>gb|AY107859.1| Zea mays PCO076568 mRNA sequence
          Length = 1538

 Score = 54.0 bits (27), Expect = 3e-05
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                       
Query: 3    gtgatggtctctgagtcagaccttgaagggtataatgcggatg 45
            ||||||||||| || |||||||| |||||||||||||| ||||
Sbjct: 1045 gtgatggtctcagaatcagacctcgaagggtataatgcagatg 1087

>gb|AC160963.2| Mus musculus BAC clone RP24-311B3 from chromosome 12, complete sequence
          Length = 155386

 Score = 38.2 bits (19), Expect = 1.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 4     tgatggtctctgagtcaga 22
             |||||||||||||||||||
Sbjct: 53544 tgatggtctctgagtcaga 53526

>gb|AC122411.4| Mus musculus BAC clone RP24-143P19 from chromosome 1, complete sequence
          Length = 182658

 Score = 38.2 bits (19), Expect = 1.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 31     ggtataatgcggatggctt 49
              |||||||||||||||||||
Sbjct: 149903 ggtataatgcggatggctt 149921

>gb|AC108424.14| Mus musculus chromosome 7, clone RP23-105A10, complete sequence
          Length = 198191

 Score = 36.2 bits (18), Expect = 7.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 3     gtgatggtctctgagtca 20
             ||||||||||||||||||
Sbjct: 22524 gtgatggtctctgagtca 22541

>ref|XM_597026.2| PREDICTED: Bos taurus similar to trichohyalin-like 1 (LOC518825),
            mRNA
          Length = 2793

 Score = 36.2 bits (18), Expect = 7.3
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                  
Query: 9    gtctctgagtcagaccttgaag 30
            ||||||||||||| ||||||||
Sbjct: 2383 gtctctgagtcaggccttgaag 2404

>gb|AC157790.10| Mus musculus chromosome 7, clone RP24-151M10, complete sequence
          Length = 167728

 Score = 36.2 bits (18), Expect = 7.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 3      gtgatggtctctgagtca 20
              ||||||||||||||||||
Sbjct: 116345 gtgatggtctctgagtca 116362

>emb|AL031729.16|HS159A19 Human DNA sequence from clone RP1-159A19 on chromosome 1p36.13 Contains
             the gene for a novel protein, the FGR gene for
             Gardner-Rasheed feline sarcoma viral (v-fgr) oncogene
             homolog, a novel pseudogene, the 3' end of a novel gene
             and two CpG islands, complete sequence
          Length = 125287

 Score = 36.2 bits (18), Expect = 7.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 14    tgagtcagaccttgaagg 31
             ||||||||||||||||||
Sbjct: 17273 tgagtcagaccttgaagg 17290

>emb|AL805905.5| Zebrafish DNA sequence from clone CH211-214D15 in linkage group 18
              Contains a novel gene and three CpG islands, complete
              sequence
          Length = 199745

 Score = 36.2 bits (18), Expect = 7.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 36     aatgcggatggcttggca 53
              ||||||||||||||||||
Sbjct: 117218 aatgcggatggcttggca 117235

>gb|AC163652.3| Mus musculus BAC clone RP24-315D17 from chromosome 17, complete
             sequence
          Length = 171992

 Score = 36.2 bits (18), Expect = 7.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 21    gaccttgaagggtataat 38
             ||||||||||||||||||
Sbjct: 81265 gaccttgaagggtataat 81282

>gb|AC026782.6| Homo sapiens chromosome 5 clone CTD-2015A6, complete sequence
          Length = 214025

 Score = 36.2 bits (18), Expect = 7.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 6      atggtctctgagtcagac 23
              ||||||||||||||||||
Sbjct: 144287 atggtctctgagtcagac 144304

>gb|AF281074.1|AF281074 Homo sapiens neuropilin 2 (NRP2) gene, complete cds, alternatively
             spliced
          Length = 111934

 Score = 36.2 bits (18), Expect = 7.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 14    tgagtcagaccttgaagg 31
             ||||||||||||||||||
Sbjct: 27201 tgagtcagaccttgaagg 27184

>gb|AC007362.4| Homo sapiens BAC clone RP11-150F11 from 2, complete sequence
          Length = 116039

 Score = 36.2 bits (18), Expect = 7.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 14    tgagtcagaccttgaagg 31
             ||||||||||||||||||
Sbjct: 37737 tgagtcagaccttgaagg 37720

>emb|Z71706.1|FPGAGPP F.poae gene for gag-like polyprotein
          Length = 1209

 Score = 36.2 bits (18), Expect = 7.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 3   gtgatggtctctgagtca 20
           ||||||||||||||||||
Sbjct: 137 gtgatggtctctgagtca 154


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 277,074
Number of Sequences: 3902068
Number of extensions: 277074
Number of successful extensions: 66831
Number of sequences better than 10.0: 13
Number of HSP's better than 10.0 without gapping: 13
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 66812
Number of HSP's gapped (non-prelim): 19
length of query: 53
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 33
effective length of database: 17,155,003,908
effective search space: 566115128964
effective search space used: 566115128964
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)