ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags6b18
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AF411228.1|AF411228 Hordeum vulgare ascorbate peroxidase mRNA... 801 0.0
2gb|BT009090.1| Triticum aestivum clone wkm2c.pk0002.f7:fis, full... 613 e-172
3ref|XM_479627.1| Oryza sativa (japonica cultivar-group), mRNA 398 e-108
4ref|XM_506596.1| PREDICTED Oryza sativa (japonica cultivar-group... 398 e-108
5dbj|AB053297.1| Oryza sativa (japonica cultivar-group) APXb mRNA... 398 e-108
6dbj|AK102751.1| Oryza sativa (japonica cultivar-group) cDNA clon... 398 e-108
7dbj|AK061715.1| Oryza sativa (japonica cultivar-group) cDNA clon... 398 e-108
8dbj|AB050724.1| Oryza sativa (japonica cultivar-group) APXb mRNA... 398 e-108
9dbj|AK068430.1| Oryza sativa (japonica cultivar-group) cDNA clon... 391 e-105
10emb|Z34934.1|ZMAPXG Z.mays apx gene encoding cytosolic ascorbate... 329 6e-87
11gb|AY104492.1| Zea mays PCO104002 mRNA sequence 329 6e-87
12gb|BT019024.1| Zea mays clone Contig527.F mRNA sequence 321 2e-84
13dbj|AK122175.1| Oryza sativa (japonica cultivar-group) cDNA clon... 236 7e-59
14gb|BT016458.1| Zea mays clone Contig291 mRNA sequence 234 3e-58
15ref|XM_470658.1| Oryza sativa (japonica cultivar-group), predic... 210 4e-51
16gb|AY254495.1| Oryza sativa (indica cultivar-group) ascorbate pe... 210 4e-51
17dbj|AK061841.1| Oryza sativa (japonica cultivar-group) cDNA clon... 210 4e-51
18dbj|D45423.1| Rice mRNA for ascorbate peroxidase, complete cds 210 4e-51
19emb|AJ006358.1|HVU6 Hordeum vulgare mRNA for ascorbate peroxidase 192 1e-45
20gb|AY462246.1| Rehmannia glutinosa ascorbate peroxidase (APX) mR... 182 9e-43
21emb|AJ279686.1|BPE279686 Betula pendula partial mRNA for ascorba... 182 9e-43
22gb|AF411227.1|AF411227 Hordeum vulgare ascorbate peroxidase mRNA... 176 6e-41
23gb|BT017015.1| Zea mays clone EK07D2311G04.c mRNA sequence 174 2e-40
24gb|DQ442272.1| Camellia sinensis ascorbate peroxidase mRNA, comp... 172 9e-40
25gb|AF159633.1|AF159633 Fragaria x ananassa cytosolic ascorbate p... 161 3e-36
26gb|AF159632.1|AF159632 Fragaria x ananassa cytosolic ascorbate p... 161 3e-36
27gb|AY937208.1| Rosa hybrid cultivar APX1 mRNA, partial cds 157 5e-35
28gb|AF159628.1|AF159628 Fragaria x ananassa cytosolic ascorbate p... 153 8e-34
29gb|AF159627.1|AF159627 Fragaria x ananassa cytosolic ascorbate p... 153 8e-34
30gb|L20864.1|SPIASCPER Spinacia oleracea ascorbate peroxidase mRN... 153 8e-34
31dbj|D85864.1|SPICAP Spinacia oleracea mRNA for cytosolic ascorba... 153 8e-34
32dbj|AB078599.1| Brassica oleracea BO-APX 1 mRNA for ascorbate pe... 149 1e-32
33gb|AF159631.1|AF159631 Fragaria x ananassa cytosolic ascorbate p... 145 2e-31
34gb|AF159630.1|AF159630 Fragaria x ananassa cytosolic ascorbate p... 145 2e-31
35gb|AF159629.1|AF159629 Fragaria x ananassa cytosolic ascorbate p... 145 2e-31
36gb|AF022213.1|AF022213 Fragaria x ananassa cytosolic ascorbate p... 145 2e-31
37gb|AY078080.1| Capsicum annuum putative ascorbate peroxidase mRN... 141 3e-30
38emb|X81376.1|CAYWCAP C.annuum mRNA for cytosolic ascorbate perox... 141 3e-30
39gb|DQ002888.1| Capsicum annuum cytosolic ascorbate peroxidase (A... 141 3e-30
40gb|DQ097722.1| Arachis hypogaea cytosolic ascorbate peroxidase m... 137 5e-29
41gb|AF039953.1|AF039953 Fragaria x ananassa cytosolic ascorbate p... 137 5e-29
42gb|AY974805.1| Lycopersicon esculentum ascorbate peroxidase (APX... 137 5e-29
43gb|AY206407.1| Ipomoea batatas ascorbate peroxidase mRNA, comple... 133 8e-28
44gb|DQ096287.1| Lycopersicon esculentum cytosolic ascorbate perox... 129 1e-26
45gb|AY338957.1| Cucumis sativus ascorbate peroxidase (apox) mRNA,... 129 1e-26
46emb|X78452.1|RSAPX R.sativus (Fakir) APX mRNA for L-ascorbate pe... 129 1e-26
47dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 129 1e-26
48dbj|AP005199.3| Oryza sativa (japonica cultivar-group) genomic D... 129 1e-26
49dbj|D88649.1| Cucumis sativus mRNA for cytosolic ascorbate perox... 129 1e-26
50emb|X62077.1|PSAPXI P.sativum ApxI mRNA for ascorbate peroxidase 127 5e-26
51gb|AF540556.1| Brassica juncea clone APX 8A ascorbate peroxidase... 125 2e-25
52gb|AY485994.1| Pinus pinaster ascorbate peroxidase (csApx) mRNA,... 119 1e-23
53gb|U15933.1|NTU15933 Nicotiana tabacum ascorbate peroxidase (APX... 119 1e-23
54dbj|D85912.1|TOBTCAP Nicotiana tabacum mRNA for cytosolic ascorb... 119 1e-23
55gb|AF540557.1| Brassica juncea clone APX 6A ascorbate peroxidase... 117 5e-23
56emb|Y11461.1|BN11461 B.napus mRNA for ascorbate peroxidase 117 5e-23
57dbj|D25238.1|RICSS622CC Oryza sativa SS622 mRNA for ascorbate pe... 113 7e-22
58dbj|AB078600.1| Brassica oleracea BO-APX 2 mRNA for ascorbate pe... 109 1e-20
59emb|AJ698922.1| Populus euramericana partial mRNA for putative a... 107 4e-20
60gb|AF457210.1| Hevea brasiliensis ascorbate peroxidase (APX) mRN... 105 2e-19
61gb|DQ222519.1| Solanum tuberosum clone 121A05 ascorbate peroxida... 103 7e-19
62dbj|AB041343.1| Solanum tuberosum APx mRNA for ascorbate peroxid... 103 7e-19
63gb|AY823545.1| Pennisetum glaucum ascorbate peroxidase (Apx) mRN... 100 1e-17
64dbj|AB254809.1| Cryptomeria japonica mRNA for putative ascorbate... 98 4e-17
65dbj|AB024991.1| Cicer arietinum mRNA for ascorbate peroxidase, p... 96 2e-16
66ref|NM_179276.1| Arabidopsis thaliana APX1; L-ascorbate peroxida... 92 3e-15
67ref|NM_202057.1| Arabidopsis thaliana APX1; L-ascorbate peroxida... 92 3e-15
68ref|NM_100663.2| Arabidopsis thaliana APX1; L-ascorbate peroxida... 92 3e-15
69ref|NM_001035915.1| Arabidopsis thaliana APX1; L-ascorbate perox... 92 3e-15
70emb|X59600.1|ATASCOR A.thaliana mRNA for ascorbate peroxidase 92 3e-15
71gb|AY094002.1| Arabidopsis thaliana At1g07890/F24B9_2 mRNA, comp... 92 3e-15
72gb|AY056395.1| Arabidopsis thaliana At1g07890/F24B9_2 mRNA, comp... 92 3e-15
73gb|AY039879.1| Arabidopsis thaliana At1g07890/F24B9_2 mRNA, comp... 92 3e-15
74emb|BX816429.1|CNS0ABNP Arabidopsis thaliana Full-length cDNA Co... 92 3e-15
75emb|BX815448.1|CNS0AE8X Arabidopsis thaliana Full-length cDNA Co... 92 3e-15
76emb|BX813944.1|CNS0AEB8 Arabidopsis thaliana Full-length cDNA Co... 92 3e-15
77emb|BX815850.1|CNS0ABNN Arabidopsis thaliana Full-length cDNA Co... 92 3e-15
78emb|BX813948.1|CNS0ACBX Arabidopsis thaliana Full-length cDNA Co... 92 3e-15
79emb|BX816810.1|CNS0ABP3 Arabidopsis thaliana Full-length cDNA Co... 92 3e-15
80emb|BX815009.1|CNS0ABC3 Arabidopsis thaliana Full-length cDNA Co... 92 3e-15
81emb|BX841772.1|CNS09Y65 Arabidopsis thaliana Full-length cDNA Co... 92 3e-15
82gb|AY086425.1| Arabidopsis thaliana clone 25057 mRNA, complete s... 92 3e-15
83dbj|AB082931.1| Glycine max apx1 mRNA for cytosolic ascorbate pe... 92 3e-15
84dbj|AB082930.1| Glycine max apx1 mRNA for cytosolic ascorbate pe... 92 3e-15
85gb|L10292.1|SOYASCPER Soybean ascorbate peroxidase mRNA, complet... 92 3e-15
86gb|DQ096286.1| Lycopersicon esculentum cytosolic ascorbate perox... 90 1e-14
87gb|DQ004738.1| Phaseolus lunatus ascorbate peroxidase (AP1) mRNA... 86 2e-13
88emb|BX815873.1|CNS0ABWS Arabidopsis thaliana Full-length cDNA Co... 86 2e-13
89gb|AY306210.1| Citrullus lanatus ascorbate peroxidase (APX) mRNA... 84 6e-13
90emb|BX814227.1|CNS0AC1P Arabidopsis thaliana Full-length cDNA Co... 84 6e-13
91emb|BX817157.1|CNS0ABKO Arabidopsis thaliana Full-length cDNA Co... 84 6e-13
92gb|AF378131.1|AF378131 Zantedeschia aethiopica ascorbate peroxid... 82 2e-12
93gb|AF281082.1|AF281082 Astragalus membranaceus ascorbate peroxid... 82 2e-12
94emb|Z17398.1|DCORFA Daucus carota mRNA for unknown protein 76 2e-10
95gb|AY148472.1| Retama raetam cytosolic ascorbate peroxidase mRNA... 74 6e-10
96ref|NM_001035914.1| Arabidopsis thaliana APX1; L-ascorbate perox... 72 2e-09
97gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 70 9e-09
98emb|AJ971947.1| Pinus pinea partial mRNA for cytosolic ascorbate... 70 9e-09
99dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 70 9e-09
100gb|AC134232.2| Oryza sativa (japonica cultivar-group) chromosome... 70 9e-09
101gb|AF159380.1|AF159380 Pimpinella brachycarpa ascorbate peroxida... 68 4e-08
102gb|AY054988.1| Medicago sativa ascorbate peroxidase mRNA, partia... 66 1e-07
103gb|AY034893.1| Suaeda maritima subsp. salsa cytosolic ascorbate ... 66 1e-07
104gb|AF038839.1| Brassica juncea ascorbate peroxidase mRNA, comple... 66 1e-07
105gb|AY831398.2| Dimocarpus longan cytosolic ascorbate peroxidase ... 64 6e-07
106gb|AY832500.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 64 6e-07
107gb|AY832499.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 64 6e-07
108gb|AY832498.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 64 6e-07
109gb|AY832497.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 64 6e-07
110gb|AY832496.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 64 6e-07
111gb|AY832495.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 64 6e-07
112gb|AY832494.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 64 6e-07
113gb|AY832493.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 64 6e-07
114gb|AY832492.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 64 6e-07
115gb|AY832491.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 64 6e-07
116gb|AY832490.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 64 6e-07
117gb|AY832489.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 64 6e-07
118gb|AY832488.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 64 6e-07
119gb|AY832487.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 64 6e-07
120gb|AY832486.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 64 6e-07
121gb|AY832485.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 64 6e-07
122gb|AY832484.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 64 6e-07
123gb|AY832483.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 64 6e-07
124gb|AY832482.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 64 6e-07
125gb|AY832481.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 64 6e-07
126gb|AY832480.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 64 6e-07
127gb|AY832479.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 64 6e-07
128gb|AY832478.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 64 6e-07
129gb|AY832477.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 64 6e-07
130gb|AY832476.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 64 6e-07
131gb|AY832475.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 64 6e-07
132gb|AY832474.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 64 6e-07
133gb|AY832473.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 64 6e-07
134emb|AJ489279.1|CSA489279 Crocus sativus partial mRNA for ascorba... 64 6e-07
135gb|AF158652.2|AF158652 Fragaria x ananassa cytosolic ascorbate p... 64 6e-07
136gb|AF158654.1|AF158654 Fragaria x ananassa cytosolic ascorbate p... 64 6e-07
137gb|AF158653.1|AF158653 Fragaria x ananassa cytosolic ascorbate p... 64 6e-07
138gb|DQ246218.1| Litchi chinensis putative ascorbate peroxidase mR... 62 2e-06
139gb|M93051.1|PEAAPXIA Pisum sativum ascorbate peroxidase (ApxI) g... 62 2e-06
140gb|AF053474.1|AF053474 Zantedeschia aethiopica ascorbate peroxid... 60 9e-06
141gb|AF127804.1|AF127804 Glycine max ascorbate peroxidase (apx1) m... 58 4e-05
142gb|U56634.1|GMU56634 Glycine max ascorbate peroxidase 2 (APx2) m... 58 4e-05
143dbj|AB082932.1| Glycine max apx2 mRNA for cytosolic ascorbate pe... 58 4e-05
144dbj|AB243015.1| Codonopsis lanceolata mRNA for cytosolic ascorba... 56 1e-04
145dbj|D14442.1|ATHAPX1 Arabidopsis thaliana APX1 gene for ascorbat... 56 1e-04
146gb|AF443182.1|AF443182 Nicotiana tabacum ascorbate peroxidase mR... 56 1e-04
147gb|AY973623.1| Manihot esculenta ascorbate peroxidase APX3 mRNA,... 56 1e-04
148gb|AY973622.1| Manihot esculenta ascorbate peroxidase APX2 mRNA,... 56 1e-04
149gb|AC007583.2|F24B9 Arabidopsis thaliana chromosome 1 BAC F24B9 ... 56 1e-04
150gb|U63815.1|ATU63815 Arabidopsis thaliana AT.I.24-1, AT.I.24-2, ... 56 1e-04
151gb|DQ442396.1| Striga asiatica clone St543 ascorbate peroxidase ... 52 0.002
152ref|NM_116947.2| Arabidopsis thaliana peroxidase AT4G08770 mRNA,... 48 0.035
153gb|BT000180.1| Arabidopsis thaliana peroxidase C2 precursor-like... 48 0.035
154gb|AY136364.1| Arabidopsis thaliana peroxidase C2 precursor-like... 48 0.035
155gb|AF452387.1| Arabidopsis thaliana class III peroxidase ATP38 m... 48 0.035
156gb|AF146521.1|AF146521 Musa acuminata ascorbate peroxidase mRNA,... 48 0.035
157gb|AY742959.1| Solanum tuberosum cytosolic ascorbate peroxidase ... 46 0.14
158gb|U61379.1|VUU61379 Vigna unguiculata cytosolic ascorbate perox... 46 0.14
159gb|AC145164.11| Medicago truncatula clone mth2-27j21, complete s... 46 0.14
160gb|AC137668.18| Medicago truncatula clone mth2-5f8, complete seq... 46 0.14
161emb|Y16773.1|LEAPX Lycopersicaon esculentum APX gene, complete CDS 46 0.14
162ref|NM_111798.2| Arabidopsis thaliana APX2 (ASCORBATE PEROXIDASE... 44 0.54
163ref|NM_001035587.1| Arabidopsis thaliana APX2 (ASCORBATE PEROXID... 44 0.54
164ref|XM_517658.1| PREDICTED: Pan troglodytes similar to very larg... 44 0.54
165ref|XM_959130.1| Neurospora crassa OR74A hypothetical protein (N... 44 0.54
166ref|XM_330732.1| Neurospora crassa OR74A hypothetical protein (N... 44 0.54
167gb|DQ446651.1| Arabidopsis thaliana clone pENTR221-At3g09640 L-a... 44 0.54
168emb|AL137857.29| Human DNA sequence from clone RP5-1166H10 on ch... 44 0.54
169gb|AC157986.4| Mus musculus chromosome 19, clone RP23-160F18, co... 44 0.54
170gb|AC093529.2| Homo sapiens chromosome 5 clone RP11-29K14, compl... 44 0.54
171gb|AC027323.5| Homo sapiens chromosome 5 clone CTD-2034A10, comp... 44 0.54
172dbj|AK020572.1| Mus musculus adult male urinary bladder cDNA, RI... 44 0.54
173dbj|AK176821.1| Arabidopsis thaliana mRNA for putative ascorbate... 44 0.54
174dbj|AK176908.1| Arabidopsis thaliana mRNA for putative ascorbate... 44 0.54
175gb|AC102722.7| Mus musculus chromosome 19, clone RP24-108O16, co... 44 0.54
176ref|NM_202299.1| Arabidopsis thaliana unknown protein AT1G54575 ... 42 2.1
177gb|AY773826.1| Arabidopsis thaliana clone pENTR221-At1g54575 hyp... 42 2.1
178gb|AY735542.1| Arabidopsis thaliana hypothetical protein AT1G545... 42 2.1
179gb|BT015723.1| Arabidopsis thaliana At1g54575 gene, complete cds 42 2.1
180gb|BT015058.1| Arabidopsis thaliana At1g54575 gene, complete cds 42 2.1
181gb|AC119181.11| Mus musculus chromosome 18, clone RP24-111I16, c... 42 2.1
182gb|AC162901.4| Mus musculus BAC clone RP23-417K5 from chromosome... 42 2.1
183emb|AL355990.18| Human DNA sequence from clone RP5-1028L10 on ch... 42 2.1
184dbj|AK221685.1| Arabidopsis thaliana mRNA for hypothetical prote... 42 2.1
185gb|AC005388.1|T22H22 Sequence of BAC T22H22 from Arabidopsis tha... 42 2.1
186gb|AC019176.4|AC019176 Homo sapiens BAC clone RP11-221H10 from 8... 42 2.1
187emb|BX818219.1|CNS0AE3B Arabidopsis thaliana Full-length cDNA Co... 42 2.1
188emb|BX818269.1|CNS0AB1D Arabidopsis thaliana Full-length cDNA Co... 42 2.1
189emb|BX817787.1|CNS0AAX6 Arabidopsis thaliana Full-length cDNA Co... 42 2.1
190gb|CP000009.1| Gluconobacter oxydans 621H, complete genome 42 2.1
191emb|AL136293.5|CNS01DVX Human chromosome 14 DNA sequence BAC C-2... 42 2.1
192gb|AC124491.5| Mus musculus BAC clone RP23-454B2 from chromosome... 42 2.1
193ref|XM_608956.2| PREDICTED: Bos taurus similar to Nucleolar prer... 40 8.5
194gb|AC134560.5| Mus musculus BAC clone RP24-100B13 from chromosom... 40 8.5
195ref|XM_981494.1| PREDICTED: Mus musculus similar to Nucleolar pr... 40 8.5
196ref|XM_489612.4| PREDICTED: Mus musculus RIKEN cDNA 4921511H13 g... 40 8.5
197ref|XM_904396.2| PREDICTED: Mus musculus RIKEN cDNA 4921511H13 g... 40 8.5
198ref|XM_975719.1| PREDICTED: Mus musculus similar to AIDA-1b, tra... 40 8.5
199ref|XM_975691.1| PREDICTED: Mus musculus similar to AIDA-1b, tra... 40 8.5
200ref|XM_975823.1| PREDICTED: Mus musculus similar to AIDA-1b, tra... 40 8.5
201ref|XM_975853.1| PREDICTED: Mus musculus similar to AIDA-1b, tra... 40 8.5
202ref|XM_975757.1| PREDICTED: Mus musculus similar to AIDA-1b, tra... 40 8.5
203ref|XM_975884.1| PREDICTED: Mus musculus similar to AIDA-1b, tra... 40 8.5
204ref|XM_975790.1| PREDICTED: Mus musculus similar to AIDA-1b, tra... 40 8.5
205ref|XM_975534.1| PREDICTED: Mus musculus similar to AIDA-1b, tra... 40 8.5
206ref|XM_001002918.1| PREDICTED: Mus musculus ankyrin repeat and s... 40 8.5
207ref|XM_924927.2| PREDICTED: Mus musculus ankyrin repeat and ster... 40 8.5
208ref|XM_924933.2| PREDICTED: Mus musculus ankyrin repeat and ster... 40 8.5
209ref|XM_924929.2| PREDICTED: Mus musculus ankyrin repeat and ster... 40 8.5
210ref|XM_924921.2| PREDICTED: Mus musculus ankyrin repeat and ster... 40 8.5
211ref|XM_924931.2| PREDICTED: Mus musculus ankyrin repeat and ster... 40 8.5
212ref|XM_917405.2| PREDICTED: Mus musculus ankyrin repeat and ster... 40 8.5
213ref|XM_001003427.1| PREDICTED: Mus musculus ankyrin repeat and s... 40 8.5
214ref|XM_001003423.1| PREDICTED: Mus musculus ankyrin repeat and s... 40 8.5
215ref|XM_001003446.1| PREDICTED: Mus musculus ankyrin repeat and s... 40 8.5
216ref|XM_001003440.1| PREDICTED: Mus musculus ankyrin repeat and s... 40 8.5
217ref|XM_001003432.1| PREDICTED: Mus musculus ankyrin repeat and s... 40 8.5
218ref|XM_001003455.1| PREDICTED: Mus musculus ankyrin repeat and s... 40 8.5
219ref|XM_001003434.1| PREDICTED: Mus musculus ankyrin repeat and s... 40 8.5
220ref|XM_001003400.1| PREDICTED: Mus musculus ankyrin repeat and s... 40 8.5
221emb|Z95116.1|HS57G9 Human DNA sequence from clone CTA-57G9 on ch... 40 8.5
222ref|XM_779767.1| PREDICTED: Strongylocentrotus purpuratus simila... 40 8.5
223emb|X98275.1|ATAPCYT A.thaliana mRNA for ascorbate peroxidase, c... 40 8.5
224emb|CR858482.1| Pongo pygmaeus mRNA; cDNA DKFZp469D094 (from clo... 40 8.5
225dbj|AK050735.1| Mus musculus 9 days embryo whole body cDNA, RIKE... 40 8.5
226gb|AC026437.5|AC026437 Homo sapiens chromosome 5 clone CTD-2251O... 40 8.5
227dbj|AK034224.1| Mus musculus adult male diencephalon cDNA, RIKEN... 40 8.5
228dbj|AK017495.1| Mus musculus 8 days embryo whole body cDNA, RIKE... 40 8.5
229gb|AC010491.4| Homo sapiens chromosome 5 clone CTD-2335I23, comp... 40 8.5
230gb|AC018633.2|AC018633 Homo sapiens clone UWGC:djs1 or RP11-16G1... 40 8.5
231gb|AC138719.4| Mus musculus BAC clone RP23-178O8 from 10, comple... 40 8.5
232gb|AC140410.3| Mus musculus BAC clone RP23-141J11 from 10, compl... 40 8.5
233emb|AL772259.7| Mouse DNA sequence from clone RP23-408D7 on chro... 40 8.5

>gb|AF411228.1|AF411228 Hordeum vulgare ascorbate peroxidase mRNA, complete cds
          Length = 1138

 Score =  801 bits (404), Expect = 0.0
 Identities = 411/412 (99%), Gaps = 1/412 (0%)
 Strand = Plus / Plus

                                                                       
Query: 10  aggccgtcttcctgatgccaccca-ggctctgaccacctcaggcaggtgttttccactca 68
           |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 464 aggccgtcttcctgatgccacccaaggctctgaccacctcaggcaggtgttttccactca 523

                                                                       
Query: 69  gatgggtttgagtgaccaggacattgttgctctttctggtggtcacaccctgggaagatg 128
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 524 gatgggtttgagtgaccaggacattgttgctctttctggtggtcacaccctgggaagatg 583

                                                                       
Query: 129 ccacaaggagagatctgggtttgagggagcctggaccgccaaccctttgatcttcgacaa 188
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 584 ccacaaggagagatctgggtttgagggagcctggaccgccaaccctttgatcttcgacaa 643

                                                                       
Query: 189 ctcttacttcactgagctcctgagtggggagaaggaaggtcttcttcagttgccgaccga 248
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 644 ctcttacttcactgagctcctgagtggggagaaggaaggtcttcttcagttgccgaccga 703

                                                                       
Query: 249 caaggtcctgctgactgacccggccttccgcccacttgtggacaaatatgctgcggatga 308
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 704 caaggtcctgctgactgacccggccttccgcccacttgtggacaaatatgctgcggatga 763

                                                                       
Query: 309 ggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttggattcgg 368
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 764 ggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttggattcgg 823

                                                               
Query: 369 cgaggcgtctgagggctgctgctgattcaagatcggcgcctgagggtcggta 420
           ||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 824 cgaggcgtctgagggctgctgctgattcaagatcggcgcctgagggtcggta 875



 Score =  276 bits (139), Expect = 8e-71
 Identities = 139/139 (100%)
 Strand = Plus / Plus

                                                                        
Query: 485  gcaataagaatctgtcgtcggcccagtggccatgtcatgtgtttgtctggatttggatta 544
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 922  gcaataagaatctgtcgtcggcccagtggccatgtcatgtgtttgtctggatttggatta 981

                                                                        
Query: 545  gatcggtcggtcgatggggtgttgcattgttttgcttttgacgcctcgtatcttgtgatg 604
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 982  gatcggtcggtcgatggggtgttgcattgttttgcttttgacgcctcgtatcttgtgatg 1041

                               
Query: 605  gacctgcttgtagtgtgaa 623
            |||||||||||||||||||
Sbjct: 1042 gacctgcttgtagtgtgaa 1060



to top

>gb|BT009090.1| Triticum aestivum clone wkm2c.pk0002.f7:fis, full insert mRNA
           sequence
          Length = 973

 Score =  613 bits (309), Expect = e-172
 Identities = 385/409 (94%), Gaps = 1/409 (0%)
 Strand = Plus / Plus

                                                                       
Query: 10  aggccgtcttcctgatgccaccca-ggctctgaccacctcaggcaggtgttttccactca 68
           |||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||
Sbjct: 281 aggccgtcttcctgatgctacccaaggctctgaccacctcaggcaggtgttttccactca 340

                                                                       
Query: 69  gatgggtttgagtgaccaggacattgttgctctttctggtggtcacaccctgggaagatg 128
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 341 gatgggtttgagtgaccaggacattgttgctctttctggtggtcacaccctgggaagatg 400

                                                                       
Query: 129 ccacaaggagagatctgggtttgagggagcctggaccgccaaccctttgatcttcgacaa 188
           |||||||||||| || || ||||||||||||||||| |||||||||||||||||||||||
Sbjct: 401 ccacaaggagaggtccggctttgagggagcctggactgccaaccctttgatcttcgacaa 460

                                                                       
Query: 189 ctcttacttcactgagctcctgagtggggagaaggaaggtcttcttcagttgccgaccga 248
           |||||||||||||||||||||  |||||||||||||||| ||||||||||||||||||||
Sbjct: 461 ctcttacttcactgagctcctttgtggggagaaggaaggccttcttcagttgccgaccga 520

                                                                       
Query: 249 caaggtcctgctgactgacccggccttccgcccacttgtggacaaatatgctgcggatga 308
           ||||  ||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 521 caagaccctcctgactgacccggccttccgcccacttgtggacaaatatgctgcggatga 580

                                                                       
Query: 309 ggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttggattcgg 368
           |||||| ||||||||||||||||| ||||||||||||||||| || ||| | ||||| ||
Sbjct: 581 ggatgctttctttgctgactacgctgaggcacacctcaagctatccgaattgggatttgg 640

                                                            
Query: 369 cgaggcgtctgagggctgctgctgattcaagatcggcgcctgagggtcg 417
           ||||||   |||||||||||||||||||||| ||||||||||| |||||
Sbjct: 641 cgaggctgttgagggctgctgctgattcaagctcggcgcctgaaggtcg 689



 Score =  151 bits (76), Expect = 3e-33
 Identities = 101/108 (93%), Gaps = 1/108 (0%)
 Strand = Plus / Plus

                                                                       
Query: 516 atgtcatgtgtttgtctggatttggattagatcggtcggtcgatggggtgttgcattgtt 575
           |||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||
Sbjct: 736 atgtcatgtgtttgtctggacttggattagatgggtcggtcgatggggtgttgcattgtt 795

                                                           
Query: 576 ttgcttttgacgcctcgtatcttgtgatggacctgcttgtagtgtgaa 623
           |||| ||||||||||||| ||||||||||| | |||||||||| ||||
Sbjct: 796 ttgc-tttgacgcctcgtgtcttgtgatgggcgtgcttgtagtatgaa 842



to top

>ref|XM_479627.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1110

 Score =  398 bits (201), Expect = e-108
 Identities = 319/357 (89%), Gaps = 1/357 (0%)
 Strand = Plus / Plus

                                                                       
Query: 10  aggccgtcttcctgatgccaccca-ggctctgaccacctcaggcaggtgttttccactca 68
           ||||||||||||||||||||| || || ||||||||||| |||||||| |||||  | ||
Sbjct: 463 aggccgtcttcctgatgccacacaaggttctgaccacctaaggcaggtcttttctgcgca 522

                                                                       
Query: 69  gatgggtttgagtgaccaggacattgttgctctttctggtggtcacaccctgggaagatg 128
           |||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 523 gatgggtttgagtgacaaggacatagttgctctttctggtggtcacaccctgggaagatg 582

                                                                       
Query: 129 ccacaaggagagatctgggtttgagggagcctggaccgccaaccctttgatcttcgacaa 188
           |||||||||||||||||| |||||||||||||||||  |||||||||||||||| |||||
Sbjct: 583 ccacaaggagagatctggctttgagggagcctggacgtccaaccctttgatctttgacaa 642

                                                                       
Query: 189 ctcttacttcactgagctcctgagtggggagaaggaaggtcttcttcagttgccgaccga 248
           |||||||||||| |||||  ||||||| ||||||||||| ||||||||| |||| |  ||
Sbjct: 643 ctcttacttcaccgagcttgtgagtggcgagaaggaaggccttcttcagctgccaagtga 702

                                                                       
Query: 249 caaggtcctgctgactgacccggccttccgcccacttgtggacaaatatgctgcggatga 308
           ||| | |||  || ||||||| |||||||| ||||| ||||| |||||||||||||||||
Sbjct: 703 caaagccctcatggctgacccagccttccgtccactggtggagaaatatgctgcggatga 762

                                                                    
Query: 309 ggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttggatt 365
           ||| || |||||||| || ||||||||||| |||||||||||||||||||| |||||
Sbjct: 763 ggacgccttctttgcggattacgccgaggcccacctcaagctctctgaactgggatt 819



to top

>ref|XM_506596.1| PREDICTED Oryza sativa (japonica cultivar-group), P0627E10.12 mRNA
          Length = 1392

 Score =  398 bits (201), Expect = e-108
 Identities = 319/357 (89%), Gaps = 1/357 (0%)
 Strand = Plus / Plus

                                                                       
Query: 10  aggccgtcttcctgatgccaccca-ggctctgaccacctcaggcaggtgttttccactca 68
           ||||||||||||||||||||| || || ||||||||||| |||||||| |||||  | ||
Sbjct: 459 aggccgtcttcctgatgccacacaaggttctgaccacctaaggcaggtcttttctgcgca 518

                                                                       
Query: 69  gatgggtttgagtgaccaggacattgttgctctttctggtggtcacaccctgggaagatg 128
           |||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 519 gatgggtttgagtgacaaggacatagttgctctttctggtggtcacaccctgggaagatg 578

                                                                       
Query: 129 ccacaaggagagatctgggtttgagggagcctggaccgccaaccctttgatcttcgacaa 188
           |||||||||||||||||| |||||||||||||||||  |||||||||||||||| |||||
Sbjct: 579 ccacaaggagagatctggctttgagggagcctggacgtccaaccctttgatctttgacaa 638

                                                                       
Query: 189 ctcttacttcactgagctcctgagtggggagaaggaaggtcttcttcagttgccgaccga 248
           |||||||||||| |||||  ||||||| ||||||||||| ||||||||| |||| |  ||
Sbjct: 639 ctcttacttcaccgagcttgtgagtggcgagaaggaaggccttcttcagctgccaagtga 698

                                                                       
Query: 249 caaggtcctgctgactgacccggccttccgcccacttgtggacaaatatgctgcggatga 308
           ||| | |||  || ||||||| |||||||| ||||| ||||| |||||||||||||||||
Sbjct: 699 caaagccctcatggctgacccagccttccgtccactggtggagaaatatgctgcggatga 758

                                                                    
Query: 309 ggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttggatt 365
           ||| || |||||||| || ||||||||||| |||||||||||||||||||| |||||
Sbjct: 759 ggacgccttctttgcggattacgccgaggcccacctcaagctctctgaactgggatt 815



to top

>dbj|AB053297.1| Oryza sativa (japonica cultivar-group) APXb mRNA for L-ascorbate
           peroxidase, complete cds
          Length = 1160

 Score =  398 bits (201), Expect = e-108
 Identities = 319/357 (89%), Gaps = 1/357 (0%)
 Strand = Plus / Plus

                                                                       
Query: 10  aggccgtcttcctgatgccaccca-ggctctgaccacctcaggcaggtgttttccactca 68
           ||||||||||||||||||||| || || ||||||||||| |||||||| |||||  | ||
Sbjct: 450 aggccgtcttcctgatgccacacaaggttctgaccacctaaggcaggtcttttctgcgca 509

                                                                       
Query: 69  gatgggtttgagtgaccaggacattgttgctctttctggtggtcacaccctgggaagatg 128
           |||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 510 gatgggtttgagtgacaaggacatagttgctctttctggtggtcacaccctgggaagatg 569

                                                                       
Query: 129 ccacaaggagagatctgggtttgagggagcctggaccgccaaccctttgatcttcgacaa 188
           |||||||||||||||||| |||||||||||||||||  |||||||||||||||| |||||
Sbjct: 570 ccacaaggagagatctggctttgagggagcctggacgtccaaccctttgatctttgacaa 629

                                                                       
Query: 189 ctcttacttcactgagctcctgagtggggagaaggaaggtcttcttcagttgccgaccga 248
           |||||||||||| |||||  ||||||| ||||||||||| ||||||||| |||| |  ||
Sbjct: 630 ctcttacttcaccgagcttgtgagtggcgagaaggaaggccttcttcagctgccaagtga 689

                                                                       
Query: 249 caaggtcctgctgactgacccggccttccgcccacttgtggacaaatatgctgcggatga 308
           ||| | |||  || ||||||| |||||||| ||||| ||||| |||||||||||||||||
Sbjct: 690 caaagccctcatggctgacccagccttccgtccactggtggagaaatatgctgcggatga 749

                                                                    
Query: 309 ggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttggatt 365
           ||| || |||||||| || ||||||||||| |||||||||||||||||||| |||||
Sbjct: 750 ggacgccttctttgcggattacgccgaggcccacctcaagctctctgaactgggatt 806



to top

>dbj|AK102751.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033106K23, full
           insert sequence
          Length = 2215

 Score =  398 bits (201), Expect = e-108
 Identities = 319/357 (89%), Gaps = 1/357 (0%)
 Strand = Plus / Plus

                                                                       
Query: 10  aggccgtcttcctgatgccaccca-ggctctgaccacctcaggcaggtgttttccactca 68
           ||||||||||||||||||||| || || ||||||||||| |||||||| |||||  | ||
Sbjct: 463 aggccgtcttcctgatgccacacaaggttctgaccacctaaggcaggtcttttctgcgca 522

                                                                       
Query: 69  gatgggtttgagtgaccaggacattgttgctctttctggtggtcacaccctgggaagatg 128
           |||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 523 gatgggtttgagtgacaaggacatagttgctctttctggtggtcacaccctgggaagatg 582

                                                                       
Query: 129 ccacaaggagagatctgggtttgagggagcctggaccgccaaccctttgatcttcgacaa 188
           |||||||||||||||||| |||||||||||||||||  |||||||||||||||| |||||
Sbjct: 583 ccacaaggagagatctggctttgagggagcctggacgtccaaccctttgatctttgacaa 642

                                                                       
Query: 189 ctcttacttcactgagctcctgagtggggagaaggaaggtcttcttcagttgccgaccga 248
           |||||||||||| |||||  ||||||| ||||||||||| ||||||||| |||| |  ||
Sbjct: 643 ctcttacttcaccgagcttgtgagtggcgagaaggaaggccttcttcagctgccaagtga 702

                                                                       
Query: 249 caaggtcctgctgactgacccggccttccgcccacttgtggacaaatatgctgcggatga 308
           ||| | |||  || ||||||| |||||||| ||||| ||||| |||||||||||||||||
Sbjct: 703 caaagccctcatggctgacccagccttccgtccactggtggagaaatatgctgcggatga 762

                                                                    
Query: 309 ggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttggatt 365
           ||| || |||||||| || ||||||||||| |||||||||||||||||||| |||||
Sbjct: 763 ggacgccttctttgcggattacgccgaggcccacctcaagctctctgaactgggatt 819



to top

>dbj|AK061715.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-H06, full
           insert sequence
          Length = 1110

 Score =  398 bits (201), Expect = e-108
 Identities = 319/357 (89%), Gaps = 1/357 (0%)
 Strand = Plus / Plus

                                                                       
Query: 10  aggccgtcttcctgatgccaccca-ggctctgaccacctcaggcaggtgttttccactca 68
           ||||||||||||||||||||| || || ||||||||||| |||||||| |||||  | ||
Sbjct: 463 aggccgtcttcctgatgccacacaaggttctgaccacctaaggcaggtcttttctgcgca 522

                                                                       
Query: 69  gatgggtttgagtgaccaggacattgttgctctttctggtggtcacaccctgggaagatg 128
           |||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 523 gatgggtttgagtgacaaggacatagttgctctttctggtggtcacaccctgggaagatg 582

                                                                       
Query: 129 ccacaaggagagatctgggtttgagggagcctggaccgccaaccctttgatcttcgacaa 188
           |||||||||||||||||| |||||||||||||||||  |||||||||||||||| |||||
Sbjct: 583 ccacaaggagagatctggctttgagggagcctggacgtccaaccctttgatctttgacaa 642

                                                                       
Query: 189 ctcttacttcactgagctcctgagtggggagaaggaaggtcttcttcagttgccgaccga 248
           |||||||||||| |||||  ||||||| ||||||||||| ||||||||| |||| |  ||
Sbjct: 643 ctcttacttcaccgagcttgtgagtggcgagaaggaaggccttcttcagctgccaagtga 702

                                                                       
Query: 249 caaggtcctgctgactgacccggccttccgcccacttgtggacaaatatgctgcggatga 308
           ||| | |||  || ||||||| |||||||| ||||| ||||| |||||||||||||||||
Sbjct: 703 caaagccctcatggctgacccagccttccgtccactggtggagaaatatgctgcggatga 762

                                                                    
Query: 309 ggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttggatt 365
           ||| || |||||||| || ||||||||||| |||||||||||||||||||| |||||
Sbjct: 763 ggacgccttctttgcggattacgccgaggcccacctcaagctctctgaactgggatt 819



to top

>dbj|AB050724.1| Oryza sativa (japonica cultivar-group) APXb mRNA for ascorbate
           peroxidase, complete cds
          Length = 1058

 Score =  398 bits (201), Expect = e-108
 Identities = 319/357 (89%), Gaps = 1/357 (0%)
 Strand = Plus / Plus

                                                                       
Query: 10  aggccgtcttcctgatgccaccca-ggctctgaccacctcaggcaggtgttttccactca 68
           ||||||||||||||||||||| || || ||||||||||| |||||||| |||||  | ||
Sbjct: 445 aggccgtcttcctgatgccacacaaggttctgaccacctaaggcaggtcttttctgcgca 504

                                                                       
Query: 69  gatgggtttgagtgaccaggacattgttgctctttctggtggtcacaccctgggaagatg 128
           |||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 505 gatgggtttgagtgacaaggacatagttgctctttctggtggtcacaccctgggaagatg 564

                                                                       
Query: 129 ccacaaggagagatctgggtttgagggagcctggaccgccaaccctttgatcttcgacaa 188
           |||||||||||||||||| |||||||||||||||||  |||||||||||||||| |||||
Sbjct: 565 ccacaaggagagatctggctttgagggagcctggacgtccaaccctttgatctttgacaa 624

                                                                       
Query: 189 ctcttacttcactgagctcctgagtggggagaaggaaggtcttcttcagttgccgaccga 248
           |||||||||||| |||||  ||||||| ||||||||||| ||||||||| |||| |  ||
Sbjct: 625 ctcttacttcaccgagcttgtgagtggcgagaaggaaggccttcttcagctgccaagtga 684

                                                                       
Query: 249 caaggtcctgctgactgacccggccttccgcccacttgtggacaaatatgctgcggatga 308
           ||| | |||  || ||||||| |||||||| ||||| ||||| |||||||||||||||||
Sbjct: 685 caaagccctcatggctgacccagccttccgtccactggtggagaaatatgctgcggatga 744

                                                                    
Query: 309 ggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttggatt 365
           ||| || |||||||| || ||||||||||| |||||||||||||||||||| |||||
Sbjct: 745 ggacgccttctttgcggattacgccgaggcccacctcaagctctctgaactgggatt 801



to top

>dbj|AK068430.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013156P11, full
           insert sequence
          Length = 1393

 Score =  391 bits (197), Expect = e-105
 Identities = 318/357 (89%), Gaps = 1/357 (0%)
 Strand = Plus / Plus

                                                                       
Query: 10  aggccgtcttcctgatgccaccca-ggctctgaccacctcaggcaggtgttttccactca 68
           ||||||||||||||||||||| || || ||||||||||| |||||||| |||||  | ||
Sbjct: 459 aggccgtcttcctgatgccacacaaggttctgaccacctaaggcaggtcttttctgcgca 518

                                                                       
Query: 69  gatgggtttgagtgaccaggacattgttgctctttctggtggtcacaccctgggaagatg 128
           |||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 519 gatgggtttgagtgacaaggacatagttgctctttctggtggtcacaccctgggaagatg 578

                                                                       
Query: 129 ccacaaggagagatctgggtttgagggagcctggaccgccaaccctttgatcttcgacaa 188
           |||||||||||||||||| |||||||||||||||||  ||| |||||||||||| |||||
Sbjct: 579 ccacaaggagagatctggctttgagggagcctggacgtccatccctttgatctttgacaa 638

                                                                       
Query: 189 ctcttacttcactgagctcctgagtggggagaaggaaggtcttcttcagttgccgaccga 248
           |||||||||||| |||||  ||||||| ||||||||||| ||||||||| |||| |  ||
Sbjct: 639 ctcttacttcaccgagcttgtgagtggcgagaaggaaggccttcttcagctgccaagtga 698

                                                                       
Query: 249 caaggtcctgctgactgacccggccttccgcccacttgtggacaaatatgctgcggatga 308
           ||| | |||  || ||||||| |||||||| ||||| ||||| |||||||||||||||||
Sbjct: 699 caaagccctcatggctgacccagccttccgtccactggtggagaaatatgctgcggatga 758

                                                                    
Query: 309 ggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttggatt 365
           ||| || |||||||| || ||||||||||| |||||||||||||||||||| |||||
Sbjct: 759 ggacgccttctttgcggattacgccgaggcccacctcaagctctctgaactgggatt 815



to top

>emb|Z34934.1|ZMAPXG Z.mays apx gene encoding cytosolic ascorbate peroxidase
          Length = 1042

 Score =  329 bits (166), Expect = 6e-87
 Identities = 299/342 (87%), Gaps = 1/342 (0%)
 Strand = Plus / Plus

                                                                       
Query: 10  aggccgtcttcctgatgccaccca-ggctctgaccacctcaggcaggtgttttccactca 68
           |||||| ||||||||||||||||| || ||||| |||||||||||||| || ||||| ||
Sbjct: 455 aggccgccttcctgatgccacccaaggttctgatcacctcaggcaggttttctccacaca 514

                                                                       
Query: 69  gatgggtttgagtgaccaggacattgttgctctttctggtggtcacaccctgggaagatg 128
           |||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 515 gatgggtttgagcgaccaggacattgttgcgctttctggtggtcacaccctgggaagatg 574

                                                                       
Query: 129 ccacaaggagagatctgggtttgagggagcctggaccgccaaccctttgatcttcgacaa 188
           ||||||||| || ||||| |||||||||||||||||  |||||||||||||||| |||||
Sbjct: 575 ccacaaggacaggtctggatttgagggagcctggacgtccaaccctttgatctttgacaa 634

                                                                       
Query: 189 ctcttacttcactgagctcctgagtggggagaaggaaggtcttcttcagttgccgaccga 248
           |||||||||||  ||||| ||||| || ||||||||||| ||||| ||| | || |  ||
Sbjct: 635 ctcttacttcaaggagcttctgagcggagagaaggaaggccttctgcagctaccaagtga 694

                                                                       
Query: 249 caaggtcctgctgactgacccggccttccgcccacttgtggacaaatatgctgcggatga 308
           ||| | ||| ||  |||| ||  |||||||||||||||| |||||||| || ||||| ||
Sbjct: 695 caaagccctcctctctgatccatccttccgcccacttgttgacaaatacgcagcggacga 754

                                                     
Query: 309 ggatgcgttctttgctgactacgccgaggcacacctcaagct 350
           ||| || ||||||||||||||||||||||| ||||| |||||
Sbjct: 755 ggacgctttctttgctgactacgccgaggcccacctgaagct 796



to top

>gb|AY104492.1| Zea mays PCO104002 mRNA sequence
          Length = 1052

 Score =  329 bits (166), Expect = 6e-87
 Identities = 299/342 (87%), Gaps = 1/342 (0%)
 Strand = Plus / Plus

                                                                       
Query: 10  aggccgtcttcctgatgccaccca-ggctctgaccacctcaggcaggtgttttccactca 68
           |||||| ||||||||||||||||| || ||||| |||||||||||||| || ||||| ||
Sbjct: 469 aggccgccttcctgatgccacccaaggttctgatcacctcaggcaggttttctccacaca 528

                                                                       
Query: 69  gatgggtttgagtgaccaggacattgttgctctttctggtggtcacaccctgggaagatg 128
           |||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 529 gatgggtttgagcgaccaggacattgttgcgctttctggtggtcacaccctgggaagatg 588

                                                                       
Query: 129 ccacaaggagagatctgggtttgagggagcctggaccgccaaccctttgatcttcgacaa 188
           ||||||||| || ||||| |||||||||||||||||  |||||||||||||||| |||||
Sbjct: 589 ccacaaggacaggtctggatttgagggagcctggacgtccaaccctttgatctttgacaa 648

                                                                       
Query: 189 ctcttacttcactgagctcctgagtggggagaaggaaggtcttcttcagttgccgaccga 248
           |||||||||||  ||||| ||||| || ||||||||||| ||||| ||| | || |  ||
Sbjct: 649 ctcttacttcaaggagcttctgagcggagagaaggaaggccttctgcagctaccaagtga 708

                                                                       
Query: 249 caaggtcctgctgactgacccggccttccgcccacttgtggacaaatatgctgcggatga 308
           ||| | ||| ||  |||| ||  |||||||||||||||| |||||||| || ||||| ||
Sbjct: 709 caaagccctcctctctgatccatccttccgcccacttgttgacaaatacgcagcggacga 768

                                                     
Query: 309 ggatgcgttctttgctgactacgccgaggcacacctcaagct 350
           ||| || ||||||||||||||||||||||| ||||| |||||
Sbjct: 769 ggacgctttctttgctgactacgccgaggcccacctgaagct 810



to top

>gb|BT019024.1| Zea mays clone Contig527.F mRNA sequence
          Length = 854

 Score =  321 bits (162), Expect = 2e-84
 Identities = 298/342 (87%), Gaps = 1/342 (0%)
 Strand = Plus / Plus

                                                                       
Query: 10  aggccgtcttcctgatgccaccca-ggctctgaccacctcaggcaggtgttttccactca 68
           |||||| ||||||||||||||||| || ||||| |||||||||||||| || || || ||
Sbjct: 267 aggccgccttcctgatgccacccaaggttctgatcacctcaggcaggttttctcgacaca 326

                                                                       
Query: 69  gatgggtttgagtgaccaggacattgttgctctttctggtggtcacaccctgggaagatg 128
           |||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 327 gatgggtttgagcgaccaggacattgttgcgctttctggtggtcacaccctgggaagatg 386

                                                                       
Query: 129 ccacaaggagagatctgggtttgagggagcctggaccgccaaccctttgatcttcgacaa 188
           ||||||||| || |||||||||||||||||||||||  |||||||||||||||| |||||
Sbjct: 387 ccacaaggacaggtctgggtttgagggagcctggacgtccaaccctttgatctttgacaa 446

                                                                       
Query: 189 ctcttacttcactgagctcctgagtggggagaaggaaggtcttcttcagttgccgaccga 248
           |||||||||||  ||||| ||||| || ||||| ||||| ||||| ||| | || |  ||
Sbjct: 447 ctcttacttcaaggagcttctgagcggagagaaagaaggccttctgcagctaccaagtga 506

                                                                       
Query: 249 caaggtcctgctgactgacccggccttccgcccacttgtggacaaatatgctgcggatga 308
           ||| | ||| ||  |||| ||  |||||||||||||||| |||||||| || ||||| ||
Sbjct: 507 caaagccctcctctctgatccatccttccgcccacttgttgacaaatacgcagcggacga 566

                                                     
Query: 309 ggatgcgttctttgctgactacgccgaggcacacctcaagct 350
           ||| || ||||||||||||||||||||||| ||||| |||||
Sbjct: 567 ggacgctttctttgctgactacgccgaggcccacctgaagct 608



to top

>dbj|AK122175.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033148L03, full
           insert sequence
          Length = 2982

 Score =  236 bits (119), Expect = 7e-59
 Identities = 165/179 (92%), Gaps = 1/179 (0%)
 Strand = Plus / Plus

                                                                       
Query: 10  aggccgtcttcctgatgccaccca-ggctctgaccacctcaggcaggtgttttccactca 68
           ||||||||||||||||||||| || || ||||||||||| |||||||| |||||  | ||
Sbjct: 460 aggccgtcttcctgatgccacacaaggttctgaccacctaaggcaggtcttttctgcgca 519

                                                                       
Query: 69  gatgggtttgagtgaccaggacattgttgctctttctggtggtcacaccctgggaagatg 128
           |||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 520 gatgggtttgagtgacaaggacatagttgctctttctggtggtcacaccctgggaagatg 579

                                                                      
Query: 129 ccacaaggagagatctgggtttgagggagcctggaccgccaaccctttgatcttcgaca 187
           |||||||||||||||||| |||||||||||||||||  |||||||||||||||| ||||
Sbjct: 580 ccacaaggagagatctggctttgagggagcctggacgtccaaccctttgatctttgaca 638



to top

>gb|BT016458.1| Zea mays clone Contig291 mRNA sequence
          Length = 1269

 Score =  234 bits (118), Expect = 3e-58
 Identities = 293/350 (83%), Gaps = 1/350 (0%)
 Strand = Plus / Plus

                                                                       
Query: 11  ggccgtcttcctgatgccacccaggct-ctgaccacctcaggcaggtgttttccactcag 69
           ||||||||||||||||||||| ||| | |||||||||| ||||| || |||  ||  |||
Sbjct: 476 ggccgtcttcctgatgccaccaagggttctgaccacctgaggcaagtctttggcaagcag 535

                                                                       
Query: 70  atgggtttgagtgaccaggacattgttgctctttctggtggtcacaccctgggaagatgc 129
           |||||||||||||| |||||||||||||| || |||||||| |||||| ||||||| |||
Sbjct: 536 atgggtttgagtgatcaggacattgttgccctctctggtggccacaccttgggaaggtgc 595

                                                                       
Query: 130 cacaaggagagatctgggtttgagggagcctggaccgccaaccctttgatcttcgacaac 189
           ||||| ||| | ||||| |||||||| ||||||||  | ||||||||| |||| ||||||
Sbjct: 596 cacaaagagcggtctggttttgagggggcctggactacgaaccctttggtctttgacaac 655

                                                                       
Query: 190 tcttacttcactgagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgac 249
           ||||||||||  || || |||||||| || ||||| || ||||||||| | || |  |||
Sbjct: 656 tcttacttcaaggaacttctgagtggcgacaaggagggccttcttcagctcccaagtgac 715

                                                                       
Query: 250 aaggtcctgctgactgacccggccttccgcccacttgtggacaaatatgctgcggatgag 309
           || | ||||||||  ||||| | ||||||||| |||||||| ||||||||||| ||||||
Sbjct: 716 aaagccctgctgagcgaccctgtcttccgccctcttgtggagaaatatgctgcagatgag 775

                                                             
Query: 310 gatgcgttctttgctgactacgccgaggcacacctcaagctctctgaact 359
            | || ||||||| |||||||   ||||| |||||||||||||| |||||
Sbjct: 776 aaggcattctttgatgactacaaagaggcccacctcaagctctccgaact 825



to top

>ref|XM_470658.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 753

 Score =  210 bits (106), Expect = 4e-51
 Identities = 290/350 (82%), Gaps = 1/350 (0%)
 Strand = Plus / Plus

                                                                       
Query: 11  ggccgtcttcctgatgccacccaggct-ctgaccacctcaggcaggtgttttccactcag 69
           ||||||||||||||||| ||| ||| | |||||||||| |||||||| ||     | |||
Sbjct: 385 ggccgtcttcctgatgctaccaagggttctgaccacctaaggcaggtcttcggtgcgcag 444

                                                                       
Query: 70  atgggtttgagtgaccaggacattgttgctctttctggtggtcacaccctgggaagatgc 129
           ||||| |||||||| |||||||||||||| || ||||| ||||||||||||||||| |||
Sbjct: 445 atgggcttgagtgatcaggacattgttgccctctctggcggtcacaccctgggaaggtgc 504

                                                                       
Query: 130 cacaaggagagatctgggtttgagggagcctggaccgccaaccctttgatcttcgacaac 189
           |||||||| |||||||| ||||||||| | |||||    |||||| ||   || ||||||
Sbjct: 505 cacaaggaaagatctggttttgagggaccttggacaagaaaccctctgcagtttgacaac 564

                                                                       
Query: 190 tcttacttcactgagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgac 249
           ||||||||||| ||||| |||||||| || ||||| || ||||||||| | || |  |||
Sbjct: 565 tcttacttcacggagcttctgagtggtgacaaggagggccttcttcagcttcctagtgac 624

                                                                       
Query: 250 aaggtcctgctgactgacccggccttccgcccacttgtggacaaatatgctgcggatgag 309
           || | |||||||| |||||| |||||||||||||| || || ||||||||||| ||||||
Sbjct: 625 aaagccctgctgagtgaccctgccttccgcccactcgtcgagaaatatgctgcagatgag 684

                                                             
Query: 310 gatgcgttctttgctgactacgccgaggcacacctcaagctctctgaact 359
            | || |||||||  ||||||   ||||| |||||||||||||| |||||
Sbjct: 685 aaggctttctttgaagactacaaggaggcccacctcaagctctccgaact 734



to top

>gb|AY254495.1| Oryza sativa (indica cultivar-group) ascorbate peroxidase mRNA,
           complete cds
          Length = 806

 Score =  210 bits (106), Expect = 4e-51
 Identities = 290/350 (82%), Gaps = 1/350 (0%)
 Strand = Plus / Plus

                                                                       
Query: 11  ggccgtcttcctgatgccacccaggct-ctgaccacctcaggcaggtgttttccactcag 69
           ||||||||||||||||| ||| ||| | |||||||||| |||||||| ||     |||||
Sbjct: 398 ggccgtcttcctgatgctaccaagggttctgaccacctaaggcaggtcttcggtgctcag 457

                                                                       
Query: 70  atgggtttgagtgaccaggacattgttgctctttctggtggtcacaccctgggaagatgc 129
           ||||| |||||||| |||||||||||||| || ||||| ||||||||||||||||| |||
Sbjct: 458 atgggcttgagtgatcaggacattgttgccctctctggcggtcacaccctgggaaggtgc 517

                                                                       
Query: 130 cacaaggagagatctgggtttgagggagcctggaccgccaaccctttgatcttcgacaac 189
           |||||||| |||||||| ||||||||| | |||||    |||||| ||   || ||||||
Sbjct: 518 cacaaggaaagatctggttttgagggaccttggacaagaaaccctctgcagtttgacaac 577

                                                                       
Query: 190 tcttacttcactgagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgac 249
           ||||||||||| ||||| |||||||| || ||||| || ||||||||| | || |  |||
Sbjct: 578 tcttacttcacggagcttctgagtggtgacaaggagggccttcttcagcttcctagtgac 637

                                                                       
Query: 250 aaggtcctgctgactgacccggccttccgcccacttgtggacaaatatgctgcggatgag 309
           || |  ||||||| |||||| |||||||||||||| || || ||||||||||| ||||||
Sbjct: 638 aaagcactgctgagtgaccctgccttccgcccactcgtcgagaaatatgctgcagatgag 697

                                                             
Query: 310 gatgcgttctttgctgactacgccgaggcacacctcaagctctctgaact 359
            | || |||||||  ||||||   ||||| |||||||||||||| |||||
Sbjct: 698 aaggctttctttgaagactacaaggaggcccacctcaagctctccgaact 747



to top

>dbj|AK061841.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-E04, full
           insert sequence
          Length = 1070

 Score =  210 bits (106), Expect = 4e-51
 Identities = 290/350 (82%), Gaps = 1/350 (0%)
 Strand = Plus / Plus

                                                                       
Query: 11  ggccgtcttcctgatgccacccaggct-ctgaccacctcaggcaggtgttttccactcag 69
           ||||||||||||||||| ||| ||| | |||||||||| |||||||| ||     | |||
Sbjct: 450 ggccgtcttcctgatgctaccaagggttctgaccacctaaggcaggtcttcggtgcgcag 509

                                                                       
Query: 70  atgggtttgagtgaccaggacattgttgctctttctggtggtcacaccctgggaagatgc 129
           ||||| |||||||| |||||||||||||| || ||||| ||||||||||||||||| |||
Sbjct: 510 atgggcttgagtgatcaggacattgttgccctctctggcggtcacaccctgggaaggtgc 569

                                                                       
Query: 130 cacaaggagagatctgggtttgagggagcctggaccgccaaccctttgatcttcgacaac 189
           |||||||| |||||||| ||||||||| | |||||    |||||| ||   || ||||||
Sbjct: 570 cacaaggaaagatctggttttgagggaccttggacaagaaaccctctgcagtttgacaac 629

                                                                       
Query: 190 tcttacttcactgagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgac 249
           ||||||||||| ||||| |||||||| || ||||| || ||||||||| | || |  |||
Sbjct: 630 tcttacttcacggagcttctgagtggtgacaaggagggccttcttcagcttcctagtgac 689

                                                                       
Query: 250 aaggtcctgctgactgacccggccttccgcccacttgtggacaaatatgctgcggatgag 309
           || | |||||||| |||||| |||||||||||||| || || ||||||||||| ||||||
Sbjct: 690 aaagccctgctgagtgaccctgccttccgcccactcgtcgagaaatatgctgcagatgag 749

                                                             
Query: 310 gatgcgttctttgctgactacgccgaggcacacctcaagctctctgaact 359
            | || |||||||  ||||||   ||||| |||||||||||||| |||||
Sbjct: 750 aaggctttctttgaagactacaaggaggcccacctcaagctctccgaact 799



to top

>dbj|D45423.1| Rice mRNA for ascorbate peroxidase, complete cds
          Length = 983

 Score =  210 bits (106), Expect = 4e-51
 Identities = 290/350 (82%), Gaps = 1/350 (0%)
 Strand = Plus / Plus

                                                                       
Query: 11  ggccgtcttcctgatgccacccaggct-ctgaccacctcaggcaggtgttttccactcag 69
           ||||||||||||||||| ||| ||| | |||||||||| |||||||| ||     | |||
Sbjct: 424 ggccgtcttcctgatgctaccaagggttctgaccacctaaggcaggtcttcggtgcgcag 483

                                                                       
Query: 70  atgggtttgagtgaccaggacattgttgctctttctggtggtcacaccctgggaagatgc 129
           ||||| |||||||| |||||||||||||| || ||||| ||||||||||||||||| |||
Sbjct: 484 atgggcttgagtgatcaggacattgttgccctctctggcggtcacaccctgggaaggtgc 543

                                                                       
Query: 130 cacaaggagagatctgggtttgagggagcctggaccgccaaccctttgatcttcgacaac 189
           |||||||| |||||||| ||||||||| | |||||    |||||| ||   || ||||||
Sbjct: 544 cacaaggaaagatctggttttgagggaccttggacaagaaaccctctgcagtttgacaac 603

                                                                       
Query: 190 tcttacttcactgagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgac 249
           ||||||||||| ||||| |||||||| || ||||| || ||||||||| | || |  |||
Sbjct: 604 tcttacttcacggagcttctgagtggtgacaaggagggccttcttcagcttcctagtgac 663

                                                                       
Query: 250 aaggtcctgctgactgacccggccttccgcccacttgtggacaaatatgctgcggatgag 309
           || | |||||||| |||||| |||||||||||||| || || ||||||||||| ||||||
Sbjct: 664 aaagccctgctgagtgaccctgccttccgcccactcgtcgagaaatatgctgcagatgag 723

                                                             
Query: 310 gatgcgttctttgctgactacgccgaggcacacctcaagctctctgaact 359
            | || |||||||  ||||||   ||||| |||||||||||||| |||||
Sbjct: 724 aaggctttctttgaagactacaaggaggcccacctcaagctctccgaact 773



to top

>emb|AJ006358.1|HVU6 Hordeum vulgare mRNA for ascorbate peroxidase
          Length = 1050

 Score =  192 bits (97), Expect = 1e-45
 Identities = 244/293 (83%)
 Strand = Plus / Plus

                                                                       
Query: 67  cagatgggtttgagtgaccaggacattgttgctctttctggtggtcacaccctgggaaga 126
           |||||||| |||||||| ||||| |||||||| || ||||||||||||||||||||||| 
Sbjct: 515 cagatgggcttgagtgatcaggatattgttgccctctctggtggtcacaccctgggaagg 574

                                                                       
Query: 127 tgccacaaggagagatctgggtttgagggagcctggaccgccaaccctttgatcttcgac 186
           || ||||||||||| ||||| ||||||||| |||||||    ||||||||||  || |||
Sbjct: 575 tgtcacaaggagaggtctggctttgagggaccctggacaaggaaccctttgaagtttgac 634

                                                                       
Query: 187 aactcttacttcactgagctcctgagtggggagaaggaaggtcttcttcagttgccgacc 246
           |||||||||||||| |||||  ||||||| || || || || ||||||||| | || |  
Sbjct: 635 aactcttacttcacggagcttttgagtggtgacaaagagggacttcttcagcttccaagt 694

                                                                       
Query: 247 gacaaggtcctgctgactgacccggccttccgcccacttgtggacaaatatgctgcggat 306
           |||||    |||||||||||||| | ||||||||| |||||||| |||||||||||||||
Sbjct: 695 gacaaaactctgctgactgaccctgtcttccgccctcttgtggagaaatatgctgcggat 754

                                                                
Query: 307 gaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaact 359
           ||| | || ||||| |  ||||||   ||||||||||||| |||||| |||||
Sbjct: 755 gagaaggctttcttcgaggactacaaggaggcacacctcaggctctccgaact 807



to top

>gb|AY462246.1| Rehmannia glutinosa ascorbate peroxidase (APX) mRNA, complete cds
          Length = 1122

 Score =  182 bits (92), Expect = 9e-43
 Identities = 263/320 (82%)
 Strand = Plus / Plus

                                                                       
Query: 37  tctgaccacctcaggcaggtgttttccactcagatgggtttgagtgaccaggacattgtt 96
           ||||||||||| ||| | |||||| |||  || ||||||||||||||||||||||| |||
Sbjct: 543 tctgaccacctgagggatgtgtttaccaaacaaatgggtttgagtgaccaggacatcgtt 602

                                                                       
Query: 97  gctctttctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgaggga 156
           || || |||||||  ||||| ||||||||||||||||||||  | || ||||||||||||
Sbjct: 603 gcactctctggtgcccacactctgggaagatgccacaaggaacgttccgggtttgaggga 662

                                                                       
Query: 157 gcctggaccgccaaccctttgatcttcgacaactcttacttcactgagctcctgagtggg 216
            | ||||| || |||||| | ||||||||||| |||||||| |  ||||| |||||||| 
Sbjct: 663 ccatggactgcaaaccctctcatcttcgacaattcttactttaaggagcttctgagtgga 722

                                                                       
Query: 217 gagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctgactgacccggccttc 276
           || || ||||| ||| | ||||||||  | ||||| |  || ||  | |||||  | |||
Sbjct: 723 gaaaaagaagggcttttgcagttgccatcagacaaagctcttcttgccgacccttcattc 782

                                                                       
Query: 277 cgcccacttgtggacaaatatgctgcggatgaggatgcgttctttgctgactacgccgag 336
           ||||||||||| || |||||||||||||| |||||||| ||||||||||| || || |||
Sbjct: 783 cgcccacttgttgagaaatatgctgcggacgaggatgccttctttgctgattatgcagag 842

                               
Query: 337 gcacacctcaagctctctga 356
           || ||| | |||||||||||
Sbjct: 843 gctcacttgaagctctctga 862



to top

>emb|AJ279686.1|BPE279686 Betula pendula partial mRNA for ascorbate peroxidase (apx gene)
          Length = 289

 Score =  182 bits (92), Expect = 9e-43
 Identities = 206/244 (84%)
 Strand = Plus / Plus

                                                                       
Query: 79  agtgaccaggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggag 138
           |||||||||||||||||||||||||||||||  |||||||||||||| ||||||||||||
Sbjct: 44  agtgaccaggacattgttgctctttctggtgcacacaccctgggaaggtgccacaaggag 103

                                                                       
Query: 139 agatctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttc 198
            | ||||| ||||||||| |||||||  |||||||| | ||||| | |||| | ||||||
Sbjct: 104 cgttctggctttgagggaccctggacttccaaccctctcatctttggcaacacgtacttc 163

                                                                       
Query: 199 actgagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctg 258
           || || ||| ||||||| ||||||||||| ||||| ||| ||||  | |||||||  |  
Sbjct: 164 acggaactcttgagtggtgagaaggaaggacttctgcagctgccatctgacaaggcacct 223

                                                                       
Query: 259 ctgactgacccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttc 318
           ||| ||||| | || |||||||| ||||| ||||||||||| || ||||||||||| |||
Sbjct: 224 ctgtctgacgcagcattccgccctcttgttgacaaatatgccgctgatgaggatgccttc 283

               
Query: 319 tttg 322
           ||||
Sbjct: 284 tttg 287



to top

>gb|AF411227.1|AF411227 Hordeum vulgare ascorbate peroxidase mRNA, partial cds
          Length = 676

 Score =  176 bits (89), Expect = 6e-41
 Identities = 242/293 (82%)
 Strand = Plus / Plus

                                                                       
Query: 67  cagatgggtttgagtgaccaggacattgttgctctttctggtggtcacaccctgggaaga 126
           |||||||| |||||||| ||||| |||||||| || ||||||||||||||||||||||| 
Sbjct: 152 cagatgggcttgagtgatcaggatattgttgccctctctggtggtcacaccctgggaagg 211

                                                                       
Query: 127 tgccacaaggagagatctgggtttgagggagcctggaccgccaaccctttgatcttcgac 186
           || ||||||||||| ||||| ||||||||| |||||||    ||||||||||  || |||
Sbjct: 212 tgtcacaaggagaggtctggctttgagggaccctggacaaggaaccctttgaagtttgac 271

                                                                       
Query: 187 aactcttacttcactgagctcctgagtggggagaaggaaggtcttcttcagttgccgacc 246
           |||||||||||||| |||||  ||||||| || ||  | || ||||||||| | || |  
Sbjct: 272 aactcttacttcacggagcttttgagtggtgacaaaaagggacttcttcagcttccaagt 331

                                                                       
Query: 247 gacaaggtcctgctgactgacccggccttccgcccacttgtggacaaatatgctgcggat 306
           |||||    |||||||||||||| | ||||||||| |||||||| |||||||||||||||
Sbjct: 332 gacaaaactctgctgactgaccctgtcttccgccctcttgtggagaaatatgctgcggat 391

                                                                
Query: 307 gaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaact 359
           ||| | || || || |  ||||||   ||||||||||||| |||||| |||||
Sbjct: 392 gagaaggcttttttcgaggactacaaggaggcacacctcaggctctccgaact 444



to top

>gb|BT017015.1| Zea mays clone EK07D2311G04.c mRNA sequence
          Length = 1097

 Score =  174 bits (88), Expect = 2e-40
 Identities = 264/323 (81%)
 Strand = Plus / Plus

                                                                       
Query: 37  tctgaccacctcaggcaggtgttttccactcagatgggtttgagtgaccaggacattgtt 96
           ||||||||||| ||||| || |||  ||  |||||||| ||||| || ||||||||||||
Sbjct: 487 tctgaccacctgaggcaagtttttggcaagcagatgggcttgagcgatcaggacattgtt 546

                                                                       
Query: 97  gctctttctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgaggga 156
           || || |||||||| |||||| ||||||| |||||||| ||| | ||||| || ||||| 
Sbjct: 547 gccctctctggtggccacaccttgggaaggtgccacaaagagcggtctggtttcgagggg 606

                                                                       
Query: 157 gcctggaccgccaaccctttgatcttcgacaactcttacttcactgagctcctgagtggg 216
           ||||||||  | ||||||||| |||| ||||||||||||||||  || || |||||||| 
Sbjct: 607 gcctggactacaaaccctttggtctttgacaactcttacttcaaggaacttctgagtggt 666

                                                                       
Query: 217 gagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctgactgacccggccttc 276
           || ||||| || ||||||||| | || |  ||||| | |||| |||  ||||| |  |||
Sbjct: 667 gataaggagggccttcttcagctcccaagtgacaaagccctgntgagcgaccctgttttc 726

                                                                       
Query: 277 cgcccacttgtggacaaatatgctgcggatgaggatgcgttctttgctgactacgccgag 336
           ||||| ||||| || |||||||||||||||||| | || ||||||| |||||||   |||
Sbjct: 727 cgccctcttgtcgagaaatatgctgcggatgagaaggctttctttgatgactacaaagag 786

                                  
Query: 337 gcacacctcaagctctctgaact 359
           || |||||||||||||| |||||
Sbjct: 787 gcccacctcaagctctccgaact 809



to top

>gb|DQ442272.1| Camellia sinensis ascorbate peroxidase mRNA, complete cds
          Length = 1042

 Score =  172 bits (87), Expect = 9e-40
 Identities = 231/279 (82%)
 Strand = Plus / Plus

                                                                       
Query: 81  tgaccaggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagag 140
           |||| |||||||||||||||| |||||||| || ||||||||||| |||||||||||| |
Sbjct: 515 tgacaaggacattgttgctctatctggtggccataccctgggaaggtgccacaaggagcg 574

                                                                       
Query: 141 atctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcac 200
            ||||| ||||||||  ||||||| ||||| ||  | ||||| || ||||| ||||||||
Sbjct: 575 ttctggatttgaggggccctggactgccaatccactcatctttgataactcctacttcac 634

                                                                       
Query: 201 tgagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgct 260
            || ||||||| ||||||||||||||| ||||| ||  ||||  | | |||||  || ||
Sbjct: 635 ggaactcctgactggggagaaggaagggcttctacaactgccatctggcaaggctctcct 694

                                                                       
Query: 261 gactgacccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttctt 320
            | ||| || | ||||||||| ||||| || ||||||||||||||||||||||| |||||
Sbjct: 695 caatgatcctgtcttccgccctcttgttgagaaatatgctgcggatgaggatgcattctt 754

                                                  
Query: 321 tgctgactacgccgaggcacacctcaagctctctgaact 359
           ||| || || ||||| || ||| | ||||||||||||||
Sbjct: 755 tgcagattatgccgaagcccacatgaagctctctgaact 793



to top

>gb|AF159633.1|AF159633 Fragaria x ananassa cytosolic ascorbate peroxidase (APX) mRNA,
           APX26 allele, complete cds
          Length = 1035

 Score =  161 bits (81), Expect = 3e-36
 Identities = 204/245 (83%)
 Strand = Plus / Plus

                                                                       
Query: 82  gaccaggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagaga 141
           |||||||||||||||||||| ||||||||||||||| |||||||    ||||||||  | 
Sbjct: 516 gaccaggacattgttgctctctctggtggtcacaccttgggaagggcacacaaggaacgg 575

                                                                       
Query: 142 tctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcact 201
           ||||||||||| ||| |||||||  |||||||| | ||||| |||||||| || ||||||
Sbjct: 576 tctgggtttgaaggaccctggactcccaaccctcttatctttgacaactcatatttcact 635

                                                                       
Query: 202 gagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctg 261
           | |||  ||||||| ||||||||||| ||||| ||| | || ||||||||||  || |||
Sbjct: 636 gtgctgttgagtggagagaaggaaggccttctacagcttccaaccgacaaggctcttctg 695

                                                                       
Query: 262 actgacccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttcttt 321
            | ||||| | ||||||||| ||||| || ||||| ||||||||||| ||||| ||||||
Sbjct: 696 tcagaccctgtcttccgccctcttgttgagaaatacgctgcggatgaagatgctttcttt 755

                
Query: 322 gctga 326
            ||||
Sbjct: 756 tctga 760



to top

>gb|AF159632.1|AF159632 Fragaria x ananassa cytosolic ascorbate peroxidase (APX) mRNA,
           APX22 allele, complete cds
          Length = 1065

 Score =  161 bits (81), Expect = 3e-36
 Identities = 204/245 (83%)
 Strand = Plus / Plus

                                                                       
Query: 82  gaccaggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagaga 141
           |||||||||||||||||||| ||||||||||||||| |||||||    ||||||||  | 
Sbjct: 529 gaccaggacattgttgctctctctggtggtcacaccttgggaagggcacacaaggaacgg 588

                                                                       
Query: 142 tctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcact 201
           ||||||||||| ||| |||||||  |||||||| | ||||| |||||||| || ||||||
Sbjct: 589 tctgggtttgaaggaccctggactcccaaccctcttatctttgacaactcatatttcact 648

                                                                       
Query: 202 gagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctg 261
           | |||  ||||||| ||||||||||| ||||| ||| | || ||||||||||  || |||
Sbjct: 649 gtgctgttgagtggagagaaggaaggccttctacagcttccaaccgacaaggctcttctg 708

                                                                       
Query: 262 actgacccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttcttt 321
            | ||||| | ||||||||| ||||| || ||||| ||||||||||| ||||| ||||||
Sbjct: 709 tcagaccctgtcttccgccctcttgttgagaaatacgctgcggatgaagatgctttcttt 768

                
Query: 322 gctga 326
            ||||
Sbjct: 769 tctga 773



to top

>gb|AY937208.1| Rosa hybrid cultivar APX1 mRNA, partial cds
          Length = 567

 Score =  157 bits (79), Expect = 5e-35
 Identities = 190/227 (83%)
 Strand = Plus / Plus

                                                                       
Query: 82  gaccaggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagaga 141
           |||||||||||||||||||| ||||||||||||||| |||||||    ||||||||  | 
Sbjct: 340 gaccaggacattgttgctctctctggtggtcacaccttgggaagggcacacaaggaacgc 399

                                                                       
Query: 142 tctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcact 201
           ||||| ||||||||| |||||||  |||||||| | ||||| |||||||| || ||||| 
Sbjct: 400 tctggatttgagggaccctggactcccaaccctcttatctttgacaactcatatttcacg 459

                                                                       
Query: 202 gagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctg 261
           |||||  ||||||| ||||||||||||||||| ||| | || || |||||||  || |||
Sbjct: 460 gagctgttgagtggagagaaggaaggtcttctacagcttccaactgacaaggctcttctg 519

                                                          
Query: 262 actgacccggccttccgcccacttgtggacaaatatgctgcggatga 308
            | ||||| | ||||||||| ||||| || |||||||||||||||||
Sbjct: 520 tccgaccctgtcttccgccctcttgttgaaaaatatgctgcggatga 566



to top

>gb|AF159628.1|AF159628 Fragaria x ananassa cytosolic ascorbate peroxidase (APX) mRNA,
           APX44 allele, complete cds
          Length = 1040

 Score =  153 bits (77), Expect = 8e-34
 Identities = 203/245 (82%)
 Strand = Plus / Plus

                                                                       
Query: 82  gaccaggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagaga 141
           |||||||||||||||||||| ||||||||||||||| |||||||    ||||||||  | 
Sbjct: 529 gaccaggacattgttgctctctctggtggtcacaccttgggaagggcgcacaaggaacgg 588

                                                                       
Query: 142 tctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcact 201
           ||||| ||||||||| | |||||  |||||||| | ||||| |||||||| || ||||||
Sbjct: 589 tctggatttgagggaccatggactcccaaccctcttatctttgacaactcatatttcact 648

                                                                       
Query: 202 gagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctg 261
           | |||  ||||||| ||||||||||| ||||| ||| | || || |||||||  || |||
Sbjct: 649 gtgctattgagtggagagaaggaaggccttctacagcttccaactgacaaggctcttctg 708

                                                                       
Query: 262 actgacccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttcttt 321
            | ||||| | ||||||||| ||||| || ||||| ||||||||||| ||||| ||||||
Sbjct: 709 tcagaccctgtcttccgccctcttgttgagaaatacgctgcggatgaagatgctttcttt 768

                
Query: 322 gctga 326
           |||||
Sbjct: 769 gctga 773



to top

>gb|AF159627.1|AF159627 Fragaria x ananassa cytosolic ascorbate peroxidase (APX) mRNA,
           APX18 allele, complete cds
          Length = 1012

 Score =  153 bits (77), Expect = 8e-34
 Identities = 203/245 (82%)
 Strand = Plus / Plus

                                                                       
Query: 82  gaccaggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagaga 141
           |||||||||||||||||||| ||||||||||||||| |||||||    ||||||||  | 
Sbjct: 501 gaccaggacattgttgctctctctggtggtcacaccttgggaagggcgcacaaggaacgg 560

                                                                       
Query: 142 tctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcact 201
           ||||| ||||||||| | |||||  |||||||| | ||||| |||||||| || ||||||
Sbjct: 561 tctggatttgagggaccatggactcccaaccctcttatctttgacaactcatatttcact 620

                                                                       
Query: 202 gagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctg 261
           | |||  ||||||| ||||||||||| ||||| ||| | || || |||||||  || |||
Sbjct: 621 gtgctattgagtggagagaaggaaggccttctacagcttccaactgacaaggctcttctg 680

                                                                       
Query: 262 actgacccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttcttt 321
            | ||||| | ||||||||| ||||| || ||||| ||||||||||| ||||| ||||||
Sbjct: 681 tcagaccctgtcttccgccctcttgttgagaaatacgctgcggatgaagatgctttcttt 740

                
Query: 322 gctga 326
           |||||
Sbjct: 741 gctga 745



to top

>gb|L20864.1|SPIASCPER Spinacia oleracea ascorbate peroxidase mRNA, complete cds
          Length = 1069

 Score =  153 bits (77), Expect = 8e-34
 Identities = 233/285 (81%)
 Strand = Plus / Plus

                                                                       
Query: 81  tgaccaggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagag 140
           ||||||||||||||||||||| ||||| || |||||  |||| ||||||||||||||  |
Sbjct: 501 tgaccaggacattgttgctctatctggaggccacactttggggagatgccacaaggaccg 560

                                                                       
Query: 141 atctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcac 200
            ||||| ||||| || || |||||  ||||||||||| ||||||||||| | ||||||| 
Sbjct: 561 ctctggttttgaaggtgcttggactaccaaccctttggtcttcgacaacacctacttcaa 620

                                                                       
Query: 201 tgagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgct 260
            |||||||||||||| ||||| ||||||||  | ||| ||||  | |||||||  || ||
Sbjct: 621 ggagctcctgagtggtgagaaagaaggtctcttgcagctgccatctgacaaggctcttct 680

                                                                       
Query: 261 gactgacccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttctt 320
             ||||||| | |||||||||||| || || |||||||| || ||||| ||||| |||||
Sbjct: 681 ctctgaccctgtcttccgcccactggttgagaaatatgcagctgatgaagatgcattctt 740

                                                        
Query: 321 tgctgactacgccgaggcacacctcaagctctctgaacttggatt 365
           ||| ||||| || ||||| ||| | || || |||||||| |||||
Sbjct: 741 tgccgactatgctgaggcgcacttgaaactttctgaactcggatt 785



to top

>dbj|D85864.1|SPICAP Spinacia oleracea mRNA for cytosolic ascorbate peroxidase, complete
           cds
          Length = 1083

 Score =  153 bits (77), Expect = 8e-34
 Identities = 233/285 (81%)
 Strand = Plus / Plus

                                                                       
Query: 81  tgaccaggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagag 140
           ||||||||||||||||||||| ||||| || |||||  |||| ||||||||||||||  |
Sbjct: 524 tgaccaggacattgttgctctatctggaggccacactttggggagatgccacaaggaccg 583

                                                                       
Query: 141 atctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcac 200
            ||||| ||||| || || |||||  ||||||||||| ||||||||||| | ||||||| 
Sbjct: 584 ctctggttttgaaggtgcttggactaccaaccctttggtcttcgacaacacctacttcaa 643

                                                                       
Query: 201 tgagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgct 260
            |||||||||||||| ||||| ||||||||  | ||| ||||  | |||||||  || ||
Sbjct: 644 ggagctcctgagtggtgagaaagaaggtctcttgcagctgccatctgacaaggctcttct 703

                                                                       
Query: 261 gactgacccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttctt 320
             ||||||| | |||||||||||| || || |||||||| || ||||| ||||| |||||
Sbjct: 704 ctctgaccctgtcttccgcccactggttgagaaatatgcagctgatgaagatgcattctt 763

                                                        
Query: 321 tgctgactacgccgaggcacacctcaagctctctgaacttggatt 365
           ||| ||||| || ||||| ||| | || || |||||||| |||||
Sbjct: 764 tgccgactatgctgaggcgcacttgaaactttctgaactcggatt 808



to top

>dbj|AB078599.1| Brassica oleracea BO-APX 1 mRNA for ascorbate peroxidase, complete
           cds
          Length = 753

 Score =  149 bits (75), Expect = 1e-32
 Identities = 147/171 (85%)
 Strand = Plus / Plus

                                                                       
Query: 67  cagatgggtttgagtgaccaggacattgttgctctttctggtggtcacaccctgggaaga 126
           ||||||||||| | ||||||||||||||| ||||| |||||||  ||||| |||||||||
Sbjct: 442 cagatgggtttaactgaccaggacattgtcgctctgtctggtgcccacactctgggaaga 501

                                                                       
Query: 127 tgccacaaggagagatctgggtttgagggagcctggaccgccaaccctttgatcttcgac 186
           ||||||||||| || ||||| || || || ||||||||  | |||||| | |||||||||
Sbjct: 502 tgccacaaggataggtctggcttcgaaggtgcctggacttcaaaccctcttatcttcgac 561

                                                              
Query: 187 aactcttacttcactgagctcctgagtggggagaaggaaggtcttcttcag 237
           |||||||||||||  || ||| |||| |||||||||||||||||| |||||
Sbjct: 562 aactcttacttcaaggaactcttgagcggggagaaggaaggtctttttcag 612



to top

>gb|AF159631.1|AF159631 Fragaria x ananassa cytosolic ascorbate peroxidase (APX) mRNA,
           APX19 allele, complete cds
          Length = 1051

 Score =  145 bits (73), Expect = 2e-31
 Identities = 202/245 (82%)
 Strand = Plus / Plus

                                                                       
Query: 82  gaccaggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagaga 141
           |||||||||||||||||||| ||||||||||||||| |||||||    ||||||||  | 
Sbjct: 516 gaccaggacattgttgctctctctggtggtcacaccttgggaagggcacacaaggaacgg 575

                                                                       
Query: 142 tctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcact 201
           ||||| || |||||| |||||||  |||||||| | ||||| |||||||| || ||||||
Sbjct: 576 tctggattcgagggaccctggactcccaaccctcttatctttgacaactcatatttcact 635

                                                                       
Query: 202 gagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctg 261
           | | |  ||||||| ||||||||||| ||||| ||| | || || |||||||  || |||
Sbjct: 636 gtgttgttgagtggagagaaggaaggccttctacagcttccaactgacaaggctcttctg 695

                                                                       
Query: 262 actgacccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttcttt 321
            | ||||| | ||||||||| ||||| || ||||| ||||||||||| ||||| ||||||
Sbjct: 696 tcagaccctgtcttccgccctcttgttgagaaatacgctgcggatgaagatgctttcttt 755

                
Query: 322 gctga 326
           |||||
Sbjct: 756 gctga 760



to top

>gb|AF159630.1|AF159630 Fragaria x ananassa cytosolic ascorbate peroxidase (APX) mRNA,
           APX42 allele, complete cds
          Length = 1035

 Score =  145 bits (73), Expect = 2e-31
 Identities = 202/245 (82%)
 Strand = Plus / Plus

                                                                       
Query: 82  gaccaggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagaga 141
           |||||||||||||||||||| ||||||||||||||| |||||||    ||||||||  | 
Sbjct: 529 gaccaggacattgttgctctctctggtggtcacaccttgggaagggcacacaaggaacgg 588

                                                                       
Query: 142 tctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcact 201
           ||||| || |||||| |||||||  |||||||  | ||||| |||||||| || ||||||
Sbjct: 589 tctggattcgagggaccctggactcccaacccccttatctttgacaactcatatttcact 648

                                                                       
Query: 202 gagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctg 261
           | |||  ||||||| ||||||||||| ||||| ||| | || || |||||||  || |||
Sbjct: 649 gtgctgttgagtggagagaaggaaggccttctacagcttccaactgacaaggctcttctg 708

                                                                       
Query: 262 actgacccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttcttt 321
            | ||||| | ||||||||| ||||| || ||||| ||||||||||| ||||| ||||||
Sbjct: 709 tcagaccctgtcttccgccctcttgttgagaaatacgctgcggatgaagatgctttcttt 768

                
Query: 322 gctga 326
           |||||
Sbjct: 769 gctga 773



to top

>gb|AF159629.1|AF159629 Fragaria x ananassa cytosolic ascorbate peroxidase (APX) mRNA,
           APX27 allele, complete cds
          Length = 1030

 Score =  145 bits (73), Expect = 2e-31
 Identities = 202/245 (82%)
 Strand = Plus / Plus

                                                                       
Query: 82  gaccaggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagaga 141
           |||||||||||||||||||| ||||||||||||||| |||||||    ||||||||  | 
Sbjct: 524 gaccaggacattgttgctctctctggtggtcacaccttgggaagggcacacaaggaacgg 583

                                                                       
Query: 142 tctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcact 201
           ||||| || |||||| |||||||  |||||||  | ||||| |||||||| || ||||||
Sbjct: 584 tctggattcgagggaccctggactcccaacccccttatctttgacaactcatatttcact 643

                                                                       
Query: 202 gagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctg 261
           | |||  ||||||| ||||||||||| ||||| ||| | || || |||||||  || |||
Sbjct: 644 gtgctgttgagtggagagaaggaaggccttctacagcttccaactgacaaggctcttctg 703

                                                                       
Query: 262 actgacccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttcttt 321
            | ||||| | ||||||||| ||||| || ||||| ||||||||||| ||||| ||||||
Sbjct: 704 tcagaccctgtcttccgccctcttgttgagaaatacgctgcggatgaagatgctttcttt 763

                
Query: 322 gctga 326
           |||||
Sbjct: 764 gctga 768



to top

>gb|AF022213.1|AF022213 Fragaria x ananassa cytosolic ascorbate peroxidase (APX-c) mRNA,
           complete cds
          Length = 1044

 Score =  145 bits (73), Expect = 2e-31
 Identities = 202/245 (82%)
 Strand = Plus / Plus

                                                                       
Query: 82  gaccaggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagaga 141
           |||||||||||||||||||| ||||||||||||||| |||||||    ||||||||  | 
Sbjct: 520 gaccaggacattgttgctctctctggtggtcacaccttgggaagggcacacaaggaacgg 579

                                                                       
Query: 142 tctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcact 201
           ||||| || |||||| |||||||  |||||||  | ||||| |||||||| || ||||||
Sbjct: 580 tctggattcgagggaccctggactcccaacccccttatctttgacaactcatatttcact 639

                                                                       
Query: 202 gagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctg 261
           | |||  ||||||| ||||||||||| ||||| ||| | || || |||||||  || |||
Sbjct: 640 gtgctgttgagtggagagaaggaaggccttctacagcttccaactgacaaggctcttctg 699

                                                                       
Query: 262 actgacccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttcttt 321
            | ||||| | ||||||||| ||||| || ||||| ||||||||||| ||||| ||||||
Sbjct: 700 tcagaccctgtcttccgccctcttgttgagaaatacgctgcggatgaagatgctttcttt 759

                
Query: 322 gctga 326
           |||||
Sbjct: 760 gctga 764



to top

>gb|AY078080.1| Capsicum annuum putative ascorbate peroxidase mRNA, complete cds
          Length = 972

 Score =  141 bits (71), Expect = 3e-30
 Identities = 230/283 (81%)
 Strand = Plus / Plus

                                                                       
Query: 85  caggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatct 144
           ||||| |||||||| || |||||||| || ||| |||||||||||||||||||| | |||
Sbjct: 482 caggatattgttgcactctctggtggccataccttgggaagatgccacaaggagcgttct 541

                                                                       
Query: 145 gggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgag 204
           || ||||||||| | ||||||||||| ||  | || || |||||||| |||||||  || 
Sbjct: 542 ggttttgagggaccttggaccgccaatcccctcatttttgacaactcatacttcaaggaa 601

                                                                       
Query: 205 ctcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctgact 264
           ||  || ||||||| || ||||||||| | ||||||||  | |||||||  || ||  ||
Sbjct: 602 ctattgggtggggaaaaagaaggtcttttacagttgccctcagacaaggctctcctctct 661

                                                                       
Query: 265 gacccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttctttgct 324
           || || || ||||| || ||||| || ||||||||||| ||||| ||||| |||||||||
Sbjct: 662 gatcctgctttccgtccccttgttgagaaatatgctgcagatgaagatgccttctttgct 721

                                                      
Query: 325 gactacgccgaggcacacctcaagctctctgaacttggattcg 367
           ||||| || ||||| ||| | |||||||||||| | |||||||
Sbjct: 722 gactatgctgaggctcacttgaagctctctgaattgggattcg 764



to top

>emb|X81376.1|CAYWCAP C.annuum mRNA for cytosolic ascorbate peroxidase
          Length = 953

 Score =  141 bits (71), Expect = 3e-30
 Identities = 230/283 (81%)
 Strand = Plus / Plus

                                                                       
Query: 85  caggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatct 144
           ||||| |||||||| || |||||||| || ||| |||||||||||||||||||| | |||
Sbjct: 486 caggatattgttgcactctctggtggccataccttgggaagatgccacaaggagcgttct 545

                                                                       
Query: 145 gggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgag 204
           || ||||||||| | ||||||||||| ||  | || || |||||||| |||||||  || 
Sbjct: 546 ggttttgagggaccttggaccgccaatcccctcatttttgacaactcatacttcaaggaa 605

                                                                       
Query: 205 ctcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctgact 264
           ||  || ||||||| || ||||||||| | ||||||||  | |||||||  || ||  ||
Sbjct: 606 ctattgggtggggaaaaagaaggtcttttacagttgccctcagacaaggctctcctctct 665

                                                                       
Query: 265 gacccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttctttgct 324
           || || || ||||| || ||||| || ||||||||||| ||||| ||||| |||||||||
Sbjct: 666 gatcctgctttccgtccccttgttgagaaatatgctgcagatgaagatgccttctttgct 725

                                                      
Query: 325 gactacgccgaggcacacctcaagctctctgaacttggattcg 367
           ||||| || ||||| ||| | |||||||||||| | |||||||
Sbjct: 726 gactatgctgaggctcacttgaagctctctgaattgggattcg 768



to top

>gb|DQ002888.1| Capsicum annuum cytosolic ascorbate peroxidase (APX1) mRNA,
           complete cds
          Length = 1011

 Score =  141 bits (71), Expect = 3e-30
 Identities = 233/287 (81%)
 Strand = Plus / Plus

                                                                       
Query: 81  tgaccaggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagag 140
           |||| |||| |||||||| || |||||||| || ||| ||||||| |||||||||||| |
Sbjct: 530 tgacaaggatattgttgcactctctggtggccataccttgggaaggtgccacaaggagcg 589

                                                                       
Query: 141 atctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcac 200
            ||||| ||||||||| | |||||| |||| ||  | || || |||||||| ||||| | 
Sbjct: 590 ttctggttttgagggaccttggaccaccaatcccctcatatttgacaactcatactttaa 649

                                                                       
Query: 201 tgagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgct 260
            || || ||||||||||| || ||||| ||| | ||||||||  | |||||||  || ||
Sbjct: 650 ggaacttctgagtggggaaaaagaagggcttttacagttgccatcagacaaggctctcct 709

                                                                       
Query: 261 gactgacccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttctt 320
             | ||||| || |||||||| ||||| || ||||||||||||||||| ||||| |||||
Sbjct: 710 ctcggaccctgctttccgcccccttgttgagaaatatgctgcggatgaagatgccttctt 769

                                                          
Query: 321 tgctgactacgccgaggcacacctcaagctctctgaacttggattcg 367
           ||||||||| || ||||| ||| | |||||||||||| | |||||||
Sbjct: 770 tgctgactatgctgaggctcacttgaagctctctgaattgggattcg 816



to top

>gb|DQ097722.1| Arachis hypogaea cytosolic ascorbate peroxidase mRNA, complete cds
          Length = 1046

 Score =  137 bits (69), Expect = 5e-29
 Identities = 233/285 (81%), Gaps = 2/285 (0%)
 Strand = Plus / Plus

                                                                       
Query: 79  agtgaccaggacattgttgctctttctggtggtcacaccctgggaagatgc-cacaagga 137
           ||||| ||||| |||||||| || |||||||||||||| || || || ||| ||||||||
Sbjct: 533 agtgatcaggatattgttgccctgtctggtggtcacactcttgg-agctgcacacaagga 591

                                                                       
Query: 138 gagatctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttactt 197
           | | ||||| ||||| ||  | |||||   ||| ||  | ||||| ||||||||||||||
Sbjct: 592 gcgttctggctttgaaggcccttggacaagcaatcccctcatctttgacaactcttactt 651

                                                                       
Query: 198 cactgagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcct 257
           ||  |||||  ||||||| ||||||||||| || ||||||||||| |  || ||||  ||
Sbjct: 652 caaggagcttttgagtggtgagaaggaaggactccttcagttgccaagtgataaggcact 711

                                                                       
Query: 258 gctgactgacccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgtt 317
             ||| |||||| |  |||||||| ||||| || ||||||||||||||||| ||||| ||
Sbjct: 712 cttgagtgaccctgtattccgccctcttgttgagaaatatgctgcggatgaagatgcatt 771

                                                        
Query: 318 ctttgctgactacgccgaggcacacctcaagctctctgaacttgg 362
           ||||||||| ||||| ||||||||||| ||||||||||| |||||
Sbjct: 772 ctttgctgattacgctgaggcacaccttaagctctctgagcttgg 816



to top

>gb|AF039953.1|AF039953 Fragaria x ananassa cytosolic ascorbate peroxidase (ApxSC) mRNA,
           complete cds
          Length = 1040

 Score =  137 bits (69), Expect = 5e-29
 Identities = 201/245 (82%)
 Strand = Plus / Plus

                                                                       
Query: 82  gaccaggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagaga 141
           |||||||||||||||||||| ||||||||||||||| |||||||    ||||||||  | 
Sbjct: 528 gaccaggacattgttgctctctctggtggtcacaccttgggaagggcacacaaggaacgg 587

                                                                       
Query: 142 tctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcact 201
           ||||| || |||||| |||||||  | |||||| | ||||| |||||||| || ||||||
Sbjct: 588 tctggattcgagggaccctggactcctaaccctcttatctttgacaactcatatttcact 647

                                                                       
Query: 202 gagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctg 261
           | |||  ||||||| ||||||||||| ||||| ||| | || || |||||||  || |||
Sbjct: 648 gtgctgttgagtggagagaaggaaggccttctacagcttccaactgacaaggctcttctg 707

                                                                       
Query: 262 actgacccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttcttt 321
            | ||||| | ||||||||| ||||| || ||||| ||||||||||| ||||| ||||||
Sbjct: 708 tcagaccctgtcttccgccctcttgttgagaaatacgctgcggatgaagatgctttcttt 767

                
Query: 322 gctga 326
            ||||
Sbjct: 768 tctga 772



to top

>gb|AY974805.1| Lycopersicon esculentum ascorbate peroxidase (APX) mRNA, complete
           cds
          Length = 1169

 Score =  137 bits (69), Expect = 5e-29
 Identities = 204/249 (81%)
 Strand = Plus / Plus

                                                                       
Query: 81  tgaccaggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagag 140
           |||| |||| |||||||| || |||||||  || ||| |||||||||||||||||||| |
Sbjct: 497 tgacaaggatattgttgcactctctggtgcccataccttgggaagatgccacaaggagcg 556

                                                                       
Query: 141 atctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcac 200
            ||||| ||||||||| | ||||||||||| ||  | ||||| |||||||| ||||| ||
Sbjct: 557 ttctggttttgagggaccttggaccgccaatccccttatctttgacaactcatactttac 616

                                                                       
Query: 201 tgagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgct 260
            |||||  |||||||||| |||||||| ||  | ||||||||  | ||||| |  || ||
Sbjct: 617 ggagcttttgagtggggaaaaggaagggctcttacagttgccatcagacaaagctctcct 676

                                                                       
Query: 261 gactgacccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttctt 320
            | ||| || || |||||||| ||||| || ||||||||||||||||| ||||| |||||
Sbjct: 677 cagtgatcctgctttccgcccccttgttgagaaatatgctgcggatgaagatgccttctt 736

                    
Query: 321 tgctgacta 329
           |||||||||
Sbjct: 737 tgctgacta 745



to top

>gb|AY206407.1| Ipomoea batatas ascorbate peroxidase mRNA, complete cds
          Length = 1046

 Score =  133 bits (67), Expect = 8e-28
 Identities = 226/279 (81%)
 Strand = Plus / Plus

                                                                       
Query: 86  aggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctg 145
           |||| ||||||||||| |||||||| || ||||||||||| |||||||||||| | ||||
Sbjct: 556 aggatattgttgctctctctggtggccataccctgggaaggtgccacaaggagcgctctg 615

                                                                       
Query: 146 ggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgagc 205
           | ||||| ||  | |||||  |||||||  | ||||| || ||||||||||| || ||||
Sbjct: 616 gatttgaaggcccttggactaccaacccactcatctttgataactcttactttacagagc 675

                                                                       
Query: 206 tcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctgactg 265
           |  ||||||| ||||| ||||| ||||| || ||||| || |||||||  || || | ||
Sbjct: 676 ttttgagtggtgagaaagaagggcttctacaattgcccactgacaaggcacttcttaatg 735

                                                                       
Query: 266 acccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttctttgctg 325
           |  | |  ||||||||||| || || ||||||||||| ||||| ||||| ||||||||||
Sbjct: 736 attccgttttccgcccactggttgaaaaatatgctgcagatgaagatgccttctttgctg 795

                                                  
Query: 326 actacgccgaggcacacctcaagctctctgaacttggat 364
           ||||  | ||||| ||  | |||||||||||||||||||
Sbjct: 796 actatccagaggctcatttgaagctctctgaacttggat 834



to top

>gb|DQ096287.1| Lycopersicon esculentum cytosolic ascorbate peroxidase 2 (APX2)
           mRNA, complete cds
          Length = 972

 Score =  129 bits (65), Expect = 1e-26
 Identities = 203/249 (81%)
 Strand = Plus / Plus

                                                                       
Query: 81  tgaccaggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagag 140
           |||| |||| |||||||| || |||||||  || ||| |||||||||||||||||||| |
Sbjct: 465 tgacaaggatattgttgcactctctggtgcccataccttgggaagatgccacaaggagcg 524

                                                                       
Query: 141 atctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcac 200
            ||||| ||||||||| | ||||||||||| ||  | ||||| |||||||| ||||| ||
Sbjct: 525 ttctggttttgagggaccttggaccgccaatccccttatctttgacaactcatactttac 584

                                                                       
Query: 201 tgagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgct 260
            |||||  |||||||||| |||||||| ||  | ||||||||  | | ||| |  || ||
Sbjct: 585 ggagcttttgagtggggaaaaggaagggctcttacagttgccatcaggcaaagctctcct 644

                                                                       
Query: 261 gactgacccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttctt 320
            | ||| || || |||||||| ||||| || ||||||||||||||||| ||||| |||||
Sbjct: 645 cagtgatcctgctttccgcccccttgttgagaaatatgctgcggatgaagatgccttctt 704

                    
Query: 321 tgctgacta 329
           |||||||||
Sbjct: 705 tgctgacta 713



to top

>gb|AY338957.1| Cucumis sativus ascorbate peroxidase (apox) mRNA, partial cds
          Length = 906

 Score =  129 bits (65), Expect = 1e-26
 Identities = 200/245 (81%)
 Strand = Plus / Plus

                                                                       
Query: 82  gaccaggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagaga 141
           ||||||||||||||||| || ||||||||||||||  |||| ||    ||||||||  ||
Sbjct: 456 gaccaggacattgttgccctctctggtggtcacacattgggtagggcacacaaggaacga 515

                                                                       
Query: 142 tctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcact 201
           || || || |||||  | |||||  |||||||| | ||||| ||||| || |||||||| 
Sbjct: 516 tccggtttcgaggggccatggactaccaaccctctcatctttgacaaatcgtacttcaca 575

                                                                       
Query: 202 gagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctg 261
           || ||| ||| ||| ||||||||||| ||||| |||||| |  | |||||||  || |||
Sbjct: 576 gaactcttgactggagagaaggaaggacttctgcagttggcatcagacaaggcacttctg 635

                                                                       
Query: 262 actgacccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttcttt 321
            ||||||| | ||||||||||||||| || ||||||||||| ||||||||||| ||||||
Sbjct: 636 tctgacccagtcttccgcccacttgtcgaaaaatatgctgccgatgaggatgctttcttt 695

                
Query: 322 gctga 326
           |||||
Sbjct: 696 gctga 700



to top

>emb|X78452.1|RSAPX R.sativus (Fakir) APX mRNA for L-ascorbate peroxidase
          Length = 753

 Score =  129 bits (65), Expect = 1e-26
 Identities = 186/225 (82%), Gaps = 1/225 (0%)
 Strand = Plus / Plus

                                                                       
Query: 14  cgtcttcctgatgccacccaggc-tctgaccacctcaggcaggtgttttccactcagatg 72
           |||||||||||||||||| |||| | ||||||  | |||||||| || |  |  ||||||
Sbjct: 388 cgtcttcctgatgccaccaaggcctgtgaccatttgaggcaggtcttcttaaagcagatg 447

                                                                       
Query: 73  ggtttgagtgaccaggacattgttgctctttctggtggtcacaccctgggaagatgccac 132
           ||||| | |||||||||||| || ||| | |||||||  ||||| |||||||||||||||
Sbjct: 448 ggtttaactgaccaggacatcgtcgctttgtctggtgcccacactctgggaagatgccac 507

                                                                       
Query: 133 aaggagagatctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactct 192
           ||||| || ||||| || || || || |||||  | |||||| | |||||||||||||||
Sbjct: 508 aaggataggtctggtttcgaaggtgcttggacttcaaaccctctcatcttcgacaactct 567

                                                        
Query: 193 tacttcactgagctcctgagtggggagaaggaaggtcttcttcag 237
           |||||||  || ||| |||| || |||||||||||||||||||||
Sbjct: 568 tacttcaaggaactcttgagcggtgagaaggaaggtcttcttcag 612



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  129 bits (65), Expect = 1e-26
 Identities = 77/81 (95%)
 Strand = Plus / Minus

                                                                            
Query: 120      gggaagatgccacaaggagagatctgggtttgagggagcctggaccgccaaccctttgat 179
                ||||||||||||||||||||||||||| |||||||||||||||||  |||||||||||||
Sbjct: 29531335 gggaagatgccacaaggagagatctggctttgagggagcctggacgtccaaccctttgat 29531276

                                     
Query: 180      cttcgacaactcttacttcac 200
                ||| |||||||||||||||||
Sbjct: 29531275 ctttgacaactcttacttcac 29531255



 Score =  117 bits (59), Expect = 5e-23
 Identities = 83/91 (91%)
 Strand = Plus / Minus

                                                                            
Query: 31       ccaggctctgaccacctcaggcaggtgttttccactcagatgggtttgagtgaccaggac 90
                ||||| ||||||||||| |||||||| |||||  | |||||||||||||||||| |||||
Sbjct: 29531513 ccaggttctgaccacctaaggcaggtcttttctgcgcagatgggtttgagtgacaaggac 29531454

                                               
Query: 91       attgttgctctttctggtggtcacaccctgg 121
                || ||||||||||||||||||||||||||||
Sbjct: 29531453 atagttgctctttctggtggtcacaccctgg 29531423



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 52/57 (91%)
 Strand = Plus / Minus

                                                                         
Query: 303      ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaact 359
                ||||||||| || |||||||| || ||||||||||| ||||||||||||||||||||
Sbjct: 29530902 ggatgaggacgccttctttgcggattacgccgaggcccacctcaagctctctgaact 29530846



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 81/96 (84%)
 Strand = Plus / Minus

                                                                            
Query: 209      tgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctgactgacc 268
                ||||||| ||||||||||| ||||||||| |||| |  ||||| | |||  || ||||||
Sbjct: 29531130 tgagtggcgagaaggaaggccttcttcagctgccaagtgacaaagccctcatggctgacc 29531071

                                                    
Query: 269      cggccttccgcccacttgtggacaaatatgctgcgg 304
                | |||||||| ||||| ||||| |||||||||||||
Sbjct: 29531070 cagccttccgtccactggtggagaaatatgctgcgg 29531035



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 10       aggccgtcttcctgatgccac 30
                |||||||||||||||||||||
Sbjct: 29531893 aggccgtcttcctgatgccac 29531873



to top

>dbj|AP005199.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0627E10
          Length = 163388

 Score =  129 bits (65), Expect = 1e-26
 Identities = 77/81 (95%)
 Strand = Plus / Minus

                                                                         
Query: 120   gggaagatgccacaaggagagatctgggtttgagggagcctggaccgccaaccctttgat 179
             ||||||||||||||||||||||||||| |||||||||||||||||  |||||||||||||
Sbjct: 58007 gggaagatgccacaaggagagatctggctttgagggagcctggacgtccaaccctttgat 57948

                                  
Query: 180   cttcgacaactcttacttcac 200
             ||| |||||||||||||||||
Sbjct: 57947 ctttgacaactcttacttcac 57927



 Score =  117 bits (59), Expect = 5e-23
 Identities = 83/91 (91%)
 Strand = Plus / Minus

                                                                         
Query: 31    ccaggctctgaccacctcaggcaggtgttttccactcagatgggtttgagtgaccaggac 90
             ||||| ||||||||||| |||||||| |||||  | |||||||||||||||||| |||||
Sbjct: 58185 ccaggttctgaccacctaaggcaggtcttttctgcgcagatgggtttgagtgacaaggac 58126

                                            
Query: 91    attgttgctctttctggtggtcacaccctgg 121
             || ||||||||||||||||||||||||||||
Sbjct: 58125 atagttgctctttctggtggtcacaccctgg 58095



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 52/57 (91%)
 Strand = Plus / Minus

                                                                      
Query: 303   ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaact 359
             ||||||||| || |||||||| || ||||||||||| ||||||||||||||||||||
Sbjct: 57574 ggatgaggacgccttctttgcggattacgccgaggcccacctcaagctctctgaact 57518



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 81/96 (84%)
 Strand = Plus / Minus

                                                                         
Query: 209   tgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctgactgacc 268
             ||||||| ||||||||||| ||||||||| |||| |  ||||| | |||  || ||||||
Sbjct: 57802 tgagtggcgagaaggaaggccttcttcagctgccaagtgacaaagccctcatggctgacc 57743

                                                 
Query: 269   cggccttccgcccacttgtggacaaatatgctgcgg 304
             | |||||||| ||||| ||||| |||||||||||||
Sbjct: 57742 cagccttccgtccactggtggagaaatatgctgcgg 57707



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 10    aggccgtcttcctgatgccac 30
             |||||||||||||||||||||
Sbjct: 58565 aggccgtcttcctgatgccac 58545



to top

>dbj|D88649.1| Cucumis sativus mRNA for cytosolic ascorbate peroxidase, complete
           cds
          Length = 1069

 Score =  129 bits (65), Expect = 1e-26
 Identities = 200/245 (81%)
 Strand = Plus / Plus

                                                                       
Query: 82  gaccaggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagaga 141
           ||||||||||||||||| || ||||||||||||||  |||| ||    ||||||||  ||
Sbjct: 488 gaccaggacattgttgccctctctggtggtcacacattgggtagggcacacaaggaacga 547

                                                                       
Query: 142 tctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcact 201
           || || || |||||  | |||||  |||||||| | ||||| ||||| || |||||||| 
Sbjct: 548 tccggtttcgaggggccatggactaccaaccctctcatctttgacaaatcgtacttcaca 607

                                                                       
Query: 202 gagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctg 261
           || ||| ||| ||| ||||||||||| ||||| |||||| |  | |||||||  || |||
Sbjct: 608 gaactcttgactggagagaaggaaggacttctgcagttggcatcagacaaggcacttctg 667

                                                                       
Query: 262 actgacccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttcttt 321
            ||||||| | ||||||||||||||| || ||||||||||| ||||||||||| ||||||
Sbjct: 668 tctgacccagtcttccgcccacttgtcgaaaaatatgctgccgatgaggatgctttcttt 727

                
Query: 322 gctga 326
           |||||
Sbjct: 728 gctga 732



to top

>emb|X62077.1|PSAPXI P.sativum ApxI mRNA for ascorbate peroxidase
          Length = 1054

 Score =  127 bits (64), Expect = 5e-26
 Identities = 234/288 (81%), Gaps = 2/288 (0%)
 Strand = Plus / Plus

                                                                       
Query: 79  agtgaccaggacattgttgctctttctggtggtcacaccctgggaagatgc-cacaagga 137
           ||||| ||||||||||||||||| ||||||||||||||| | || || ||| ||||||||
Sbjct: 534 agtgatcaggacattgttgctctatctggtggtcacaccattgg-agctgcacacaagga 592

                                                                       
Query: 138 gagatctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttactt 197
           | | ||||| ||||||||| | |||||  | || ||| | || || |||||||| || ||
Sbjct: 593 gcgttctggatttgagggaccatggacttctaatcctctcatttttgacaactcatattt 652

                                                                       
Query: 198 cactgagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcct 257
           ||||||| |  ||| ||| |||||||| || |||||||||||||| |  || ||||  ||
Sbjct: 653 cactgagttgttgactggtgagaaggatggccttcttcagttgccaagtgataaggcact 712

                                                                       
Query: 258 gctgactgacccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgtt 317
             |||||||| | |  |||||||| ||||| || ||||||||||||||||| ||||  ||
Sbjct: 713 tttgactgactctgtattccgccctcttgttgagaaatatgctgcggatgaagatgtttt 772

                                                           
Query: 318 ctttgctgactacgccgaggcacacctcaagctctctgaacttggatt 365
           ||||||||| || || || ||||| || ||||||||||| ||||||||
Sbjct: 773 ctttgctgattatgctgaagcacatcttaagctctctgagcttggatt 820



to top

>gb|AF540556.1| Brassica juncea clone APX 8A ascorbate peroxidase mRNA, complete
           cds
          Length = 987

 Score =  125 bits (63), Expect = 2e-25
 Identities = 144/171 (84%)
 Strand = Plus / Plus

                                                                       
Query: 67  cagatgggtttgagtgaccaggacattgttgctctttctggtggtcacaccctgggaaga 126
           ||||||||||||  |||| |||||||||| ||| | |||||||  ||||| |||||||||
Sbjct: 511 cagatgggtttgtctgacaaggacattgtcgctttatctggtgcccacactctgggaaga 570

                                                                       
Query: 127 tgccacaaggagagatctgggtttgagggagcctggaccgccaaccctttgatcttcgac 186
           ||||||||||| || ||||| || || || ||||||||  | |||||| | || ||||||
Sbjct: 571 tgccacaaggataggtctggattcgaaggtgcctggacgtcaaaccctcttattttcgac 630

                                                              
Query: 187 aactcttacttcactgagctcctgagtggggagaaggaaggtcttcttcag 237
           |||||||||||||  |||||| |||  || |||||||||||||||||||||
Sbjct: 631 aactcttacttcaaggagctcttgaccggtgagaaggaaggtcttcttcag 681



to top

>gb|AY485994.1| Pinus pinaster ascorbate peroxidase (csApx) mRNA, complete cds
          Length = 1084

 Score =  119 bits (60), Expect = 1e-23
 Identities = 120/140 (85%)
 Strand = Plus / Plus

                                                                       
Query: 103 tctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgg 162
           |||||||  |||||| |||| ||||||||||||||||||||||| ||||| ||| | |||
Sbjct: 546 tctggtgcccacaccttggggagatgccacaaggagagatctggttttgaaggaccatgg 605

                                                                       
Query: 163 accgccaaccctttgatcttcgacaactcttacttcactgagctcctgagtggggagaag 222
           ||| | |||||| | ||||| ||||||||||||||||| |||||  ||| ||| ||||||
Sbjct: 606 acctctaaccctcttatctttgacaactcttacttcacagagcttgtgactggagagaag 665

                               
Query: 223 gaaggtcttcttcagttgcc 242
           |||||||| |||||| ||||
Sbjct: 666 gaaggtctgcttcagctgcc 685



 Score = 44.1 bits (22), Expect = 0.54
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 310 gatgcgttctttgctgactacgccgaggcacacctcaagctctctgaact 359
           ||||| |||||||||||||| || || || ||||| ||||| ||||||||
Sbjct: 753 gatgctttctttgctgactatgcggaagctcacctgaagctttctgaact 802



to top

>gb|U15933.1|NTU15933 Nicotiana tabacum ascorbate peroxidase (APX) mRNA, complete cds
          Length = 1040

 Score =  119 bits (60), Expect = 1e-23
 Identities = 219/272 (80%)
 Strand = Plus / Plus

                                                                       
Query: 86  aggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctg 145
           |||| |||||||| || |||||||| || ||| ||||||| |||||||||||  | ||||
Sbjct: 544 aggatattgttgcactctctggtggccataccttgggaaggtgccacaaggaacgttctg 603

                                                                       
Query: 146 ggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgagc 205
           | ||||||||| | |||||  |||| ||  | ||||| |||||||| ||||| || || |
Sbjct: 604 gttttgagggaccttggactaccaatcccctcatctttgacaactcatactttacggaac 663

                                                                       
Query: 206 tcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctgactg 265
           |  ||||||||||||| ||||| ||| | ||||||||  | |||||||  || ||  |||
Sbjct: 664 ttttgagtggggagaaagaagggcttttgcagttgccttcagacaaggctctcctctctg 723

                                                                       
Query: 266 acccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttctttgctg 325
           | || || |||||||| ||||| || ||||||||||||||||| || || |||||||| |
Sbjct: 724 atcctgctttccgcccccttgttgagaaatatgctgcggatgaagacgccttctttgcgg 783

                                           
Query: 326 actacgccgaggcacacctcaagctctctgaa 357
           |||| || ||||| ||| | ||||||||||||
Sbjct: 784 actatgctgaggctcacttgaagctctctgaa 815



to top

>dbj|D85912.1|TOBTCAP Nicotiana tabacum mRNA for cytosolic ascorbate peroxidase, complete
           cds
          Length = 1055

 Score =  119 bits (60), Expect = 1e-23
 Identities = 222/276 (80%)
 Strand = Plus / Plus

                                                                       
Query: 81  tgaccaggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagag 140
           |||| |||| |||||||| || |||||||| || ||| ||||||| |||||||||||  |
Sbjct: 567 tgacaaggatattgttgcactctctggtggccataccttgggaaggtgccacaaggaacg 626

                                                                       
Query: 141 atctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcac 200
            ||||| || |||||| | |||||  |||| ||  | ||||| |||||||| ||||| ||
Sbjct: 627 ttctggtttcgagggaccttggactaccaatcccctcatctttgacaactcatactttac 686

                                                                       
Query: 201 tgagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgct 260
            || ||  ||||||||||||| ||||| ||| | ||||||||  | |||||||  || ||
Sbjct: 687 ggaacttttgagtggggagaaagaagggcttttgcagttgccttcagacaaggctctcct 746

                                                                       
Query: 261 gactgacccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttctt 320
             |||| || || |||||||| ||||| || ||||||||||||||||| || || |||||
Sbjct: 747 ttctgatcctgctttccgcccccttgttgagaaatatgctgcggatgaagacgccttctt 806

                                               
Query: 321 tgctgactacgccgaggcacacctcaagctctctga 356
           ||||||||| || ||||| ||| | |||||||||||
Sbjct: 807 tgctgactatgctgaggctcacttgaagctctctga 842



to top

>gb|AF540557.1| Brassica juncea clone APX 6A ascorbate peroxidase mRNA, complete
           cds
          Length = 990

 Score =  117 bits (59), Expect = 5e-23
 Identities = 143/171 (83%)
 Strand = Plus / Plus

                                                                       
Query: 67  cagatgggtttgagtgaccaggacattgttgctctttctggtggtcacaccctgggaaga 126
           ||||||||||||  |||| |||||||||| ||| | |||||||  ||||| |||||||||
Sbjct: 461 cagatgggtttgtctgacaaggacattgtcgctttatctggtgcccacactctgggaaga 520

                                                                       
Query: 127 tgccacaaggagagatctgggtttgagggagcctggaccgccaaccctttgatcttcgac 186
           ||||||||||| || ||||| || || || || |||||  | |||||| | || ||||||
Sbjct: 521 tgccacaaggataggtctggattcgaaggtgcatggacgtcaaaccctcttattttcgac 580

                                                              
Query: 187 aactcttacttcactgagctcctgagtggggagaaggaaggtcttcttcag 237
           |||||||||||||  |||||| |||  || |||||||||||||||||||||
Sbjct: 581 aactcttacttcaaggagctcttgaccggtgagaaggaaggtcttcttcag 631



to top

>emb|Y11461.1|BN11461 B.napus mRNA for ascorbate peroxidase
          Length = 1050

 Score =  117 bits (59), Expect = 5e-23
 Identities = 143/171 (83%)
 Strand = Plus / Plus

                                                                       
Query: 67  cagatgggtttgagtgaccaggacattgttgctctttctggtggtcacaccctgggaaga 126
           ||||||| ||| | ||||||||||||||| ||| | |||||||  ||||| |||||||||
Sbjct: 494 cagatggttttaactgaccaggacattgtcgctttgtctggtgcccacactctgggaaga 553

                                                                       
Query: 127 tgccacaaggagagatctgggtttgagggagcctggaccgccaaccctttgatcttcgac 186
           ||||||||||| || ||||| || || || ||||||||  | |||||| | || ||||||
Sbjct: 554 tgccacaaggataggtctggcttcgaaggtgcctggacttcaaaccctcttattttcgac 613

                                                              
Query: 187 aactcttacttcactgagctcctgagtggggagaaggaaggtcttcttcag 237
           |||||||||||||  || ||  |||| || |||||||||||||||||||||
Sbjct: 614 aactcttacttcaaggaacttttgagcggtgagaaggaaggtcttcttcag 664



to top

>dbj|D25238.1|RICSS622CC Oryza sativa SS622 mRNA for ascorbate peroxidase, partial cds
          Length = 273

 Score =  113 bits (57), Expect = 7e-22
 Identities = 85/95 (89%)
 Strand = Plus / Plus

                                                                       
Query: 271 gccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttctttgctgactac 330
           |||||||| ||||| ||||| |||||||||||||||||||| || |||||||| || |||
Sbjct: 46  gccttccgtccactggtgganaaatatgctgcggatgaggacgccttctttgcggattac 105

                                              
Query: 331 gccgaggcacacctcaagctctctgaacttggatt 365
           |||||||| |||||||||||||||||| | |||||
Sbjct: 106 gccgaggcccacctcaagctctctgaantgggatt 140



to top

>dbj|AB078600.1| Brassica oleracea BO-APX 2 mRNA for ascorbate peroxidase, complete
           cds
          Length = 753

 Score =  109 bits (55), Expect = 1e-20
 Identities = 142/171 (83%)
 Strand = Plus / Plus

                                                                       
Query: 67  cagatgggtttgagtgaccaggacattgttgctctttctggtggtcacaccctgggaaga 126
           |||||||||||   |||| |||||||||| ||| | ||||| |  ||||| |||||||||
Sbjct: 442 cagatgggtttatctgacaaggacattgtcgctttatctggcgcccacactctgggaaga 501

                                                                       
Query: 127 tgccacaaggagagatctgggtttgagggagcctggaccgccaaccctttgatcttcgac 186
           ||||||||||| || ||||| || || || || |||||  | |||||| | || ||||||
Sbjct: 502 tgccacaaggataggtctggattcgaaggtgcatggacttcaaaccctcttattttcgac 561

                                                              
Query: 187 aactcttacttcactgagctcctgagtggggagaaggaaggtcttcttcag 237
           |||||||||||||  |||||| |||| || |||||||||||||||||||||
Sbjct: 562 aactcttacttcaaggagctcttgagcggtgagaaggaaggtcttcttcag 612



to top

>emb|AJ698922.1| Populus euramericana partial mRNA for putative ascorbate peroxidase
           (apx gene)
          Length = 933

 Score =  107 bits (54), Expect = 4e-20
 Identities = 135/162 (83%)
 Strand = Plus / Plus

                                                                       
Query: 70  atgggtttgagtgaccaggacattgttgctctttctggtggtcacaccctgggaagatgc 129
           |||||| | |||||| | || |||||||| || || ||||||||||| |||||||| |||
Sbjct: 307 atgggtctcagtgacaaagatattgttgccctatccggtggtcacactctgggaaggtgc 366

                                                                       
Query: 130 cacaaggagagatctgggtttgagggagcctggaccgccaaccctttgatcttcgacaac 189
           ||||||||| | ||||| ||||||||| |||||||| |||||||| |  | |||||||||
Sbjct: 367 cacaaggagcgttctggatttgagggaccctggacccccaaccctcttgttttcgacaac 426

                                                     
Query: 190 tcttacttcactgagctcctgagtggggagaaggaaggtctt 231
           || || ||||  || ||||| ||||| ||||| |||||||||
Sbjct: 427 tcctatttcaaggaactcctcagtggagagaaagaaggtctt 468



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 273 cttccgcccacttgtggacaaatatgctgcggatgaggatgcgttctttgc 323
           ||||||||| ||||| || ||||||||||| ||||||||||| ||||||||
Sbjct: 510 cttccgcccccttgttgaaaaatatgctgcagatgaggatgccttctttgc 560



to top

>gb|AF457210.1| Hevea brasiliensis ascorbate peroxidase (APX) mRNA, complete cds
          Length = 1058

 Score =  105 bits (53), Expect = 2e-19
 Identities = 206/257 (80%)
 Strand = Plus / Plus

                                                                       
Query: 70  atgggtttgagtgaccaggacattgttgctctttctggtggtcacaccctgggaagatgc 129
           |||||| | |||||| |||| || |||| ||| |||||||| |||||||||||||| |||
Sbjct: 516 atgggtctcagtgacaaggatatcgttgttctctctggtggccacaccctgggaaggtgc 575

                                                                       
Query: 130 cacaaggagagatctgggtttgagggagcctggaccgccaaccctttgatcttcgacaac 189
           ||||||||| | ||||| ||||| ||  ||||||| || |||||  | ||||| ||||| 
Sbjct: 576 cacaaggagcgctctggttttgacgggccctggactgctaacccactcatctttgacaat 635

                                                                       
Query: 190 tcttacttcactgagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgac 249
           |||| |||||| |||||| ||  |||  |||||||||| ||||| || ||||| || |||
Sbjct: 636 tctttcttcacggagctcttggctggacagaaggaaggccttctacaattgccaactgac 695

                                                                       
Query: 250 aaggtcctgctgactgacccggccttccgcccacttgtggacaaatatgctgcggatgag 309
           |  || ||  | || || || | ||||||||||  ||| || ||||||||||| ||||| 
Sbjct: 696 accgttcttgttaccgatcctgtcttccgcccatatgttgaaaaatatgctgctgatgaa 755

                            
Query: 310 gatgcgttctttgctga 326
           ||||| |||||||||||
Sbjct: 756 gatgcattctttgctga 772



to top

>gb|DQ222519.1| Solanum tuberosum clone 121A05 ascorbate peroxidase-like mRNA,
           complete cds
          Length = 969

 Score =  103 bits (52), Expect = 7e-19
 Identities = 196/244 (80%)
 Strand = Plus / Plus

                                                                       
Query: 86  aggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctg 145
           |||| |||||||| || |||||||  || ||| ||||||| |||||||||||| | ||||
Sbjct: 533 aggatattgttgcactctctggtgcccataccttgggaaggtgccacaaggagcgttctg 592

                                                                       
Query: 146 ggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgagc 205
           | ||||||||| | ||||||||||| ||  | ||||| |||||||| ||||| || ||||
Sbjct: 593 gttttgagggaccttggaccgccaatccccttatctttgacaactcatactttacggagc 652

                                                                       
Query: 206 tcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctgactg 265
           |  |||||||||| || ||||| ||  | ||||||||  | |||||||  || ||   ||
Sbjct: 653 ttttgagtggggaaaaagaagggctcttacagttgccatcagacaaggctctcctctgtg 712

                                                                       
Query: 266 acccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttctttgctg 325
           | || || |||||||  ||||| || ||||||||||||||||| ||||| ||||| ||||
Sbjct: 713 atcctgctttccgcctccttgttgagaaatatgctgcggatgaagatgccttcttcgctg 772

               
Query: 326 acta 329
           ||||
Sbjct: 773 acta 776



to top

>dbj|AB041343.1| Solanum tuberosum APx mRNA for ascorbate peroxidase, complete cds
          Length = 1039

 Score =  103 bits (52), Expect = 7e-19
 Identities = 196/244 (80%)
 Strand = Plus / Plus

                                                                       
Query: 86  aggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctg 145
           |||| |||||||| || |||||||  || ||| ||||||| |||||||||||| | ||||
Sbjct: 545 aggatattgttgcactctctggtgcccataccttgggaaggtgccacaaggagcgttctg 604

                                                                       
Query: 146 ggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgagc 205
           | ||||||||| | ||||||||||| ||  | ||||| |||||||| ||||| || ||||
Sbjct: 605 gttttgagggaccttggaccgccaatccccttatctttgacaactcatactttacggagc 664

                                                                       
Query: 206 tcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctgactg 265
           |  |||||||||| || ||||| ||  | ||||||||  | |||||||  || ||   ||
Sbjct: 665 ttttgagtggggaaaaagaagggctcttacagttgccatcagacaaggctctcctctgtg 724

                                                                       
Query: 266 acccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttctttgctg 325
           | || || |||||||  ||||| || ||||||||||||||||| ||||| ||||| ||||
Sbjct: 725 atcctgctttccgcctccttgttgagaaatatgctgcggatgaagatgccttcttcgctg 784

               
Query: 326 acta 329
           ||||
Sbjct: 785 acta 788



to top

>gb|AY823545.1| Pennisetum glaucum ascorbate peroxidase (Apx) mRNA, complete cds
          Length = 680

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 114/134 (85%), Gaps = 1/134 (0%)
 Strand = Plus / Plus

                                                                       
Query: 67  cagatgggtttgagtgaccaggacattgttgctctttctggtggtcacaccctgggaaga 126
           |||||||| |||||||| |||||||||||||| || |||||||| |||||| ||||||| 
Sbjct: 529 cagatgggcttgagtgatcaggacattgttgccctctctggtggccacaccttgggaagg 588

                                                                       
Query: 127 tgccacaaggagagatctgggtttgagggagcctggaccgccaaccctttgatc-ttcga 185
           || ||||||||| | ||||| ||||||||  |||||||    ||||||||| || || ||
Sbjct: 589 tgtcacaaggagcggtctggttttgaggggccctggactagaaaccctttggtcttttga 648

                         
Query: 186 caactcttacttca 199
           ||||||||||||||
Sbjct: 649 caactcttacttca 662



to top

>dbj|AB254809.1| Cryptomeria japonica mRNA for putative ascorbate peroxidase,
           complete cds
          Length = 1012

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 142/173 (82%)
 Strand = Plus / Plus

                                                                       
Query: 70  atgggtttgagtgaccaggacattgttgctctttctggtggtcacaccctgggaagatgc 129
           ||||| |||||||||||||||||||| ||| | ||||||| ||||||  ||||||| |||
Sbjct: 482 atgggattgagtgaccaggacattgtggctttgtctggtgctcacactttgggaagttgc 541

                                                                       
Query: 130 cacaaggagagatctgggtttgagggagcctggaccgccaaccctttgatcttcgacaac 189
           ||||||||||||||||| ||||| ||  | |||||  | |||||  | ||||| ||||||
Sbjct: 542 cacaaggagagatctggatttgaaggtccatggacttctaacccgctcatctttgacaac 601

                                                                
Query: 190 tcttacttcactgagctcctgagtggggagaaggaaggtcttcttcagttgcc 242
           || || ||||| || ||  | | ||| |||||||||||||| ||||| |||||
Sbjct: 602 tcctatttcacagaacttgtcactggagagaaggaaggtctgcttcaattgcc 654



to top

>dbj|AB024991.1| Cicer arietinum mRNA for ascorbate peroxidase, partial cds
          Length = 738

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 212/264 (80%), Gaps = 2/264 (0%)
 Strand = Plus / Plus

                                                                       
Query: 91  attgttgctctttctggtggtcacaccctgggaagatgc-cacaaggagagatctgggtt 149
           ||||||||| | || |||||||||||| | || || ||| ||||||||| | ||||| ||
Sbjct: 247 attgttgctttgtccggtggtcacaccattgg-agctgcacacaaggagcgttctggatt 305

                                                                       
Query: 150 tgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgagctcct 209
           ||||||  | |||||  |||| ||| | || || ||||||||||||||||| ||| |  |
Sbjct: 306 tgagggcccatggacttccaatcctctcatttttgacaactcttacttcacggagttgtt 365

                                                                       
Query: 210 gagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctgactgaccc 269
           || ||| ||||||||||| |||||| ||||||| |  || ||||  ||  ||| ||||||
Sbjct: 366 gaatggtgagaaggaaggccttcttaagttgccaagtgataaggcacttttgagtgaccc 425

                                                                       
Query: 270 ggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttctttgctgacta 329
            |  ||||| || ||||| || ||||||||||||||||| ||||| ||||||||||| ||
Sbjct: 426 tgtattccgtcctcttgtagagaaatatgctgcggatgaagatgccttctttgctgatta 485

                                   
Query: 330 cgccgaggcacacctcaagctctc 353
           ||| ||||| || || ||||||||
Sbjct: 486 cgctgaggctcatcttaagctctc 509



to top

>ref|NM_179276.1| Arabidopsis thaliana APX1; L-ascorbate peroxidase AT1G07890 (APX1)
           transcript variant AT1G07890.2 mRNA, complete cds
          Length = 999

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 124/150 (82%)
 Strand = Plus / Plus

                                                                       
Query: 88  gacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctggg 147
           |||||||| ||| | |||||||  ||||| |||||| ||||||||||||| || ||||| 
Sbjct: 489 gacattgtcgctttatctggtgcccacactctgggacgatgccacaaggataggtctggc 548

                                                                       
Query: 148 tttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgagctc 207
           || || || || |||||  | |||||| | ||||||||||||||||||||||  || |||
Sbjct: 549 ttcgaaggtgcatggacatcaaaccctctaatcttcgacaactcttacttcaaggaactc 608

                                         
Query: 208 ctgagtggggagaaggaaggtcttcttcag 237
            |||| || ||||||||||| |||||||||
Sbjct: 609 ttgagcggagagaaggaaggccttcttcag 638



to top

>ref|NM_202057.1| Arabidopsis thaliana APX1; L-ascorbate peroxidase AT1G07890 (APX1)
           transcript variant AT1G07890.3 mRNA, complete cds
          Length = 1012

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 124/150 (82%)
 Strand = Plus / Plus

                                                                       
Query: 88  gacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctggg 147
           |||||||| ||| | |||||||  ||||| |||||| ||||||||||||| || ||||| 
Sbjct: 502 gacattgtcgctttatctggtgcccacactctgggacgatgccacaaggataggtctggc 561

                                                                       
Query: 148 tttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgagctc 207
           || || || || |||||  | |||||| | ||||||||||||||||||||||  || |||
Sbjct: 562 ttcgaaggtgcatggacatcaaaccctctaatcttcgacaactcttacttcaaggaactc 621

                                         
Query: 208 ctgagtggggagaaggaaggtcttcttcag 237
            |||| || ||||||||||| |||||||||
Sbjct: 622 ttgagcggagagaaggaaggccttcttcag 651



to top

>ref|NM_100663.2| Arabidopsis thaliana APX1; L-ascorbate peroxidase AT1G07890 (APX1)
           transcript variant AT1G07890.1 mRNA, complete cds
          Length = 1116

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 124/150 (82%)
 Strand = Plus / Plus

                                                                       
Query: 88  gacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctggg 147
           |||||||| ||| | |||||||  ||||| |||||| ||||||||||||| || ||||| 
Sbjct: 606 gacattgtcgctttatctggtgcccacactctgggacgatgccacaaggataggtctggc 665

                                                                       
Query: 148 tttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgagctc 207
           || || || || |||||  | |||||| | ||||||||||||||||||||||  || |||
Sbjct: 666 ttcgaaggtgcatggacatcaaaccctctaatcttcgacaactcttacttcaaggaactc 725

                                         
Query: 208 ctgagtggggagaaggaaggtcttcttcag 237
            |||| || ||||||||||| |||||||||
Sbjct: 726 ttgagcggagagaaggaaggccttcttcag 755



to top

>ref|NM_001035915.1| Arabidopsis thaliana APX1; L-ascorbate peroxidase AT1G07890 (APX1)
           transcript variant AT1G07890.5 mRNA, complete cds
          Length = 1291

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 124/150 (82%)
 Strand = Plus / Plus

                                                                       
Query: 88  gacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctggg 147
           |||||||| ||| | |||||||  ||||| |||||| ||||||||||||| || ||||| 
Sbjct: 701 gacattgtcgctttatctggtgcccacactctgggacgatgccacaaggataggtctggc 760

                                                                       
Query: 148 tttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgagctc 207
           || || || || |||||  | |||||| | ||||||||||||||||||||||  || |||
Sbjct: 761 ttcgaaggtgcatggacatcaaaccctctaatcttcgacaactcttacttcaaggaactc 820

                                         
Query: 208 ctgagtggggagaaggaaggtcttcttcag 237
            |||| || ||||||||||| |||||||||
Sbjct: 821 ttgagcggagagaaggaaggccttcttcag 850



to top

>emb|X59600.1|ATASCOR A.thaliana mRNA for ascorbate peroxidase
          Length = 1023

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 124/150 (82%)
 Strand = Plus / Plus

                                                                       
Query: 88  gacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctggg 147
           |||||||| ||| | |||||||  ||||| |||||| ||||||||||||| || ||||| 
Sbjct: 502 gacattgtcgctttatctggtgcccacactctgggacgatgccacaaggataggtctggc 561

                                                                       
Query: 148 tttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgagctc 207
           || || || || |||||  | |||||| | ||||||||||||||||||||||  || |||
Sbjct: 562 ttcgaaggtgcatggacatcaaaccctctaatcttcgacaactcttacttcaaggaactc 621

                                         
Query: 208 ctgagtggggagaaggaaggtcttcttcag 237
            |||| || ||||||||||| |||||||||
Sbjct: 622 ttgagcggagagaaggaaggccttcttcag 651



to top

>gb|AY094002.1| Arabidopsis thaliana At1g07890/F24B9_2 mRNA, complete cds
          Length = 753

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 124/150 (82%)
 Strand = Plus / Plus

                                                                       
Query: 88  gacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctggg 147
           |||||||| ||| | |||||||  ||||| |||||| ||||||||||||| || ||||| 
Sbjct: 463 gacattgtcgctttatctggtgcccacactctgggacgatgccacaaggataggtctggc 522

                                                                       
Query: 148 tttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgagctc 207
           || || || || |||||  | |||||| | ||||||||||||||||||||||  || |||
Sbjct: 523 ttcgaaggtgcatggacatcaaaccctctaatcttcgacaactcttacttcaaggaactc 582

                                         
Query: 208 ctgagtggggagaaggaaggtcttcttcag 237
            |||| || ||||||||||| |||||||||
Sbjct: 583 ttgagcggagagaaggaaggccttcttcag 612



to top

>gb|AY056395.1| Arabidopsis thaliana At1g07890/F24B9_2 mRNA, complete cds
          Length = 1060

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 124/150 (82%)
 Strand = Plus / Plus

                                                                       
Query: 88  gacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctggg 147
           |||||||| ||| | |||||||  ||||| |||||| ||||||||||||| || ||||| 
Sbjct: 553 gacattgtcgctttatctggtgcccacactctgggacgatgccacaaggataggtctggc 612

                                                                       
Query: 148 tttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgagctc 207
           || || || || |||||  | |||||| | ||||||||||||||||||||||  || |||
Sbjct: 613 ttcgaaggtgcatggacatcaaaccctctaatcttcgacaactcttacttcaaggaactc 672

                                         
Query: 208 ctgagtggggagaaggaaggtcttcttcag 237
            |||| || ||||||||||| |||||||||
Sbjct: 673 ttgagcggagagaaggaaggccttcttcag 702



to top

>gb|AY039879.1| Arabidopsis thaliana At1g07890/F24B9_2 mRNA, complete cds
          Length = 1059

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 124/150 (82%)
 Strand = Plus / Plus

                                                                       
Query: 88  gacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctggg 147
           |||||||| ||| | |||||||  ||||| |||||| ||||||||||||| || ||||| 
Sbjct: 553 gacattgtcgctttatctggtgcccacactctgggacgatgccacaaggataggtctggc 612

                                                                       
Query: 148 tttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgagctc 207
           || || || || |||||  | |||||| | ||||||||||||||||||||||  || |||
Sbjct: 613 ttcgaaggtgcatggacatcaaaccctctaatcttcgacaactcttacttcaaggaactc 672

                                         
Query: 208 ctgagtggggagaaggaaggtcttcttcag 237
            |||| || ||||||||||| |||||||||
Sbjct: 673 ttgagcggagagaaggaaggccttcttcag 702



to top

>emb|BX816429.1|CNS0ABNP Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH48ZA02 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1032

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 124/150 (82%)
 Strand = Plus / Plus

                                                                       
Query: 88  gacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctggg 147
           |||||||| ||| | |||||||  ||||| |||||| ||||||||||||| || ||||| 
Sbjct: 530 gacattgtcgctttatctggtgcccacactctgggacgatgccacaaggataggtctggc 589

                                                                       
Query: 148 tttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgagctc 207
           || || || || |||||  | |||||| | ||||||||||||||||||||||  || |||
Sbjct: 590 ttcgaaggtgcatggacatcaaaccctctaatcttcgacaactcttacttcaaggaactc 649

                                         
Query: 208 ctgagtggggagaaggaaggtcttcttcag 237
            |||| || ||||||||||| |||||||||
Sbjct: 650 ttgagcggagagaaggaaggccttcttcag 679



to top

>emb|BX815448.1|CNS0AE8X Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS60ZF11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 929

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 124/150 (82%)
 Strand = Plus / Plus

                                                                       
Query: 88  gacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctggg 147
           |||||||| ||| | |||||||  ||||| |||||| ||||||||||||| || ||||| 
Sbjct: 421 gacattgtcgctttatctggtgcccacactctgggacgatgccacaaggataggtctggc 480

                                                                       
Query: 148 tttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgagctc 207
           || || || || |||||  | |||||| | ||||||||||||||||||||||  || |||
Sbjct: 481 ttcgaaggtgcatggacatcaaaccctctaatcttcgacaactcttacttcaaggaactc 540

                                         
Query: 208 ctgagtggggagaaggaaggtcttcttcag 237
            |||| || ||||||||||| |||||||||
Sbjct: 541 ttgagcggagagaaggaaggccttcttcag 570



to top

>emb|BX813944.1|CNS0AEB8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB49ZC10 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1009

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 124/150 (82%)
 Strand = Plus / Plus

                                                                       
Query: 88  gacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctggg 147
           |||||||| ||| | |||||||  ||||| |||||| ||||||||||||| || ||||| 
Sbjct: 501 gacattgtcgctttatctggtgcccacactctgggacgatgccacaaggataggtctggc 560

                                                                       
Query: 148 tttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgagctc 207
           || || || || |||||  | |||||| | ||||||||||||||||||||||  || |||
Sbjct: 561 ttcgaaggtgcatggacatcaaaccctctaatcttcgacaactcttacttcaaggaactc 620

                                         
Query: 208 ctgagtggggagaaggaaggtcttcttcag 237
            |||| || ||||||||||| |||||||||
Sbjct: 621 ttgagcggagagaaggaaggccttcttcag 650



to top

>emb|BX815850.1|CNS0ABNN Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH12ZD09 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 907

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 124/150 (82%)
 Strand = Plus / Plus

                                                                       
Query: 88  gacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctggg 147
           |||||||| ||| | |||||||  ||||| |||||| ||||||||||||| || ||||| 
Sbjct: 397 gacattgtcgctttatctggtgcccacactctgggacgatgccacaaggataggtctggc 456

                                                                       
Query: 148 tttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgagctc 207
           || || || || |||||  | |||||| | ||||||||||||||||||||||  || |||
Sbjct: 457 ttcgaaggtgcatggacatcaaaccctctaatcttcgacaactcttacttcaaggaactc 516

                                         
Query: 208 ctgagtggggagaaggaaggtcttcttcag 237
            |||| || ||||||||||| |||||||||
Sbjct: 517 ttgagcggagagaaggaaggccttcttcag 546



to top

>emb|BX813948.1|CNS0ACBX Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB49ZF02 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1045

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 124/150 (82%)
 Strand = Plus / Plus

                                                                       
Query: 88  gacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctggg 147
           |||||||| ||| | |||||||  ||||| |||||| ||||||||||||| || ||||| 
Sbjct: 537 gacattgtcgctttatctggtgcccacactctgggacgatgccacaaggataggtctggc 596

                                                                       
Query: 148 tttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgagctc 207
           || || || || |||||  | |||||| | ||||||||||||||||||||||  || |||
Sbjct: 597 ttcgaaggtgcatggacatcaaaccctctaatcttcgacaactcttacttcaaggaactc 656

                                         
Query: 208 ctgagtggggagaaggaaggtcttcttcag 237
            |||| || ||||||||||| |||||||||
Sbjct: 657 ttgagcggagagaaggaaggccttcttcag 686



to top

>emb|BX816810.1|CNS0ABP3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH69ZH04 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 972

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 124/150 (82%)
 Strand = Plus / Plus

                                                                       
Query: 88  gacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctggg 147
           |||||||| ||| | |||||||  ||||| |||||| ||||||||||||| || ||||| 
Sbjct: 529 gacattgtcgctttatctggtgcccacactctgggacgatgccacaaggataggtctggc 588

                                                                       
Query: 148 tttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgagctc 207
           || || || || |||||  | |||||| | ||||||||||||||||||||||  || |||
Sbjct: 589 ttcgaaggtgcatggacatcaaaccctctaatcttcgacaactcttacttcaaggaactc 648

                                         
Query: 208 ctgagtggggagaaggaaggtcttcttcag 237
            |||| || ||||||||||| |||||||||
Sbjct: 649 ttgagcggagagaaggaaggccttcttcag 678



to top

>emb|BX815009.1|CNS0ABC3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS23ZF04 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1023

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 124/150 (82%)
 Strand = Plus / Plus

                                                                       
Query: 88  gacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctggg 147
           |||||||| ||| | |||||||  ||||| |||||| ||||||||||||| || ||||| 
Sbjct: 529 gacattgtcgctttatctggtgcccacactctgggacgatgccacaaggataggtctggc 588

                                                                       
Query: 148 tttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgagctc 207
           || || || || |||||  | |||||| | ||||||||||||||||||||||  || |||
Sbjct: 589 ttcgaaggtgcatggacatcaaaccctctaatcttcgacaactcttacttcaaggaactc 648

                                         
Query: 208 ctgagtggggagaaggaaggtcttcttcag 237
            |||| || ||||||||||| |||||||||
Sbjct: 649 ttgagcggagagaaggaaggccttcttcag 678



to top

>emb|BX841772.1|CNS09Y65 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB28ZA07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 975

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 124/150 (82%)
 Strand = Plus / Plus

                                                                       
Query: 88  gacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctggg 147
           |||||||| ||| | |||||||  ||||| |||||| ||||||||||||| || ||||| 
Sbjct: 477 gacattgtcgctttatctggtgcccacactctgggacgatgccacaaggataggtctggc 536

                                                                       
Query: 148 tttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgagctc 207
           || || || || |||||  | |||||| | ||||||||||||||||||||||  || |||
Sbjct: 537 ttcgaaggtgcatggacatcaaaccctctaatcttcgacaactcttacttcaaggaactc 596

                                         
Query: 208 ctgagtggggagaaggaaggtcttcttcag 237
            |||| || ||||||||||| |||||||||
Sbjct: 597 ttgagcggagagaaggaaggccttcttcag 626



to top

>gb|AY086425.1| Arabidopsis thaliana clone 25057 mRNA, complete sequence
          Length = 1112

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 124/150 (82%)
 Strand = Plus / Plus

                                                                       
Query: 88  gacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctggg 147
           |||||||| ||| | |||||||  ||||| |||||| ||||||||||||| || ||||| 
Sbjct: 606 gacattgtcgctttatctggtgcccacactctgggacgatgccacaaggataggtctggc 665

                                                                       
Query: 148 tttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgagctc 207
           || || || || |||||  | |||||| | ||||||||||||||||||||||  || |||
Sbjct: 666 ttcgaaggtgcatggacatcaaaccctctaatcttcgacaactcttacttcaaggaactc 725

                                         
Query: 208 ctgagtggggagaaggaaggtcttcttcag 237
            |||| || ||||||||||| |||||||||
Sbjct: 726 ttgagcggagagaaggaaggccttcttcag 755



to top

>dbj|AB082931.1| Glycine max apx1 mRNA for cytosolic ascorbate peroxidase 1,
           complete cds, cultivar:Hokkaihadaka
          Length = 840

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 172/214 (80%)
 Strand = Plus / Plus

                                                                       
Query: 130 cacaaggagagatctgggtttgagggagcctggaccgccaaccctttgatcttcgacaac 189
           ||||||||| | ||||| ||||||||  |||||||| | || ||| | || |||||||||
Sbjct: 548 cacaaggagcgttctggatttgagggtccctggacctctaatcctcttattttcgacaac 607

                                                                       
Query: 190 tcttacttcactgagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgac 249
           || |||||||| ||| |  ||||||| |||||||||||||| |||||| | ||  | |||
Sbjct: 608 tcatacttcacggagttgttgagtggtgagaaggaaggtctccttcagctaccttctgac 667

                                                                       
Query: 250 aaggtcctgctgactgacccggccttccgcccacttgtggacaaatatgctgcggatgag 309
           ||||  ||  || ||||||| |  |||||||| || || || |||||||| ||||| || 
Sbjct: 668 aaggctcttttgtctgaccctgtattccgccctctcgttgataaatatgcagcggacgaa 727

                                             
Query: 310 gatgcgttctttgctgactacgccgaggcacacc 343
           ||||| ||||||||||| ||||| ||||| ||||
Sbjct: 728 gatgccttctttgctgattacgctgaggctcacc 761



to top

>dbj|AB082930.1| Glycine max apx1 mRNA for cytosolic ascorbate peroxidase 1,
           complete cds, cultivar:Kitamusume
          Length = 839

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 172/214 (80%)
 Strand = Plus / Plus

                                                                       
Query: 130 cacaaggagagatctgggtttgagggagcctggaccgccaaccctttgatcttcgacaac 189
           ||||||||| | ||||| ||||||||  |||||||| | || ||| | || |||||||||
Sbjct: 548 cacaaggagcgttctggatttgagggtccctggacctctaatcctcttattttcgacaac 607

                                                                       
Query: 190 tcttacttcactgagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgac 249
           || |||||||| ||| |  ||||||| |||||||||||||| |||||| | ||  | |||
Sbjct: 608 tcatacttcacggagttgttgagtggtgagaaggaaggtctccttcagctaccttctgac 667

                                                                       
Query: 250 aaggtcctgctgactgacccggccttccgcccacttgtggacaaatatgctgcggatgag 309
           ||||  ||  || ||||||| |  |||||||| || || || |||||||| ||||| || 
Sbjct: 668 aaggctcttttgtctgaccctgtattccgccctctcgttgataaatatgcagcggacgaa 727

                                             
Query: 310 gatgcgttctttgctgactacgccgaggcacacc 343
           ||||| ||||||||||| ||||| ||||| ||||
Sbjct: 728 gatgccttctttgctgattacgctgaggctcacc 761



to top

>gb|L10292.1|SOYASCPER Soybean ascorbate peroxidase mRNA, complete cds
          Length = 1030

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 172/214 (80%)
 Strand = Plus / Plus

                                                                       
Query: 130 cacaaggagagatctgggtttgagggagcctggaccgccaaccctttgatcttcgacaac 189
           ||||||||| | ||||| ||||||||  |||||||| | || ||| | || |||||||||
Sbjct: 552 cacaaggagcgttctggatttgagggtccctggacctctaatcctcttattttcgacaac 611

                                                                       
Query: 190 tcttacttcactgagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgac 249
           || |||||||| ||| |  ||||||| |||||||||||||| |||||| | ||  | |||
Sbjct: 612 tcatacttcacggagttgttgagtggtgagaaggaaggtctccttcagctaccttctgac 671

                                                                       
Query: 250 aaggtcctgctgactgacccggccttccgcccacttgtggacaaatatgctgcggatgag 309
           ||||  ||  || ||||||| |  |||||||| || || || |||||||| ||||| || 
Sbjct: 672 aaggctcttttgtctgaccctgtattccgccctctcgttgataaatatgcagcggacgaa 731

                                             
Query: 310 gatgcgttctttgctgactacgccgaggcacacc 343
           ||||| ||||||||||| ||||| ||||| ||||
Sbjct: 732 gatgccttctttgctgattacgctgaggctcacc 765



to top

>gb|DQ096286.1| Lycopersicon esculentum cytosolic ascorbate peroxidase 1 (APX1)
           mRNA, complete cds
          Length = 1117

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 219/277 (79%)
 Strand = Plus / Plus

                                                                       
Query: 81  tgaccaggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagag 140
           ||||||||| |||||||| || |||||||  || ||| |||||||    ||||||||| |
Sbjct: 621 tgaccaggatattgttgcactctctggtgcccataccttgggaagggcacacaaggagcg 680

                                                                       
Query: 141 atctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcac 200
            ||||| ||||| ||| | ||||| ||||| ||  | ||||| ||||| || ||||||||
Sbjct: 681 ttctggttttgaaggaccttggactgccaatccccttatctttgacaattcatacttcac 740

                                                                       
Query: 201 tgagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgct 260
            |||||  |||||||||| || || || ||  | ||||||||| | |||||||  || ||
Sbjct: 741 ggagcttttgagtggggaaaaagaggggctcttacagttgccgtcagacaaggctctcct 800

                                                                       
Query: 261 gactgacccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttctt 320
              ||| || || ||||| || ||||| || ||||||||||||||||| ||||| |||||
Sbjct: 801 ttgtgatcctgctttccgtccccttgttgagaaatatgctgcggatgaagatgccttctt 860

                                                
Query: 321 tgctgactacgccgaggcacacctcaagctctctgaa 357
           ||||||||| || ||||| ||| | ||||| ||||||
Sbjct: 861 tgctgactatgctgaggctcacttgaagctttctgaa 897



to top

>gb|DQ004738.1| Phaseolus lunatus ascorbate peroxidase (AP1) mRNA, partial cds
          Length = 374

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 204/255 (80%), Gaps = 2/255 (0%)
 Strand = Plus / Plus

                                                                       
Query: 79  agtgaccaggacattgttgctctttctggtggtcacaccctgggaagatgc-cacaagga 137
           ||||||| ||| ||||||||||| ||||||||||||||| | ||| |  || ||||||||
Sbjct: 87  agtgacctggatattgttgctctatctggtggtcacaccatcgga-gcggcacacaagga 145

                                                                       
Query: 138 gagatctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttactt 197
           | | ||||| ||||||||  | |||||| | |||||| | || || |||||||| |||||
Sbjct: 146 gcgttctggatttgaggggccgtggacctcaaaccctcttatttttgacaactcgtactt 205

                                                                       
Query: 198 cactgagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcct 257
           ||  ||| |  |||| || || |||||||| || |||||| ||||  | |||||||  ||
Sbjct: 206 caaggagttgttgagcggtgaaaaggaaggcctccttcagctgccttctgacaaggcact 265

                                                                       
Query: 258 gctgactgacccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgtt 317
             |||||||||| |  |||||||| ||||| || |||||||| ||||| || ||||||||
Sbjct: 266 tttgactgaccctgtattccgccctcttgttgaaaaatatgcagcggacgaagatgcgtt 325

                          
Query: 318 ctttgctgactacgc 332
           ||| ||||| |||||
Sbjct: 326 cttcgctgattacgc 340



to top

>emb|BX815873.1|CNS0ABWS Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH14ZC09 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1009

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 112/135 (82%)
 Strand = Plus / Plus

                                                                       
Query: 103 tctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgg 162
           |||||||  ||||| |||||| ||||||||||||| || ||||| || || || || |||
Sbjct: 555 tctggtgcccacactctgggacgatgccacaaggataggtctggcttcgaaggtgcatgg 614

                                                                       
Query: 163 accgccaaccctttgatcttcgacaactcttacttcactgagctcctgagtggggagaag 222
           ||  | |||||| | ||||||||||||||||||||||  || ||| |||| || ||||||
Sbjct: 615 acatcaaaccctctaatcttcgacaactcttacttcaaggaactcttgagcggagagaag 674

                          
Query: 223 gaaggtcttcttcag 237
           ||||| |||||||||
Sbjct: 675 gaaggccttcttcag 689



to top

>gb|AY306210.1| Citrullus lanatus ascorbate peroxidase (APX) mRNA, partial cds
          Length = 370

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 174/218 (79%)
 Strand = Plus / Plus

                                                                       
Query: 82  gaccaggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagaga 141
           ||||||||||||||||| || ||||| ||||||||  |||| ||    ||||| ||  ||
Sbjct: 146 gaccaggacattgttgccctctctggcggtcacacattgggtagggcacacaaagaacga 205

                                                                       
Query: 142 tctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcact 201
           ||||| ||||||||  | |||||  |||||||| | ||||| || || || |||||||||
Sbjct: 206 tctggttttgaggggccgtggacttccaaccctctcatctttgataattcatacttcact 265

                                                                       
Query: 202 gagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctg 261
           || ||| |||| |||||||||||||| ||||| |||||| |  | |||||||  || |||
Sbjct: 266 gaactcttgagcggggagaaggaaggccttctgcagttggcatcagacaaggcacttctg 325

                                                 
Query: 262 actgacccggccttccgcccacttgtggacaaatatgc 299
            |||| || | ||||||||| ||||| || ||||||||
Sbjct: 326 tctgatcccgtcttccgcccccttgttgaaaaatatgc 363



to top

>emb|BX814227.1|CNS0AC1P Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB62ZB01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 998

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 123/150 (82%)
 Strand = Plus / Plus

                                                                       
Query: 88  gacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctggg 147
           |||||||| ||| | |||||||  ||||| |||||| ||||||||||||| || ||||| 
Sbjct: 529 gacattgtcgctttatctggtgcccacactctgggacgatgccacaaggataggtctggc 588

                                                                       
Query: 148 tttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgagctc 207
           || || || || |||||  | |||||| | ||||||||||||||| ||||||  || |||
Sbjct: 589 ttcgaaggtgcatggacatcaaaccctctaatcttcgacaactctgacttcaaggaactc 648

                                         
Query: 208 ctgagtggggagaaggaaggtcttcttcag 237
            |||| || ||||||||||| |||||||||
Sbjct: 649 ttgagcggagagaaggaaggccttcttcag 678



to top

>emb|BX817157.1|CNS0ABKO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH8ZD10 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1033

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 105/126 (83%)
 Strand = Plus / Plus

                                                                       
Query: 112 cacaccctgggaagatgccacaaggagagatctgggtttgagggagcctggaccgccaac 171
           ||||| |||||| ||||||||||||| || ||||| || || || || |||||  | |||
Sbjct: 562 cacactctgggacgatgccacaaggataggtctggcttcgaaggtgcatggacatcaaac 621

                                                                       
Query: 172 cctttgatcttcgacaactcttacttcactgagctcctgagtggggagaaggaaggtctt 231
           ||| | ||||||||||||||||||||||  || ||| |||| || ||||||||||| |||
Sbjct: 622 cctctaatcttcgacaactcttacttcaaggaactcttgagcggagagaaggaaggcctt 681

                 
Query: 232 cttcag 237
           ||||||
Sbjct: 682 cttcag 687



to top

>gb|AF378131.1|AF378131 Zantedeschia aethiopica ascorbate peroxidase (csApx2) mRNA,
           complete cds
          Length = 1108

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 230/293 (78%)
 Strand = Plus / Plus

                                                                       
Query: 67  cagatgggtttgagtgaccaggacattgttgctctttctggtggtcacaccctgggaaga 126
           ||||||||| |  ||||||| || || |||||||||||||| || || |||||||| || 
Sbjct: 482 cagatgggtctctgtgaccaagatatcgttgctctttctgggggccataccctgggtagg 541

                                                                       
Query: 127 tgccacaaggagagatctgggtttgagggagcctggaccgccaaccctttgatcttcgac 186
              |||| |||| | ||||| |||||||| || |||||  | || ||| | || || || 
Sbjct: 542 gcgcacagggagcgttctggctttgagggtgcttggacttcaaatcctcttatatttgat 601

                                                                       
Query: 187 aactcttacttcactgagctcctgagtggggagaaggaaggtcttcttcagttgccgacc 246
           |||||||||||||| || ||  |||  |||||||||||||| ||||| ||| ||||  | 
Sbjct: 602 aactcttacttcacggaacttttgaccggggagaaggaagggcttctccagctgccatct 661

                                                                       
Query: 247 gacaaggtcctgctgactgacccggccttccgcccacttgtggacaaatatgctgcggat 306
           ||||| | ||| || | |||||| |  |||||||| |||||||| |||||||| || |||
Sbjct: 662 gacaaagccctccttagtgaccctgtgttccgcccccttgtggagaaatatgcagctgat 721

                                                                
Query: 307 gaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaact 359
           |||||||| |||||||| || ||  | || || ||| | ||||||||||||||
Sbjct: 722 gaggatgctttctttgccgattattctgaagctcacttaaagctctctgaact 774



to top

>gb|AF281082.1|AF281082 Astragalus membranaceus ascorbate peroxidase mRNA, partial cds
          Length = 545

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 158/197 (80%)
 Strand = Plus / Plus

                                                                       
Query: 130 cacaaggagagatctgggtttgagggagcctggaccgccaaccctttgatcttcgacaac 189
           ||||||||| | ||||| |||| |||  |||||||  | || ||||| || || ||||||
Sbjct: 125 cacaaggagcgttctggatttgggggtccctggacttctaatcctttaatttttgacaac 184

                                                                       
Query: 190 tcttacttcactgagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgac 249
           || |||||||  ||| |  ||||||| ||||||||||| || |||||| |||| |  || 
Sbjct: 185 tcatacttcaaggagttgttgagtggagagaaggaaggcctccttcagctgccaagtgat 244

                                                                       
Query: 250 aaggtcctgctgactgacccggccttccgcccacttgtggacaaatatgctgcggatgag 309
           ||||  ||  |||||||||| |  |||||||| ||||| || ||||||||||||||||| 
Sbjct: 245 aaggcacttttgactgaccctgtattccgccctcttgttgagaaatatgctgcggatgaa 304

                            
Query: 310 gatgcgttctttgctga 326
           ||||| |||||||||||
Sbjct: 305 gatgccttctttgctga 321



to top

>emb|Z17398.1|DCORFA Daucus carota mRNA for unknown protein
          Length = 1049

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 131/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 81  tgaccaggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagag 140
           |||| |||| |||||| |||||||||| || || || |||||||| || ||||||||| |
Sbjct: 494 tgacaaggatattgttactctttctggcgggcatactctgggaaggtgtcacaaggagcg 553

                                                                       
Query: 141 atctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcac 200
           |||||||||||| ||| |||||||   ||| ||| | ||||||||||||   ||||||| 
Sbjct: 554 atctgggtttgaaggaccctggactagcaatcctctcatcttcgacaacagctacttcaa 613

                                                     
Query: 201 tgagctcctgagtggggagaaggaaggtcttcttcagttgcc 242
            || ||| ||| |||||| || ||||| ||||| || |||||
Sbjct: 614 ggaactcttgactggggaaaaagaagggcttctgcaattgcc 655



 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 273 cttccgcccacttgtggacaaatatgctgcggatgaggatgcgttctttgc 323
           |||||| || |||||||| ||||||||||||||||||||||| ||||||||
Sbjct: 686 cttccgtcctcttgtggaaaaatatgctgcggatgaggatgctttctttgc 736



to top

>gb|AY148472.1| Retama raetam cytosolic ascorbate peroxidase mRNA, complete cds
          Length = 673

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 121/149 (81%)
 Strand = Plus / Plus

                                                                       
Query: 79  agtgaccaggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggag 138
           ||||| ||||| |||||||||||||||||||| |||||| | |||  |   |||||||||
Sbjct: 464 agtgatcaggatattgttgctctttctggtggccacaccattggagcagcacacaaggag 523

                                                                       
Query: 139 agatctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttc 198
            | ||||| ||||||||| ||||||||  ||| ||  | || || |||||||| ||||||
Sbjct: 524 cgttctggatttgagggaccctggaccagcaatcccctcatttttgacaactcatacttc 583

                                        
Query: 199 actgagctcctgagtggggagaaggaagg 227
           || || ||  ||||||| |||||||||||
Sbjct: 584 acggaactattgagtggtgagaaggaagg 612



to top

>ref|NM_001035914.1| Arabidopsis thaliana APX1; L-ascorbate peroxidase AT1G07890 (APX1)
           transcript variant AT1G07890.4 mRNA, complete cds
          Length = 1294

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 93/112 (83%)
 Strand = Plus / Plus

                                                                       
Query: 88  gacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctggg 147
           |||||||| ||| | |||||||  ||||| |||||| ||||||||||||| || ||||| 
Sbjct: 701 gacattgtcgctttatctggtgcccacactctgggacgatgccacaaggataggtctggc 760

                                                               
Query: 148 tttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttca 199
           || || || || |||||  | |||||| | ||||||||||||||||||||||
Sbjct: 761 ttcgaaggtgcatggacatcaaaccctctaatcttcgacaactcttacttca 812



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                      
Query: 67      cagatgggtttgagtgaccaggacattgttgctctttctggtggtcacaccctgg 121
               |||||||| |||||||| |||||||||||||| || ||||| |||||||||||||
Sbjct: 9817708 cagatgggcttgagtgatcaggacattgttgccctctctggcggtcacaccctgg 9817762



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 84/101 (83%)
 Strand = Plus / Plus

                                                                           
Query: 202     gagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctg 261
               ||||| |||||||| || ||||| || ||||||||| | || |  ||||| | |||||||
Sbjct: 9818024 gagcttctgagtggtgacaaggagggccttcttcagcttcctagtgacaaagccctgctg 9818083

                                                        
Query: 262     actgacccggccttccgcccacttgtggacaaatatgctgc 302
               | |||||| |||||||||||||| || || |||||||||||
Sbjct: 9818084 agtgaccctgccttccgcccactcgtcgagaaatatgctgc 9818124



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                    
Query: 120     gggaagatgccacaaggagagatctgggtttgaggga 156
               |||||| ||||||||||| |||||||| |||||||||
Sbjct: 9817847 gggaaggtgccacaaggaaagatctggttttgaggga 9817883



to top

>emb|AJ971947.1| Pinus pinea partial mRNA for cytosolic ascorbate peroxidase (apxcyt
           gene)
          Length = 167

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 89/107 (83%)
 Strand = Plus / Plus

                                                                       
Query: 136 gagagatctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttac 195
           ||||||||||| ||||| ||| | |||||| | |||||| | ||||| ||||||||||||
Sbjct: 1   gagagatctggttttgaaggaccatggacctctaaccctcttatctttgacaactcttac 60

                                                          
Query: 196 ttcactgagctcctgagtggggagaaggaaggtcttcttcagttgcc 242
           ||||  |||||  ||| ||| ||||||||||| || |||||| ||||
Sbjct: 61  ttcatagagcttgtgactggagagaaggaaggcctgcttcagctgcc 107



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                      
Query: 67      cagatgggtttgagtgaccaggacattgttgctctttctggtggtcacaccctgg 121
               |||||||| |||||||| |||||||||||||| || ||||| |||||||||||||
Sbjct: 9815829 cagatgggcttgagtgatcaggacattgttgccctctctggcggtcacaccctgg 9815883



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 84/101 (83%)
 Strand = Plus / Plus

                                                                           
Query: 202     gagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctg 261
               ||||| |||||||| || ||||| || ||||||||| | || |  ||||| | |||||||
Sbjct: 9816145 gagcttctgagtggtgacaaggagggccttcttcagcttcctagtgacaaagccctgctg 9816204

                                                        
Query: 262     actgacccggccttccgcccacttgtggacaaatatgctgc 302
               | |||||| |||||||||||||| || || |||||||||||
Sbjct: 9816205 agtgaccctgccttccgcccactcgtcgagaaatatgctgc 9816245



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                    
Query: 120     gggaagatgccacaaggagagatctgggtttgaggga 156
               |||||| ||||||||||| |||||||| |||||||||
Sbjct: 9815968 gggaaggtgccacaaggaaagatctggttttgaggga 9816004



to top

>gb|AC134232.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone
             OSJNBa0013D02, complete sequence
          Length = 131883

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                    
Query: 67    cagatgggtttgagtgaccaggacattgttgctctttctggtggtcacaccctgg 121
             |||||||| |||||||| |||||||||||||| || ||||| |||||||||||||
Sbjct: 56789 cagatgggcttgagtgatcaggacattgttgccctctctggcggtcacaccctgg 56735



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 84/101 (83%)
 Strand = Plus / Minus

                                                                         
Query: 202   gagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctg 261
             ||||| |||||||| || ||||| || ||||||||| | || |  ||||| | |||||||
Sbjct: 56473 gagcttctgagtggtgacaaggagggccttcttcagcttcctagtgacaaagccctgctg 56414

                                                      
Query: 262   actgacccggccttccgcccacttgtggacaaatatgctgc 302
             | |||||| |||||||||||||| || || |||||||||||
Sbjct: 56413 agtgaccctgccttccgcccactcgtcgagaaatatgctgc 56373



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                  
Query: 120   gggaagatgccacaaggagagatctgggtttgaggga 156
             |||||| ||||||||||| |||||||| |||||||||
Sbjct: 56650 gggaaggtgccacaaggaaagatctggttttgaggga 56614



to top

>gb|AF159380.1|AF159380 Pimpinella brachycarpa ascorbate peroxidase (APX) mRNA, complete
           cds
          Length = 994

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 220/282 (78%)
 Strand = Plus / Plus

                                                                       
Query: 81  tgaccaggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagag 140
           |||| |||| |||||| | || |||||||| |||||||||||| |    || |||||| |
Sbjct: 505 tgacaaggatattgttaccctctctggtggccacaccctgggacgcgctcataaggagcg 564

                                                                       
Query: 141 atctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcac 200
            ||||||||||| ||| |||||||   ||| ||| | ||||| || ||||| ||||| | 
Sbjct: 565 ttctgggtttgaaggaccctggacaagcaatcctctcatctttgataactcctactttaa 624

                                                                       
Query: 201 tgagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgct 260
            || ||| ||| ||| ||||||||||| ||||||||  |||| || ||||||   || ||
Sbjct: 625 ggaactcttgactggagagaaggaagggcttcttcaactgccaactgacaagtctcttct 684

                                                                       
Query: 261 gactgacccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttctt 320
               ||||| | |||||| || ||||| ||||||||||||   ||||||||||| |||||
Sbjct: 685 tgaagaccctgtcttccgtccccttgttgacaaatatgcttgtgatgaggatgccttctt 744

                                                     
Query: 321 tgctgactacgccgaggcacacctcaagctctctgaacttgg 362
           ||||||||| || ||  | ||| | ||||| |||||||||||
Sbjct: 745 tgctgactatgctgaatctcacatgaagctttctgaacttgg 786



to top

>gb|AY054988.1| Medicago sativa ascorbate peroxidase mRNA, partial cds
          Length = 564

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 134/165 (81%), Gaps = 2/165 (1%)
 Strand = Plus / Plus

                                                                       
Query: 79  agtgaccaggacattgttgctctttctggtggtcacaccctgggaagatgc-cacaagga 137
           |||||||||||||| |||||||| |||||||| |||||| | || || ||| ||||||||
Sbjct: 337 agtgaccaggacatcgttgctctgtctggtggccacaccattgg-agctgcacacaagga 395

                                                                       
Query: 138 gagatctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttactt 197
           | | ||||| ||||||||  | |||||  | || ||| | || || |||||||| |||||
Sbjct: 396 gcgttctggatttgagggcccatggacttctaatcctctcatttttgacaactcatactt 455

                                                        
Query: 198 cactgagctcctgagtggggagaaggaaggtcttcttcagttgcc 242
           ||  ||| |  || |||| ||||||||||| ||||||||||||||
Sbjct: 456 caaggagttgttgggtggtgagaaggaaggccttcttcagttgcc 500



to top

>gb|AY034893.1| Suaeda maritima subsp. salsa cytosolic ascorbate peroxidase (APX)
           mRNA, complete cds
          Length = 1152

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 51/57 (89%)
 Strand = Plus / Plus

                                                                    
Query: 81  tgaccaggacattgttgctctttctggtggtcacaccctgggaagatgccacaagga 137
           |||||| ||||||||||||||||| || || |||||| ||||||| |||||||||||
Sbjct: 561 tgaccaagacattgttgctctttccggaggccacaccttgggaaggtgccacaagga 617



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 82/100 (82%)
 Strand = Plus / Plus

                                                                       
Query: 263 ctgacccggccttccgcccacttgtggacaaatatgctgcggatgaggatgcgttctttg 322
           ||||||| | ||| ||||||||||| || |||||||| || || |||||||| |||||||
Sbjct: 743 ctgaccctgtctttcgcccacttgttgagaaatatgcagctgacgaggatgcattctttg 802

                                                   
Query: 323 ctgactacgccgaggcacacctcaagctctctgaacttgg 362
           | |||||  | || || ||||| || || |||||||||||
Sbjct: 803 ccgactattctgatgcccacctgaaactttctgaacttgg 842



to top

>gb|AF038839.1| Brassica juncea ascorbate peroxidase mRNA, complete cds
          Length = 753

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 51/57 (89%)
 Strand = Plus / Plus

                                                                    
Query: 181 ttcgacaactcttacttcactgagctcctgagtggggagaaggaaggtcttcttcag 237
           |||||||||||||||||||  |||||| |||  || |||||||||||||||||||||
Sbjct: 556 ttcgacaactcttacttcaaggagctcttgaccggtgagaaggaaggtcttcttcag 612



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                       
Query: 67  cagatgggtttgagtgaccaggacattgttgctctttctggtggtcacaccctgggaaga 126
           ||||||| ||| | ||||||||||||||| ||| | |||||||  ||||| |||||||||
Sbjct: 442 cagatggttttaactgaccaggacattgtcgctttgtctggtgcccacactctgggaaga 501

            
Query: 127 t 127
           |
Sbjct: 502 t 502



to top

>gb|AY831398.2| Dimocarpus longan cytosolic ascorbate peroxidase mRNA, partial cds
          Length = 868

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 62/72 (86%)
 Strand = Plus / Plus

                                                                       
Query: 294 atatgctgcggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctc 353
           ||||||||| ||||||||||| ||||||||||| ||||| ||  | ||  | ||||||||
Sbjct: 551 atatgctgcagatgaggatgctttctttgctgattacgctgaatctcatttaaagctctc 610

                       
Query: 354 tgaacttggatt 365
           ||||||||||||
Sbjct: 611 tgaacttggatt 622



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 67/79 (84%)
 Strand = Plus / Plus

                                                                       
Query: 86  aggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctg 145
           |||| ||||||||  | ||||| |||||||||||||| || |||||| ||||| | ||||
Sbjct: 343 aggatattgttgccttatctggcggtcacaccctgggtaggtgccacgaggagcgttctg 402

                              
Query: 146 ggtttgagggagcctggac 164
           | ||||||||| |||||||
Sbjct: 403 gatttgagggaccctggac 421



to top

>gb|AY832500.1| Pseudotsuga menziesii var. menziesii haplotype Pm-APX_412m2
           ascorbate peroxidase (APX) gene, partial cds
          Length = 856

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 303 ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 362
           |||||||||||| ||||||||||| || || || || ||||| |||||||||||||||||
Sbjct: 420 ggatgaggatgccttctttgctgattatgcggaagcccacctgaagctctctgaacttgg 479



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 103 tctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgg 162
           |||||||  |||||| |||| ||||| ||||||||| ||||||| ||||||||||| |||
Sbjct: 2   tctggtgcccacaccttgggtagatgtcacaaggagcgatctggctttgagggagcatgg 61

             
Query: 163 ac 164
           ||
Sbjct: 62  ac 63



to top

>gb|AY832499.1| Pseudotsuga menziesii var. menziesii haplotype Pm-APX_412m1
           ascorbate peroxidase (APX) gene, partial cds
          Length = 858

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 303 ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 362
           |||||||||||| ||||||||||| || || || || ||||| |||||||||||||||||
Sbjct: 422 ggatgaggatgccttctttgctgattatgcggaagcccacctgaagctctctgaacttgg 481



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 103 tctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgg 162
           |||||||  |||||| |||| ||||| ||||||||| ||||||| ||||||||||| |||
Sbjct: 2   tctggtgcccacaccttgggtagatgtcacaaggagcgatctggctttgagggagcatgg 61

             
Query: 163 ac 164
           ||
Sbjct: 62  ac 63



to top

>gb|AY832498.1| Pseudotsuga menziesii var. menziesii haplotype Pm-APX_013d2
           ascorbate peroxidase (APX) gene, partial cds
          Length = 863

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 303 ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 362
           |||||||||||| ||||||||||| || || || || ||||| |||||||||||||||||
Sbjct: 420 ggatgaggatgccttctttgctgattatgcggaagcccacctgaagctctctgaacttgg 479



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 103 tctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgg 162
           |||||||  |||||| |||| ||||| ||||||||| ||||||| ||||||||||| |||
Sbjct: 2   tctggtgcccacaccttgggtagatgtcacaaggagcgatctggctttgagggagcatgg 61

             
Query: 163 ac 164
           ||
Sbjct: 62  ac 63



to top

>gb|AY832497.1| Pseudotsuga menziesii var. menziesii haplotype Pm-APX_013d1
           ascorbate peroxidase (APX) gene, partial cds
          Length = 856

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 303 ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 362
           |||||||||||| ||||||||||| || || || || ||||| |||||||||||||||||
Sbjct: 420 ggatgaggatgccttctttgctgattatgcggaagcccacctgaagctctctgaacttgg 479



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 103 tctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgg 162
           |||||||  |||||| |||| ||||| ||||||||| ||||||| ||||||||||| |||
Sbjct: 2   tctggtgcccacaccttgggtagatgtcacaaggagcgatctggctttgagggagcatgg 61

             
Query: 163 ac 164
           ||
Sbjct: 62  ac 63



to top

>gb|AY832496.1| Pseudotsuga menziesii var. menziesii haplotype Pm-APX_24 ascorbate
           peroxidase (APX) gene, partial cds
          Length = 858

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 303 ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 362
           |||||||||||| ||||||||||| || || || || ||||| |||||||||||||||||
Sbjct: 422 ggatgaggatgccttctttgctgattatgcggaagcccacctgaagctctctgaacttgg 481



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 103 tctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgg 162
           |||||||  |||||| |||| ||||| ||||||||| ||||||| ||||||||||| |||
Sbjct: 2   tctggtgcccacaccttgggtagatgtcacaaggagcgatctggctttgagggagcatgg 61

             
Query: 163 ac 164
           ||
Sbjct: 62  ac 63



to top

>gb|AY832495.1| Pseudotsuga menziesii var. menziesii haplotype Pm-APX_23 ascorbate
           peroxidase (APX) gene, partial cds
          Length = 856

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 303 ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 362
           |||||||||||| ||||||||||| || || || || ||||| |||||||||||||||||
Sbjct: 420 ggatgaggatgccttctttgctgattatgcggaagcccacctgaagctctctgaacttgg 479



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 103 tctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgg 162
           |||||||  |||||| |||| ||||| ||||||||| ||||||| ||||||||||| |||
Sbjct: 2   tctggtgcccacaccttgggtagatgtcacaaggagcgatctggctttgagggagcatgg 61

             
Query: 163 ac 164
           ||
Sbjct: 62  ac 63



to top

>gb|AY832494.1| Pseudotsuga menziesii var. menziesii haplotype Pm-APX_22 ascorbate
           peroxidase (APX) gene, partial cds
          Length = 850

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 303 ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 362
           |||||||||||| ||||||||||| || || || || ||||| |||||||||||||||||
Sbjct: 420 ggatgaggatgccttctttgctgattatgcggaagcccacctgaagctctctgaacttgg 479



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 103 tctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgg 162
           |||||||  |||||| |||| ||||| ||||||||| ||||||| ||||||||||| |||
Sbjct: 2   tctggtgcccacaccttgggtagatgtcacaaggagcgatctggctttgagggagcatgg 61

             
Query: 163 ac 164
           ||
Sbjct: 62  ac 63



to top

>gb|AY832493.1| Pseudotsuga menziesii var. menziesii haplotype Pm-APX_21 ascorbate
           peroxidase (APX) gene, partial cds
          Length = 856

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 303 ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 362
           |||||||||||| ||||||||||| || || || || ||||| |||||||||||||||||
Sbjct: 420 ggatgaggatgccttctttgctgattatgcggaagcccacctgaagctctctgaacttgg 479



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 103 tctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgg 162
           |||||||  |||||| |||| ||||| ||||||||| ||||||| ||||||||||| |||
Sbjct: 2   tctggtgcccacaccttgggtagatgtcacaaggagcgatctggctttgagggagcatgg 61

             
Query: 163 ac 164
           ||
Sbjct: 62  ac 63



to top

>gb|AY832492.1| Pseudotsuga menziesii var. menziesii haplotype Pm-APX_20 ascorbate
           peroxidase (APX) gene, partial cds
          Length = 858

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 303 ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 362
           |||||||||||| ||||||||||| || || || || ||||| |||||||||||||||||
Sbjct: 422 ggatgaggatgccttctttgctgattatgcggaagcccacctgaagctctctgaacttgg 481



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 103 tctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgg 162
           |||||||  |||||| |||| ||||| ||||||||| ||||||| ||||||||||| |||
Sbjct: 2   tctggtgcccacaccttgggtagatgtcacaaggagcgatctggctttgagggagcatgg 61

             
Query: 163 ac 164
           ||
Sbjct: 62  ac 63



to top

>gb|AY832491.1| Pseudotsuga menziesii var. menziesii haplotype Pm-APX_19 ascorbate
           peroxidase (APX) gene, partial cds
          Length = 854

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 303 ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 362
           |||||||||||| ||||||||||| || || || || ||||| |||||||||||||||||
Sbjct: 420 ggatgaggatgccttctttgctgattatgcggaagcccacctgaagctctctgaacttgg 479



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 103 tctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgg 162
           |||||||  |||||| |||| ||||| ||||||||| ||||||| ||||||||||| |||
Sbjct: 2   tctggtgcccacaccttgggtagatgtcacaaggagcgatctggctttgagggagcatgg 61

             
Query: 163 ac 164
           ||
Sbjct: 62  ac 63



to top

>gb|AY832490.1| Pseudotsuga menziesii var. menziesii haplotype Pm-APX_18 ascorbate
           peroxidase (APX) gene, partial cds
          Length = 856

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 303 ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 362
           |||||||||||| ||||||||||| || || || || ||||| |||||||||||||||||
Sbjct: 420 ggatgaggatgccttctttgctgattatgcggaagcccacctgaagctctctgaacttgg 479



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 103 tctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgg 162
           |||||||  |||||| |||| ||||| ||||||||| ||||||| ||||||||||| |||
Sbjct: 2   tctggtgcccacaccttgggtagatgtcacaaggagcgatctggctttgagggagcatgg 61

             
Query: 163 ac 164
           ||
Sbjct: 62  ac 63



to top

>gb|AY832489.1| Pseudotsuga menziesii var. menziesii haplotype Pm-APX_17 ascorbate
           peroxidase (APX) gene, partial cds
          Length = 858

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 303 ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 362
           |||||||||||| ||||||||||| || || || || ||||| |||||||||||||||||
Sbjct: 422 ggatgaggatgccttctttgctgattatgcggaagcccacctgaagctctctgaacttgg 481



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 103 tctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgg 162
           |||||||  |||||| |||| ||||| ||||||||| ||||||| ||||||||||| |||
Sbjct: 2   tctggtgcccacaccttgggtagatgtcacaaggagcgatctggctttgagggagcatgg 61

             
Query: 163 ac 164
           ||
Sbjct: 62  ac 63



to top

>gb|AY832488.1| Pseudotsuga menziesii var. menziesii haplotype Pm-APX_16 ascorbate
           peroxidase (APX) gene, partial cds
          Length = 858

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 303 ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 362
           |||||||||||| ||||||||||| || || || || ||||| |||||||||||||||||
Sbjct: 422 ggatgaggatgccttctttgctgattatgcggaagcccacctgaagctctctgaacttgg 481



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 103 tctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgg 162
           |||||||  |||||| |||| ||||| ||||||||| ||||||| ||||||||||| |||
Sbjct: 2   tctggtgcccacaccttgggtagatgtcacaaggagcgatctggctttgagggagcatgg 61

             
Query: 163 ac 164
           ||
Sbjct: 62  ac 63



to top

>gb|AY832487.1| Pseudotsuga menziesii var. menziesii haplotype Pm-APX_15 ascorbate
           peroxidase (APX) gene, partial cds
          Length = 856

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 303 ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 362
           |||||||||||| ||||||||||| || || || || ||||| |||||||||||||||||
Sbjct: 420 ggatgaggatgccttctttgctgattatgcggaagcccacctgaagctctctgaacttgg 479



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 103 tctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgg 162
           |||||||  |||||| |||| ||||| ||||||||| ||||||| ||||||||||| |||
Sbjct: 2   tctggtgcccacaccttgggtagatgtcacaaggagcgatctggctttgagggagcatgg 61

             
Query: 163 ac 164
           ||
Sbjct: 62  ac 63



to top

>gb|AY832486.1| Pseudotsuga menziesii var. menziesii haplotype Pm-APX_14 ascorbate
           peroxidase (APX) gene, partial cds
          Length = 856

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 303 ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 362
           |||||||||||| ||||||||||| || || || || ||||| |||||||||||||||||
Sbjct: 420 ggatgaggatgccttctttgctgattatgcggaagcccacctgaagctctctgaacttgg 479



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 103 tctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgg 162
           |||||||  |||||| |||| ||||| ||||||||| ||||||| ||||||||||| |||
Sbjct: 2   tctggtgcccacaccttgggtagatgtcacaaggagcgatctggctttgagggagcatgg 61

             
Query: 163 ac 164
           ||
Sbjct: 62  ac 63



to top

>gb|AY832485.1| Pseudotsuga menziesii var. menziesii haplotype Pm-APX_13 ascorbate
           peroxidase (APX) gene, partial cds
          Length = 856

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 303 ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 362
           |||||||||||| ||||||||||| || || || || ||||| |||||||||||||||||
Sbjct: 420 ggatgaggatgccttctttgctgattatgcggaagcccacctgaagctctctgaacttgg 479



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 103 tctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgg 162
           |||||||  |||||| |||| ||||| ||||||||| ||||||| ||||||||||| |||
Sbjct: 2   tctggtgcccacaccttgggtagatgtcacaaggagcgatctggctttgagggagcatgg 61

             
Query: 163 ac 164
           ||
Sbjct: 62  ac 63



to top

>gb|AY832484.1| Pseudotsuga menziesii var. menziesii haplotype Pm-APX_12 ascorbate
           peroxidase (APX) gene, partial cds
          Length = 858

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 303 ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 362
           |||||||||||| ||||||||||| || || || || ||||| |||||||||||||||||
Sbjct: 422 ggatgaggatgccttctttgctgattatgcggaagcccacctgaagctctctgaacttgg 481



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 103 tctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgg 162
           |||||||  |||||| |||| ||||| ||||||||| ||||||| ||||||||||| |||
Sbjct: 2   tctggtgcccacaccttgggtagatgtcacaaggagcgatctggctttgagggagcatgg 61

             
Query: 163 ac 164
           ||
Sbjct: 62  ac 63



to top

>gb|AY832483.1| Pseudotsuga menziesii var. menziesii haplotype Pm-APX_11 ascorbate
           peroxidase (APX) gene, partial cds
          Length = 863

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 303 ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 362
           |||||||||||| ||||||||||| || || || || ||||| |||||||||||||||||
Sbjct: 420 ggatgaggatgccttctttgctgattatgcggaagcccacctgaagctctctgaacttgg 479



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 103 tctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgg 162
           |||||||  |||||| |||| ||||| ||||||||| ||||||| ||||||||||| |||
Sbjct: 2   tctggtgcccacaccttgggtagatgtcacaaggagcgatctggctttgagggagcatgg 61

             
Query: 163 ac 164
           ||
Sbjct: 62  ac 63



to top

>gb|AY832482.1| Pseudotsuga menziesii var. menziesii haplotype Pm-APX_10 ascorbate
           peroxidase (APX) gene, partial cds
          Length = 856

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 303 ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 362
           |||||||||||| ||||||||||| || || || || ||||| |||||||||||||||||
Sbjct: 420 ggatgaggatgccttctttgctgattatgcggaagcccacctgaagctctctgaacttgg 479



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 103 tctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgg 162
           |||||||  |||||| |||| ||||| ||||||||| ||||||| ||||||||||| |||
Sbjct: 2   tctggtgcccacaccttgggtagatgtcacaaggagcgatctggctttgagggagcatgg 61

             
Query: 163 ac 164
           ||
Sbjct: 62  ac 63



to top

>gb|AY832481.1| Pseudotsuga menziesii var. menziesii haplotype Pm-APX_9 ascorbate
           peroxidase (APX) gene, partial cds
          Length = 858

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 303 ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 362
           |||||||||||| ||||||||||| || || || || ||||| |||||||||||||||||
Sbjct: 422 ggatgaggatgccttctttgctgattatgcggaagcccacctgaagctctctgaacttgg 481



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 103 tctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgg 162
           |||||||  |||||| |||| ||||| ||||||||| ||||||| ||||||||||| |||
Sbjct: 2   tctggtgcccacaccttgggtagatgtcacaaggagcgatctggctttgagggagcatgg 61

             
Query: 163 ac 164
           ||
Sbjct: 62  ac 63



to top

>gb|AY832480.1| Pseudotsuga menziesii var. menziesii haplotype Pm-APX_8 ascorbate
           peroxidase (APX) gene, partial cds
          Length = 856

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 303 ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 362
           |||||||||||| ||||||||||| || || || || ||||| |||||||||||||||||
Sbjct: 420 ggatgaggatgccttctttgctgattatgcggaagcccacctgaagctctctgaacttgg 479



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 103 tctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgg 162
           |||||||  |||||| |||| ||||| ||||||||| ||||||| ||||||||||| |||
Sbjct: 2   tctggtgcccacaccttgggtagatgtcacaaggagcgatctggctttgagggagcatgg 61

             
Query: 163 ac 164
           ||
Sbjct: 62  ac 63



to top

>gb|AY832479.1| Pseudotsuga menziesii var. menziesii haplotype Pm-APX_7 ascorbate
           peroxidase (APX) gene, partial cds
          Length = 858

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 303 ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 362
           |||||||||||| ||||||||||| || || || || ||||| |||||||||||||||||
Sbjct: 422 ggatgaggatgccttctttgctgattatgcggaagcccacctgaagctctctgaacttgg 481



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 103 tctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgg 162
           |||||||  |||||| |||| ||||| ||||||||| ||||||| ||||||||||| |||
Sbjct: 2   tctggtgcccacaccttgggtagatgtcacaaggagcgatctggctttgagggagcatgg 61

             
Query: 163 ac 164
           ||
Sbjct: 62  ac 63



to top

>gb|AY832478.1| Pseudotsuga menziesii var. menziesii haplotype Pm-APX_6 ascorbate
           peroxidase (APX) gene, partial cds
          Length = 856

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 303 ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 362
           |||||||||||| ||||||||||| || || || || ||||| |||||||||||||||||
Sbjct: 420 ggatgaggatgccttctttgctgattatgcggaagcccacctgaagctctctgaacttgg 479



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 103 tctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgg 162
           |||||||  |||||| |||| ||||| ||||||||| ||||||| ||||||||||| |||
Sbjct: 2   tctggtgcccacaccttgggtagatgtcacaaggagcgatctggctttgagggagcatgg 61

             
Query: 163 ac 164
           ||
Sbjct: 62  ac 63



to top

>gb|AY832477.1| Pseudotsuga menziesii var. menziesii haplotype Pm-APX_5 ascorbate
           peroxidase (APX) gene, partial cds
          Length = 858

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 303 ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 362
           |||||||||||| ||||||||||| || || || || ||||| |||||||||||||||||
Sbjct: 422 ggatgaggatgccttctttgctgattatgcggaagcccacctgaagctctctgaacttgg 481



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 103 tctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgg 162
           |||||||  |||||| |||| ||||| ||||||||| ||||||| ||||||||||| |||
Sbjct: 2   tctggtgcccacaccttgggtagatgtcacaaggagcgatctggctttgagggagcatgg 61

             
Query: 163 ac 164
           ||
Sbjct: 62  ac 63



to top

>gb|AY832476.1| Pseudotsuga menziesii var. menziesii haplotype Pm-APX_4 ascorbate
           peroxidase (APX) gene, partial cds
          Length = 857

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 303 ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 362
           |||||||||||| ||||||||||| || || || || ||||| |||||||||||||||||
Sbjct: 420 ggatgaggatgccttctttgctgattatgcggaagcccacctgaagctctctgaacttgg 479



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 103 tctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgg 162
           |||||||  |||||| |||| ||||| ||||||||| ||||||| ||||||||||| |||
Sbjct: 2   tctggtgcccacaccttgggtagatgtcacaaggagcgatctggctttgagggagcatgg 61

             
Query: 163 ac 164
           ||
Sbjct: 62  ac 63



to top

>gb|AY832475.1| Pseudotsuga menziesii var. menziesii haplotype Pm-APX_3 ascorbate
           peroxidase (APX) gene, partial cds
          Length = 856

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 303 ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 362
           |||||||||||| ||||||||||| || || || || ||||| |||||||||||||||||
Sbjct: 420 ggatgaggatgccttctttgctgattatgcggaagcccacctgaagctctctgaacttgg 479



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 103 tctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgg 162
           |||||||  |||||| |||| ||||| ||||||||| ||||||| ||||||||||| |||
Sbjct: 2   tctggtgcccacaccttgggtagatgtcacaaggagcgatctggctttgagggagcatgg 61

             
Query: 163 ac 164
           ||
Sbjct: 62  ac 63



to top

>gb|AY832474.1| Pseudotsuga menziesii var. menziesii haplotype Pm-APX_2 ascorbate
           peroxidase (APX) gene, partial cds
          Length = 856

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 303 ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 362
           |||||||||||| ||||||||||| || || || || ||||| |||||||||||||||||
Sbjct: 420 ggatgaggatgccttctttgctgattatgcggaagcccacctgaagctctctgaacttgg 479



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 103 tctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgg 162
           |||||||  |||||| |||| ||||| ||||||||| ||||||| ||||||||||| |||
Sbjct: 2   tctggtgcccacaccttgggtagatgtcacaaggagcgatctggctttgagggagcatgg 61

             
Query: 163 ac 164
           ||
Sbjct: 62  ac 63



to top

>gb|AY832473.1| Pseudotsuga menziesii var. menziesii haplotype Pm-APX_1 ascorbate
           peroxidase (APX) gene, partial cds
          Length = 858

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 303 ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 362
           |||||||||||| ||||||||||| || || || || ||||| |||||||||||||||||
Sbjct: 422 ggatgaggatgccttctttgctgattatgcggaagcccacctgaagctctctgaacttgg 481



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 103 tctggtggtcacaccctgggaagatgccacaaggagagatctgggtttgagggagcctgg 162
           |||||||  |||||| |||| ||||| ||||||||| ||||||| ||||||||||| |||
Sbjct: 2   tctggtgcccacaccttgggtagatgtcacaaggagcgatctggctttgagggagcatgg 61

             
Query: 163 ac 164
           ||
Sbjct: 62  ac 63



to top

>emb|AJ489279.1|CSA489279 Crocus sativus partial mRNA for ascorbate peroxidase
          Length = 525

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 59/68 (86%)
 Strand = Plus / Plus

                                                                       
Query: 70  atgggtttgagtgaccaggacattgttgctctttctggtggtcacaccctgggaagatgc 129
           ||||| ||||| ||| ||||||||||||| |||||||| || ||||| |||||||| || 
Sbjct: 445 atgggattgagcgacaaggacattgttgcgctttctggaggacacacactgggaaggtgt 504

                   
Query: 130 cacaagga 137
           ||||||||
Sbjct: 505 cacaagga 512



to top

>gb|AF158652.2|AF158652 Fragaria x ananassa cytosolic ascorbate peroxidase (ApxSC) gene,
            ApxSC-c allele, complete cds
          Length = 6436

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 35/36 (97%)
 Strand = Plus / Plus

                                                
Query: 82   gaccaggacattgttgctctttctggtggtcacacc 117
            |||||||||||||||||||| |||||||||||||||
Sbjct: 5071 gaccaggacattgttgctctctctggtggtcacacc 5106



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 78/96 (81%)
 Strand = Plus / Plus

                                                                        
Query: 209  tgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctgactgacc 268
            ||||||| ||||||||||| ||||| ||| | || || |||||||  || ||| | ||||
Sbjct: 5440 tgagtggagagaaggaaggccttctacagcttccaactgacaaggctcttctgtcagacc 5499

                                                
Query: 269  cggccttccgcccacttgtggacaaatatgctgcgg 304
            | | ||||||||| ||||| || ||||| |||||||
Sbjct: 5500 ctgtcttccgccctcttgttgagaaatacgctgcgg 5535



to top

>gb|AF158654.1|AF158654 Fragaria x ananassa cytosolic ascorbate peroxidase APX26 gene,
            complete cds
          Length = 3430

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 35/36 (97%)
 Strand = Plus / Plus

                                                
Query: 82   gaccaggacattgttgctctttctggtggtcacacc 117
            |||||||||||||||||||| |||||||||||||||
Sbjct: 2171 gaccaggacattgttgctctctctggtggtcacacc 2206



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 79/96 (82%)
 Strand = Plus / Plus

                                                                        
Query: 209  tgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctgactgacc 268
            ||||||| ||||||||||| ||||| ||| | || ||||||||||  || ||| | ||||
Sbjct: 2537 tgagtggagagaaggaaggccttctacagcttccaaccgacaaggctcttctgtcagacc 2596

                                                
Query: 269  cggccttccgcccacttgtggacaaatatgctgcgg 304
            | | ||||||||| ||||| || ||||| |||||||
Sbjct: 2597 ctgtcttccgccctcttgttgagaaatacgctgcgg 2632



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                       
Query: 142  tctgggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcac 200
            ||||||||||| ||| |||||||  |||||||| | ||||| |||||||| || |||||
Sbjct: 2360 tctgggtttgaaggaccctggactcccaaccctcttatctttgacaactcatatttcac 2418



to top

>gb|AF158653.1|AF158653 Fragaria x ananassa cytosolic ascorbate peroxidase APX19 gene,
            complete cds
          Length = 5393

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 35/36 (97%)
 Strand = Plus / Plus

                                                
Query: 82   gaccaggacattgttgctctttctggtggtcacacc 117
            |||||||||||||||||||| |||||||||||||||
Sbjct: 3903 gaccaggacattgttgctctctctggtggtcacacc 3938



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 78/96 (81%)
 Strand = Plus / Plus

                                                                        
Query: 209  tgagtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctgactgacc 268
            ||||||| ||||||||||| ||||| ||| | || || |||||||  || ||| | ||||
Sbjct: 4348 tgagtggagagaaggaaggccttctacagcttccaactgacaaggctcttctgtcagacc 4407

                                                
Query: 269  cggccttccgcccacttgtggacaaatatgctgcgg 304
            | | ||||||||| ||||| || ||||| |||||||
Sbjct: 4408 ctgtcttccgccctcttgttgagaaatacgctgcgg 4443



to top

>gb|DQ246218.1| Litchi chinensis putative ascorbate peroxidase mRNA, partial cds
          Length = 420

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 67/79 (84%)
 Strand = Plus / Plus

                                                                       
Query: 86  aggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctg 145
           |||| ||||||||  | ||||| |||||||||||||| || |||||||||||| | ||||
Sbjct: 341 aggatattgttgccttatctggcggtcacaccctgggtaggtgccacaaggagcgttctg 400

                              
Query: 146 ggtttgagggagcctggac 164
           | ||||| ||| |||||||
Sbjct: 401 gttttgaaggaccctggac 419



to top

>gb|M93051.1|PEAAPXIA Pisum sativum ascorbate peroxidase (ApxI) gene, complete cds
          Length = 3625

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 37/39 (94%)
 Strand = Plus / Plus

                                                   
Query: 79   agtgaccaggacattgttgctctttctggtggtcacacc 117
            ||||| ||||||||||||||||| |||||||||||||||
Sbjct: 2417 agtgatcaggacattgttgctctatctggtggtcacacc 2455



 Score = 40.1 bits (20), Expect = 8.5
 Identities = 50/60 (83%)
 Strand = Plus / Plus

                                                                        
Query: 303  ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 362
            |||||| ||||  ||||||||||| || || || ||||| || ||||||||||| |||||
Sbjct: 3089 ggatgaagatgttttctttgctgattatgctgaagcacatcttaagctctctgagcttgg 3148



to top

>gb|AF053474.1|AF053474 Zantedeschia aethiopica ascorbate peroxidase (csApx1) mRNA,
           complete cds
          Length = 1097

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 115 accctgggaagatgccacaaggagagatctgggtttgagggagcctggac 164
           ||||||||||| |||||||||||| | ||||| ||||||||||| |||||
Sbjct: 544 accctgggaaggtgccacaaggagcgttctggctttgagggagcttggac 593



to top

>gb|AF127804.1|AF127804 Glycine max ascorbate peroxidase (apx1) mRNA, complete cds
          Length = 758

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 182/233 (78%)
 Strand = Plus / Plus

                                                                       
Query: 130 cacaaggagagatctgggtttgagggagcctggaccgccaaccctttgatcttcgacaac 189
           ||||||||| | ||||| || |||||  |||||||| | || ||| | || |||||||||
Sbjct: 505 cacaaggagcgttctggattcgagggtccctggacctctaatcctcttattttcgacaac 564

                                                                       
Query: 190 tcttacttcactgagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgac 249
           || |||||||  ||| |  ||||||| ||||| ||||| || |||||| | ||  | |||
Sbjct: 565 tcatacttcaaggagttgttgagtggtgagaaagaaggcctccttcagctaccttctgac 624

                                                                       
Query: 250 aaggtcctgctgactgacccggccttccgcccacttgtggacaaatatgctgcggatgag 309
           ||||  ||  || ||||||| |  |||||||| ||||| || ||||||||  |||| || 
Sbjct: 625 aaggcacttttgtctgaccctgtgttccgccctcttgttgagaaatatgcatcggacgaa 684

                                                                
Query: 310 gatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 362
           ||||| ||||| ||||| ||||| ||||| ||||  ||||| ||||| |||||
Sbjct: 685 gatgccttcttcgctgattacgctgaggctcaccaaaagctttctgagcttgg 737



to top

>gb|U56634.1|GMU56634 Glycine max ascorbate peroxidase 2 (APx2) mRNA, complete cds
          Length = 1064

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 182/233 (78%)
 Strand = Plus / Plus

                                                                       
Query: 130 cacaaggagagatctgggtttgagggagcctggaccgccaaccctttgatcttcgacaac 189
           ||||||||| | ||||| || |||||  |||||||| | || ||| | || |||||||||
Sbjct: 580 cacaaggagcgttctggattcgagggtccctggacctctaatcctcttattttcgacaac 639

                                                                       
Query: 190 tcttacttcactgagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgac 249
           || |||||||  ||| |  ||||||| ||||| ||||| || |||||| | ||  | |||
Sbjct: 640 tcatacttcaaggagttgttgagtggtgagaaagaaggcctccttcagctaccttctgac 699

                                                                       
Query: 250 aaggtcctgctgactgacccggccttccgcccacttgtggacaaatatgctgcggatgag 309
           ||||  ||  || ||||||| |  |||||||| ||||| || ||||||||  |||| || 
Sbjct: 700 aaggcacttttgtctgaccctgtgttccgccctcttgttgagaaatatgcatcggacgaa 759

                                                                
Query: 310 gatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 362
           ||||| ||||| ||||| ||||| ||||| ||||  ||||| ||||| |||||
Sbjct: 760 gatgccttcttcgctgattacgctgaggctcaccaaaagctttctgagcttgg 812



to top

>dbj|AB082932.1| Glycine max apx2 mRNA for cytosolic ascorbate peroxidase 2,
           complete cds
          Length = 840

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 182/233 (78%)
 Strand = Plus / Plus

                                                                       
Query: 130 cacaaggagagatctgggtttgagggagcctggaccgccaaccctttgatcttcgacaac 189
           ||||||||| | ||||| || |||||  |||||||| | || ||| | || |||||||||
Sbjct: 548 cacaaggagcgttctggattcgagggtccctggacctctaatcctcttattttcgacaac 607

                                                                       
Query: 190 tcttacttcactgagctcctgagtggggagaaggaaggtcttcttcagttgccgaccgac 249
           || |||||||  ||| |  ||||||| ||||| ||||| || |||||| | ||  | |||
Sbjct: 608 tcatacttcaaggagttgttgagtggtgagaaagaaggcctccttcagctaccttctgac 667

                                                                       
Query: 250 aaggtcctgctgactgacccggccttccgcccacttgtggacaaatatgctgcggatgag 309
           ||||  ||  || ||||||| |  |||||||| ||||| || ||||||||  |||| || 
Sbjct: 668 aaggcacttttgtctgaccctgtgttccgccctcttgttgagaaatatgcatcggacgaa 727

                                                                
Query: 310 gatgcgttctttgctgactacgccgaggcacacctcaagctctctgaacttgg 362
           ||||| ||||| ||||| ||||| ||||| ||||  ||||| ||||| |||||
Sbjct: 728 gatgccttcttcgctgattacgctgaggctcaccaaaagctttctgagcttgg 780



to top

>dbj|AB243015.1| Codonopsis lanceolata mRNA for cytosolic ascorbate peroxidase,
           complete cds
          Length = 983

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 91  attgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctgg 146
           |||||| |||| || ||||||||||| |||||||| ||||||||||| || |||||
Sbjct: 497 attgttactctatccggtggtcacactctgggaaggtgccacaaggaaaggtctgg 552



to top

>dbj|D14442.1|ATHAPX1 Arabidopsis thaliana APX1 gene for ascorbate peroxidase, complete cds
          Length = 3050

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Plus

                                                                        
Query: 120  gggaagatgccacaaggagagatctgggtttgagggagcctggaccgccaaccctttgat 179
            |||| ||||||||||||| || ||||| || || || || |||||  | |||||| | ||
Sbjct: 1723 gggacgatgccacaaggataggtctggcttcgaaggtgcatggacatcaaaccctctaat 1782

                                
Query: 180  cttcgacaactcttacttca 199
            ||||||||||||||||||||
Sbjct: 1783 cttcgacaactcttacttca 1802



to top

>gb|AF443182.1|AF443182 Nicotiana tabacum ascorbate peroxidase mRNA, partial cds
          Length = 457

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 91/112 (81%)
 Strand = Plus / Plus

                                                                       
Query: 86  aggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctg 145
           |||| |||||||| || |||||||| || ||| ||||||| |||||||||||  | ||||
Sbjct: 345 aggatattgttgcactctctggtggccataccttgggaaggtgccacaaggaacgttctg 404

                                                               
Query: 146 ggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttactt 197
           | ||||||||| | |||||  |||| ||  | ||||| |||||||| |||||
Sbjct: 405 gttttgagggaccttggactaccaatcccctcatctttgacaactcatactt 456



to top

>gb|AY973623.1| Manihot esculenta ascorbate peroxidase APX3 mRNA, complete cds
          Length = 1060

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 86  aggacattgttgctctttctggtggtcacaccctgggaagatgccacaagga 137
           |||| |||||||  ||||||||||| |||||| ||||||| |||||||||||
Sbjct: 522 aggatattgttgtcctttctggtggccacaccttgggaaggtgccacaagga 573



 Score = 44.1 bits (22), Expect = 0.54
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                 
Query: 273 cttccgcccacttgtggacaaatatgctgcggatgaggatgcgttctttgctga 326
           ||||||||||  ||| || ||||||||||| ||||| || || |||||||||||
Sbjct: 709 cttccgcccatatgttgaaaaatatgctgctgatgaagaggcattctttgctga 762



to top

>gb|AY973622.1| Manihot esculenta ascorbate peroxidase APX2 mRNA, complete cds
          Length = 1045

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 86  aggacattgttgctctttctggtggtcacaccctgggaagatgccacaagga 137
           |||| |||||||  ||||||||||| |||||| ||||||| |||||||||||
Sbjct: 526 aggatattgttgtcctttctggtggccacaccttgggaaggtgccacaagga 577



 Score = 44.1 bits (22), Expect = 0.54
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                 
Query: 273 cttccgcccacttgtggacaaatatgctgcggatgaggatgcgttctttgctga 326
           ||||||||||  ||| || ||||||||||| ||||| || || |||||||||||
Sbjct: 713 cttccgcccatatgttgaaaaatatgctgctgatgaagaggcattctttgctga 766



to top

>gb|AC007583.2|F24B9 Arabidopsis thaliana chromosome 1 BAC F24B9 sequence, complete
            sequence
          Length = 107234

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                        
Query: 120  gggaagatgccacaaggagagatctgggtttgagggagcctggaccgccaaccctttgat 179
            |||| ||||||||||||| || ||||| || || || || |||||  | |||||| | ||
Sbjct: 6298 gggacgatgccacaaggataggtctggcttcgaaggtgcatggacatcaaaccctctaat 6239

                                
Query: 180  cttcgacaactcttacttca 199
            ||||||||||||||||||||
Sbjct: 6238 cttcgacaactcttacttca 6219



to top

>gb|U63815.1|ATU63815 Arabidopsis thaliana AT.I.24-1, AT.I.24-2, AT.I.24-3, AT.I.24-4,
             AT.I.24-5, AT.I.24-6, AT.I.24-9 and AT.I.24-14 genes,
             partial cds, AT.I.24-7, ascorbate peroxidase (ATHAPX1),
             EF-1alpha-A1, -A2 and -A3 (EF-1alpha) and AT.I.24-13
             genes, complete cds
          Length = 63093

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Plus

                                                                         
Query: 120   gggaagatgccacaaggagagatctgggtttgagggagcctggaccgccaaccctttgat 179
             |||| ||||||||||||| || ||||| || || || || |||||  | |||||| | ||
Sbjct: 23414 gggacgatgccacaaggataggtctggcttcgaaggtgcatggacatcaaaccctctaat 23473

                                 
Query: 180   cttcgacaactcttacttca 199
             ||||||||||||||||||||
Sbjct: 23474 cttcgacaactcttacttca 23493



to top

>gb|DQ442396.1| Striga asiatica clone St543 ascorbate peroxidase mRNA, partial cds
          Length = 459

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 86/106 (81%)
 Strand = Plus / Plus

                                                                       
Query: 86  aggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatctg 145
           |||||||||||||  | |||||||| ||||| ||||||||   ||| |||||  | ||||
Sbjct: 352 aggacattgttgcattgtctggtggccacactctgggaagggcccataaggaacggtctg 411

                                                         
Query: 146 ggtttgagggagcctggaccgccaaccctttgatcttcgacaactc 191
           | ||||||||| ||||||| |  |||||| | ||||| ||||||||
Sbjct: 412 gatttgagggaccctggactgaaaaccctctcatctttgacaactc 457



to top

>ref|NM_116947.2| Arabidopsis thaliana peroxidase AT4G08770 mRNA, complete cds
          Length = 1235

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 94  gttgctctttctggtggtcacacc 117
           ||||||||||||||||||||||||
Sbjct: 606 gttgctctttctggtggtcacacc 629



to top

>gb|BT000180.1| Arabidopsis thaliana peroxidase C2 precursor-like protein
           (At4g08770) mRNA, complete cds
          Length = 1126

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 94  gttgctctttctggtggtcacacc 117
           ||||||||||||||||||||||||
Sbjct: 556 gttgctctttctggtggtcacacc 579



to top

>gb|AY136364.1| Arabidopsis thaliana peroxidase C2 precursor-like protein
           (At4g08770) mRNA, complete cds
          Length = 1210

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 94  gttgctctttctggtggtcacacc 117
           ||||||||||||||||||||||||
Sbjct: 606 gttgctctttctggtggtcacacc 629



to top

>gb|AF452387.1| Arabidopsis thaliana class III peroxidase ATP38 mRNA, complete cds
          Length = 1174

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 94  gttgctctttctggtggtcacacc 117
           ||||||||||||||||||||||||
Sbjct: 567 gttgctctttctggtggtcacacc 590



to top

>gb|AF146521.1|AF146521 Musa acuminata ascorbate peroxidase mRNA, partial cds
          Length = 346

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 102/128 (79%)
 Strand = Plus / Plus

                                                                       
Query: 85  caggacattgttgctctttctggtggtcacaccctgggaagatgccacaaggagagatct 144
           ||||| || ||||| || || ||||| |||||  |||| ||||||||||||||| | || 
Sbjct: 110 caggatatcgttgcgctctccggtgggcacacggtggggagatgccacaaggagcgctcc 169

                                                                       
Query: 145 gggtttgagggagcctggaccgccaaccctttgatcttcgacaactcttacttcactgag 204
           || || |||||||| |||||  |||| ||| | || ||||| ||||| || ||||  |||
Sbjct: 170 ggtttcgagggagcttggacttccaatcctcttattttcgataactcctatttcaaggag 229

                   
Query: 205 ctcctgag 212
           ||||||||
Sbjct: 230 ctcctgag 237



to top

>gb|AY742959.1| Solanum tuberosum cytosolic ascorbate peroxidase (APX) mRNA,
           partial cds
          Length = 277

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 47/55 (85%)
 Strand = Plus / Plus

                                                                  
Query: 303 ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaa 357
           |||||| ||||| |||||||||||||| || ||||| ||| | ||||| ||||||
Sbjct: 11  ggatgaagatgccttctttgctgactatgctgaggctcacttgaagctttctgaa 65



to top

>gb|U61379.1|VUU61379 Vigna unguiculata cytosolic ascorbate peroxidase mRNA, complete cds
          Length = 1117

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                  
Query: 79  agtgaccaggacattgttgctctttctggtggtcacacc 117
           ||||| ||||| ||||||||||| |||||||| ||||||
Sbjct: 543 agtgatcaggatattgttgctctatctggtggccacacc 581



to top

>gb|AC145164.11| Medicago truncatula clone mth2-27j21, complete sequence
          Length = 110295

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                    
Query: 79    agtgaccaggacattgttgctctttctggtggtcacacc 117
             |||||||||||||| |||||| | |||||||| ||||||
Sbjct: 20123 agtgaccaggacatcgttgctttgtctggtggccacacc 20085



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 74/91 (81%)
 Strand = Plus / Minus

                                                                         
Query: 212   gtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctgactgacccgg 271
             |||| ||||||||||| |||||||||||||| |  || ||||  ||  |||  ||||| |
Sbjct: 19615 gtggtgagaaggaaggccttcttcagttgccaagtgataaggcacttttgagcgaccctg 19556

                                            
Query: 272   ccttccgcccacttgtggacaaatatgctgc 302
               |||||||||||||| || |||||||||||
Sbjct: 19555 tattccgcccacttgttgagaaatatgctgc 19525



to top

>gb|AC137668.18| Medicago truncatula clone mth2-5f8, complete sequence
          Length = 133085

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                     
Query: 79     agtgaccaggacattgttgctctttctggtggtcacacc 117
              |||||||||||||| |||||| | |||||||| ||||||
Sbjct: 116602 agtgaccaggacatcgttgctttgtctggtggccacacc 116564



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 74/91 (81%)
 Strand = Plus / Minus

                                                                          
Query: 212    gtggggagaaggaaggtcttcttcagttgccgaccgacaaggtcctgctgactgacccgg 271
              |||| ||||||||||| |||||||||||||| |  || ||||  ||  |||  ||||| |
Sbjct: 116094 gtggtgagaaggaaggccttcttcagttgccaagtgataaggcacttttgagcgaccctg 116035

                                             
Query: 272    ccttccgcccacttgtggacaaatatgctgc 302
                |||||||||||||| || |||||||||||
Sbjct: 116034 tattccgcccacttgttgagaaatatgctgc 116004



to top

>emb|Y16773.1|LEAPX Lycopersicaon esculentum APX gene, complete CDS
          Length = 4460

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 47/55 (85%)
 Strand = Plus / Plus

                                                                   
Query: 303  ggatgaggatgcgttctttgctgactacgccgaggcacacctcaagctctctgaa 357
            |||||| ||||| |||||||||||||| || ||||| ||| | ||||| ||||||
Sbjct: 3855 ggatgaagatgccttctttgctgactatgctgaggctcacttgaagctttctgaa 3909



to top

>ref|NM_111798.2| Arabidopsis thaliana APX2 (ASCORBATE PEROXIDASE 2); L-ascorbate
           peroxidase AT3G09640 (APX2) transcript variant
           AT3G09640.1 mRNA, complete cds
          Length = 756

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                     
Query: 279 cccacttgtggacaaatatgctgcggatgaggatgcgttctt 320
           |||| |||| || ||||||||||| ||||||||||| |||||
Sbjct: 654 cccatttgttgaaaaatatgctgcagatgaggatgccttctt 695



to top

>ref|NM_001035587.1| Arabidopsis thaliana APX2 (ASCORBATE PEROXIDASE 2); L-ascorbate
           peroxidase AT3G09640 (APX2) transcript variant
           AT3G09640.2 mRNA, complete cds
          Length = 1065

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                     
Query: 279 cccacttgtggacaaatatgctgcggatgaggatgcgttctt 320
           |||| |||| || ||||||||||| ||||||||||| |||||
Sbjct: 799 cccatttgttgaaaaatatgctgcagatgaggatgccttctt 840



to top

>ref|XM_517658.1| PREDICTED: Pan troglodytes similar to very large G-protein coupled
           receptor 1; very large G protein-coupled receptor 1; G
           protein-coupled receptor 98 (LOC461757), mRNA
          Length = 19057

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 104 ctggtggtcacaccctgggaagatgc 129
           |||||||||||||| |||||||||||
Sbjct: 400 ctggtggtcacaccatgggaagatgc 425



to top

>ref|XM_959130.1| Neurospora crassa OR74A hypothetical protein (NCU03297.1) partial
           mRNA
          Length = 1077

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 11  ggccgtcttcctgatgccacccaggc 36
           |||||||||||||||||| |||||||
Sbjct: 625 ggccgtcttcctgatgcctcccaggc 650



to top

>ref|XM_330732.1| Neurospora crassa OR74A hypothetical protein (NCU03297.1) partial
           mRNA
          Length = 1077

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 11  ggccgtcttcctgatgccacccaggc 36
           |||||||||||||||||| |||||||
Sbjct: 625 ggccgtcttcctgatgcctcccaggc 650



to top

>gb|DQ446651.1| Arabidopsis thaliana clone pENTR221-At3g09640 L-ascorbate
           peroxidase 1b (At3g09640) mRNA, complete cds
          Length = 756

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                     
Query: 279 cccacttgtggacaaatatgctgcggatgaggatgcgttctt 320
           |||| |||| || ||||||||||| ||||||||||| |||||
Sbjct: 654 cccatttgttgaaaaatatgctgcagatgaggatgccttctt 695



to top

>emb|AL137857.29| Human DNA sequence from clone RP5-1166H10 on chromosome 1p33-35.1
             Contains the MATN1 gene for matrilin 1 cartilage matrix
             protein, a novel gene (FLJ46197, FLJ33163), the 3' end of
             the gene for Lysosomal-associated multispanning membrane
             protein-5 (LAPTM5) and a CpG island, complete sequence
          Length = 152042

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 560   ggggtgttgcattgttttgctt 581
             ||||||||||||||||||||||
Sbjct: 34256 ggggtgttgcattgttttgctt 34235



to top

>gb|AC157986.4| Mus musculus chromosome 19, clone RP23-160F18, complete sequence
          Length = 207504

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 133   aaggagagatctgggtttgagg 154
             ||||||||||||||||||||||
Sbjct: 45044 aaggagagatctgggtttgagg 45023



to top

>gb|AC093529.2| Homo sapiens chromosome 5 clone RP11-29K14, complete sequence
          Length = 109306

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 104    ctggtggtcacaccctgggaagatgc 129
              |||||||||||||| |||||||||||
Sbjct: 103531 ctggtggtcacaccatgggaagatgc 103506



to top

>gb|AC027323.5| Homo sapiens chromosome 5 clone CTD-2034A10, complete sequence
          Length = 140016

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 104  ctggtggtcacaccctgggaagatgc 129
            |||||||||||||| |||||||||||
Sbjct: 9379 ctggtggtcacaccatgggaagatgc 9354



to top

>dbj|AK020572.1| Mus musculus adult male urinary bladder cDNA, RIKEN full-length
           enriched library, clone:9530025L08
           product:unclassifiable, full insert sequence
          Length = 1019

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 133 aaggagagatctgggtttgagg 154
           ||||||||||||||||||||||
Sbjct: 73  aaggagagatctgggtttgagg 94



to top

>dbj|AK176821.1| Arabidopsis thaliana mRNA for putative ascorbate peroxidase,
           complete cds, clone: RAFL25-37-O10
          Length = 992

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                     
Query: 279 cccacttgtggacaaatatgctgcggatgaggatgcgttctt 320
           |||| |||| || ||||||||||| ||||||||||| |||||
Sbjct: 716 cccatttgttgaaaaatatgctgcagatgaggatgccttctt 757



to top

>dbj|AK176908.1| Arabidopsis thaliana mRNA for putative ascorbate peroxidase,
           complete cds, clone: RAFL25-48-E13
          Length = 1075

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                     
Query: 279 cccacttgtggacaaatatgctgcggatgaggatgcgttctt 320
           |||| |||| || ||||||||||| ||||||||||| |||||
Sbjct: 799 cccatttgttgaaaaatatgctgcagatgaggatgccttctt 840



to top

>gb|AC102722.7| Mus musculus chromosome 19, clone RP24-108O16, complete sequence
          Length = 141681

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 133   aaggagagatctgggtttgagg 154
             ||||||||||||||||||||||
Sbjct: 95177 aaggagagatctgggtttgagg 95198



to top

>ref|NM_202299.1| Arabidopsis thaliana unknown protein AT1G54575 mRNA, complete cds
          Length = 638

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 562 ggtgttgcattgttttgcttttgac 586
           |||||| ||||||||||||||||||
Sbjct: 245 ggtgtttcattgttttgcttttgac 221



to top

>gb|AY773826.1| Arabidopsis thaliana clone pENTR221-At1g54575 hypothetical protein
           (At1g54575) gene, complete cds
          Length = 309

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 562 ggtgttgcattgttttgcttttgac 586
           |||||| ||||||||||||||||||
Sbjct: 212 ggtgtttcattgttttgcttttgac 188



to top

>gb|AY735542.1| Arabidopsis thaliana hypothetical protein AT1G54575 mRNA, complete
           cds
          Length = 670

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 562 ggtgttgcattgttttgcttttgac 586
           |||||| ||||||||||||||||||
Sbjct: 258 ggtgtttcattgttttgcttttgac 234



to top

>gb|BT015723.1| Arabidopsis thaliana At1g54575 gene, complete cds
          Length = 309

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 562 ggtgttgcattgttttgcttttgac 586
           |||||| ||||||||||||||||||
Sbjct: 212 ggtgtttcattgttttgcttttgac 188



to top

>gb|BT015058.1| Arabidopsis thaliana At1g54575 gene, complete cds
          Length = 573

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 562 ggtgttgcattgttttgcttttgac 586
           |||||| ||||||||||||||||||
Sbjct: 222 ggtgtttcattgttttgcttttgac 198



to top

>gb|AC119181.11| Mus musculus chromosome 18, clone RP24-111I16, complete sequence
          Length = 195506

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 339    acacctcaagctctctgaact 359
              |||||||||||||||||||||
Sbjct: 177365 acacctcaagctctctgaact 177385



to top

>gb|AC162901.4| Mus musculus BAC clone RP23-417K5 from chromosome 8, complete sequence
          Length = 205244

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 373    gcgtctgagggctgctgctga 393
              |||||||||||||||||||||
Sbjct: 101515 gcgtctgagggctgctgctga 101495



to top

>emb|AL355990.18| Human DNA sequence from clone RP5-1028L10 on chromosome 1 Contains the
             5' end of gene LOC284462, two novel genes and a CpG
             island, complete sequence
          Length = 47338

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 31    ccaggctctgaccacctcaggcagg 55
             |||||||||| ||||||||||||||
Sbjct: 26548 ccaggctctgtccacctcaggcagg 26524



to top

>dbj|AK221685.1| Arabidopsis thaliana mRNA for hypothetical protein, complete cds,
           clone: RAFL14-90-M11
          Length = 654

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 562 ggtgttgcattgttttgcttttgac 586
           |||||| ||||||||||||||||||
Sbjct: 258 ggtgtttcattgttttgcttttgac 234



to top

>gb|AC005388.1|T22H22 Sequence of BAC T22H22 from Arabidopsis thaliana chromosome 1, complete
             sequence
          Length = 87768

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 562   ggtgttgcattgttttgcttttgac 586
             |||||| ||||||||||||||||||
Sbjct: 15829 ggtgtttcattgttttgcttttgac 15805



to top

>gb|AC019176.4|AC019176 Homo sapiens BAC clone RP11-221H10 from 8, complete sequence
          Length = 170680

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 566   ttgcattgttttgcttttgac 586
             |||||||||||||||||||||
Sbjct: 63462 ttgcattgttttgcttttgac 63442



to top

>emb|BX818219.1|CNS0AE3B Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL67ZF04 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 631

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 562 ggtgttgcattgttttgcttttgac 586
           |||||| ||||||||||||||||||
Sbjct: 238 ggtgtttcattgttttgcttttgac 214



to top

>emb|BX818269.1|CNS0AB1D Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL6ZF07 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 599

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 562 ggtgttgcattgttttgcttttgac 586
           |||||| ||||||||||||||||||
Sbjct: 229 ggtgtttcattgttttgcttttgac 205



to top

>emb|BX817787.1|CNS0AAX6 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL41ZD08 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 630

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 562 ggtgttgcattgttttgcttttgac 586
           |||||| ||||||||||||||||||
Sbjct: 245 ggtgtttcattgttttgcttttgac 221



to top

>gb|CP000009.1| Gluconobacter oxydans 621H, complete genome
          Length = 2702173

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 298     gctgcggatgaggatgcgttc 318
               |||||||||||||||||||||
Sbjct: 1358119 gctgcggatgaggatgcgttc 1358099



to top

>emb|AL136293.5|CNS01DVX Human chromosome 14 DNA sequence BAC C-2555C10 of library CalTech-D
             from chromosome 14 of Homo sapiens (Human), complete
             sequence
          Length = 226035

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 520   catgtgtttgtctggatttgg 540
             |||||||||||||||||||||
Sbjct: 48800 catgtgtttgtctggatttgg 48820



to top

>gb|AC124491.5| Mus musculus BAC clone RP23-454B2 from chromosome 8, complete sequence
          Length = 187779

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 373   gcgtctgagggctgctgctga 393
             |||||||||||||||||||||
Sbjct: 32993 gcgtctgagggctgctgctga 33013



to top

>ref|XM_608956.2| PREDICTED: Bos taurus similar to Nucleolar preribosomal-associated
            protein 1 (LOC530483), mRNA
          Length = 8377

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 203  agctcctgagtggggagaag 222
            ||||||||||||||||||||
Sbjct: 1199 agctcctgagtggggagaag 1218



to top

>gb|AC134560.5| Mus musculus BAC clone RP24-100B13 from chromosome 16, complete sequence
          Length = 175179

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 203    agctcctgagtggggagaag 222
              ||||||||||||||||||||
Sbjct: 151918 agctcctgagtggggagaag 151937



to top

>ref|XM_981494.1| PREDICTED: Mus musculus similar to Nucleolar
           preribosomal-associated protein 1 (LOC670473), mRNA
          Length = 1619

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 203 agctcctgagtggggagaag 222
           ||||||||||||||||||||
Sbjct: 671 agctcctgagtggggagaag 690



to top

>ref|XM_489612.4| PREDICTED: Mus musculus RIKEN cDNA 4921511H13 gene (4921511H13Rik),
           mRNA
          Length = 7482

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 203 agctcctgagtggggagaag 222
           ||||||||||||||||||||
Sbjct: 300 agctcctgagtggggagaag 319



to top

>ref|XM_904396.2| PREDICTED: Mus musculus RIKEN cDNA 4921511H13 gene (4921511H13Rik),
           mRNA
          Length = 7482

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 203 agctcctgagtggggagaag 222
           ||||||||||||||||||||
Sbjct: 300 agctcctgagtggggagaag 319



to top

>ref|XM_975719.1| PREDICTED: Mus musculus similar to AIDA-1b, transcript variant 7
            (LOC544718), mRNA
          Length = 3873

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 44   acctcaggcaggtgttttccactc 67
            |||||||||||| |||||||||||
Sbjct: 2927 acctcaggcaggggttttccactc 2950



to top

>ref|XM_975691.1| PREDICTED: Mus musculus similar to AIDA-1b, transcript variant 6
            (LOC544718), mRNA
          Length = 4510

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 44   acctcaggcaggtgttttccactc 67
            |||||||||||| |||||||||||
Sbjct: 3564 acctcaggcaggggttttccactc 3587



to top

>ref|XM_975823.1| PREDICTED: Mus musculus similar to AIDA-1b, transcript variant 10
            (LOC544718), mRNA
          Length = 5052

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 44   acctcaggcaggtgttttccactc 67
            |||||||||||| |||||||||||
Sbjct: 4106 acctcaggcaggggttttccactc 4129



to top

>ref|XM_975853.1| PREDICTED: Mus musculus similar to AIDA-1b, transcript variant 11
            (LOC544718), mRNA
          Length = 7565

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 44   acctcaggcaggtgttttccactc 67
            |||||||||||| |||||||||||
Sbjct: 6619 acctcaggcaggggttttccactc 6642



to top

>ref|XM_975757.1| PREDICTED: Mus musculus similar to AIDA-1b, transcript variant 8
            (LOC544718), mRNA
          Length = 5127

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 44   acctcaggcaggtgttttccactc 67
            |||||||||||| |||||||||||
Sbjct: 4181 acctcaggcaggggttttccactc 4204



to top

>ref|XM_975884.1| PREDICTED: Mus musculus similar to AIDA-1b, transcript variant 12
            (LOC544718), mRNA
          Length = 5232

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 44   acctcaggcaggtgttttccactc 67
            |||||||||||| |||||||||||
Sbjct: 4286 acctcaggcaggggttttccactc 4309



to top

>ref|XM_975790.1| PREDICTED: Mus musculus similar to AIDA-1b, transcript variant 9
            (LOC544718), mRNA
          Length = 5304

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 44   acctcaggcaggtgttttccactc 67
            |||||||||||| |||||||||||
Sbjct: 4358 acctcaggcaggggttttccactc 4381



to top

>ref|XM_975534.1| PREDICTED: Mus musculus similar to AIDA-1b, transcript variant 2
            (LOC544718), mRNA
          Length = 7333

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 44   acctcaggcaggtgttttccactc 67
            |||||||||||| |||||||||||
Sbjct: 6387 acctcaggcaggggttttccactc 6410



to top

>ref|XM_001002918.1| PREDICTED: Mus musculus ankyrin repeat and sterile alpha motif domain
            containing 1B, transcript variant 19 (Anks1b), mRNA
          Length = 3873

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 44   acctcaggcaggtgttttccactc 67
            |||||||||||| |||||||||||
Sbjct: 2927 acctcaggcaggggttttccactc 2950



to top

>ref|XM_924927.2| PREDICTED: Mus musculus ankyrin repeat and sterile alpha motif domain
            containing 1B, transcript variant 13 (Anks1b), mRNA
          Length = 7565

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 44   acctcaggcaggtgttttccactc 67
            |||||||||||| |||||||||||
Sbjct: 6619 acctcaggcaggggttttccactc 6642



to top

>ref|XM_924933.2| PREDICTED: Mus musculus ankyrin repeat and sterile alpha motif domain
            containing 1B, transcript variant 17 (Anks1b), mRNA
          Length = 5052

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 44   acctcaggcaggtgttttccactc 67
            |||||||||||| |||||||||||
Sbjct: 4106 acctcaggcaggggttttccactc 4129



to top

>ref|XM_924929.2| PREDICTED: Mus musculus ankyrin repeat and sterile alpha motif domain
            containing 1B, transcript variant 15 (Anks1b), mRNA
          Length = 5127

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 44   acctcaggcaggtgttttccactc 67
            |||||||||||| |||||||||||
Sbjct: 4181 acctcaggcaggggttttccactc 4204



to top

>ref|XM_924921.2| PREDICTED: Mus musculus ankyrin repeat and sterile alpha motif domain
            containing 1B, transcript variant 10 (Anks1b), mRNA
          Length = 5232

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 44   acctcaggcaggtgttttccactc 67
            |||||||||||| |||||||||||
Sbjct: 4286 acctcaggcaggggttttccactc 4309



to top

>ref|XM_924931.2| PREDICTED: Mus musculus ankyrin repeat and sterile alpha motif domain
            containing 1B, transcript variant 16 (Anks1b), mRNA
          Length = 5304

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 44   acctcaggcaggtgttttccactc 67
            |||||||||||| |||||||||||
Sbjct: 4358 acctcaggcaggggttttccactc 4381



to top

>ref|XM_917405.2| PREDICTED: Mus musculus ankyrin repeat and sterile alpha motif domain
            containing 1B, transcript variant 9 (Anks1b), mRNA
          Length = 7333

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 44   acctcaggcaggtgttttccactc 67
            |||||||||||| |||||||||||
Sbjct: 6387 acctcaggcaggggttttccactc 6410



to top

>ref|XM_001003427.1| PREDICTED: Mus musculus ankyrin repeat and sterile alpha motif domain
            containing 1B, transcript variant 7 (Anks1b), mRNA
          Length = 3873

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 44   acctcaggcaggtgttttccactc 67
            |||||||||||| |||||||||||
Sbjct: 2927 acctcaggcaggggttttccactc 2950



to top

>ref|XM_001003423.1| PREDICTED: Mus musculus ankyrin repeat and sterile alpha motif domain
            containing 1B, transcript variant 6 (Anks1b), mRNA
          Length = 4510

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 44   acctcaggcaggtgttttccactc 67
            |||||||||||| |||||||||||
Sbjct: 3564 acctcaggcaggggttttccactc 3587



to top

>ref|XM_001003446.1| PREDICTED: Mus musculus ankyrin repeat and sterile alpha motif domain
            containing 1B, transcript variant 11 (Anks1b), mRNA
          Length = 7565

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 44   acctcaggcaggtgttttccactc 67
            |||||||||||| |||||||||||
Sbjct: 6619 acctcaggcaggggttttccactc 6642



to top

>ref|XM_001003440.1| PREDICTED: Mus musculus ankyrin repeat and sterile alpha motif domain
            containing 1B, transcript variant 10 (Anks1b), mRNA
          Length = 5052

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 44   acctcaggcaggtgttttccactc 67
            |||||||||||| |||||||||||
Sbjct: 4106 acctcaggcaggggttttccactc 4129



to top

>ref|XM_001003432.1| PREDICTED: Mus musculus ankyrin repeat and sterile alpha motif domain
            containing 1B, transcript variant 8 (Anks1b), mRNA
          Length = 5127

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 44   acctcaggcaggtgttttccactc 67
            |||||||||||| |||||||||||
Sbjct: 4181 acctcaggcaggggttttccactc 4204



to top

>ref|XM_001003455.1| PREDICTED: Mus musculus ankyrin repeat and sterile alpha motif domain
            containing 1B, transcript variant 12 (Anks1b), mRNA
          Length = 5232

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 44   acctcaggcaggtgttttccactc 67
            |||||||||||| |||||||||||
Sbjct: 4286 acctcaggcaggggttttccactc 4309



to top

>ref|XM_001003434.1| PREDICTED: Mus musculus ankyrin repeat and sterile alpha motif domain
            containing 1B, transcript variant 9 (Anks1b), mRNA
          Length = 5304

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 44   acctcaggcaggtgttttccactc 67
            |||||||||||| |||||||||||
Sbjct: 4358 acctcaggcaggggttttccactc 4381



to top

>ref|XM_001003400.1| PREDICTED: Mus musculus ankyrin repeat and sterile alpha motif domain
            containing 1B, transcript variant 2 (Anks1b), mRNA
          Length = 7813

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 44   acctcaggcaggtgttttccactc 67
            |||||||||||| |||||||||||
Sbjct: 6867 acctcaggcaggggttttccactc 6890



to top

>emb|Z95116.1|HS57G9 Human DNA sequence from clone CTA-57G9 on chromosome 22q12.1, complete
             sequence
          Length = 113872

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 61    tccactcagatgggtttgag 80
             ||||||||||||||||||||
Sbjct: 33207 tccactcagatgggtttgag 33188



to top

>ref|XM_779767.1| PREDICTED: Strongylocentrotus purpuratus similar to Ankyrin repeat
            and SAM domain containing protein 1 (LOC579663), mRNA
          Length = 4386

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 304  gatgaggatgcgttctttgc 323
            ||||||||||||||||||||
Sbjct: 2401 gatgaggatgcgttctttgc 2382



to top

>emb|X98275.1|ATAPCYT A.thaliana mRNA for ascorbate peroxidase, cytosolic (APX2)
          Length = 756

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 279 cccacttgtggacaaatatgctgcggatgaggatgc 314
           |||| |||| || ||||||||||| |||||||||||
Sbjct: 654 cccatttgttgaaaaatatgctgcagatgaggatgc 689



to top

>emb|CR858482.1| Pongo pygmaeus mRNA; cDNA DKFZp469D094 (from clone DKFZp469D094)
          Length = 4768

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 96   tgctctttctggtggtcaca 115
            ||||||||||||||||||||
Sbjct: 1230 tgctctttctggtggtcaca 1211



to top

>dbj|AK050735.1| Mus musculus 9 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:D030012J21 product:hypothetical
           protein, full insert sequence
          Length = 2184

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 203 agctcctgagtggggagaag 222
           ||||||||||||||||||||
Sbjct: 301 agctcctgagtggggagaag 320



to top

>gb|AC026437.5|AC026437 Homo sapiens chromosome 5 clone CTD-2251O21, complete sequence
          Length = 91770

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 29    acccaggctctgaccacctc 48
             ||||||||||||||||||||
Sbjct: 26687 acccaggctctgaccacctc 26668



to top

>dbj|AK034224.1| Mus musculus adult male diencephalon cDNA, RIKEN full-length enriched
            library, clone:9330165B21 product:RIKEN cDNA C030032C09
            gene, full insert sequence
          Length = 2590

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 44   acctcaggcaggtgttttccactc 67
            |||||||||||| |||||||||||
Sbjct: 1648 acctcaggcaggggttttccactc 1671



to top

>dbj|AK017495.1| Mus musculus 8 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:5730405K23 product:hypothetical
           protein, full insert sequence
          Length = 1224

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 203 agctcctgagtggggagaag 222
           ||||||||||||||||||||
Sbjct: 294 agctcctgagtggggagaag 313



to top

>gb|AC010491.4| Homo sapiens chromosome 5 clone CTD-2335I23, complete sequence
          Length = 142056

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 29     acccaggctctgaccacctc 48
              ||||||||||||||||||||
Sbjct: 122322 acccaggctctgaccacctc 122303



to top

>gb|AC018633.2|AC018633 Homo sapiens clone UWGC:djs1 or RP11-16G1 from 7p14-15, complete
             sequence
          Length = 169234

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 150   tgagggagcctggaccgcca 169
             ||||||||||||||||||||
Sbjct: 73256 tgagggagcctggaccgcca 73237



to top

>gb|AC138719.4| Mus musculus BAC clone RP23-178O8 from 10, complete sequence
          Length = 183689

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 44     acctcaggcaggtgttttccactc 67
              |||||||||||| |||||||||||
Sbjct: 151957 acctcaggcaggggttttccactc 151980



to top

>gb|AC140410.3| Mus musculus BAC clone RP23-141J11 from 10, complete sequence
          Length = 205197

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 44   acctcaggcaggtgttttccactc 67
            |||||||||||| |||||||||||
Sbjct: 9787 acctcaggcaggggttttccactc 9810



to top

>emb|AL772259.7| Mouse DNA sequence from clone RP23-408D7 on chromosome 4, complete
            sequence
          Length = 48500

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 38   ctgaccacctcaggcaggtg 57
            ||||||||||||||||||||
Sbjct: 4460 ctgaccacctcaggcaggtg 4479


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,626,968
Number of Sequences: 3902068
Number of extensions: 4626968
Number of successful extensions: 110477
Number of sequences better than 10.0: 233
Number of HSP's better than 10.0 without gapping: 233
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 109908
Number of HSP's gapped (non-prelim): 511
length of query: 623
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 600
effective length of database: 17,143,297,704
effective search space: 10285978622400
effective search space used: 10285978622400
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top