ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags6f05
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|NM_183744.1| Oryza sativa (japonica cultivar-group), predic... 76 1e-10
2dbj|AK070437.1| Oryza sativa (japonica cultivar-group) cDNA clon... 76 1e-10
3dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 54 5e-04
4dbj|AP003921.3| Oryza sativa (japonica cultivar-group) genomic D... 54 5e-04
5gb|AY144442.1| Sorghum bicolor BAC 95A23/98N8.1 Rph region, part... 52 0.002
6emb|BX017755.1|CNS08LV3 Single read from an extremity of a full-... 46 0.11
7emb|CR932542.1|CNS0KYA8 Paramecium tetraurelia, Small GTPase rab... 42 1.8
8gb|AC137837.3| Medicago truncatula clone mth2-30e7, complete seq... 42 1.8
9emb|BX071290.1|CNS09R66 Single read from an extremity of a full-... 42 1.8
10emb|BX069739.1|CNS09PZ3 Single read from an extremity of a full-... 42 1.8
11emb|BX066824.1|CNS09NQ4 Single read from an extremity of a full-... 42 1.8
12emb|BX060326.1|CNS09IPM Single read from an extremity of a full-... 42 1.8
13emb|BX059475.1|CNS09I1Z Single read from an extremity of a full-... 42 1.8
14emb|BX059081.1|CNS09HR1 Single read from an extremity of a full-... 42 1.8
15emb|BX052952.1|CNS09D0S Single read from an extremity of a full-... 42 1.8
16emb|BX040285.1|CNS0938X Single read from an extremity of a full-... 42 1.8
17emb|BX040284.1|CNS0938W Single read from an extremity of a full-... 42 1.8
18emb|BX031353.1|CNS08WCT Single read from an extremity of a full-... 42 1.8
19emb|BX028908.1|CNS08UGW Single read from an extremity of a full-... 42 1.8
20emb|BX025964.1|CNS08S74 Single read from an extremity of a full-... 42 1.8
21emb|BX024488.1|CNS08R24 Single read from an extremity of a full-... 42 1.8
22emb|BX023901.1|CNS08QLT Single read from an extremity of a full-... 42 1.8
23emb|BX023048.1|CNS08PY4 Single read from an extremity of a full-... 42 1.8
24emb|BX020146.1|CNS08NPI Single read from an extremity of a full-... 42 1.8
25emb|BX019960.1|CNS08NKC Single read from an extremity of a full-... 42 1.8
26emb|BX019959.1|CNS08NKB Single read from an extremity of a full-... 42 1.8
27emb|BX017776.1|CNS08LVO Single read from an extremity of a full-... 42 1.8
28emb|BX017775.1|CNS08LVN Single read from an extremity of a full-... 42 1.8
29emb|BX017759.1|CNS08LV7 Single read from an extremity of a full-... 42 1.8
30emb|BX014510.1|CNS08JCY Single read from an extremity of a full-... 42 1.8
31emb|BX014034.1|CNS08IZQ Single read from an extremity of a full-... 42 1.8
32emb|BX012176.1|CNS08HK4 Single read from an extremity of a full-... 42 1.8
33emb|BX012175.1|CNS08HK3 Single read from an extremity of a full-... 42 1.8
34emb|BX010336.1|CNS08G50 Single read from an extremity of a full-... 42 1.8
35emb|BX006820.1|CNS08DFC Single read from an extremity of a full-... 42 1.8
36emb|BX006819.1|CNS08DFB Single read from an extremity of a full-... 42 1.8
37emb|BX005860.1|CNS08COO Single read from an extremity of a full-... 42 1.8
38gb|AC153460.22| Medicago truncatula clone mth2-76i7, complete se... 42 1.8
39ref|XM_320351.2| Anopheles gambiae str. PEST ENSANGP00000014046 ... 42 1.8
40gb|AE017261.1| Picrophilus torridus DSM 9790, complete genome 40 7.1
41gb|AC157900.3| Mus musculus chromosome 18, clone RP23-10A11, com... 40 7.1
42gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome 40 7.1
43gb|AC107759.18| Mus musculus chromosome 5, clone RP23-193N17, co... 40 7.1
44gb|AC069562.51| Mus musculus strain C57BL/6J clone rp23-317e13 m... 40 7.1
45gb|AC129805.7| Homo sapiens 12 BAC RP11-125N22 (Roswell Park Can... 40 7.1
46emb|BX890571.10| Zebrafish DNA sequence from clone CH211-57F7, c... 40 7.1
47gb|AC022721.9| Homo sapiens, clone RP11-191H13, complete sequence 40 7.1
48gb|AC015820.10| Homo sapiens chromosome 11, clone RP11-108G3, co... 40 7.1
49gb|AY639900.1| Mycoplasma synoviae VlhA (vlhA) gene, partial cds... 40 7.1
50gb|AC080004.12| Homo sapiens 3q BAC RP11-307O15 (Roswell Park Ca... 40 7.1
51gb|AF090689.1|AF090689 Mycoplasma synoviae phase-variable hemagg... 40 7.1
52emb|BX784036.6| Zebrafish DNA sequence from clone CH211-223P14 i... 40 7.1
53gb|AC019211.6| Homo sapiens BAC clone RP11-454J11 from 2, comple... 40 7.1
54emb|BX248328.6| Zebrafish DNA sequence from clone CH211-202H10, ... 40 7.1
55dbj|AB180415.1| Plutella xylostella mRNA for Ribosomal protein S... 40 7.1
56emb|CR384089.24| Zebrafish DNA sequence from clone CH211-122A17 ... 40 7.1
57gb|AC153541.4| Mus musculus 10 BAC RP23-80P5 (Roswell Park Cance... 40 7.1 
>ref|NM_183744.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1488

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 88/104 (84%), Gaps = 3/104 (2%)
 Strand = Plus / Plus

                                                                       
Query: 254 ccaaatggtcatttgggagatttgtgcaaagaaaacactgacgatatcctcatagacaac 313
           |||||||||||| ||||||||||||||||||| ||   |||||   ||||||||||||| 
Sbjct: 790 ccaaatggtcatatgggagatttgtgcaaagacaatgatgacg---tcctcatagacaat 846

                                                       
Query: 314 cgaggagccaaagatgggtatcagccgtttgagaacgccaagca 357
           | || |||||| || || || ||||| |||||||||||||||||
Sbjct: 847 caagcagccaatgaaggataccagccatttgagaacgccaagca 890



 Score = 48.1 bits (24), Expect = 0.029
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                
Query: 487  tgaaaaactgccagttttgaagcatgtctactctgg 522
            ||||||||  |||| |||||||||||||||||||||
Sbjct: 1074 tgaaaaaccaccagctttgaagcatgtctactctgg 1109
to top
>dbj|AK070437.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023050F17, full
            insert sequence
          Length = 3946

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 88/104 (84%), Gaps = 3/104 (2%)
 Strand = Plus / Plus

                                                                        
Query: 254  ccaaatggtcatttgggagatttgtgcaaagaaaacactgacgatatcctcatagacaac 313
            |||||||||||| ||||||||||||||||||| ||   |||||   ||||||||||||| 
Sbjct: 3027 ccaaatggtcatatgggagatttgtgcaaagacaatgatgacg---tcctcatagacaat 3083

                                                        
Query: 314  cgaggagccaaagatgggtatcagccgtttgagaacgccaagca 357
            | || |||||| || || || ||||| |||||||||||||||||
Sbjct: 3084 caagcagccaatgaaggataccagccatttgagaacgccaagca 3127



 Score = 48.1 bits (24), Expect = 0.029
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                
Query: 487  tgaaaaactgccagttttgaagcatgtctactctgg 522
            ||||||||  |||| |||||||||||||||||||||
Sbjct: 3311 tgaaaaaccaccagctttgaagcatgtctactctgg 3346
to top
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                               
Query: 254      ccaaatggtcatttgggagatttgtgcaaag 284
                |||||||||||| ||||||||||||||||||
Sbjct: 11962933 ccaaatggtcatatgggagatttgtgcaaag 11962963



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 50/58 (86%)
 Strand = Plus / Plus

                                                                          
Query: 300      tcctcatagacaaccgaggagccaaagatgggtatcagccgtttgagaacgccaagca 357
                ||||||||||||| | || |||||| || || || ||||| |||||||||||||||||
Sbjct: 11963786 tcctcatagacaatcaagcagccaatgaaggataccagccatttgagaacgccaagca 11963843



 Score = 48.1 bits (24), Expect = 0.029
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                    
Query: 487      tgaaaaactgccagttttgaagcatgtctactctgg 522
                ||||||||  |||| |||||||||||||||||||||
Sbjct: 11964027 tgaaaaaccaccagctttgaagcatgtctactctgg 11964062
to top
>dbj|AP003921.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
            clone:P0028G04
          Length = 159761

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                           
Query: 254  ccaaatggtcatttgggagatttgtgcaaag 284
            |||||||||||| ||||||||||||||||||
Sbjct: 8597 ccaaatggtcatatgggagatttgtgcaaag 8627



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 50/58 (86%)
 Strand = Plus / Plus

                                                                      
Query: 300  tcctcatagacaaccgaggagccaaagatgggtatcagccgtttgagaacgccaagca 357
            ||||||||||||| | || |||||| || || || ||||| |||||||||||||||||
Sbjct: 9450 tcctcatagacaatcaagcagccaatgaaggataccagccatttgagaacgccaagca 9507



 Score = 48.1 bits (24), Expect = 0.029
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                
Query: 487  tgaaaaactgccagttttgaagcatgtctactctgg 522
            ||||||||  |||| |||||||||||||||||||||
Sbjct: 9691 tgaaaaaccaccagctttgaagcatgtctactctgg 9726
to top
>gb|AY144442.1| Sorghum bicolor BAC 95A23/98N8.1 Rph region, partial sequence
          Length = 268433

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                        
Query: 287    aacactgacgatatcctcatagacaa 312
              ||||||||||||||||||||||||||
Sbjct: 266390 aacactgacgatatcctcatagacaa 266365
to top
>emb|BX017755.1|CNS08LV3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA26DD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 511

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 54  aaaaagaagaagctaaacatttt 76
           |||||||||||||||||||||||
Sbjct: 488 aaaaagaagaagctaaacatttt 466
to top
>emb|CR932542.1|CNS0KYA8 Paramecium tetraurelia, Small GTPase rab, putative, complete gene
          Length = 3001

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 475 agaagtaattactgaaaaactgccagttttgaa 507
           ||||||||||  ||||||||||| |||||||||
Sbjct: 130 agaagtaatttatgaaaaactgcaagttttgaa 98
to top
>gb|AC137837.3| Medicago truncatula clone mth2-30e7, complete sequence
          Length = 79015

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 435  cagtggaagccgagaaaaatt 455
            |||||||||||||||||||||
Sbjct: 6453 cagtggaagccgagaaaaatt 6433
to top
>emb|BX071290.1|CNS09R66 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8DA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 933

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 54  aaaaagaagaagctaaacatt 74
           |||||||||||||||||||||
Sbjct: 766 aaaaagaagaagctaaacatt 786
to top
>emb|BX069739.1|CNS09PZ3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6CB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 857

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 54  aaaaagaagaagctaaacatt 74
           |||||||||||||||||||||
Sbjct: 469 aaaaagaagaagctaaacatt 449
to top
>emb|BX066824.1|CNS09NQ4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50BA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 992

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 54  aaaaagaagaagctaaacatt 74
           |||||||||||||||||||||
Sbjct: 694 aaaaagaagaagctaaacatt 714
to top
>emb|BX060326.1|CNS09IPM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40CF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 971

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 54  aaaaagaagaagctaaacatt 74
           |||||||||||||||||||||
Sbjct: 814 aaaaagaagaagctaaacatt 834
to top
>emb|BX059475.1|CNS09I1Z Single read from an extremity of a full-length cDNA clone made
          from Anopheles gambiae total adult females. 5-PRIME end
          of clone FK0AAC4BD02 of strain 6-9 of Anopheles gambiae
          (African malaria mosquito)
          Length = 956

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                               
Query: 54 aaaaagaagaagctaaacatt 74
          |||||||||||||||||||||
Sbjct: 25 aaaaagaagaagctaaacatt 45
to top
>emb|BX059081.1|CNS09HR1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39DB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 963

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 54  aaaaagaagaagctaaacatt 74
           |||||||||||||||||||||
Sbjct: 703 aaaaagaagaagctaaacatt 723
to top
>emb|BX052952.1|CNS09D0S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30BD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 983

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 54  aaaaagaagaagctaaacatt 74
           |||||||||||||||||||||
Sbjct: 737 aaaaagaagaagctaaacatt 757
to top
>emb|BX040285.1|CNS0938X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC11AB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 932

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 54  aaaaagaagaagctaaacatt 74
           |||||||||||||||||||||
Sbjct: 495 aaaaagaagaagctaaacatt 475
to top
>emb|BX040284.1|CNS0938W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC11AB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 954

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 54  aaaaagaagaagctaaacatt 74
           |||||||||||||||||||||
Sbjct: 725 aaaaagaagaagctaaacatt 745
to top
>emb|BX031353.1|CNS08WCT Single read from an extremity of a full-length cDNA clone made
          from Anopheles gambiae total adult females. 5-PRIME end
          of clone FK0AAA46DA11 of strain 6-9 of Anopheles
          gambiae (African malaria mosquito)
          Length = 1008

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                               
Query: 54 aaaaagaagaagctaaacatt 74
          |||||||||||||||||||||
Sbjct: 60 aaaaagaagaagctaaacatt 80
to top
>emb|BX028908.1|CNS08UGW Single read from an extremity of a full-length cDNA clone made
          from Anopheles gambiae total adult females. 5-PRIME end
          of clone FK0AAA43AH01 of strain 6-9 of Anopheles
          gambiae (African malaria mosquito)
          Length = 1037

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                               
Query: 54 aaaaagaagaagctaaacatt 74
          |||||||||||||||||||||
Sbjct: 57 aaaaagaagaagctaaacatt 77
to top
>emb|BX025964.1|CNS08S74 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA4AB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 950

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 54  aaaaagaagaagctaaacatt 74
           |||||||||||||||||||||
Sbjct: 694 aaaaagaagaagctaaacatt 714
to top
>emb|BX024488.1|CNS08R24 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA37BD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 419

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 54  aaaaagaagaagctaaacatt 74
           |||||||||||||||||||||
Sbjct: 337 aaaaagaagaagctaaacatt 317
to top
>emb|BX023901.1|CNS08QLT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA36BH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 913

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 54  aaaaagaagaagctaaacatt 74
           |||||||||||||||||||||
Sbjct: 779 aaaaagaagaagctaaacatt 799
to top
>emb|BX023048.1|CNS08PY4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA35BA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 821

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 54  aaaaagaagaagctaaacatt 74
           |||||||||||||||||||||
Sbjct: 723 aaaaagaagaagctaaacatt 743
to top
>emb|BX020146.1|CNS08NPI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA3CG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 960

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 54  aaaaagaagaagctaaacatt 74
           |||||||||||||||||||||
Sbjct: 724 aaaaagaagaagctaaacatt 744
to top
>emb|BX019960.1|CNS08NKC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA3BF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 972

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 54  aaaaagaagaagctaaacatt 74
           |||||||||||||||||||||
Sbjct: 471 aaaaagaagaagctaaacatt 451
to top
>emb|BX019959.1|CNS08NKB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA3BF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1066

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 54  aaaaagaagaagctaaacatt 74
           |||||||||||||||||||||
Sbjct: 812 aaaaagaagaagctaaacatt 832
to top
>emb|BX017776.1|CNS08LVO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA26DE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 992

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 54  aaaaagaagaagctaaacatt 74
           |||||||||||||||||||||
Sbjct: 493 aaaaagaagaagctaaacatt 473
to top
>emb|BX017775.1|CNS08LVN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA26DE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 986

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 54  aaaaagaagaagctaaacatt 74
           |||||||||||||||||||||
Sbjct: 789 aaaaagaagaagctaaacatt 809
to top
>emb|BX017759.1|CNS08LV7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA26DD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 542

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 54  aaaaagaagaagctaaacatt 74
           |||||||||||||||||||||
Sbjct: 462 aaaaagaagaagctaaacatt 442
to top
>emb|BX014510.1|CNS08JCY Single read from an extremity of a full-length cDNA clone made
          from Anopheles gambiae total adult females. 5-PRIME end
          of clone FK0AAA21DD01 of strain 6-9 of Anopheles
          gambiae (African malaria mosquito)
          Length = 981

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                               
Query: 54 aaaaagaagaagctaaacatt 74
          |||||||||||||||||||||
Sbjct: 58 aaaaagaagaagctaaacatt 78
to top
>emb|BX014034.1|CNS08IZQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA21AC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 726

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 54  aaaaagaagaagctaaacatt 74
           |||||||||||||||||||||
Sbjct: 139 aaaaagaagaagctaaacatt 159
to top
>emb|BX012176.1|CNS08HK4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA19BE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 890

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 54  aaaaagaagaagctaaacatt 74
           |||||||||||||||||||||
Sbjct: 426 aaaaagaagaagctaaacatt 406
to top
>emb|BX012175.1|CNS08HK3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA19BE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 944

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 54  aaaaagaagaagctaaacatt 74
           |||||||||||||||||||||
Sbjct: 731 aaaaagaagaagctaaacatt 751
to top
>emb|BX010336.1|CNS08G50 Single read from an extremity of a full-length cDNA clone made
          from Anopheles gambiae total adult females. 5-PRIME end
          of clone FK0AAA16CE12 of strain 6-9 of Anopheles
          gambiae (African malaria mosquito)
          Length = 846

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                               
Query: 54 aaaaagaagaagctaaacatt 74
          |||||||||||||||||||||
Sbjct: 51 aaaaagaagaagctaaacatt 71
to top
>emb|BX006820.1|CNS08DFC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA11BH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 915

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 54  aaaaagaagaagctaaacatt 74
           |||||||||||||||||||||
Sbjct: 869 aaaaagaagaagctaaacatt 849
to top
>emb|BX006819.1|CNS08DFB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA11BH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1002

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 54  aaaaagaagaagctaaacatt 74
           |||||||||||||||||||||
Sbjct: 141 aaaaagaagaagctaaacatt 161
to top
>emb|BX005860.1|CNS08COO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA10AB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 971

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 54  aaaaagaagaagctaaacatt 74
           |||||||||||||||||||||
Sbjct: 121 aaaaagaagaagctaaacatt 141
to top
>gb|AC153460.22| Medicago truncatula clone mth2-76i7, complete sequence
          Length = 127094

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 435    cagtggaagccgagaaaaatt 455
              |||||||||||||||||||||
Sbjct: 112623 cagtggaagccgagaaaaatt 112643
to top
>ref|XM_320351.2| Anopheles gambiae str. PEST ENSANGP00000014046
           (ENSANGG00000011557), mRNA
          Length = 954

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 54  aaaaagaagaagctaaacatt 74
           |||||||||||||||||||||
Sbjct: 725 aaaaagaagaagctaaacatt 745
to top
>gb|AE017261.1| Picrophilus torridus DSM 9790, complete genome
          Length = 1545895

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 358     tccactggagaaattaccat 377
               ||||||||||||||||||||
Sbjct: 1537626 tccactggagaaattaccat 1537645
to top
>gb|AC157900.3| Mus musculus chromosome 18, clone RP23-10A11, complete sequence
          Length = 200258

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 204    ataagaaagacatcacagtg 223
              ||||||||||||||||||||
Sbjct: 147236 ataagaaagacatcacagtg 147255
to top
>gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome
          Length = 3402093

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 29      aatgatcggtatggtaagcc 48
               ||||||||||||||||||||
Sbjct: 2545421 aatgatcggtatggtaagcc 2545440
to top
>gb|AC107759.18| Mus musculus chromosome 5, clone RP23-193N17, complete sequence
          Length = 262970

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 128   agcagggcaactgattgtctaaca 151
             ||||||||||||||| ||||||||
Sbjct: 61959 agcagggcaactgatggtctaaca 61936
to top
>gb|AC069562.51| Mus musculus strain C57BL/6J clone rp23-317e13 map 13, complete sequence
          Length = 215278

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 115    cccacattgtctaagcaggg 134
              ||||||||||||||||||||
Sbjct: 105688 cccacattgtctaagcaggg 105669
to top
>gb|AC129805.7| Homo sapiens 12 BAC RP11-125N22 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 165378

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 397    taaaactgctctatcagaag 416
              ||||||||||||||||||||
Sbjct: 146293 taaaactgctctatcagaag 146274
to top
>emb|BX890571.10| Zebrafish DNA sequence from clone CH211-57F7, complete sequence
          Length = 167315

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 67    taaacattttgctggagcag 86
             ||||||||||||||||||||
Sbjct: 12508 taaacattttgctggagcag 12527
to top
>gb|AC022721.9| Homo sapiens, clone RP11-191H13, complete sequence
          Length = 164354

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 369   aattaccattgcttactgag 388
             ||||||||||||||||||||
Sbjct: 87214 aattaccattgcttactgag 87195
to top
>gb|AC015820.10| Homo sapiens chromosome 11, clone RP11-108G3, complete sequence
          Length = 165149

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 486    ctgaaaaactgccagttttg 505
              ||||||||||||||||||||
Sbjct: 146667 ctgaaaaactgccagttttg 146686
to top
>gb|AY639900.1| Mycoplasma synoviae VlhA (vlhA) gene, partial cds; and
           glyceraldehyde 3-P dehydrogenase, UvrC (uvrC), pyruvate
           dehydrogenase E1 component alpha subunit, pyruvate
           dehydrogenase E1 component beta subunit,
           dihydrolipoamide acetyltransferase, and dihydrolipoamide
           dehydrogenase genes, complete cds
          Length = 11062

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 134 gcaactgattgtctaacagaagat 157
           |||||||||| |||||||||||||
Sbjct: 459 gcaactgattttctaacagaagat 482
to top
>gb|AC080004.12| Homo sapiens 3q BAC RP11-307O15 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 206162

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 486   ctgaaaaactgccagttttg 505
             ||||||||||||||||||||
Sbjct: 50081 ctgaaaaactgccagttttg 50062
to top
>gb|AF090689.1|AF090689 Mycoplasma synoviae phase-variable hemagglutinin homolog pseudogenes
          Length = 9693

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 134  gcaactgattgtctaacagaagat 157
            |||||||||| |||||||||||||
Sbjct: 1254 gcaactgattttctaacagaagat 1277
to top
>emb|BX784036.6| Zebrafish DNA sequence from clone CH211-223P14 in linkage group 2,
              complete sequence
          Length = 162047

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 494    ctgccagttttgaagcatgt 513
              ||||||||||||||||||||
Sbjct: 128669 ctgccagttttgaagcatgt 128688
to top
>gb|AC019211.6| Homo sapiens BAC clone RP11-454J11 from 2, complete sequence
          Length = 167471

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 350   gccaagcatccactggagaa 369
             ||||||||||||||||||||
Sbjct: 11802 gccaagcatccactggagaa 11783
to top
>emb|BX248328.6| Zebrafish DNA sequence from clone CH211-202H10, complete sequence
          Length = 194853

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 494   ctgccagttttgaagcatgt 513
             ||||||||||||||||||||
Sbjct: 18365 ctgccagttttgaagcatgt 18384
to top
>dbj|AB180415.1| Plutella xylostella mRNA for Ribosomal protein S8, complete cds
          Length = 687

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 322 caaagatgggtatcagccgt 341
           ||||||||||||||||||||
Sbjct: 10  caaagatgggtatcagccgt 29
to top
>emb|CR384089.24| Zebrafish DNA sequence from clone CH211-122A17 in linkage group 19,
             complete sequence
          Length = 92630

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 361   actggagaaattaccattgc 380
             ||||||||||||||||||||
Sbjct: 65319 actggagaaattaccattgc 65338
to top
>gb|AC153541.4| Mus musculus 10 BAC RP23-80P5 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 222655

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 370    attaccattgcttactgaga 389
              ||||||||||||||||||||
Sbjct: 103323 attaccattgcttactgaga 103342


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,979,481
Number of Sequences: 3902068
Number of extensions: 4979481
Number of successful extensions: 93311
Number of sequences better than 10.0: 57
Number of HSP's better than 10.0 without gapping: 57
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 93138
Number of HSP's gapped (non-prelim): 173
length of query: 522
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 499
effective length of database: 17,143,297,704
effective search space: 8554505554296
effective search space used: 8554505554296
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top