>emb|X82548.1|HVBKIN2 H.vulgare mRNA for SNF1-related protein kinase
          Length = 1453

 Score = 77.8 bits (39), Expect = 2e-12
 Identities = 43/45 (95%)
 Strand = Plus / Plus

                                                        
Query: 2   atgcatcctcatatcatacggctttatgaggncatanatacccca 46
           ||||||||||||||||||||||||||||||| |||| ||||||||
Sbjct: 161 atgcatcctcatatcatacggctttatgaggtcatagatacccca 205

>gb|AF143743.1| Lycopersicon esculentum SNF1 (SNF1) mRNA, complete cds
          Length = 1948

 Score = 58.0 bits (29), Expect = 2e-06
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 2   atgcatcctcatatcatacggctttatgaggncata 37
           |||||||||||||| |||||||||||||||| ||||
Sbjct: 255 atgcatcctcatattatacggctttatgaggtcata 290

>gb|BT018428.1| Zea mays clone EL01N0363F09.d mRNA sequence
          Length = 1948

 Score = 54.0 bits (27), Expect = 3e-05
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                           
Query: 2    atgcatcctcatatcatacggctttatgagg 32
            |||||||||||||||||||| ||||||||||
Sbjct: 1649 atgcatcctcatatcatacgcctttatgagg 1619

>gb|AY112453.1| Zea mays CL7115_1 mRNA sequence
          Length = 1391

 Score = 54.0 bits (27), Expect = 3e-05
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 2   atgcatcctcatatcatacggctttatgagg 32
           |||||||||||||||||||| ||||||||||
Sbjct: 297 atgcatcctcatatcatacgcctttatgagg 327

>gb|BT009004.1| Triticum aestivum clone wdk2c.pk018.c16:fis, full insert mRNA
           sequence
          Length = 1899

 Score = 44.1 bits (22), Expect = 0.025
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 8   cctcatatcatacggctttatgaggncat 36
           ||||||||||| ||||||||||||| |||
Sbjct: 289 cctcatatcatccggctttatgaggtcat 317

>emb|X65605.1|HVBKIN9P H.vulgare BKIN9 gene for protein kinase, exons 1 & 2
          Length = 2735

 Score = 42.1 bits (21), Expect = 0.10
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 5    catcctcatatcatacggctttatgaggncat 36
            |||||||||||||| ||| ||||||||| |||
Sbjct: 2651 catcctcatatcatccgggtttatgaggccat 2682

>gb|AY486125.1| Zea mays SNF1-related protein kinase mRNA, complete cds
          Length = 1898

 Score = 40.1 bits (20), Expect = 0.40
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 11  catatcatacggctttatgaggncata 37
           |||||||| ||||||||||||| ||||
Sbjct: 348 catatcattcggctttatgaggtcata 374

>gb|AY107942.1| Zea mays PCO079657 mRNA sequence
          Length = 1948

 Score = 40.1 bits (20), Expect = 0.40
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 11  catatcatacggctttatgaggncata 37
           |||||||| ||||||||||||| ||||
Sbjct: 398 catatcattcggctttatgaggtcata 424

>gb|AY462018.1| Nicotiana attenuata SNF1-related protein kinase alpha subunit mRNA,
           complete cds
          Length = 1869

 Score = 38.2 bits (19), Expect = 1.6
 Identities = 28/31 (90%)
 Strand = Plus / Plus

                                          
Query: 2   atgcatcctcatatcatacggctttatgagg 32
           ||||||||||| ||||| ||||| |||||||
Sbjct: 414 atgcatcctcacatcattcggctgtatgagg 444

>emb|AJ007990.1|HVU7990 Hordeum vulgare mRNA for SnRK1-type protein kinase, partial
          Length = 1542

 Score = 38.2 bits (19), Expect = 1.6
 Identities = 27/30 (90%)
 Strand = Plus / Plus

                                         
Query: 8   cctcatatcatacggctttatgaggncata 37
           ||||||||||| ||| ||||||||| ||||
Sbjct: 232 cctcatatcatccgggtttatgaggtcata 261

>emb|Y10036.1|CSSNF1RPK C.sativus mRNA for SNF1-related protein kinase
          Length = 1778

 Score = 38.2 bits (19), Expect = 1.6
 Identities = 28/31 (90%)
 Strand = Plus / Plus

                                          
Query: 2   atgcatcctcatatcatacggctttatgagg 32
           ||||||||||| || |||||||| |||||||
Sbjct: 216 atgcatcctcacattatacggctctatgagg 246

>emb|X65604.1|HVBKIN12M H.vulgare BKIN12 mRNA for protein kinase (partial)
          Length = 1539

 Score = 38.2 bits (19), Expect = 1.6
 Identities = 27/30 (90%)
 Strand = Plus / Plus

                                         
Query: 8   cctcatatcatacggctttatgaggncata 37
           ||||||||||| ||| ||||||||| ||||
Sbjct: 232 cctcatatcatccgggtttatgaggtcata 261

>dbj|D26602.1|TOBNPK5 Tobacco mRNA for protein kinase NPK5, complete cds
          Length = 2028

 Score = 38.2 bits (19), Expect = 1.6
 Identities = 28/31 (90%)
 Strand = Plus / Plus

                                          
Query: 2   atgcatcctcatatcatacggctttatgagg 32
           ||||||||||| ||||| ||||| |||||||
Sbjct: 373 atgcatcctcacatcattcggctgtatgagg 403

>gb|AC094830.5| Rattus norvegicus 8 BAC CH230-3H18 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 237199

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                    
Query: 7      tcctcatatcatacggctttat 28
              |||||||||||||| |||||||
Sbjct: 148160 tcctcatatcatactgctttat 148139

>gb|AC116748.8| Mus musculus chromosome 9, clone RP23-80L8, complete sequence
          Length = 268886

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                    
Query: 7      tcctcatatcatacggctttat 28
              |||||||||||||| |||||||
Sbjct: 189447 tcctcatatcatacagctttat 189468

>gb|M74113.1|RYERKIN1 Secale cereale RKIN1 mRNA, complete CDS
          Length = 1809

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                        
Query: 8   cctcatatcatacggctttatgaggncat 36
           ||||||||||| ||| ||||||||| |||
Sbjct: 332 cctcatatcatccgggtttatgaggtcat 360


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 104,982
Number of Sequences: 3902068
Number of extensions: 104982
Number of successful extensions: 25502
Number of sequences better than 10.0: 16
Number of HSP's better than 10.0 without gapping: 16
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 25486
Number of HSP's gapped (non-prelim): 16
length of query: 48
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 28
effective length of database: 17,155,003,908
effective search space: 480340109424
effective search space used: 480340109424
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)