| Clone Name | bags5k04 |
|---|---|
| Clone Library Name | barley_pub |
>emb|AJ222589.1|ZMPARP2 Zea mays mRNA for poly(ADP-ribose) polymerase (3211bp) Length = 3211 Score = 630 bits (318), Expect = e-177 Identities = 603/698 (86%) Strand = Plus / Plus Query: 16 gaagatggcaaaagcatttacaatacaaccctaaacatttctgacatgacacaaggtgtt 75 |||||||| |||||||| |||||| ||||| ||||||| |||||| || ||| |||||| Sbjct: 1613 gaagatgggaaaagcatatacaatgcaaccttaaacatgtctgacctggcactaggtgtg 1672 Query: 76 aacagctactatatacttcagatcatcgaagaggatgatgggagtgaatgctatgtattt 135 |||||||||||| |||| |||||||| ||| ||||||||||| ||| ||||| |||||| Sbjct: 1673 aacagctactatgtactccagatcattgaacaggatgatgggtctgagtgctacgtattt 1732 Query: 136 cgaaagtgggggcgagttggcagtgaaaagattggtggaaagaaactggaggagatgtca 195 || |||||||| || ||||| ||||| || ||||| || | |||||||||||||||||| Sbjct: 1733 cgtaagtggggacgggttgggagtgagaaaattggagggcaaaaactggaggagatgtca 1792 Query: 196 aaaactgacgcaatacatgaatttaaaagattatttctggaaaagactggaaacccctgg 255 |||||||| ||||| | ||||| |||||||||||||| || |||||||||||| | ||| Sbjct: 1793 aaaactgaggcaatcaaggaattcaaaagattatttcttgagaagactggaaactcatgg 1852 Query: 256 gaagcatgggaacaaaaaacaaattttcagaagcagcctgggagattttatccacttgac 315 ||||| |||||| ||||| ||||||| ||||||||||||||||||||| |||||||| Sbjct: 1853 gaagcttgggaatgtaaaaccaattttcggaagcagcctgggagattttacccacttgat 1912 Query: 316 attgattacggagttaagcaagcaccgaaacggaaagacatcagcaaaatgaaaagttca 375 ||||||| || |||||| ||||||| ||||||||||| ||||| ||||||||||||| Sbjct: 1913 gttgattatggtgttaagaaagcaccaaaacggaaagatatcagtgaaatgaaaagttct 1972 Query: 376 cttgctcctcaggtgctggaactcatgatgatgcttttcaatgttgaaacatatagggct 435 ||||||||||| |||| |||||||||| ||||||||||||||| || |||||||| ||| Sbjct: 1973 cttgctcctcaattgctagaactcatgaagatgcttttcaatgtggagacatatagagct 2032 Query: 436 gctatgatggaatttgaaatcaatatggcagaaatgccccttgggaaattaagcaaggaa 495 |||||||||||||||||||| |||||| |||||||||| |||||||| ||||||||||| Sbjct: 2033 gctatgatggaatttgaaattaatatgtcagaaatgcctcttgggaagctaagcaaggaa 2092 Query: 496 aatatccagaaaggatttgaagcattaactgagatacaaaatctactggatgacactggc 555 ||||| ||||||||||||||||||||||||||||||| ||| || || | ||||| | Sbjct: 2093 aatattgagaaaggatttgaagcattaactgagatacagaatttattgaaggacaccgct 2152 Query: 556 aatcaagaactggctcttagagagagcttgattgttgctgcaagcaatcgtttcttcact 615 |||||| ||||||| ||||||| ||||| ||||||||||| |||||||| || |||||| Sbjct: 2153 gatcaagcactggctgttagagaaagcttaattgttgctgcgagcaatcgctttttcact 2212 Query: 616 cttattccttctgttcatccacatattatacatgataaggatgacctgacaatgaaagcg 675 ||||| |||||| ||||||| |||||||||| ||| ||||||| ||| || |||||| Sbjct: 2213 cttatcccttctattcatcctcatattatacgggatgaggatgatttgatgatcaaagcg 2272 Query: 676 aaaatgcttgaagctcttcaggatattgaaattgcttc 713 ||||||||||||||||| |||||||||||||||||||| Sbjct: 2273 aaaatgcttgaagctctgcaggatattgaaattgcttc 2310
>gb|AF093627.1|AF093627 Zea mays poly(ADP)-ribose polymerase (PARP1) mRNA, complete cds Length = 3285 Score = 630 bits (318), Expect = e-177 Identities = 603/698 (86%) Strand = Plus / Plus Query: 16 gaagatggcaaaagcatttacaatacaaccctaaacatttctgacatgacacaaggtgtt 75 |||||||| |||||||| |||||| ||||| ||||||| |||||| || ||| |||||| Sbjct: 1633 gaagatgggaaaagcatatacaatgcaaccttaaacatgtctgacctggcactaggtgtg 1692 Query: 76 aacagctactatatacttcagatcatcgaagaggatgatgggagtgaatgctatgtattt 135 |||||||||||| |||| |||||||| ||| ||||||||||| ||| ||||| |||||| Sbjct: 1693 aacagctactatgtactccagatcattgaacaggatgatgggtctgagtgctacgtattt 1752 Query: 136 cgaaagtgggggcgagttggcagtgaaaagattggtggaaagaaactggaggagatgtca 195 || |||||||| || ||||| ||||| || ||||| || | |||||||||||||||||| Sbjct: 1753 cgtaagtggggacgggttgggagtgagaaaattggagggcaaaaactggaggagatgtca 1812 Query: 196 aaaactgacgcaatacatgaatttaaaagattatttctggaaaagactggaaacccctgg 255 |||||||| ||||| | ||||| |||||||||||||| || |||||||||||| | ||| Sbjct: 1813 aaaactgaggcaatcaaggaattcaaaagattatttcttgagaagactggaaactcatgg 1872 Query: 256 gaagcatgggaacaaaaaacaaattttcagaagcagcctgggagattttatccacttgac 315 ||||| |||||| ||||| ||||||| ||||||||||||||||||||| |||||||| Sbjct: 1873 gaagcttgggaatgtaaaaccaattttcggaagcagcctgggagattttacccacttgat 1932 Query: 316 attgattacggagttaagcaagcaccgaaacggaaagacatcagcaaaatgaaaagttca 375 ||||||| || |||||| ||||||| ||||||||||| ||||| ||||||||||||| Sbjct: 1933 gttgattatggtgttaagaaagcaccaaaacggaaagatatcagtgaaatgaaaagttct 1992 Query: 376 cttgctcctcaggtgctggaactcatgatgatgcttttcaatgttgaaacatatagggct 435 ||||||||||| |||| |||||||||| ||||||||||||||| || |||||||| ||| Sbjct: 1993 cttgctcctcaattgctagaactcatgaagatgcttttcaatgtggagacatatagagct 2052 Query: 436 gctatgatggaatttgaaatcaatatggcagaaatgccccttgggaaattaagcaaggaa 495 |||||||||||||||||||| |||||| |||||||||| |||||||| ||||||||||| Sbjct: 2053 gctatgatggaatttgaaattaatatgtcagaaatgcctcttgggaagctaagcaaggaa 2112 Query: 496 aatatccagaaaggatttgaagcattaactgagatacaaaatctactggatgacactggc 555 ||||| ||||||||||||||||||||||||||||||| ||| || || | ||||| | Sbjct: 2113 aatattgagaaaggatttgaagcattaactgagatacagaatttattgaaggacaccgct 2172 Query: 556 aatcaagaactggctcttagagagagcttgattgttgctgcaagcaatcgtttcttcact 615 |||||| ||||||| ||||||| ||||| ||||||||||| |||||||| || |||||| Sbjct: 2173 gatcaagcactggctgttagagaaagcttaattgttgctgcgagcaatcgctttttcact 2232 Query: 616 cttattccttctgttcatccacatattatacatgataaggatgacctgacaatgaaagcg 675 ||||| |||||| ||||||| |||||||||| ||| ||||||| ||| || |||||| Sbjct: 2233 cttatcccttctattcatcctcatattatacgggatgaggatgatttgatgatcaaagcg 2292 Query: 676 aaaatgcttgaagctcttcaggatattgaaattgcttc 713 ||||||||||||||||| |||||||||||||||||||| Sbjct: 2293 aaaatgcttgaagctctgcaggatattgaaattgcttc 2330
>ref|XM_477671.1| Oryza sativa (japonica cultivar-group), mRNA Length = 3292 Score = 609 bits (307), Expect = e-171 Identities = 601/699 (85%) Strand = Plus / Plus Query: 16 gaagatggcaaaagcatttacaatacaaccctaaacatttctgacatgacacaaggtgtt 75 |||||||| |||||||| |||||||||||||| ||||| |||||| |||||| |||||| Sbjct: 1609 gaagatggaaaaagcatatacaatacaaccctgaacatgtctgacctgacacgaggtgtg 1668 Query: 76 aacagctactatatacttcagatcatcgaagaggatgatgggagtgaatgctatgtattt 135 |||||||| |||||||||||| |||| ||||||||| ||||| ||| || |||||||| Sbjct: 1669 aacagctattatatacttcaggtcattgaagaggataatgggtctgattgttatgtattc 1728 Query: 136 cgaaagtgggggcgagttggcagtgaaaagattggtggaaagaaactggaggagatgtca 195 ||||||||||| |||||||| | |||||| ||||| || | || ||||||||||||| Sbjct: 1729 cgaaagtggggacgagttgggaatgaaaaaattggaggcactaagttggaggagatgtcg 1788 Query: 196 aaaactgacgcaatacatgaatttaaaagattatttctggaaaagactggaaacccctgg 255 |||| | | || || || ||||||| |||||| ||||| || |||||||||||||||||| Sbjct: 1789 aaaattcatgctattcaggaatttagaagattgtttcttgagaagactggaaacccctgg 1848 Query: 256 gaagcatgggaacaaaaaacaaattttcagaagcagcctgggagattttatccacttgac 315 |||||||||||||||||||||||||| || ||||||||||||| |||||||||||||||| Sbjct: 1849 gaagcatgggaacaaaaaacaaatttccaaaagcagcctgggaaattttatccacttgac 1908 Query: 316 attgattacggagttaagcaagcaccgaaacggaaagacatcagcaaaatgaaaagttca 375 ||||| || || || | ||||| ||| || ||||||||||| |||||||||||||||| Sbjct: 1909 attgactatggtgtaaggcaaggaccaaagcggaaagacattgacaaaatgaaaagttca 1968 Query: 376 cttgctcctcaggtgctggaactcatgatgatgcttttcaatgttgaaacatatagggct 435 ||| |||| ||| ||||||| ||||||| |||||||||||| |||||||||| |||||| Sbjct: 1969 cttcctccccagttgctggagctcatgaatatgcttttcaatattgaaacatacagggct 2028 Query: 436 gctatgatggaatttgaaatcaatatggcagaaatgccccttgggaaattaagcaaggaa 495 |||||| ||||||| |||| || ||| | || |||||||| || ||| ||||||||||| Sbjct: 2029 gctatgctggaattcaaaattaacatgtctgagatgcccctgggtaaactaagcaaggaa 2088 Query: 496 aatatccagaaaggatttgaagcattaactgagatacaaaatctactggatgacactggc 555 |||||||| ||||| ||||||||||||||||||||||| |||||| ||| | ||||| Sbjct: 2089 aatatccaaaaaggttttgaagcattaactgagatacagaatctattgggtaacactaat 2148 Query: 556 aatcaagaactggctcttagagagagcttgattgttgctgcaagcaatcgtttcttcact 615 |||||||||||||| |||||||||||||||| ||||| || ||||||||||||||||| Sbjct: 2149 aatcaagaactggcggttagagagagcttgatcgttgccgcgagcaatcgtttcttcacc 2208 Query: 616 cttattccttctgttcatccacatattatacatgataaggatgacctgacaatgaaagcg 675 |||||||||||| ||||||| || |||||||| ||| ||||||| ||| |||||| | Sbjct: 2209 cttattccttctattcatcctcacattatacaagatgaggatgatttgatggtgaaagtg 2268 Query: 676 aaaatgcttgaagctcttcaggatattgaaattgcttct 714 ||||||||||||||||| || |||||||||||||||||| Sbjct: 2269 aaaatgcttgaagctctgcaagatattgaaattgcttct 2307
>dbj|AK106540.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-108-D11, full insert sequence Length = 1964 Score = 601 bits (303), Expect = e-168 Identities = 600/699 (85%) Strand = Plus / Plus Query: 16 gaagatggcaaaagcatttacaatacaaccctaaacatttctgacatgacacaaggtgtt 75 |||||||| |||||||| |||||||||||||| ||||| |||||| |||||| |||||| Sbjct: 244 gaagatggaaaaagcatatacaatacaaccctgaacatgtctgacctgacacgaggtgtg 303 Query: 76 aacagctactatatacttcagatcatcgaagaggatgatgggagtgaatgctatgtattt 135 |||||||| |||||||||||| |||| ||||||||| ||||| ||| || |||||||| Sbjct: 304 aacagctattatatacttcaggtcattgaagaggataatgggtctgattgttatgtattc 363 Query: 136 cgaaagtgggggcgagttggcagtgaaaagattggtggaaagaaactggaggagatgtca 195 ||||||||||| |||||||| | |||||| ||||| || | || ||||||||||||| Sbjct: 364 cgaaagtggggacgagttgggaatgaaaaaattggaggcactaagttggaggagatgtcg 423 Query: 196 aaaactgacgcaatacatgaatttaaaagattatttctggaaaagactggaaacccctgg 255 |||| | | || || || ||||||| |||||| ||||| || |||||||||||||||||| Sbjct: 424 aaaattcatgctattcaggaatttagaagattgtttcttgagaagactggaaacccctgg 483 Query: 256 gaagcatgggaacaaaaaacaaattttcagaagcagcctgggagattttatccacttgac 315 |||||||||||||||||||||||||| || ||||||||||||| |||||||||||||||| Sbjct: 484 gaagcatgggaacaaaaaacaaatttccaaaagcagcctgggaaattttatccacttgac 543 Query: 316 attgattacggagttaagcaagcaccgaaacggaaagacatcagcaaaatgaaaagttca 375 ||||| || || || | ||||| ||| || ||||||||||| |||||||||||||||| Sbjct: 544 attgactatggtgtaaggcaaggaccaaagcggaaagacattgacaaaatgaaaagttca 603 Query: 376 cttgctcctcaggtgctggaactcatgatgatgcttttcaatgttgaaacatatagggct 435 ||| |||| ||| ||||||| ||||||| |||||||||||| |||||||||| |||||| Sbjct: 604 cttcctccccagttgctggagctcatgaatatgcttttcaatattgaaacatacagggct 663 Query: 436 gctatgatggaatttgaaatcaatatggcagaaatgccccttgggaaattaagcaaggaa 495 |||||| ||||||| |||| || ||| | || |||||||| || ||| ||||||||||| Sbjct: 664 gctatgctggaattcaaaattaacatgtctgagatgcccctgggtaaactaagcaaggaa 723 Query: 496 aatatccagaaaggatttgaagcattaactgagatacaaaatctactggatgacactggc 555 |||||||| ||||| |||||||||||||||||||||| |||||| ||| | ||||| Sbjct: 724 aatatccaaaaaggtgttgaagcattaactgagatacagaatctattgggtaacactaat 783 Query: 556 aatcaagaactggctcttagagagagcttgattgttgctgcaagcaatcgtttcttcact 615 |||||||||||||| |||||||||||||||| ||||| || ||||||||||||||||| Sbjct: 784 aatcaagaactggcggttagagagagcttgatcgttgccgcgagcaatcgtttcttcacc 843 Query: 616 cttattccttctgttcatccacatattatacatgataaggatgacctgacaatgaaagcg 675 |||||||||||| ||||||| || |||||||| ||| ||||||| ||| |||||| | Sbjct: 844 cttattccttctattcatcctcacattatacaagatgaggatgatttgatggtgaaagtg 903 Query: 676 aaaatgcttgaagctcttcaggatattgaaattgcttct 714 ||||||||||||||||| || |||||||||||||||||| Sbjct: 904 aaaatgcttgaagctctgcaagatattgaaattgcttct 942
>dbj|AK103479.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033130E20, full insert sequence Length = 3292 Score = 601 bits (303), Expect = e-168 Identities = 600/699 (85%) Strand = Plus / Plus Query: 16 gaagatggcaaaagcatttacaatacaaccctaaacatttctgacatgacacaaggtgtt 75 |||||||| |||||||| |||||||||||||| ||||| |||||| |||||| |||||| Sbjct: 1609 gaagatggaaaaagcatatacaatacaaccctgaacatgtctgacctgacacgaggtgtg 1668 Query: 76 aacagctactatatacttcagatcatcgaagaggatgatgggagtgaatgctatgtattt 135 |||||||| |||||||||||| |||| ||||||||| ||||| ||| || |||||||| Sbjct: 1669 aacagctattatatacttcaggtcattgaagaggataatgggtctgattgttatgtattc 1728 Query: 136 cgaaagtgggggcgagttggcagtgaaaagattggtggaaagaaactggaggagatgtca 195 ||||||||||| |||||||| | |||||| ||||| || | || ||||||||||||| Sbjct: 1729 cgaaagtggggacgagttgggaatgaaaaaattggaggcactaagttggaggagatgtcg 1788 Query: 196 aaaactgacgcaatacatgaatttaaaagattatttctggaaaagactggaaacccctgg 255 |||| | | || || || ||||||| |||||| ||||| || |||||||||||||||||| Sbjct: 1789 aaaattcatgctattcaggaatttagaagattgtttcttgagaagactggaaacccctgg 1848 Query: 256 gaagcatgggaacaaaaaacaaattttcagaagcagcctgggagattttatccacttgac 315 |||||||||||||||||||||||||| || ||||||||||||| |||||||||||||||| Sbjct: 1849 gaagcatgggaacaaaaaacaaatttccaaaagcagcctgggaaattttatccacttgac 1908 Query: 316 attgattacggagttaagcaagcaccgaaacggaaagacatcagcaaaatgaaaagttca 375 ||||| || | || | ||||| ||| || ||||||||||| |||||||||||||||| Sbjct: 1909 attgactatagtgtaaggcaaggaccaaagcggaaagacattgacaaaatgaaaagttca 1968 Query: 376 cttgctcctcaggtgctggaactcatgatgatgcttttcaatgttgaaacatatagggct 435 ||| |||| ||| ||||||| ||||||| |||||||||||| |||||||||| |||||| Sbjct: 1969 cttcctccccagttgctggagctcatgaatatgcttttcaatattgaaacatacagggct 2028 Query: 436 gctatgatggaatttgaaatcaatatggcagaaatgccccttgggaaattaagcaaggaa 495 |||||| ||||||| |||| || ||| | || |||||||| || ||| ||||||||||| Sbjct: 2029 gctatgctggaattcaaaattaacatgtctgagatgcccctgggtaaactaagcaaggaa 2088 Query: 496 aatatccagaaaggatttgaagcattaactgagatacaaaatctactggatgacactggc 555 |||||||| ||||| ||||||||||||||||||||||| |||||| ||| | ||||| Sbjct: 2089 aatatccaaaaaggttttgaagcattaactgagatacagaatctattgggtaacactaat 2148 Query: 556 aatcaagaactggctcttagagagagcttgattgttgctgcaagcaatcgtttcttcact 615 |||||||||||||| |||||||||||||||| ||||| || ||||||||||||||||| Sbjct: 2149 aatcaagaactggcggttagagagagcttgatcgttgccgcgagcaatcgtttcttcacc 2208 Query: 616 cttattccttctgttcatccacatattatacatgataaggatgacctgacaatgaaagcg 675 |||||||||||| ||||||| || |||||||| ||| ||||||| ||| |||||| | Sbjct: 2209 cttattccttctattcatcctcacattatacaagatgaggatgatttgatggtgaaagtg 2268 Query: 676 aaaatgcttgaagctcttcaggatattgaaattgcttct 714 ||||||||||||||||| || |||||||||||||||||| Sbjct: 2269 aaaatgcttgaagctctgcaagatattgaaattgcttct 2307
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 216 bits (109), Expect = 8e-53 Identities = 208/241 (86%) Strand = Plus / Plus Query: 79 agctactatatacttcagatcatcgaagaggatgatgggagtgaatgctatgtatttcga 138 ||||| |||||||||||| |||| ||||||||| ||||| ||| || |||||||| ||| Sbjct: 12980011 agctattatatacttcaggtcattgaagaggataatgggtctgattgttatgtattccga 12980070 Query: 139 aagtgggggcgagttggcagtgaaaagattggtggaaagaaactggaggagatgtcaaaa 198 |||||||| |||||||| | |||||| ||||| || | || ||||||||||||| ||| Sbjct: 12980071 aagtggggacgagttgggaatgaaaaaattggaggcactaagttggaggagatgtcgaaa 12980130 Query: 199 actgacgcaatacatgaatttaaaagattatttctggaaaagactggaaacccctgggaa 258 | | | || || || ||||||| |||||| ||||| || ||||||||||||||||||||| Sbjct: 12980131 attcatgctattcaggaatttagaagattgtttcttgagaagactggaaacccctgggaa 12980190 Query: 259 gcatgggaacaaaaaacaaattttcagaagcagcctgggagattttatccacttgacatt 318 ||||||||||||||||||||||| || ||||||||||||| ||||||||||||||||||| Sbjct: 12980191 gcatgggaacaaaaaacaaatttccaaaagcagcctgggaaattttatccacttgacatt 12980250 Query: 319 g 319 | Sbjct: 12980251 g 12980251 Score = 153 bits (77), Expect = 9e-34 Identities = 131/149 (87%) Strand = Plus / Plus Query: 511 tttgaagcattaactgagatacaaaatctactggatgacactggcaatcaagaactggct 570 ||||||||||||||||||||||| |||||| ||| | ||||| |||||||||||||| Sbjct: 12980712 tttgaagcattaactgagatacagaatctattgggtaacactaataatcaagaactggcg 12980771 Query: 571 cttagagagagcttgattgttgctgcaagcaatcgtttcttcactcttattccttctgtt 630 |||||||||||||||| ||||| || ||||||||||||||||| |||||||||||| || Sbjct: 12980772 gttagagagagcttgatcgttgccgcgagcaatcgtttcttcacccttattccttctatt 12980831 Query: 631 catccacatattatacatgataaggatga 659 ||||| || |||||||| ||| ||||||| Sbjct: 12980832 catcctcacattatacaagatgaggatga 12980860 Score = 87.7 bits (44), Expect = 5e-14 Identities = 83/96 (86%) Strand = Plus / Plus Query: 333 gcaagcaccgaaacggaaagacatcagcaaaatgaaaagttcacttgctcctcaggtgct 392 ||||| ||| || ||||||||||| ||||||||||||||||||| |||| ||| |||| Sbjct: 12980358 gcaaggaccaaagcggaaagacattgacaaaatgaaaagttcacttcctccccagttgct 12980417 Query: 393 ggaactcatgatgatgcttttcaatgttgaaacata 428 ||| ||||||| |||||||||||| |||||||||| Sbjct: 12980418 ggagctcatgaatatgcttttcaatattgaaacata 12980453 Score = 73.8 bits (37), Expect = 7e-10 Identities = 58/65 (89%) Strand = Plus / Plus Query: 16 gaagatggcaaaagcatttacaatacaaccctaaacatttctgacatgacacaaggtgtt 75 |||||||| |||||||| |||||||||||||| ||||| |||||| |||||| |||||| Sbjct: 12979292 gaagatggaaaaagcatatacaatacaaccctgaacatgtctgacctgacacgaggtgtg 12979351 Query: 76 aacag 80 ||||| Sbjct: 12979352 aacag 12979356 Score = 63.9 bits (32), Expect = 7e-07 Identities = 38/40 (95%) Strand = Plus / Plus Query: 675 gaaaatgcttgaagctcttcaggatattgaaattgcttct 714 |||||||||||||||||| || |||||||||||||||||| Sbjct: 12981567 gaaaatgcttgaagctctgcaagatattgaaattgcttct 12981606 Score = 63.9 bits (32), Expect = 7e-07 Identities = 68/80 (85%) Strand = Plus / Plus Query: 430 agggctgctatgatggaatttgaaatcaatatggcagaaatgccccttgggaaattaagc 489 |||||||||||| ||||||| |||| || ||| | || |||||||| || ||| ||||| Sbjct: 12980545 agggctgctatgctggaattcaaaattaacatgtctgagatgcccctgggtaaactaagc 12980604 Query: 490 aaggaaaatatccagaaagg 509 |||||||||||||| ||||| Sbjct: 12980605 aaggaaaatatccaaaaagg 12980624
>dbj|AP005247.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJNBa0077F02 Length = 172442 Score = 216 bits (109), Expect = 8e-53 Identities = 208/241 (86%) Strand = Plus / Plus Query: 79 agctactatatacttcagatcatcgaagaggatgatgggagtgaatgctatgtatttcga 138 ||||| |||||||||||| |||| ||||||||| ||||| ||| || |||||||| ||| Sbjct: 54308 agctattatatacttcaggtcattgaagaggataatgggtctgattgttatgtattccga 54367 Query: 139 aagtgggggcgagttggcagtgaaaagattggtggaaagaaactggaggagatgtcaaaa 198 |||||||| |||||||| | |||||| ||||| || | || ||||||||||||| ||| Sbjct: 54368 aagtggggacgagttgggaatgaaaaaattggaggcactaagttggaggagatgtcgaaa 54427 Query: 199 actgacgcaatacatgaatttaaaagattatttctggaaaagactggaaacccctgggaa 258 | | | || || || ||||||| |||||| ||||| || ||||||||||||||||||||| Sbjct: 54428 attcatgctattcaggaatttagaagattgtttcttgagaagactggaaacccctgggaa 54487 Query: 259 gcatgggaacaaaaaacaaattttcagaagcagcctgggagattttatccacttgacatt 318 ||||||||||||||||||||||| || ||||||||||||| ||||||||||||||||||| Sbjct: 54488 gcatgggaacaaaaaacaaatttccaaaagcagcctgggaaattttatccacttgacatt 54547 Query: 319 g 319 | Sbjct: 54548 g 54548 Score = 153 bits (77), Expect = 9e-34 Identities = 131/149 (87%) Strand = Plus / Plus Query: 511 tttgaagcattaactgagatacaaaatctactggatgacactggcaatcaagaactggct 570 ||||||||||||||||||||||| |||||| ||| | ||||| |||||||||||||| Sbjct: 55009 tttgaagcattaactgagatacagaatctattgggtaacactaataatcaagaactggcg 55068 Query: 571 cttagagagagcttgattgttgctgcaagcaatcgtttcttcactcttattccttctgtt 630 |||||||||||||||| ||||| || ||||||||||||||||| |||||||||||| || Sbjct: 55069 gttagagagagcttgatcgttgccgcgagcaatcgtttcttcacccttattccttctatt 55128 Query: 631 catccacatattatacatgataaggatga 659 ||||| || |||||||| ||| ||||||| Sbjct: 55129 catcctcacattatacaagatgaggatga 55157 Score = 87.7 bits (44), Expect = 5e-14 Identities = 83/96 (86%) Strand = Plus / Plus Query: 333 gcaagcaccgaaacggaaagacatcagcaaaatgaaaagttcacttgctcctcaggtgct 392 ||||| ||| || ||||||||||| ||||||||||||||||||| |||| ||| |||| Sbjct: 54655 gcaaggaccaaagcggaaagacattgacaaaatgaaaagttcacttcctccccagttgct 54714 Query: 393 ggaactcatgatgatgcttttcaatgttgaaacata 428 ||| ||||||| |||||||||||| |||||||||| Sbjct: 54715 ggagctcatgaatatgcttttcaatattgaaacata 54750 Score = 73.8 bits (37), Expect = 7e-10 Identities = 58/65 (89%) Strand = Plus / Plus Query: 16 gaagatggcaaaagcatttacaatacaaccctaaacatttctgacatgacacaaggtgtt 75 |||||||| |||||||| |||||||||||||| ||||| |||||| |||||| |||||| Sbjct: 53589 gaagatggaaaaagcatatacaatacaaccctgaacatgtctgacctgacacgaggtgtg 53648 Query: 76 aacag 80 ||||| Sbjct: 53649 aacag 53653 Score = 63.9 bits (32), Expect = 7e-07 Identities = 38/40 (95%) Strand = Plus / Plus Query: 675 gaaaatgcttgaagctcttcaggatattgaaattgcttct 714 |||||||||||||||||| || |||||||||||||||||| Sbjct: 55864 gaaaatgcttgaagctctgcaagatattgaaattgcttct 55903 Score = 63.9 bits (32), Expect = 7e-07 Identities = 68/80 (85%) Strand = Plus / Plus Query: 430 agggctgctatgatggaatttgaaatcaatatggcagaaatgccccttgggaaattaagc 489 |||||||||||| ||||||| |||| || ||| | || |||||||| || ||| ||||| Sbjct: 54842 agggctgctatgctggaattcaaaattaacatgtctgagatgcccctgggtaaactaagc 54901 Query: 490 aaggaaaatatccagaaagg 509 |||||||||||||| ||||| Sbjct: 54902 aaggaaaatatccaaaaagg 54921
>gb|AY110247.1| Zea mays CL1689_1 mRNA sequence Length = 3278 Score = 202 bits (102), Expect = 1e-48 Identities = 254/308 (82%) Strand = Plus / Plus Query: 16 gaagatggcaaaagcatttacaatacaaccctaaacatttctgacatgacacaaggtgtt 75 |||||||| |||||||| |||||| ||||| ||||||| |||||| || ||| |||||| Sbjct: 1633 gaagatgggaaaagcatatacaatgcaaccttaaacatgtctgacctggcactaggtgtg 1692 Query: 76 aacagctactatatacttcagatcatcgaagaggatgatgggagtgaatgctatgtattt 135 |||||||||||| |||| |||||||| ||| ||||||||||| ||| ||||| |||||| Sbjct: 1693 aacagctactatgtactccagatcattgaacaggatgatgggtctgagtgctacgtattt 1752 Query: 136 cgaaagtgggggcgagttggcagtgaaaagattggtggaaagaaactggaggagatgtca 195 || |||||||| || ||||| ||||| || ||||| || |||||||||||||| Sbjct: 1753 cgtaagtggggacgggttgggagtgagaaaattggagggcnnnnnctggaggagatgtcn 1812 Query: 196 aaaactgacgcaatacatgaatttaaaagattatttctggaaaagactggaaacccctgg 255 |||| ||||| | ||||| |||||||||||||| || |||||||||||| | ||| Sbjct: 1813 nnnnctgaggcaatcaaggaattcaaaagattatttcttgagaagactggaaactcatgg 1872 Query: 256 gaagcatgggaacaaaaaacaaattttcagaagcagcctgggagattttatccacttgac 315 ||||| |||||| ||||| ||||||| ||||||||||||||||||||| |||||||| Sbjct: 1873 gaagcttgggaatgtaaaaccaattttcggaagcagcctgggagattttacccacttgat 1932 Query: 316 attgatta 323 ||||||| Sbjct: 1933 gttgatta 1940 Score = 153 bits (77), Expect = 9e-34 Identities = 110/121 (90%) Strand = Plus / Plus Query: 362 aaatgaaaagttcacttgctcctcaggtgctggaactcatgatgatgcttttcaatgttg 421 ||||||||||||| ||||||||||| |||| |||||||||| ||||||||||||||| | Sbjct: 1979 aaatgaaaagttctcttgctcctcaattgctagaactcatgaagatgcttttcaatgtgg 2038 Query: 422 aaacatatagggctgctatgatggaatttgaaatcaatatggcagaaatgccccttggga 481 | |||||||| ||||||||||||||||||||||| |||||| |||||||||| ||||||| Sbjct: 2039 agacatatagagctgctatgatggaatttgaaattaatatgtcagaaatgcctcttggga 2098 Query: 482 a 482 | Sbjct: 2099 a 2099 Score = 89.7 bits (45), Expect = 1e-14 Identities = 75/85 (88%) Strand = Plus / Plus Query: 629 ttcatccacatattatacatgataaggatgacctgacaatgaaagcgaaaatgcttgaag 688 ||||||| |||||||||| ||| ||||||| ||| || ||||||||||||||||||| Sbjct: 2246 ttcatcctcatattatacgggatgaggatgatttgatgatcaaagcgaaaatgcttgaag 2305 Query: 689 ctcttcaggatattgaaattgcttc 713 |||| |||||||||||||||||||| Sbjct: 2306 ctctgcaggatattgaaattgcttc 2330 Score = 69.9 bits (35), Expect = 1e-08 Identities = 77/91 (84%) Strand = Plus / Plus Query: 514 gaagcattaactgagatacaaaatctactggatgacactggcaatcaagaactggctctt 573 |||||||||||||||||||| ||| || || | ||||| | |||||| ||||||| || Sbjct: 2131 gaagcattaactgagatacagaatttattgaaggacaccgctgatcaagcactggctgtt 2190 Query: 574 agagagagcttgattgttgctgcaagcaatc 604 ||||| ||||| ||||||||||| ||||||| Sbjct: 2191 agagaaagcttaattgttgctgcgagcaatc 2221
>ref|NM_179834.1| Arabidopsis thaliana DNA binding / NAD+ ADP-ribosyltransferase AT2G31320 mRNA, complete cds Length = 3327 Score = 85.7 bits (43), Expect = 2e-13 Identities = 136/167 (81%) Strand = Plus / Plus Query: 130 gtatttcgaaagtgggggcgagttggcagtgaaaagattggtggaaagaaactggaggag 189 |||||||| || ||||| |||||||| | ||||||||||||||| || ||| ||||||| Sbjct: 1810 gtatttcgtaaatggggccgagttggaaatgaaaagattggtggtaacaaagtggaggaa 1869 Query: 190 atgtcaaaaactgacgcaatacatgaatttaaaagattatttctggaaaagactggaaac 249 |||||||| |||| || | || ||||| ||| | ||||||| ||||| || |||||| Sbjct: 1870 atgtcaaagtctgatgcggttcacgaattcaaacgtctatttcttgaaaaaaccggaaac 1929 Query: 250 ccctgggaagcatgggaacaaaaaacaaattttcagaagcagcctgg 296 | |||||| | |||||||||||||| ||||| ||||| || ||||| Sbjct: 1930 acatgggaatcttgggaacaaaaaacgaatttccagaaacaacctgg 1976
>gb|AY150460.1| Arabidopsis thaliana putative poly(ADP-ribose) polymerase (At2g31320) mRNA, complete cds Length = 2983 Score = 85.7 bits (43), Expect = 2e-13 Identities = 136/167 (81%) Strand = Plus / Plus Query: 130 gtatttcgaaagtgggggcgagttggcagtgaaaagattggtggaaagaaactggaggag 189 |||||||| || ||||| |||||||| | ||||||||||||||| || ||| ||||||| Sbjct: 1660 gtatttcgtaaatggggccgagttggaaatgaaaagattggtggtaacaaagtggaggaa 1719 Query: 190 atgtcaaaaactgacgcaatacatgaatttaaaagattatttctggaaaagactggaaac 249 |||||||| |||| || | || ||||| ||| | ||||||| ||||| || |||||| Sbjct: 1720 atgtcaaagtctgatgcggttcacgaattcaaacgtctatttcttgaaaaaaccggaaac 1779 Query: 250 ccctgggaagcatgggaacaaaaaacaaattttcagaagcagcctgg 296 | |||||| | |||||||||||||| ||||| ||||| || ||||| Sbjct: 1780 acatgggaatcttgggaacaaaaaacgaatttccagaaacaacctgg 1826
>gb|AY091061.1| Arabidopsis thaliana putative poly (ADP-ribose) polymerase (At2g31320) mRNA, complete cds Length = 3308 Score = 85.7 bits (43), Expect = 2e-13 Identities = 136/167 (81%) Strand = Plus / Plus Query: 130 gtatttcgaaagtgggggcgagttggcagtgaaaagattggtggaaagaaactggaggag 189 |||||||| || ||||| |||||||| | ||||||||||||||| || ||| ||||||| Sbjct: 1810 gtatttcgtaaatggggccgagttggaaatgaaaagattggtggtaacaaagtggaggaa 1869 Query: 190 atgtcaaaaactgacgcaatacatgaatttaaaagattatttctggaaaagactggaaac 249 |||||||| |||| || | || ||||| ||| | ||||||| ||||| || |||||| Sbjct: 1870 atgtcaaagtctgatgcggttcacgaattcaaacgtctatttcttgaaaaaaccggaaac 1929 Query: 250 ccctgggaagcatgggaacaaaaaacaaattttcagaagcagcctgg 296 | |||||| | |||||||||||||| ||||| ||||| || ||||| Sbjct: 1930 acatgggaatcttgggaacaaaaaacgaatttccagaaacaacctgg 1976
>emb|AJ131705.1|ATH131705 Arabidopsis thaliana mRNA for poly(ADP-ribose) polymerase Length = 3187 Score = 85.7 bits (43), Expect = 2e-13 Identities = 136/167 (81%) Strand = Plus / Plus Query: 130 gtatttcgaaagtgggggcgagttggcagtgaaaagattggtggaaagaaactggaggag 189 |||||||| || ||||| |||||||| | ||||||||||||||| || ||| ||||||| Sbjct: 1670 gtatttcgtaaatggggccgagttggaaatgaaaagattggtggtaacaaagtggaggaa 1729 Query: 190 atgtcaaaaactgacgcaatacatgaatttaaaagattatttctggaaaagactggaaac 249 |||||||| |||| || | || ||||| ||| | ||||||| ||||| || |||||| Sbjct: 1730 atgtcaaagtctgatgcggttcacgaattcaaacgtctatttcttgaaaaaaccggaaac 1789 Query: 250 ccctgggaagcatgggaacaaaaaacaaattttcagaagcagcctgg 296 | |||||| | |||||||||||||| ||||| ||||| || ||||| Sbjct: 1790 acatgggaatcttgggaacaaaaaacgaatttccagaaacaacctgg 1836
>gb|AC006593.5| Arabidopsis thaliana chromosome 2 clone F16D14 map nga361, complete sequence Length = 84872 Score = 85.7 bits (43), Expect = 2e-13 Identities = 136/167 (81%) Strand = Plus / Minus Query: 130 gtatttcgaaagtgggggcgagttggcagtgaaaagattggtggaaagaaactggaggag 189 |||||||| || ||||| |||||||| | ||||||||||||||| || ||| ||||||| Sbjct: 75178 gtatttcgtaaatggggccgagttggaaatgaaaagattggtggtaacaaagtggaggaa 75119 Query: 190 atgtcaaaaactgacgcaatacatgaatttaaaagattatttctggaaaagactggaaac 249 |||||||| |||| || | || ||||| ||| | ||||||| ||||| || |||||| Sbjct: 75118 atgtcaaagtctgatgcggttcacgaattcaaacgtctatttcttgaaaaaaccggaaac 75059 Query: 250 ccctgggaagcatgggaacaaaaaacaaattttcagaagcagcctgg 296 | |||||| | |||||||||||||| ||||| ||||| || ||||| Sbjct: 75058 acatgggaatcttgggaacaaaaaacgaatttccagaaacaacctgg 75012
>gb|AC113201.15| Mus musculus chromosome 6, clone RP23-271G7, complete sequence Length = 205816 Score = 46.1 bits (23), Expect = 0.16 Identities = 23/23 (100%) Strand = Plus / Plus Query: 282 tcagaagcagcctgggagatttt 304 ||||||||||||||||||||||| Sbjct: 171207 tcagaagcagcctgggagatttt 171229
>gb|AC093502.2| Drosophila melanogaster 3L BAC RP98-48C4 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 166249 Score = 46.1 bits (23), Expect = 0.16 Identities = 23/23 (100%) Strand = Plus / Plus Query: 25 aaaagcatttacaatacaaccct 47 ||||||||||||||||||||||| Sbjct: 118043 aaaagcatttacaatacaaccct 118065
>gb|AC010031.8| Drosophila melanogaster 3L BAC RP98-2M20 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 173509 Score = 46.1 bits (23), Expect = 0.16 Identities = 23/23 (100%) Strand = Plus / Plus Query: 25 aaaagcatttacaatacaaccct 47 ||||||||||||||||||||||| Sbjct: 50052 aaaagcatttacaatacaaccct 50074
>gb|AC104703.3| Drosophila melanogaster 3L BAC RP98-35M1 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 185404 Score = 46.1 bits (23), Expect = 0.16 Identities = 23/23 (100%) Strand = Plus / Plus Query: 25 aaaagcatttacaatacaaccct 47 ||||||||||||||||||||||| Sbjct: 166498 aaaagcatttacaatacaaccct 166520
>gb|AC155655.8| Mus musculus 6 BAC RP24-66L18 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 203618 Score = 46.1 bits (23), Expect = 0.16 Identities = 23/23 (100%) Strand = Plus / Minus Query: 282 tcagaagcagcctgggagatttt 304 ||||||||||||||||||||||| Sbjct: 178893 tcagaagcagcctgggagatttt 178871
>gb|AE003536.4| Drosophila melanogaster chromosome 3L, section 49 of 83 of the complete sequence Length = 350428 Score = 46.1 bits (23), Expect = 0.16 Identities = 23/23 (100%) Strand = Plus / Minus Query: 25 aaaagcatttacaatacaaccct 47 ||||||||||||||||||||||| Sbjct: 210068 aaaagcatttacaatacaaccct 210046
>gb|AC122224.4| Mus musculus BAC clone RP23-130L16 from chromosome 9, complete sequence Length = 200246 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Plus Query: 476 ttgggaaattaagcaaggaaaa 497 |||||||||||||||||||||| Sbjct: 91759 ttgggaaattaagcaaggaaaa 91780
>gb|AC124068.6| Homo sapiens chromosome 15, clone RP11-217B1, complete sequence Length = 172505 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Plus Query: 283 cagaagcagcctgggagatttt 304 |||||||||||||||||||||| Sbjct: 76092 cagaagcagcctgggagatttt 76113
>gb|AC010595.7| Homo sapiens chromosome 5 clone CTC-480C2, complete sequence Length = 179484 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Minus Query: 266 aacaaaaaacaaattttcagaa 287 |||||||||||||||||||||| Sbjct: 8273 aacaaaaaacaaattttcagaa 8252
>gb|AC026700.5| Homo sapiens chromosome 5 clone CTC-534B23, complete sequence Length = 59483 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Minus Query: 266 aacaaaaaacaaattttcagaa 287 |||||||||||||||||||||| Sbjct: 27004 aacaaaaaacaaattttcagaa 26983
>gb|AC005318.1|AC005318 Homo sapiens Chromosome 15q26.1 PAC clone pDJ105i19, complete sequence Length = 87925 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Minus Query: 283 cagaagcagcctgggagatttt 304 |||||||||||||||||||||| Sbjct: 11618 cagaagcagcctgggagatttt 11597
>ref|NM_187448.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1365 Score = 42.1 bits (21), Expect = 2.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 611 tcactcttattccttctgttcatccacat 639 |||||||| ||||| |||||||||||||| Sbjct: 46 tcactcttcttcctcctgttcatccacat 74
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 42.1 bits (21), Expect = 2.5 Identities = 27/29 (93%) Strand = Plus / Minus Query: 611 tcactcttattccttctgttcatccacat 639 |||||||| ||||| |||||||||||||| Sbjct: 8686716 tcactcttcttcctcctgttcatccacat 8686688
>emb|CR450835.4| Zebrafish DNA sequence from clone CH211-179C12 in linkage group 7, complete sequence Length = 57975 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 188 agatgtcaaaaactgacgcaa 208 ||||||||||||||||||||| Sbjct: 55299 agatgtcaaaaactgacgcaa 55279
>emb|AL160266.25| Human DNA sequence from clone RP5-1068F3 on chromosome X, complete sequence Length = 134124 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 215 aatttaaaagattatttctgg 235 ||||||||||||||||||||| Sbjct: 30569 aatttaaaagattatttctgg 30589
>emb|BX883043.1| Rattus norvegicus chromosome 20, major histocompatibility complex, assembled from 40 BACs, strain Brown Norway (BN/ssNHsd), RT1n haplotype; segment 2/11 Length = 347664 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 175 aagaaactggaggagatgtca 195 ||||||||||||||||||||| Sbjct: 170447 aagaaactggaggagatgtca 170467
>emb|AJ439353.1|AGA439353 Anopheles gambiae BAC clone 30E5 Length = 167014 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 21 tggcaaaagcatttacaatac 41 ||||||||||||||||||||| Sbjct: 103777 tggcaaaagcatttacaatac 103757
>emb|CR376863.10| Zebrafish DNA sequence from clone DKEY-93F15 in linkage group 5, complete sequence Length = 183007 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 270 aaaaacaaattttcagaagca 290 ||||||||||||||||||||| Sbjct: 95637 aaaaacaaattttcagaagca 95657
>emb|CR354422.7| Zebrafish DNA sequence from clone CH211-129O4 in linkage group 20, complete sequence Length = 177570 Score = 42.1 bits (21), Expect = 2.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 512 ttgaagcattaactgagatacaaaa 536 ||||||||| ||||||||||||||| Sbjct: 61939 ttgaagcataaactgagatacaaaa 61915
>gb|AC171140.2| Helobdella robusta clone CH306-1B2, complete sequence Length = 105143 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 267 acaaaaaacaaattttcagaa 287 ||||||||||||||||||||| Sbjct: 51998 acaaaaaacaaattttcagaa 52018
>gb|AC135205.4| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1012B02, complete sequence Length = 115270 Score = 42.1 bits (21), Expect = 2.5 Identities = 27/29 (93%) Strand = Plus / Minus Query: 611 tcactcttattccttctgttcatccacat 639 |||||||| ||||| |||||||||||||| Sbjct: 30367 tcactcttcttcctcctgttcatccacat 30339
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 42.1 bits (21), Expect = 2.5 Identities = 27/29 (93%) Strand = Plus / Minus Query: 611 tcactcttattccttctgttcatccacat 639 |||||||| ||||| |||||||||||||| Sbjct: 8684551 tcactcttcttcctcctgttcatccacat 8684523
>emb|BX088722.8| Zebrafish DNA sequence from clone CH211-253P18 in linkage group 20, complete sequence Length = 195359 Score = 42.1 bits (21), Expect = 2.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 512 ttgaagcattaactgagatacaaaa 536 ||||||||| ||||||||||||||| Sbjct: 85776 ttgaagcataaactgagatacaaaa 85752
>emb|CT485787.6| Mouse DNA sequence from clone RP23-412N8 on chromosome 14, complete sequence Length = 210837 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 270 aaaaacaaattttcagaagca 290 ||||||||||||||||||||| Sbjct: 68126 aaaaacaaattttcagaagca 68106
>gb|CP000025.1| Campylobacter jejuni RM1221, complete genome Length = 1777831 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 17 aagatggcaaaagcatttac 36 |||||||||||||||||||| Sbjct: 984953 aagatggcaaaagcatttac 984972
>gb|AF443188.1| Paracoccidioides brasiliensis sorbitol dehydrogenase (SOR1) gene; hydroxyacid dehydrogenase protein Ynl274c (YNL274c) gene; and 60S ribosomal protein Rpl17A (RPL17A) gene, partial cds Length = 6361 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 487 agcaaggaaaatatccagaa 506 |||||||||||||||||||| Sbjct: 1703 agcaaggaaaatatccagaa 1722
>gb|AC129583.15| Mus musculus chromosome 15, clone RP23-197P10, complete sequence Length = 206094 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 53 tttctgacatgacacaaggt 72 |||||||||||||||||||| Sbjct: 13697 tttctgacatgacacaaggt 13678
>gb|AC160552.13| Mus musculus chromosome 3, clone RP23-326D6, complete sequence Length = 210051 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 281 ttcagaagcagcctgggaga 300 |||||||||||||||||||| Sbjct: 118706 ttcagaagcagcctgggaga 118687
>ref|NM_001030950.1| Gallus gallus RAD21 homolog (S. pombe) (RAD21), mRNA Length = 3679 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 170 gtggaaagaaactggaggag 189 |||||||||||||||||||| Sbjct: 1215 gtggaaagaaactggaggag 1234
>ref|NM_013707.1| Mus musculus keratin associated protein 14 (Krtap14), mRNA Length = 859 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 236 aaaagactggaaacccctgg 255 |||||||||||||||||||| Sbjct: 372 aaaagactggaaacccctgg 353
>gb|AY559299.1| Pan troglodytes verus isolate Yvonne large multifunctional protease 7 (lmp7) gene, exon 6 and partial cds; and antigen peptide transporter 2 gene, exons 1 through 6 and partial cds Length = 9362 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 8288 cttcactcttattccttctg 8307
>gb|AY559298.1| Pan troglodytes verus isolate Yvonne large multifunctional protease 7 (lmp7) gene, exon 6 and partial cds; and antigen peptide transporter 2 gene, exons 1 through 6 and partial cds Length = 9368 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 8295 cttcactcttattccttctg 8314
>gb|AY559297.1| Pan troglodytes verus isolate Yoran large multifunctional protease 7 (lmp7) gene, exon 6 and partial cds; and antigen peptide transporter 2 gene, exons 1 through 6 and partial cds Length = 9366 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 8292 cttcactcttattccttctg 8311
>gb|AY559296.1| Pan troglodytes verus isolate Yoran large multifunctional protease 7 (lmp7) gene, exon 6 and partial cds; and antigen peptide transporter 2 gene, exons 1 through 6 and partial cds Length = 9370 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 8296 cttcactcttattccttctg 8315
>gb|AY559295.1| Pan troglodytes verus isolate Sonja large multifunctional protease 7 (lmp7) gene, exon 6 and partial cds; and antigen peptide transporter 2 gene, exons 1 through 6 and partial cds Length = 9366 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 8292 cttcactcttattccttctg 8311
>gb|AY559294.1| Pan troglodytes verus isolate Sonja large multifunctional protease 7 (lmp7) gene, exon 6 and partial cds; and antigen peptide transporter 2 gene, exons 1 through 6 and partial cds Length = 9370 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 8296 cttcactcttattccttctg 8315
>gb|AY559293.1| Pan troglodytes verus isolate Socrates large multifunctional protease 7 (lmp7) gene, exon 6 and partial cds; and antigen peptide transporter 2 gene, exons 1 through 6 and partial cds Length = 9362 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 8288 cttcactcttattccttctg 8307
>gb|AY559292.1| Pan troglodytes verus isolate Socrates large multifunctional protease 7 (lmp7) gene, exon 6 and partial cds; and antigen peptide transporter 2 gene, exons 1 through 6 and partial cds Length = 9370 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 8296 cttcactcttattccttctg 8315
>gb|AY559291.1| Pan troglodytes verus isolate Regina large multifunctional protease 7 (lmp7) gene, exon 6 and partial cds; and antigen peptide transporter 2 gene, exons 1 through 6 and partial cds Length = 9362 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 8288 cttcactcttattccttctg 8307
>gb|AY559290.1| Pan troglodytes verus isolate Regina large multifunctional protease 7 (lmp7) gene, exon 6 and partial cds; and antigen peptide transporter 2 gene, exons 1 through 6 and partial cds Length = 9368 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 8295 cttcactcttattccttctg 8314
>gb|AY559289.1| Pan troglodytes verus isolate Oscar large multifunctional protease 7 (lmp7) gene, exon 6 and partial cds; and antigen peptide transporter 2 gene, exons 1 through 6 and partial cds Length = 9367 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 8293 cttcactcttattccttctg 8312
>gb|AY559288.1| Pan troglodytes verus isolate Oscar large multifunctional protease 7 (lmp7) gene, exon 6 and partial cds; and antigen peptide transporter 2 gene, exons 1 through 6 and partial cds Length = 9368 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 8295 cttcactcttattccttctg 8314
>gb|AY559287.1| Pan troglodytes verus isolate Marco large multifunctional protease 7 (lmp7) gene, exon 6 and partial cds; and antigen peptide transporter 2 gene, exons 1 through 6 and partial cds Length = 9370 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 8296 cttcactcttattccttctg 8315
>gb|AY559286.1| Pan troglodytes verus isolate Marco large multifunctional protease 7 (lmp7) gene, exon 6 and partial cds; and antigen peptide transporter 2 gene, exons 1 through 6 and partial cds Length = 9370 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 8296 cttcactcttattccttctg 8315
>gb|AY559285.1| Pan troglodytes verus isolate Louise large multifunctional protease 7 (lmp7) gene, exon 6 and partial cds; and antigen peptide transporter 2 gene, exons 1 through 6 and partial cds Length = 9366 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 8292 cttcactcttattccttctg 8311
>gb|AY559284.1| Pan troglodytes verus isolate Louise large multifunctional protease 7 (lmp7) gene, exon 6 and partial cds; and antigen peptide transporter 2 gene, exons 1 through 6 and partial cds Length = 9370 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 8296 cttcactcttattccttctg 8315
>gb|AY559283.1| Pan troglodytes verus isolate Liesbeth large multifunctional protease 7 (lmp7) gene, exon 6 and partial cds; and antigen peptide transporter 2 gene, exons 1 through 6 and partial cds Length = 9370 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 8296 cttcactcttattccttctg 8315
>gb|AY559282.1| Pan troglodytes verus isolate Liesbeth large multifunctional protease 7 (lmp7) gene, exon 6 and partial cds; and antigen peptide transporter 2 gene, exons 1 through 6 and partial cds Length = 9370 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 8296 cttcactcttattccttctg 8315
>gb|AY559281.1| Pan troglodytes verus isolate Hilko large multifunctional protease 7 (lmp7) gene, exon 6 and partial cds; and antigen peptide transporter 2 gene, exons 1 through 6 and partial cds Length = 9366 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 8292 cttcactcttattccttctg 8311
>gb|AY559280.1| Pan troglodytes verus isolate Hilko large multifunctional protease 7 (lmp7) gene, exon 6 and partial cds; and antigen peptide transporter 2 gene, exons 1 through 6 and partial cds Length = 9366 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 8292 cttcactcttattccttctg 8311
>gb|AY559279.1| Pan troglodytes verus isolate Frits large multifunctional protease 7 (lmp7) gene, exon 6 and partial cds; and antigen peptide transporter 2 gene, exons 1 through 6 and partial cds Length = 9366 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 8292 cttcactcttattccttctg 8311
>gb|AY559278.1| Pan troglodytes verus isolate Frits large multifunctional protease 7 (lmp7) gene, exon 6 and partial cds; and antigen peptide transporter 2 gene, exons 1 through 6 and partial cds Length = 9370 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 8296 cttcactcttattccttctg 8315
>gb|AY559277.1| Pan troglodytes verus isolate Annaclara large multifunctional protease 7 (lmp7) gene, exon 6 and partial cds; and antigen peptide transporter 2 gene, exons 1 through 6 and partial cds Length = 9362 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 8288 cttcactcttattccttctg 8307
>gb|AY559276.1| Pan troglodytes verus isolate Annaclara large multifunctional protease 7 (lmp7) gene, exon 6 and partial cds; and antigen peptide transporter 2 gene, exons 1 through 6 and partial cds Length = 9370 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 8296 cttcactcttattccttctg 8315
>gb|AY559275.1| Pan troglodytes verus isolate NDH0329G1 large multifunctional protease 7 (lmp7) gene, exon 6 and partial cds; and antigen peptide transporter 2 gene, exons 1 through 6 and partial cds Length = 9366 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 8292 cttcactcttattccttctg 8311
>gb|AY559274.1| Pan troglodytes verus isolate NDH0329G1 large multifunctional protease 7 (lmp7) gene, exon 6 and partial cds; and antigen peptide transporter 2 gene, exons 1 through 6 and partial cds Length = 9368 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 8295 cttcactcttattccttctg 8314
>gb|AY559273.1| Pan troglodytes verus isolate NDH0328G1 large multifunctional protease 7 (lmp7) gene, exon 6 and partial cds; and antigen peptide transporter 2 gene, exons 1 through 6 and partial cds Length = 9367 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 8293 cttcactcttattccttctg 8312
>gb|AY559272.1| Pan troglodytes verus isolate NDH0328G1 large multifunctional protease 7 (lmp7) gene, exon 6 and partial cds; and antigen peptide transporter 2 gene, exons 1 through 6 and partial cds Length = 9368 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 8295 cttcactcttattccttctg 8314
>gb|AY559271.1| Pan troglodytes verus isolate NDH0326G1 large multifunctional protease 7 (lmp7) gene, exon 6 and partial cds; and antigen peptide transporter 2 gene, exons 1 through 6 and partial cds Length = 9362 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 8288 cttcactcttattccttctg 8307
>gb|AY559270.1| Pan troglodytes verus isolate NDH0326G1 large multifunctional protease 7 (lmp7) gene, exon 6 and partial cds; and antigen peptide transporter 2 gene, exons 1 through 6 and partial cds Length = 9369 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 8295 cttcactcttattccttctg 8314
>gb|AY559269.1| Pan troglodytes verus isolate NDH0325G1 large multifunctional protease 7 (lmp7) gene, exon 6 and partial cds; and antigen peptide transporter 2 gene, exons 1 through 6 and partial cds Length = 9369 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 8295 cttcactcttattccttctg 8314
>gb|AY559268.1| Pan troglodytes verus isolate NDH0325G1 large multifunctional protease 7 (lmp7) gene, exon 6 and partial cds; and antigen peptide transporter 2 gene, exons 1 through 6 and partial cds Length = 9370 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 8296 cttcactcttattccttctg 8315
>gb|AY559267.1| Pan troglodytes verus isolate NDH0322G1 large multifunctional protease 7 (lmp7) gene, exon 6 and partial cds; and antigen peptide transporter 2 gene, exons 1 through 6 and partial cds Length = 9366 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 8292 cttcactcttattccttctg 8311
>gb|AY559266.1| Pan troglodytes verus isolate NDH0322G1 large multifunctional protease 7 (lmp7) gene, exon 6 and partial cds; and antigen peptide transporter 2 gene, exons 1 through 6 and partial cds Length = 9369 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 8295 cttcactcttattccttctg 8314
>gb|AY559265.1| Pan troglodytes verus isolate NDH0321G1 large multifunctional protease 7 (lmp7) gene, exon 6 and partial cds; and antigen peptide transporter 2 gene, exons 1 through 6 and partial cds Length = 9369 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 8295 cttcactcttattccttctg 8314
>gb|AY559264.1| Pan troglodytes verus isolate NDH0321G1 large multifunctional protease 7 (lmp7) gene, exon 6 and partial cds; and antigen peptide transporter 2 gene, exons 1 through 6 and partial cds Length = 9366 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 8292 cttcactcttattccttctg 8311
>gb|AY559263.1| Pan troglodytes verus isolate NDH0320G1 large multifunctional protease 7 (lmp7) gene, exon 6 and partial cds; and antigen peptide transporter 2 gene, exons 1 through 6 and partial cds Length = 9362 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 8288 cttcactcttattccttctg 8307
>gb|AY559262.1| Pan troglodytes verus isolate NDH0320G1 large multifunctional protease 7 (lmp7) gene, exon 6 and partial cds; and antigen peptide transporter 2 gene, exons 1 through 6 and partial cds Length = 9368 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 8295 cttcactcttattccttctg 8314
>gb|AY559261.1| Pan troglodytes verus isolate NDH0317G1 large multifunctional protease 7 (lmp7) gene, exon 6 and partial cds; and antigen peptide transporter 2 gene, exons 1 through 6 and partial cds Length = 9363 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 8289 cttcactcttattccttctg 8308
>gb|AY559260.1| Pan troglodytes verus isolate NDH0317G1 large multifunctional protease 7 (lmp7) gene, exon 6 and partial cds; and antigen peptide transporter 2 gene, exons 1 through 6 and partial cds Length = 9368 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 8295 cttcactcttattccttctg 8314
>gb|AY559259.1| Pan troglodytes verus isolate NDH0314G1 large multifunctional protease 7 (lmp7) gene, exon 6 and partial cds; and antigen peptide transporter 2 gene, exons 1 through 6 and partial cds Length = 9366 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 8292 cttcactcttattccttctg 8311
>gb|AY559258.1| Pan troglodytes verus isolate NDH0314G1 large multifunctional protease 7 (lmp7) gene, exon 6 and partial cds; and antigen peptide transporter 2 gene, exons 1 through 6 and partial cds Length = 9370 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 8296 cttcactcttattccttctg 8315
>gb|AY559257.1| Pan troglodytes verus isolate NDH0313G1 large multifunctional protease 7 (lmp7) gene, exon 6 and partial cds; and antigen peptide transporter 2 gene, exons 1 through 6 and partial cds Length = 9366 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 8292 cttcactcttattccttctg 8311
>gb|AY559256.1| Pan troglodytes verus isolate NDH0313G1 large multifunctional protease 7 (lmp7) gene, exon 6 and partial cds; and antigen peptide transporter 2 gene, exons 1 through 6 and partial cds Length = 9370 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 8296 cttcactcttattccttctg 8315
>gb|AY559255.1| Pan troglodytes verus isolate NDH0311G1 large multifunctional protease 7 (lmp7) gene, exon 6 and partial cds; and antigen peptide transporter 2 gene, exons 1 through 6 and partial cds Length = 9370 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 8296 cttcactcttattccttctg 8315
>gb|AY559254.1| Pan troglodytes verus isolate NDH0311G1 large multifunctional protease 7 (lmp7) gene, exon 6 and partial cds; and antigen peptide transporter 2 gene, exons 1 through 6 and partial cds Length = 9370 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 8296 cttcactcttattccttctg 8315
>gb|AY559253.1| Pan troglodytes verus isolate NDH0312G1 large multifunctional protease 7 (lmp7) gene, exon 6 and partial cds; and antigen peptide transporter 2 gene, exons 1 through 6 and partial cds Length = 9366 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 8292 cttcactcttattccttctg 8311
>gb|AY559252.1| Pan troglodytes verus isolate NDH0312G1 large multifunctional protease 7 (lmp7) gene, exon 6 and partial cds; and antigen peptide transporter 2 gene, exons 1 through 6 and partial cds Length = 9369 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 8295 cttcactcttattccttctg 8314
>gb|BC104263.1| Mus musculus keratin associated protein 14, mRNA (cDNA clone MGC:129169 IMAGE:40040071), complete cds Length = 808 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 236 aaaagactggaaacccctgg 255 |||||||||||||||||||| Sbjct: 356 aaaagactggaaacccctgg 337
>gb|BC104262.1| Mus musculus keratin associated protein 14, mRNA (cDNA clone MGC:129168 IMAGE:40040069), complete cds Length = 809 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 236 aaaagactggaaacccctgg 255 |||||||||||||||||||| Sbjct: 357 aaaagactggaaacccctgg 338
>gb|AC113053.21| Mus musculus chromosome 17, clone RP23-250J2, complete sequence Length = 234124 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 176 agaaactggaggagatgtca 195 |||||||||||||||||||| Sbjct: 2927 agaaactggaggagatgtca 2908
>ref|XM_430260.1| PREDICTED: Gallus gallus LOC425521 (LOC425521), mRNA Length = 637 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 394 gaactcatgatgatgctttt 413 |||||||||||||||||||| Sbjct: 170 gaactcatgatgatgctttt 151
>gb|DQ114220.1| Bacteriophage F108, complete genome Length = 30505 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 212 atgaatttaaaagattattt 231 |||||||||||||||||||| Sbjct: 19277 atgaatttaaaagattattt 19296
>gb|AC113508.14| Mus musculus chromosome 13, clone RP23-376D8, complete sequence Length = 176600 Score = 40.1 bits (20), Expect = 9.8 Identities = 29/32 (90%) Strand = Plus / Plus Query: 477 tgggaaattaagcaaggaaaatatccagaaag 508 |||||||||||||||| ||| |||||||||| Sbjct: 141613 tgggaaattaagcaagataaaaatccagaaag 141644
>gb|AC164098.4| Mus musculus BAC clone RP23-341D24 from chromosome 1, complete sequence Length = 221754 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 539 tactggatgacactggcaat 558 |||||||||||||||||||| Sbjct: 165616 tactggatgacactggcaat 165635
>gb|AC123640.9| Mus musculus chromosome 15, clone RP23-11D17, complete sequence Length = 219106 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 215 aatttaaaagattatttctg 234 |||||||||||||||||||| Sbjct: 68726 aatttaaaagattatttctg 68707
>gb|AC144705.2| Danio rerio clone CH211-160P5, complete sequence Length = 163897 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 331 aagcaagcaccgaaacggaaagac 354 ||||||||||||||| |||||||| Sbjct: 128691 aagcaagcaccgaaatggaaagac 128714
>gb|AC140194.2| Mus musculus BAC clone RP23-250K1 from chromosome 16, complete sequence Length = 183155 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 236 aaaagactggaaacccctgg 255 |||||||||||||||||||| Sbjct: 137596 aaaagactggaaacccctgg 137577
>emb|X66401.1|HSMHCAPG H.sapiens genes TAP1, TAP2, LMP2, LMP7 and DOB Length = 66109 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 45678 cttcactcttattccttctg 45697
>emb|AJ251484.1|PTR251484 Pan troglodytes partial lmp7 gene for large multifunctional protease 7, exon 7 and tap2 gene for antigen peptide transporter 2, exon 1-6 Length = 9662 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 8543 cttcactcttattccttctg 8562
>gb|AC125199.3| Mus musculus BAC clone RP23-261K7 from chromosome 16, complete sequence Length = 226724 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 236 aaaagactggaaacccctgg 255 |||||||||||||||||||| Sbjct: 221276 aaaagactggaaacccctgg 221295
>gb|AY063500.1| Mamestra brassicae cytochrome P450 CYP4S4 (Cyp4S4) mRNA, complete cds Length = 3039 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 684 tgaagctcttcaggatattgaaat 707 |||||||||||||||| ||||||| Sbjct: 650 tgaagctcttcaggatgttgaaat 627
>emb|CT009500.4| Human DNA sequence from clone DAMA-353C16 on chromosome 6, complete sequence Length = 14668 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 12860 cttcactcttattccttctg 12841
>ref|XM_648464.1| Entamoeba histolytica HM-1:IMSS hypothetical protein (79.t00022) partial mRNA Length = 5733 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 212 atgaatttaaaagattattt 231 |||||||||||||||||||| Sbjct: 2488 atgaatttaaaagattattt 2507
>gb|AC005165.1| Homo sapiens BAC clone CTA-242H14 from 7, complete sequence Length = 155164 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 362 aaatgaaaagttcacttgct 381 |||||||||||||||||||| Sbjct: 88281 aaatgaaaagttcacttgct 88262
>emb|CT009502.2| Human DNA sequence from clone DAMC-27I8 on chromosome 6, complete sequence Length = 35167 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 23236 cttcactcttattccttctg 23217
>emb|BX321882.7| Zebrafish DNA sequence from clone DKEYP-30F1 in linkage group 12, complete sequence Length = 187475 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 212 atgaatttaaaagattattt 231 |||||||||||||||||||| Sbjct: 71342 atgaatttaaaagattattt 71361
>emb|BX682530.4| Human DNA sequence from clone DASS-193J13 on chromosome 6, complete sequence Length = 19936 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 11708 cttcactcttattccttctg 11689
>emb|AL935043.4| Human DNA sequence from clone DAQB-69D7 on chromosome 6 Contains the TAP2 gene for transporter 2, ATP-binding cassette, sub-family B (MDR/TAP), the PSMB8 gene for proteasome (prosome, macropain) subunit, beta type, 8 (large multifunctional protease 7), the TAP1 gene for transporter 1, ATP-binding cassette, sub-family B (MDR/TAP), the PSMB9 gene for proteasome (prosome, macropain) subunit, beta type, 9 (large multifunctional protease 2), the PPP1R2P1 gene for protein phosphatase 2, regulatory (inhibitor) subunit 2 pseudogene 1 and 1 CpG island, complete sequence Length = 63179 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 12860 cttcactcttattccttctg 12841
>emb|AL669918.5| Human DNA sequence from clone XXbac-246D15 on chromosome 6 contains the HLA-DOB gene for major histocompatibility complex, class II, DO beta, the TAP2 gene for transporter 2, ATP-binding cassette, subfamily B (MDR/TAP), the PSMB8 gene for proteasome (prosome, macropain) subunit, beta type, 8 (large multifunctional protease 7), the TAP1 gene for transporter 1, ATP-binding cassette, sub-family B (MDR/TAP), the PSMB9 gene for proteasome (prosome, macropain) subunit, beta type, 9 (large multifunctional protease 2), a novel protein similar to protein phosphatase 1, regulatory (inhibitor) subunit 2 and two CpG islands, complete sequence Length = 126988 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 35408 cttcactcttattccttctg 35389
>emb|AL671681.4| Human DNA sequence from clone XXbac-32M13 on chromosome 6 contains the 5' end of the HLA-DQB2 gene for major histocompatibility complex, class II, DQ beta 2, the HLA-DOB gene for major histocompatibility complex, class II, DO beta, the TAP2 gene for transporter 2, ATP-binding cassette, subfamily B (MDR/TAP), the PSMB8 gene for proteasome (prosome, macropain) subunit, beta type, 8 (large multifunctional protease 7), the TAP1 gene for transporter 1, ATP-binding cassette, sub-family B (MDR/TAP), the PSMB9 gene for proteasome (prosome, macropain) subunit, beta type, 9 (large multifunctional protease 2), the gene for a novel protein similar to protein phosphatase 1, regulatory (inhibitor) subunit 2 and three CpG islands, complete sequence Length = 166803 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 75228 cttcactcttattccttctg 75209
>emb|AL596269.6| Human DNA sequence from clone RP11-29E12 on chromosome 1 Contains part of the ELTD1 gene for EGF latrophilin and seven transmembrane domain containing 1, complete sequence Length = 101427 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 212 atgaatttaaaagattattt 231 |||||||||||||||||||| Sbjct: 50985 atgaatttaaaagattattt 51004
>emb|AL512343.21| Human DNA sequence from clone RP11-396C23 on chromosome 1 Contains the H3F3A gene for H3 histone, family 3A, a nove gene and four CpG islands, complete sequence Length = 105087 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 446 aatttgaaatcaatatggcagaaa 469 |||||||||| ||||||||||||| Sbjct: 5946 aatttgaaataaatatggcagaaa 5969
>emb|AL365180.13| Human DNA sequence from clone RP13-212J24 on chromosome 10, complete sequence Length = 49768 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 607 ttcttcactcttattccttctgtt 630 |||||| ||||||||||||||||| Sbjct: 15668 ttcttctctcttattccttctgtt 15645
>emb|AL161736.33| Human DNA sequence from clone RP11-421E17 on chromosome 1 Contains the 3' end of the FNBP2 gene for formin binding protein 2 and a RAP1, GTP-GDP dissociation stimulator 1 (RAP1GDS1) pseudogene, complete sequence Length = 159474 Score = 40.1 bits (20), Expect = 9.8 Identities = 26/28 (92%) Strand = Plus / Plus Query: 210 acatgaatttaaaagattatttctggaa 237 |||||||||||||| || |||||||||| Sbjct: 104228 acatgaatttaaaaaatgatttctggaa 104255
>emb|AL160274.9| Human DNA sequence from clone RP11-395N21 on chromosome 9 Contains the 3' end of the UNC13 gene for unc-13-like (C. elegans)(MUNC13, hmunc13) and the 5' end of a novel gene, complete sequence Length = 144102 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 253 tgggaagcatgggaacaaaa 272 |||||||||||||||||||| Sbjct: 30935 tgggaagcatgggaacaaaa 30916
>gb|AC022296.34| Homo sapiens 3 BAC RP11-91K8 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 153650 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 222 aagattatttctggaaaagactgg 245 |||| ||||||||||||||||||| Sbjct: 56029 aagaatatttctggaaaagactgg 56006
>gb|AF306443.5| Homo sapiens chromosome 8 clone RP11-79H13 map 8p21-p11, complete sequence Length = 161850 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 266 aacaaaaaacaaattttcag 285 |||||||||||||||||||| Sbjct: 161435 aacaaaaaacaaattttcag 161416
>emb|BX469929.9| Zebrafish DNA sequence from clone DKEYP-24B8 in linkage group 8, complete sequence Length = 149287 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 261 atgggaacaaaaaacaaattttca 284 |||||| ||||||||||||||||| Sbjct: 81052 atgggagcaaaaaacaaattttca 81075
>emb|AJ719731.1| Gallus gallus mRNA for hypothetical protein, clone 5m6 Length = 3679 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 170 gtggaaagaaactggaggag 189 |||||||||||||||||||| Sbjct: 1215 gtggaaagaaactggaggag 1234
>gb|AC021956.8| Homo sapiens chromosome 11, clone RP11-447I3, complete sequence Length = 197864 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 210 acatgaatttaaaagattat 229 |||||||||||||||||||| Sbjct: 75970 acatgaatttaaaagattat 75951 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 210 acatgaatttaaaagattat 229 |||||||||||||||||||| Sbjct: 75937 acatgaatttaaaagattat 75918
>emb|CR749765.5| Human DNA sequence from clone DASS-94G7 on chromosome 6, complete sequence Length = 19937 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 11708 cttcactcttattccttctg 11689
>emb|CR762476.2| Human DNA sequence from clone DAAP-57C1 on chromosome 6, complete sequence Length = 95554 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 60760 cttcactcttattccttctg 60741
>emb|CR753889.4| Human DNA sequence from clone DADB-78A10 on chromosome 6, complete sequence Length = 47546 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 16699 cttcactcttattccttctg 16680
>emb|CR318624.8| Zebrafish DNA sequence from clone CH211-227I15 in linkage group 24, complete sequence Length = 170084 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 689 ctcttcaggatattgaaatt 708 |||||||||||||||||||| Sbjct: 59981 ctcttcaggatattgaaatt 60000
>dbj|AP008230.1| Desulfitobacterium hafniense Y51 genomic DNA, complete genome Length = 5727534 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 559 caagaactggctcttagaga 578 |||||||||||||||||||| Sbjct: 1608990 caagaactggctcttagaga 1609009
>dbj|AP007159.1| Aspergillus oryzae RIB40 genomic DNA, SC026 Length = 2324132 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 666 aatgaaagcgaaaatgcttgaagc 689 ||||||||| |||||||||||||| Sbjct: 869344 aatgaaagccaaaatgcttgaagc 869367
>gb|AC099685.2| Homo sapiens chromosome 8, clone RP11-87N16, complete sequence Length = 182413 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 266 aacaaaaaacaaattttcag 285 |||||||||||||||||||| Sbjct: 112182 aacaaaaaacaaattttcag 112201
>gb|AC154143.6| Mus musculus chromosome 15, clone RP24-338F24, complete sequence Length = 172765 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 215 aatttaaaagattatttctg 234 |||||||||||||||||||| Sbjct: 133274 aatttaaaagattatttctg 133255
>gb|BC110248.1| Bos taurus cDNA clone MGC:133915 IMAGE:8065971, complete cds Length = 1901 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 220 aaaagattatttctggaaaa 239 |||||||||||||||||||| Sbjct: 1023 aaaagattatttctggaaaa 1042
>emb|BX927138.5| Human DNA sequence from clone DAMA-91I23 on chromosome 6, complete sequence Length = 110856 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 192 cttcactcttattccttctg 173
>gb|AC154530.2| Mus musculus BAC clone RP23-467F17 from chromosome 16, complete sequence Length = 179995 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 606 tttcttcactcttattcctt 625 |||||||||||||||||||| Sbjct: 98382 tttcttcactcttattcctt 98401
>gb|AC024581.3|AC024581 Homo sapiens chromosome 5 clone CTD-3066C23, complete sequence Length = 162899 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 262 tgggaacaaaaaacaaattttcag 285 |||||||||||||||| ||||||| Sbjct: 120734 tgggaacaaaaaacaacttttcag 120757
>ref|XM_577168.1| PREDICTED: Rattus norvegicus similar to anagen-specific protein mKAP13 (LOC501768), mRNA Length = 507 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 236 aaaagactggaaacccctgg 255 |||||||||||||||||||| Sbjct: 330 aaaagactggaaacccctgg 311
>dbj|BA000004.3| Bacillus halodurans C-125 DNA, complete genome Length = 4202352 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 656 atgacctgacaatgaaagcg 675 |||||||||||||||||||| Sbjct: 2386305 atgacctgacaatgaaagcg 2386324
>dbj|AB115697.1| Oryzias latipes Rad21 mRNA for cohesin subunit Rad21, complete cds Length = 2812 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 170 gtggaaagaaactggaggag 189 |||||||||||||||||||| Sbjct: 1246 gtggaaagaaactggaggag 1265
>gb|AC148151.3| Monodelphis domestica clone VMRC6-414K6, complete sequence Length = 158302 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 451 gaaatcaatatggcagaaat 470 |||||||||||||||||||| Sbjct: 14576 gaaatcaatatggcagaaat 14557
>gb|U88168.1| Caenorhabditis elegans cosmid K11H12, complete sequence Length = 37635 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 269 aaaaaacaaattttcagaag 288 |||||||||||||||||||| Sbjct: 24630 aaaaaacaaattttcagaag 24649
>gb|AC005878.3|AC005878 citb_255_f_20, complete sequence Length = 148852 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 607 ttcttcactcttattccttctgtt 630 |||||| ||||||||||||||||| Sbjct: 36081 ttcttctctcttattccttctgtt 36104
>gb|AF162800.1|AF162800 Mus musculus keratin-associated protein gene cluster, complete sequence Length = 10333 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 236 aaaagactggaaacccctgg 255 |||||||||||||||||||| Sbjct: 5857 aaaagactggaaacccctgg 5838
>gb|AC140483.3| Mus musculus BAC clone RP24-145A22 from 1, complete sequence Length = 176649 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 539 tactggatgacactggcaat 558 |||||||||||||||||||| Sbjct: 109539 tactggatgacactggcaat 109520
>emb|CR556710.7| Zebrafish DNA sequence from clone CH211-132E22 in linkage group 13, complete sequence Length = 97211 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 331 aagcaagcaccgaaacggaaagac 354 ||||||||||||||| |||||||| Sbjct: 3766 aagcaagcaccgaaatggaaagac 3743
>emb|BX649312.6| Zebrafish DNA sequence from clone DKEY-170M15 in linkage group 20, complete sequence Length = 162661 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 331 aagcaagcaccgaaacggaaagac 354 ||||||||||||||| |||||||| Sbjct: 18795 aagcaagcaccgaaatggaaagac 18818
>emb|BX321888.21| Zebrafish DNA sequence from clone DKEYP-47D4 in linkage group 20, complete sequence Length = 176463 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 207 aatacatgaatttaaaagat 226 |||||||||||||||||||| Sbjct: 95019 aatacatgaatttaaaagat 95038
>emb|BX119973.7| Zebrafish DNA sequence from clone RP71-77D7 in linkage group 13, complete sequence Length = 182073 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 331 aagcaagcaccgaaacggaaagac 354 ||||||||||||||| |||||||| Sbjct: 10668 aagcaagcaccgaaatggaaagac 10645
>emb|BX296516.3| Zebrafish DNA sequence from clone DKEY-219E20 in linkage group 20, complete sequence Length = 160555 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 207 aatacatgaatttaaaagat 226 |||||||||||||||||||| Sbjct: 10860 aatacatgaatttaaaagat 10841
>emb|CR456625.13| Zebrafish DNA sequence from clone DKEY-76G24 in linkage group 12, complete sequence Length = 228447 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 331 aagcaagcaccgaaacggaaagac 354 ||||||||||||||| |||||||| Sbjct: 212940 aagcaagcaccgaaatggaaagac 212963
>emb|Z75552.1|CEW04D2 Caenorhabditis elegans Cosmid W04D2, complete sequence Length = 27098 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 268 caaaaaacaaattttcagaa 287 |||||||||||||||||||| Sbjct: 13995 caaaaaacaaattttcagaa 14014
>gb|AE015927.1| Clostridium tetani E88, complete genome Length = 2799251 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 212 atgaatttaaaagattattt 231 |||||||||||||||||||| Sbjct: 2115188 atgaatttaaaagattattt 2115207 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 212 atgaatttaaaagattattt 231 |||||||||||||||||||| Sbjct: 1519326 atgaatttaaaagattattt 1519307 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 212 atgaatttaaaagattattt 231 |||||||||||||||||||| Sbjct: 879056 atgaatttaaaagattattt 879075 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 212 atgaatttaaaagattattt 231 |||||||||||||||||||| Sbjct: 836218 atgaatttaaaagattattt 836199 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 212 atgaatttaaaagattattt 231 |||||||||||||||||||| Sbjct: 526840 atgaatttaaaagattattt 526821 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 212 atgaatttaaaagattattt 231 |||||||||||||||||||| Sbjct: 447823 atgaatttaaaagattattt 447804 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 212 atgaatttaaaagattattt 231 |||||||||||||||||||| Sbjct: 191398 atgaatttaaaagattattt 191379 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 212 atgaatttaaaagattattt 231 |||||||||||||||||||| Sbjct: 131086 atgaatttaaaagattattt 131105 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 212 atgaatttaaaagattattt 231 |||||||||||||||||||| Sbjct: 95790 atgaatttaaaagattattt 95809
>emb|BX000489.8| Zebrafish DNA sequence from clone CH211-215E19, complete sequence Length = 201748 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 25 aaaagcatttacaatacaacccta 48 |||||||||| ||||||||||||| Sbjct: 163510 aaaagcatttgcaatacaacccta 163487
>emb|AL450303.10| Human DNA sequence from clone RP11-245D2 on chromosome 1 Contains four genes for novel 7 transmembrane receptor (rhodopsin family) proteins, the OR2M7 gene for olfactory receptor, family 2, subfamily M, member 7 and the OR5BF1 gene for olfactory receptor, family 5, subfamily BF, member 1, complete sequence Length = 159867 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 257 aagcatgggaacaaaaaaca 276 |||||||||||||||||||| Sbjct: 95003 aagcatgggaacaaaaaaca 95022
>gb|AC102518.11| Mus musculus chromosome 8, clone RP24-502J8, complete sequence Length = 199824 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 137 gaaagtgggggcgagttggc 156 |||||||||||||||||||| Sbjct: 82203 gaaagtgggggcgagttggc 82222
>gb|AF003691.1|AF003691 Mus musculus pmg-1 protein (pmg-1) mRNA, complete cds Length = 859 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 236 aaaagactggaaacccctgg 255 |||||||||||||||||||| Sbjct: 372 aaaagactggaaacccctgg 353
>emb|X87344.1|HSEVMHC H.sapiens DMA, DMB, HLA-Z1, IPP2, LMP2, TAP1, LMP7, TAP2, DOB, DQB2 and RING8, 9, 13 and 14 genes Length = 198285 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 121467 cttcactcttattccttctg 121486
>gb|AY285446.1| Sus scrofa clone UMNp686.gcg microsatellite sequence Length = 308 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 478 gggaaattaagcaaggaaaa 497 |||||||||||||||||||| Sbjct: 109 gggaaattaagcaaggaaaa 128
>gb|DP000021.1| Monodelphis domestica target 1 genomic scaffold Length = 1833844 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 451 gaaatcaatatggcagaaat 470 |||||||||||||||||||| Sbjct: 14576 gaaatcaatatggcagaaat 14557
>emb|AL672271.9| Mouse DNA sequence from clone RP23-450H23 on chromosome X, complete sequence Length = 196613 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 53 tttctgacatgacacaaggt 72 |||||||||||||||||||| Sbjct: 123387 tttctgacatgacacaaggt 123368
>emb|AJ251485.1|GGO251485 Gorilla gorilla partial lmp7 gene for large multifunctional protease 7, exon 7 and tap2 gene for antigen peptide transporter 2, exons 1-6 Length = 9672 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 609 cttcactcttattccttctg 628 |||||||||||||||||||| Sbjct: 8546 cttcactcttattccttctg 8565
>gb|AC171206.2| Mus musculus BAC clone RP23-416I23 from chromosome 9, complete sequence Length = 194366 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 266 aacaaaaaacaaattttcag 285 |||||||||||||||||||| Sbjct: 43680 aacaaaaaacaaattttcag 43699
>dbj|D85925.1| Mus musculus mRNA for anagen-specific protein mKAP13, complete cds Length = 844 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 236 aaaagactggaaacccctgg 255 |||||||||||||||||||| Sbjct: 372 aaaagactggaaacccctgg 353 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 9,204,768 Number of Sequences: 3902068 Number of extensions: 9204768 Number of successful extensions: 200339 Number of sequences better than 10.0: 163 Number of HSP's better than 10.0 without gapping: 163 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 199593 Number of HSP's gapped (non-prelim): 729 length of query: 714 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 691 effective length of database: 17,143,297,704 effective search space: 11846018713464 effective search space used: 11846018713464 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)