg 363



to top

>emb|CR647437.2|CNS0EYJ7 Tetraodon nigroviridis full-length cDNA
          Length = 1277

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 164 tggaggtgatgggcctgatgctggg 188
           |||||||||||||||||||||||||
Sbjct: 346 tggaggtgatgggcctgatgctggg 370



to top

>emb|CR646589.2|CNS0EXVN Tetraodon nigroviridis full-length cDNA
          Length = 1278

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 164 tggaggtgatgggcctgatgctggg 188
           |||||||||||||||||||||||||
Sbjct: 354 tggaggtgatgggcctgatgctggg 378



to top

>emb|CR645283.2|CNS0EWVD Tetraodon nigroviridis full-length cDNA
          Length = 1267

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 164 tggaggtgatgggcctgatgctggg 188
           |||||||||||||||||||||||||
Sbjct: 331 tggaggtgatgggcctgatgctggg 355



to top

>emb|CR641289.2|CNS0ETSF Tetraodon nigroviridis full-length cDNA
          Length = 1300

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 164 tggaggtgatgggcctgatgctggg 188
           |||||||||||||||||||||||||
Sbjct: 360 tggaggtgatgggcctgatgctggg 384



to top

>emb|CR638316.1|CNS0ERHU Tetraodon nigroviridis full-length cDNA
          Length = 1258

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 164 tggaggtgatgggcctgatgctggg 188
           |||||||||||||||||||||||||
Sbjct: 332 tggaggtgatgggcctgatgctggg 356



to top

>emb|CR636358.2|CNS0EPZG Tetraodon nigroviridis full-length cDNA
          Length = 1288

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 164 tggaggtgatgggcctgatgctggg 188
           |||||||||||||||||||||||||
Sbjct: 360 tggaggtgatgggcctgatgctggg 384



to top

>ref|XM_774934.1| PREDICTED: Strongylocentrotus purpuratus similar to proteasome
           (prosome, macropain) 26S subunit, non-ATPase, 14,
           transcript variant 1 (LOC580426), mRNA
          Length = 1034

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 91/113 (80%)
 Strand = Plus / Plus

                                                                       
Query: 301 gacatgctcaagcagaccggaagacctgaaatggtggtaggctggtaccactcgcatcct 360
           |||||||| |||||||| ||  | || || |||||||| || ||||| ||||| ||||| 
Sbjct: 390 gacatgctgaagcagacgggtcgtccagagatggtggtgggatggtatcactctcatcca 449

                                                                
Query: 361 ggatttggttgctggctttcaggagttgacatcaatactcagcagagttttga 413
           || || || |||||| | || || || |||||||| || ||||||||||||||
Sbjct: 450 gggttcggatgctggttgtcgggcgtcgacatcaacacacagcagagttttga 502



to top

>gb|AF014465.1|AF014465 Schistosoma mansoni Pad1 homolog (SmPOH) mRNA, complete cds
          Length = 1045

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 73/89 (82%)
 Strand = Plus / Plus

                                                                       
Query: 328 gaaatggtggtaggctggtaccactcgcatcctggatttggttgctggctttcaggagtt 387
           |||||||| || || ||||| ||||| ||||||||||| ||||||||| | || || || 
Sbjct: 378 gaaatggttgtcggatggtatcactcacatcctggattcggttgctggttatctggtgtg 437

                                        
Query: 388 gacatcaatactcagcagagttttgaagc 416
           || || ||||| || || |||||||||||
Sbjct: 438 gatatgaatacacaacaaagttttgaagc 466



to top

>gb|AF014466.1|AF014466 Schistosoma mansoni trans-spliced variant protein (SmPOH.Trans)
           mRNA, partial cds
          Length = 527

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 73/89 (82%)
 Strand = Plus / Plus

                                                                       
Query: 328 gaaatggtggtaggctggtaccactcgcatcctggatttggttgctggctttcaggagtt 387
           |||||||| || || ||||| ||||| ||||||||||| ||||||||| | || || || 
Sbjct: 308 gaaatggttgtcggatggtatcactcacatcctggattcggttgctggttatctggtgtg 367

                                        
Query: 388 gacatcaatactcagcagagttttgaagc 416
           || || ||||| || || |||||||||||
Sbjct: 368 gatatgaatacacaacaaagttttgaagc 396



to top

>ref|XM_657004.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN4492.2), mRNA
          Length = 1035

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 120/152 (78%)
 Strand = Plus / Plus

                                                                       
Query: 226 gtcttcgccatgccgcagagcgggaccggggtcagcgtcgaggccgtcgaccacgtcttc 285
           ||||| || ||||| |||||||| || || ||||| ||||| || || ||||  || |||
Sbjct: 244 gtctttgcgatgcctcagagcggtacaggcgtcagtgtcgaagctgttgaccctgtattc 303

                                                                       
Query: 286 cagaccaacatgctcgacatgctcaagcagaccggaagacctgaaatggtggtaggctgg 345
           || || || ||| | |||||||| | ||| |||||| |||| |||   || || || |||
Sbjct: 304 caaacaaaaatgatggacatgcttaggcaaaccggacgaccggaacccgttgtcggttgg 363

                                           
Query: 346 taccactcgcatcctggatttggttgctggct 377
           || |||||||||||||| ||||| ||||||||
Sbjct: 364 tatcactcgcatcctgggtttggatgctggct 395



to top

>gb|AF349677.1| Cochliobolus carbonum histone deacetylase 2 (HDC2) gene, complete
           cds
          Length = 2906

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 75/92 (81%)
 Strand = Plus / Minus

                                                                       
Query: 103 gtctacatctcctccctcgccctcctcaagatgctcaagcacgggagggccggcgtgccc 162
           ||||||||||| || |||||||| ||||||||| |    |||||  ||||||| ||||| 
Sbjct: 92  gtctacatctcttcgctcgccctactcaagatgttgcgacacggccgggccggtgtgcct 33

                                           
Query: 163 atggaggtgatgggcctgatgctgggcgagtt 194
           ||||| || ||||| |||||| |||| |||||
Sbjct: 32  atggaagtcatgggactgatgttgggagagtt 1



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
               sequence
          Length = 28434780

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                           
Query: 163     atggaggtgatgggcctgatgctgggcgagttcgtcgacgacta 206
               |||||||||||||| ||| |||| || ||||| |||||||||||
Sbjct: 2579026 atggaggtgatggggctggtgcttggggagttggtcgacgacta 2578983



to top

>gb|AY152546.1| Saccharomyces cerevisiae 26S proteasome regulatory subunit (RPN11)
           gene, RPN11-1 allele, complete cds
          Length = 921

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                       
Query: 130 aagatgctcaagcacgggagggccggcgtgcccatggaggtgatgggcctgatgctgggc 189
           |||||||| ||||| || || ||||| || || ||||| |||||||| |||||| | |||
Sbjct: 106 aagatgctgaagcatggtagagccggtgttccaatggaagtgatgggactgatgttaggc 165

                   
Query: 190 gagttcgt 197
           ||||||||
Sbjct: 166 gagttcgt 173



to top

>dbj|AP005526.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
             clone:P0571B09
          Length = 147382

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                         
Query: 163   atggaggtgatgggcctgatgctgggcgagttcgtcgacgacta 206
             |||||||||||||| ||| |||| || ||||| |||||||||||
Sbjct: 93383 atggaggtgatggggctggtgcttggggagttggtcgacgacta 93340



to top

>dbj|AP005506.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
              clone:P0665F09
          Length = 147102

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                          
Query: 163    atggaggtgatgggcctgatgctgggcgagttcgtcgacgacta 206
              |||||||||||||| ||| |||| || ||||| |||||||||||
Sbjct: 140655 atggaggtgatggggctggtgcttggggagttggtcgacgacta 140612



to top

>gb|BC003742.1| Mus musculus proteasome (prosome, macropain) 26S subunit,
           non-ATPase, 14, mRNA (cDNA clone MGC:5840
           IMAGE:3599671), complete cds
          Length = 1460

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                      
Query: 358 cctggatttggttgctggctttcaggagttgacatcaatactcagcagagttttgaagc 416
           ||||| ||||| || |||||||| || || || ||||| ||||||||||| ||||||||
Sbjct: 563 cctggctttggctgttggctttctggtgtggatatcaacactcagcagagctttgaagc 621



to top

>ref|NM_021526.1| Mus musculus proteasome (prosome, macropain) 26S subunit,
           non-ATPase, 14 (Psmd14), mRNA
          Length = 1479

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                      
Query: 358 cctggatttggttgctggctttcaggagttgacatcaatactcagcagagttttgaagc 416
           ||||| ||||| || |||||||| || || || ||||| ||||||||||| ||||||||
Sbjct: 579 cctggctttggctgttggctttctggtgtggatatcaacactcagcagagctttgaagc 637



to top

>ref|XM_454588.1| Kluyveromyces lactis NRRL Y-1140, KLLA0E14190g predicted mRNA
          Length = 936

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 466 aaggggaaagtggtcattgatgcattc 492
           ||||| |||||||||||||||||||||
Sbjct: 457 aagggtaaagtggtcattgatgcattc 483



to top

>emb|CR382125.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome E of strain NRRL Y-1140
               of Kluyveromyces lactis
          Length = 2234072

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                          
Query: 466     aaggggaaagtggtcattgatgcattc 492
               ||||| |||||||||||||||||||||
Sbjct: 1252359 aagggtaaagtggtcattgatgcattc 1252333



to top

>emb|BX538352.1| Cryptosporidium parvum chromosome 6, complete sequence; segment 3/4
          Length = 293050

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                            
Query: 337   gtaggctggtaccactcgcatcctggatttggttgctggctttcagg 383
             ||||| ||||| ||||| ||||| || |||||||||||| |||||||
Sbjct: 23006 gtaggatggtatcactcacatccaggttttggttgctggttttcagg 23052



to top

>emb|AL590450.1|CNS07EGH chromosome XI of strain GB-M1 of Encephalitozoon cuniculi (Microspora)
          Length = 267509

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 95/119 (79%)
 Strand = Plus / Minus

                                                                         
Query: 130   aagatgctcaagcacgggagggccggcgtgcccatggaggtgatgggcctgatgctgggc 189
             |||||||||||||| ||| |||| ||  | ||| | ||||| ||||| |||||||| || 
Sbjct: 80457 aagatgctcaagcatgggcgggcagggattcccctcgaggtcatgggactgatgcttgga 80398

                                                                        
Query: 190   gagttcgtcgacgactacacggtcagggtggtggatgtcttcgccatgccgcagagcgg 248
             ||||| || ||||| ||||| || | ||| || || || || |||||||| ||||||||
Sbjct: 80397 gagtttgttgacgaatacactgtgaaggtcgtcgacgtgtttgccatgcctcagagcgg 80339



to top

>dbj|AK151733.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830035M05 product:proteasome
           (prosome, macropain) 26S subunit, non-ATPase, 14, full
           insert sequence
          Length = 1523

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                      
Query: 358 cctggatttggttgctggctttcaggagttgacatcaatactcagcagagttttgaagc 416
           ||||| ||||| || |||||||| || || || ||||| ||||||||||| ||||||||
Sbjct: 641 cctggctttggctgttggctttctggtgtggatatcaacactcagcagagctttgaagc 699



to top

>dbj|AK150280.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830001F22 product:proteasome
           (prosome, macropain) 26S subunit, non-ATPase, 14, full
           insert sequence
          Length = 1477

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                      
Query: 358 cctggatttggttgctggctttcaggagttgacatcaatactcagcagagttttgaagc 416
           ||||| ||||| || |||||||| || || || ||||| ||||||||||| ||||||||
Sbjct: 594 cctggctttggctgttggctttctggtgtggatatcaacactcagcagagctttgaagc 652



to top

>dbj|AK151104.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830025D09 product:proteasome
           (prosome, macropain) 26S subunit, non-ATPase, 14, full
           insert sequence
          Length = 1523

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                      
Query: 358 cctggatttggttgctggctttcaggagttgacatcaatactcagcagagttttgaagc 416
           ||||| ||||| || |||||||| || || || ||||| ||||||||||| ||||||||
Sbjct: 641 cctggctttggctgttggctttctggtgtggatatcaacactcagcagagctttgaagc 699



to top

>ref|XM_627672.1| Cryptosporidium parvum Iowa II 26S proteasome-associated
           Mov34/MPN/PAD-1 family. JAB domain. (cgd6_3270), partial
           mRNA
          Length = 948

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 337 gtaggctggtaccactcgcatcctggatttggttgctggctttcagg 383
           ||||| ||||| ||||| ||||| || |||||||||||| |||||||
Sbjct: 343 gtaggatggtatcactcacatccaggttttggttgctggttttcagg 389



to top

>dbj|AK078134.1| Mus musculus adult male medulla oblongata cDNA, RIKEN full-length
           enriched library, clone:6330552E02 product:26S
           proteasome-associated pad1 homolog, full insert sequence
          Length = 1492

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                      
Query: 358 cctggatttggttgctggctttcaggagttgacatcaatactcagcagagttttgaagc 416
           ||||| ||||| || |||||||| || || || ||||| ||||||||||| ||||||||
Sbjct: 610 cctggctttggctgttggctttctggtgtggatatcaacactcagcagagctttgaagc 668



to top

>dbj|AK031863.1| Mus musculus adult male medulla oblongata cDNA, RIKEN full-length
           enriched library, clone:6330436B12 product:26S
           proteasome-associated pad1 homolog, full insert sequence
          Length = 1473

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                      
Query: 358 cctggatttggttgctggctttcaggagttgacatcaatactcagcagagttttgaagc 416
           ||||| ||||| || |||||||| || || || ||||| ||||||||||| ||||||||
Sbjct: 596 cctggctttggctgttggctttctggtgtggatatcaacactcagcagagctttgaagc 654



to top

>dbj|AK012013.1| Mus musculus 10 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2610312C03 product:26S
           proteasome-associated pad1 homolog, full insert sequence
          Length = 1407

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                      
Query: 358 cctggatttggttgctggctttcaggagttgacatcaatactcagcagagttttgaagc 416
           ||||| ||||| || |||||||| || || || ||||| ||||||||||| ||||||||
Sbjct: 589 cctggctttggctgttggctttctggtgtggatatcaacactcagcagagctttgaagc 647



to top

>dbj|AK011974.1| Mus musculus 10 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2610303K13 product:26S
           proteasome-associated pad1 homolog, full insert sequence
          Length = 1039

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                      
Query: 358 cctggatttggttgctggctttcaggagttgacatcaatactcagcagagttttgaagc 416
           ||||| ||||| || |||||||| || || || ||||| ||||||||||| ||||||||
Sbjct: 607 cctggctttggctgttggctttctggtgtggatatcaacactcagcagagctttgaagc 665



to top

>gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, complete sequence
          Length = 2914771

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 41      gcggcgcgaccgggatggggcag 63
               |||||||||||||||||||||||
Sbjct: 2173452 gcggcgcgaccgggatggggcag 2173430



to top

>emb|AL845291.5| Mouse DNA sequence from clone RP23-1O11 on chromosome 2, complete
              sequence
          Length = 209914

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                         
Query: 358    cctggatttggttgctggctttcaggagttgacatcaatactcagcagagttttgaagc 416
              ||||| ||||| || |||||||| || || || ||||| ||||||||||| ||||||||
Sbjct: 139347 cctggctttggctgttggctttctggtgtggatatcaacactcagcagagctttgaagc 139405



to top

>emb|Y13071.1|MM26SPROT Mus musculus mRNA for 26S proteasome non-ATPase subunit
          Length = 1479

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                      
Query: 358 cctggatttggttgctggctttcaggagttgacatcaatactcagcagagttttgaagc 416
           ||||| ||||| || |||||||| || || || ||||| ||||||||||| ||||||||
Sbjct: 579 cctggctttggctgttggctttctggtgtggatatcaacactcagcagagctttgaagc 637



to top

>ref|XM_567446.1| Cryptococcus neoformans var. neoformans JEC21 hypothetical protein
           (CNJ02350) partial mRNA
          Length = 1368

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                         
Query: 339 aggctggtaccactcgcatcctggatttggttgctggctttcagga 384
           ||||||||| ||||| || ||||||| ||| || ||||||||||||
Sbjct: 425 aggctggtatcactcccaccctggatatggctgttggctttcagga 470



to top

>gb|U00032.2| Caenorhabditis elegans cosmid F37A4, complete sequence
          Length = 50335

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                           
Query: 164   tggaggtgatgggcctgatgctgggcgagttcgtcgacgactacac 209
             ||||||||||||| |||||||| || || || || |||||||||||
Sbjct: 36619 tggaggtgatgggtctgatgctcggagactttgtggacgactacac 36664



to top

>emb|AJ719811.1| Gallus gallus mRNA for hypothetical protein, clone 6l21
          Length = 1481

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 164 tggaggtgatgggcctgatgctgggc 189
           ||||||||||||| ||||||||||||
Sbjct: 369 tggaggtgatggggctgatgctgggc 394



to top

>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome
          Length = 4967148

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 249     gaccggggtcagcgtcgaggcc 270
               ||||||||||||||||||||||
Sbjct: 4868853 gaccggggtcagcgtcgaggcc 4868832



to top

>ref|NM_066069.1| Caenorhabditis elegans F37A4.5 (F37A4.5) mRNA, complete cds
          Length = 960

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                         
Query: 164 tggaggtgatgggcctgatgctgggcgagttcgtcgacgactacac 209
           ||||||||||||| |||||||| || || || || |||||||||||
Sbjct: 146 tggaggtgatgggtctgatgctcggagactttgtggacgactacac 191



to top

>ref|XM_393559.2| PREDICTED: Apis mellifera similar to ENSANGP00000013055 (LOC410072),
            mRNA
          Length = 1741

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                              
Query: 328  gaaatggtggtaggctggtaccactcgcatcctggatttggttgctggct 377
            |||||||| ||||| ||||| || || ||||| ||||||||||| |||||
Sbjct: 977  gaaatggtagtaggatggtatcattctcatccaggatttggttgttggct 1026



to top

>ref|NM_001039311.1| Gallus gallus similar to 38 kDa Mov34 homolog (LOC426579), mRNA
          Length = 1481

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 164 tggaggtgatgggcctgatgctgggc 189
           ||||||||||||| ||||||||||||
Sbjct: 369 tggaggtgatggggctgatgctgggc 394



to top

>gb|AC007478.1|AC007478 Arabidopsis thaliana BAC F15A18 from chromosome V near 68.5 cM,
             complete sequence
          Length = 107931

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 64/78 (82%)
 Strand = Plus / Plus

                                                                         
Query: 324   acctgaaatggtggtaggctggtaccactcgcatcctggatttggttgctggctttcagg 383
             ||||||||||||||| || ||||| || || |||||||| ||||| |  ||||  || ||
Sbjct: 70869 acctgaaatggtggttggttggtatcattcacatcctggttttggcttttggcgctctgg 70928

                               
Query: 384   agttgacatcaatactca 401
              |||||||| ||||||||
Sbjct: 70929 ggttgacattaatactca 70946



to top

>gb|AY692755.1| Saccharomyces cerevisiae clone FLH112885.01X YFR004W gene, complete
           cds
          Length = 921

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 329 aaatggtggtaggctggtaccactcgcatcctggatttggttgctggct 377
           ||||||| || |||||||||||||| ||||| || ||||| || |||||
Sbjct: 305 aaatggtcgttggctggtaccactctcatccagggtttggctgttggct 353



to top

>ref|XM_709968.1| Candida albicans SC5314 putative 26S proteasome regulatory particle
           subunit Rpn11p (CaO19.7264), mRNA
          Length = 939

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 343 tggtaccactcgcatcctggatttggttgctgg 375
           |||||||||||||| ||||| ||||| ||||||
Sbjct: 337 tggtaccactcgcaccctgggtttgggtgctgg 369



to top

>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome
          Length = 9105828

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 190     gagttcgtcgacgactacacggtca 214
               ||||||| |||||||||||||||||
Sbjct: 1505006 gagttcggcgacgactacacggtca 1505030



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 297     gctcgacatgctcaagcaga 316
               ||||||||||||||||||||
Sbjct: 2714780 gctcgacatgctcaagcaga 2714799



to top

>emb|X79561.1|SCMTP S.cerevisiae (GRF88) mpr1 gene
          Length = 921

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 329 aaatggtggtaggctggtaccactcgcatcctggatttggttgctggct 377
           ||||||| || |||||||||||||| ||||| || ||||| || |||||
Sbjct: 305 aaatggtcgttggctggtaccactctcatccagggtttggctgttggct 353



to top

>dbj|D50617.1|YSCCHRVIN Saccharomyces cerevisiae chromosome VI complete DNA sequence
          Length = 270148

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                               
Query: 329    aaatggtggtaggctggtaccactcgcatcctggatttggttgctggct 377
              ||||||| || |||||||||||||| ||||| || ||||| || |||||
Sbjct: 153691 aaatggtcgttggctggtaccactctcatccagggtttggctgttggct 153739



to top

>gb|AY787218.1| Boletellus projectellus isolate AFTOL-ID 713 RNA polymerase II second
            largest subunit (RPB2) gene, partial cds
          Length = 2838

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 178  ctgatgctgggcgagttcgtcgac 201
            ||||||||||||||||| ||||||
Sbjct: 1337 ctgatgctgggcgagtttgtcgac 1360



to top

>ref|XM_468296.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2787

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 180 gatgctgggcgagttcgtcg 199
           ||||||||||||||||||||
Sbjct: 48  gatgctgggcgagttcgtcg 67



to top

>gb|AF488414.1| Pennisetum glaucum BAC 311G2 complete sequence
          Length = 123096

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 127   ctcaagatgctcaagcacgg 146
             ||||||||||||||||||||
Sbjct: 85404 ctcaagatgctcaagcacgg 85385



to top

>gb|AC149290.1| Solanum demissum chromosome 5 clone PGEC093P17 map MAP_LOC, complete
             sequence
          Length = 200238

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 123   cctcctcaagatgctcaagc 142
             ||||||||||||||||||||
Sbjct: 98078 cctcctcaagatgctcaagc 98097



to top

>gb|AY590263.1| Synthetic construct mutant collagen alpha 1(I) chain (Col1a1) gene,
            complete cds
          Length = 10461

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 110  tctcctccctcgccctcctc 129
            ||||||||||||||||||||
Sbjct: 3567 tctcctccctcgccctcctc 3586



to top

>gb|CP000285.1| Chromohalobacter salexigens DSM 3043, complete genome
          Length = 3696649

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 257    tcagcgtcgaggccgtcgac 276
              ||||||||||||||||||||
Sbjct: 921000 tcagcgtcgaggccgtcgac 920981



to top

>ref|XM_453441.1| Kluyveromyces lactis NRRL Y-1140, KLLA0D08503g predicted mRNA
          Length = 1122

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 340 ggctggtaccactcgcatcctggatttggttg 371
           |||||||||||||| ||||| |||| ||||||
Sbjct: 430 ggctggtaccactctcatccaggatatggttg 461



to top

>gb|CP000352.1| Ralstonia metallidurans CH34, complete genome
          Length = 3928089

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 242     agagcgggaccggggtcagcgtcgaggc 269
               |||||||| | |||||||||||||||||
Sbjct: 2800700 agagcgggtcgggggtcagcgtcgaggc 2800673



to top

>emb|X98705.1|HSCOLPDGF H.sapiens DNA sequence of COL1A1 gene fused with intron 1 of PDGFB
            gene
          Length = 16814

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 110  tctcctccctcgccctcctc 129
            ||||||||||||||||||||
Sbjct: 3757 tctcctccctcgccctcctc 3776



to top

>gb|AC015909.14| Homo sapiens chromosome 17, clone RP11-893F2, complete sequence
          Length = 217746

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 110    tctcctccctcgccctcctc 129
              ||||||||||||||||||||
Sbjct: 169206 tctcctccctcgccctcctc 169225



to top

>ref|XM_773477.1| Giardia lamblia ATCC 50803 multidrug resistance protein
           (GLP_111_4773_5777) partial mRNA
          Length = 1005

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 340 ggctggtaccactcgcatcc 359
           ||||||||||||||||||||
Sbjct: 349 ggctggtaccactcgcatcc 368



to top

>emb|AL672311.26| Human DNA sequence from clone RP13-167H21 on chromosome X, complete
              sequence
          Length = 115998

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Plus

                                              
Query: 110    tctcctccctcgccctcctcaagatgctcaag 141
              |||||||||| ||||| |||||||||||||||
Sbjct: 111999 tctcctccct-gcccttctcaagatgctcaag 112029



to top

>emb|AL135939.12| Human DNA sequence from clone RP3-481F12 on chromosome 20 Contains the
             SPO11 gene for SPO11 meiotic protein covalently bound to
             DSB (S. cerevisiae)-like protein, the 5' end of the RAE1
             gene for an mRNA export protein, an MTND1 (NADH
             dehydrogenase subunit 1) pseudogene, a RPL39 (ribosomal
             protein L39) pseudogene and a CpG island, complete
             sequence
          Length = 66033

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 52    gggatggggcagccggggac 71
             ||||||||||||||||||||
Sbjct: 11215 gggatggggcagccggggac 11234



to top

>ref|XM_970644.1| PREDICTED: Tribolium castaneum similar to CG18174-PA, transcript
           variant 2 (LOC657072), mRNA
          Length = 1075

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 160 cccatggaggtgatgggcctgatgctgggcgagttc 195
           |||||||| || |||||||||||| |||| ||||||
Sbjct: 242 cccatggaagtcatgggcctgatgttgggtgagttc 277



to top

>ref|XM_970158.1| PREDICTED: Tribolium castaneum similar to CG7453-PA, isoform A
           (LOC664144), mRNA
          Length = 612

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 188 gcgagttcgtcgacgactac 207
           ||||||||||||||||||||
Sbjct: 292 gcgagttcgtcgacgactac 311



to top

>gb|CP000088.1| Thermobifida fusca YX, complete genome
          Length = 3642249

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 195     cgtcgacgactacacggtca 214
               ||||||||||||||||||||
Sbjct: 1071675 cgtcgacgactacacggtca 1071694



to top

>emb|CR382124.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome D of strain NRRL
              Y-1140 of Kluyveromyces lactis
          Length = 1715506

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                              
Query: 340    ggctggtaccactcgcatcctggatttggttg 371
              |||||||||||||| ||||| |||| ||||||
Sbjct: 726034 ggctggtaccactctcatccaggatatggttg 726065



to top

>gb|AC097273.3| Genomic sequence for Mus musculus, clone RP23-118N13, complete sequence
          Length = 211657

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 368   gttgctggctttcaggagtt 387
             ||||||||||||||||||||
Sbjct: 98372 gttgctggctttcaggagtt 98353



to top

>gb|AC119676.2| Homo sapiens chromosome 1 clone RP5-820O16, complete sequence
          Length = 160573

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 165   ggaggtgatgggcctgatgc 184
             ||||||||||||||||||||
Sbjct: 85567 ggaggtgatgggcctgatgc 85548



to top

>ref|XM_688172.1| PREDICTED: Danio rerio similar to LOC495492 protein (LOC564849),
           mRNA
          Length = 1889

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 359 ctggatttggttgctggctttcag 382
           |||||||||| |||||||||||||
Sbjct: 575 ctggatttggctgctggctttcag 598



to top

>gb|AC154451.2| Mus musculus BAC clone RP24-171K15 from chromosome 13, complete sequence
          Length = 162744

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 389    acatcaatactcagcagagt 408
              ||||||||||||||||||||
Sbjct: 156049 acatcaatactcagcagagt 156068



to top

>gb|AC069158.6| Genomic Sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBa0049O12, from chromosome 2, complete sequence
          Length = 155154

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 180   gatgctgggcgagttcgtcg 199
             ||||||||||||||||||||
Sbjct: 61350 gatgctgggcgagttcgtcg 61369



to top

>gb|DQ366280.1| Boletellus shichianus isolate AFTOL-ID 532 RNA polymerase II second
           largest subunit (RPB2) gene, partial cds
          Length = 1066

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 178 ctgatgctgggcgagttcgtcgac 201
           ||||||||||||||||| ||||||
Sbjct: 694 ctgatgctgggcgagtttgtcgac 717



to top

>gb|DQ366279.1| Aureoboletus thibetanus isolate AFTOL-ID 450 RNA polymerase II
           second largest subunit (RPB2) gene, partial cds
          Length = 2174

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 178 ctgatgctgggcgagttcgtcgac 201
           ||||||||||||||||| ||||||
Sbjct: 712 ctgatgctgggcgagtttgtcgac 735



to top

>gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome
          Length = 4352825

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 266    aggccgtcgaccacgtcttc 285
              ||||||||||||||||||||
Sbjct: 556788 aggccgtcgaccacgtcttc 556807



to top

>gb|AF017178.2|AF017178 Homo sapiens pro alpha 1(I) collagen (COL1A1) gene, complete cds
          Length = 18609

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 110  tctcctccctcgccctcctc 129
            ||||||||||||||||||||
Sbjct: 1575 tctcctccctcgccctcctc 1594



to top

>gb|AE010299.1| Methanosarcina acetivorans str. C2A, complete genome
          Length = 5751492

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 199     gacgactacacggtcagggt 218
               ||||||||||||||||||||
Sbjct: 4135707 gacgactacacggtcagggt 4135726



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 180      gatgctgggcgagttcgtcg 199
                ||||||||||||||||||||
Sbjct: 34443849 gatgctgggcgagttcgtcg 34443830



to top

>gb|AC154541.2| Mus musculus BAC clone RP23-458N20 from chromosome 13, complete
             sequence
          Length = 174991

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 389   acatcaatactcagcagagt 408
             ||||||||||||||||||||
Sbjct: 17637 acatcaatactcagcagagt 17656



to top

>gb|AC104326.20| Mus musculus strain C57BL/6J chromosome 2 clone rp23-20g17, complete
             sequence
          Length = 232241

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 368   gttgctggctttcaggagtt 387
             ||||||||||||||||||||
Sbjct: 33081 gttgctggctttcaggagtt 33100



to top

>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome
          Length = 9025608

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 261     cgtcgaggccgtcgaccacg 280
               ||||||||||||||||||||
Sbjct: 2484802 cgtcgaggccgtcgaccacg 2484821



to top

>gb|AC099066.3| Homo sapiens chromosome 1 clone RP11-145A3, complete sequence
          Length = 149549

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 520   cttggccaggagccacggca 539
             ||||||||||||||||||||
Sbjct: 91578 cttggccaggagccacggca 91559



to top

>dbj|AP004153.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1111_C07
          Length = 115190

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 180   gatgctgggcgagttcgtcg 199
             ||||||||||||||||||||
Sbjct: 60091 gatgctgggcgagttcgtcg 60072



to top

>gb|AE015451.1| Pseudomonas putida KT2440 complete genome
          Length = 6181863

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 183     gctgggcgagttcgtcgacg 202
               ||||||||||||||||||||
Sbjct: 2679880 gctgggcgagttcgtcgacg 2679899



to top

>emb|BX927385.15| Zebrafish DNA sequence from clone DKEY-76P7 in linkage group 10, complete
              sequence
          Length = 243665

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 359    ctggatttggttgctggctttcag 382
              |||||||||| |||||||||||||
Sbjct: 189148 ctggatttggctgctggctttcag 189171



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 359    ctggatttggttgctggctttcag 382
              |||||||||| |||||||||||||
Sbjct: 147053 ctggatttggctgctggctttcag 147076



to top

>gb|M20789.1|HUMC1A1 Human, alpha 1 collagen type I gene, exons 1-25, clone RMS-8
          Length = 7616

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 110  tctcctccctcgccctcctc 129
            ||||||||||||||||||||
Sbjct: 1271 tctcctccctcgccctcctc 1290



to top

>gb|J03559.1|HUMCOLAI1A Human alpha-1 collagen type I gene, exon 1, clone pUC19-E
          Length = 2256

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 110  tctcctccctcgccctcctc 129
            ||||||||||||||||||||
Sbjct: 2075 tctcctccctcgccctcctc 2094



to top

>gb|J02829.1|HUMCG1A1P Human alpha-1(I) collagen gene, exons 1 and 2 (partial)
          Length = 1950

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 110  tctcctccctcgccctcctc 129
            ||||||||||||||||||||
Sbjct: 1519 tctcctccctcgccctcctc 1538



to top

>emb|AJ297367.1|GLA297367 Giardia lamblia mpr1 gene for non-ATPase subunit MPR1 of 26S
           proteasome
          Length = 949

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 340 ggctggtaccactcgcatcc 359
           ||||||||||||||||||||
Sbjct: 356 ggctggtaccactcgcatcc 375


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,651,080
Number of Sequences: 3902068
Number of extensions: 3651080
Number of successful extensions: 72191
Number of sequences better than 10.0: 220
Number of HSP's better than 10.0 without gapping: 218
Number of HSP's successfully gapped in prelim test: 2
Number of HSP's that attempted gapping in prelim test: 70921
Number of HSP's gapped (non-prelim): 1247
length of query: 574
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 551
effective length of database: 17,143,297,704
effective search space: 9445957034904
effective search space used: 9445957034904
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top