ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags6b24
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AL591167.6| Human DNA sequence from clone RP11-25O10 on chro... 44 0.079
2emb|AL356575.8| Human DNA sequence from clone RP11-340C20 on chr... 40 1.2
3gb|AY035787.1|Y035786S02 Homo sapiens propionyl-CoA carboxylase ... 40 1.2
4gb|AY486795.1| Hevea brasiliensis clone mHbCIRt140 microsatellit... 38 4.9
5ref|XM_389638.1| Gibberella zeae PH-1 chromosome 4 hypothetical ... 38 4.9
6gb|AC017007.9| Homo sapiens BAC clone RP11-119H12 from 4, comple... 38 4.9

>emb|AL591167.6| Human DNA sequence from clone RP11-25O10 on chromosome 1 Contains the
             5' end of gene KIAA0191, a pseudogene similar to part of
             eukaryotic translation elongation factor 1 gamma (EEF1G)
             and a CpG island, complete sequence
          Length = 60185

 Score = 44.1 bits (22), Expect = 0.079
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 64    aataaattgcaaatacttgaat 85
             ||||||||||||||||||||||
Sbjct: 10585 aataaattgcaaatacttgaat 10564



to top

>emb|AL356575.8| Human DNA sequence from clone RP11-340C20 on chromosome 13 Contains
             part of the PCCA gene for propionyl Coenzyme A carboxylase
             alpha polypeptide, and a ribosomal protein L15 (RPL15)
             pseudogene, complete sequence
          Length = 158527

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 64    aataaattgcaaatacttga 83
             ||||||||||||||||||||
Sbjct: 11404 aataaattgcaaatacttga 11385



to top

>gb|AY035787.1|Y035786S02 Homo sapiens propionyl-CoA carboxylase alpha polypeptide
          precursor (PCCA) gene, exon 2
          Length = 238

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 aataaattgcaaatacttga 83
          ||||||||||||||||||||
Sbjct: 62 aataaattgcaaatacttga 43



to top

>gb|AY486795.1| Hevea brasiliensis clone mHbCIRt140 microsatellite sequences
          Length = 1034

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 71  tgcaaatacttgaatgaag 89
           |||||||||||||||||||
Sbjct: 859 tgcaaatacttgaatgaag 877



to top

>ref|XM_389638.1| Gibberella zeae PH-1 chromosome 4 hypothetical protein (FG09462.1)
           partial mRNA
          Length = 2064

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 12  gaaccgtcatacaccaagg 30
           |||||||||||||||||||
Sbjct: 613 gaaccgtcatacaccaagg 631



to top

>gb|AC017007.9| Homo sapiens BAC clone RP11-119H12 from 4, complete sequence
          Length = 182805

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 49     ggtactactagttccaata 67
              |||||||||||||||||||
Sbjct: 149628 ggtactactagttccaata 149610


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 578,205
Number of Sequences: 3902068
Number of extensions: 578205
Number of successful extensions: 46366
Number of sequences better than 10.0: 6
Number of HSP's better than 10.0 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 46360
Number of HSP's gapped (non-prelim): 6
length of query: 108
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 87
effective length of database: 17,151,101,840
effective search space: 1492145860080
effective search space used: 1492145860080
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top