Clone Name	bags5e21
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	ref|XM_475538.1| Oryza sativa (japonica cultivar-group), predic...	165	2e-37
2	dbj|AK105314.1| Oryza sativa (japonica cultivar-group) cDNA clon...	165	2e-37
3	ref|XM_475546.1| Oryza sativa (japonica cultivar-group), predic...	149	1e-32
4	gb|AC079021.5| Oryza sativa (japonica cultivar-group) chromosome...	111	3e-21
5	dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D...	111	3e-21
6	gb|AC134931.2| Oryza sativa (japonica cultivar-group) chromosome...	96	2e-16
7	ref|NM_194490.1| Oryza sativa (japonica cultivar-group) putative...	68	4e-08
8	dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D...	58	4e-05
9	dbj|AP004801.3| Oryza sativa (japonica cultivar-group) genomic D...	58	4e-05
10	dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D...	54	6e-04
11	dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D...	54	6e-04
12	dbj|AK063302.1| Oryza sativa (japonica cultivar-group) cDNA clon...	54	6e-04
13	gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome...	54	6e-04
14	gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome...	54	6e-04
15	emb|BX000505.1|CNS08CDV Oryza sativa chromosome 12, . BAC OJ1126...	54	6e-04
16	emb|BX000497.1|CNS08CDN Oryza sativa chromosome 11, . BAC OSJNBa...	54	6e-04
17	gb|AC079632.4| Oryza sativa (japonica cultivar-group) chromosome...	52	0.002
18	gb|AC145127.1| Oryza sativa (japonica cultivar-group) chromosome...	52	0.002
19	gb|AC099400.2| Oryza sativa (japonica cultivar-group) chromosome...	52	0.002
20	dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D...	52	0.002
21	gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome...	52	0.002
22	dbj|AK069731.1| Oryza sativa (japonica cultivar-group) cDNA clon...	50	0.009
23	dbj|AK059510.1| Oryza sativa (japonica cultivar-group) cDNA clon...	50	0.009
24	dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...	48	0.036
25	dbj|AP004031.3| Oryza sativa (japonica cultivar-group) genomic D...	48	0.036
26	dbj|AP004073.2| Oryza sativa (japonica cultivar-group) genomic D...	48	0.036
27	dbj|AP003687.3| Oryza sativa (japonica cultivar-group) genomic D...	48	0.036
28	ref|NM_184900.1| Oryza sativa (japonica cultivar-group), mRNA	44	0.56
29	gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3	44	0.56
30	dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D...	44	0.56
31	dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D...	44	0.56
32	dbj|AP003868.3| Oryza sativa (japonica cultivar-group) genomic D...	44	0.56
33	emb|AL929061.31| Mouse DNA sequence from clone RP23-402A18 on ch...	44	0.56
34	dbj|AP003881.3| Oryza sativa (japonica cultivar-group) genomic D...	44	0.56
35	gb|AC091494.9| Oryza sativa chromosome 3 BAC OSJNBa0070N04 genom...	44	0.56
36	emb|AL365333.13| Mouse DNA sequence from clone RP21-490L20 on ch...	44	0.56
37	ref|XM_518688.1| PREDICTED: Pan troglodytes similar to solute ca...	42	2.2
38	gb|CP000067.1| Trypanosoma brucei chromosome 4, complete sequence	42	2.2
39	gb|AC087606.2| Trypanosoma brucei chromosome 4 clone RPCI93-4J6,...	42	2.2
40	gb|AC080131.9| Trypanosoma brucei chromosome 4 clone RPCI93-2H8,...	42	2.2
41	gb|U64607.1| Caenorhabditis elegans cosmid F43E12, complete sequ...	42	2.2
42	emb|AL365269.23| Human DNA sequence from clone RP11-516J14 on ch...	42	2.2
43	gb|AF417288.1| Cosmarium humile var. substriatum ribulose 1,5-bi...	42	2.2
44	gb|BC018281.1| Mus musculus CCR4-NOT transcription complex, subu...	42	2.2
45	emb|AL807763.7| Mouse DNA sequence from clone RP23-28B24 on chro...	42	2.2
46	gb|CP000036.1| Shigella boydii Sb227, complete genome	42	2.2
47	gb|M75140.1|HYDATPASE H.vulgaris Na,K-ATPase alpha subunit mRNA,...	42	2.2
48	gb|AC160389.4| Mus musculus chromosome 7, clone RP23-257G13, com...	40	8.7
49	gb|DQ015936.1| Spirogyra condensata strain UTEX LB 1744 ribulose...	40	8.7
50	gb|AC148460.2| Xenopus tropicalis clone CH216-3L17, complete seq...	40	8.7
51	gb|BT017434.1| Zea mays clone EL01N0403G04.c mRNA sequence	40	8.7
52	gb|AE017346.1| Cryptococcus neoformans var. neoformans JEC21 chr...	40	8.7
53	gb|BT014927.1| Drosophila melanogaster AT15894 full insert cDNA	40	8.7
54	gb|AC156577.3| Ornithorhynchus anatinus BAC clone OABb-470C16 fr...	40	8.7
55	ref|XM_974133.1| PREDICTED: Mus musculus similar to CCR4-NOT tra...	40	8.7
56	ref|XM_974632.1| PREDICTED: Mus musculus similar to CCR4-NOT tra...	40	8.7
57	ref|XM_974591.1| PREDICTED: Mus musculus similar to CCR4-NOT tra...	40	8.7
58	ref|XM_484354.4| PREDICTED: Mus musculus similar to CCR4-NOT tra...	40	8.7
59	gb|AY082315.1| Coleochaete conchata ribulose-1,5-bisphosphate ca...	40	8.7
60	gb|AY082314.1| Coleochaete scutata strain 54a6 ribulose-1,5-bisp...	40	8.7
61	gb|AY082313.1| Coleochaete scutata strain 531a4 ribulose-1,5-bis...	40	8.7
62	gb|AY082312.1| Coleochaete sp. 40D2 ribulose-1,5-bisphosphate ca...	40	8.7
63	ref|XM_001002332.1| PREDICTED: Mus musculus CCR4-NOT transcripti...	40	8.7
64	ref|XM_001002371.1| PREDICTED: Mus musculus CCR4-NOT transcripti...	40	8.7
65	ref|XM_001002356.1| PREDICTED: Mus musculus CCR4-NOT transcripti...	40	8.7
66	ref|XM_001002393.1| PREDICTED: Mus musculus CCR4-NOT transcripti...	40	8.7
67	ref|XM_001002382.1| PREDICTED: Mus musculus CCR4-NOT transcripti...	40	8.7
68	ref|XM_001002409.1| PREDICTED: Mus musculus CCR4-NOT transcripti...	40	8.7
69	ref|XM_001002423.1| PREDICTED: Mus musculus CCR4-NOT transcripti...	40	8.7
70	ref|XM_923182.2| PREDICTED: Mus musculus CCR4-NOT transcription ...	40	8.7
71	ref|XM_923199.2| PREDICTED: Mus musculus CCR4-NOT transcription ...	40	8.7
72	ref|XM_923156.2| PREDICTED: Mus musculus CCR4-NOT transcription ...	40	8.7
73	ref|XM_001002486.1| PREDICTED: Mus musculus CCR4-NOT transcripti...	40	8.7
74	ref|XM_001002473.1| PREDICTED: Mus musculus CCR4-NOT transcripti...	40	8.7
75	ref|XM_923215.2| PREDICTED: Mus musculus CCR4-NOT transcription ...	40	8.7
76	ref|XM_914270.2| PREDICTED: Mus musculus CCR4-NOT transcription ...	40	8.7
77	ref|XM_901816.2| PREDICTED: Mus musculus CCR4-NOT transcription ...	40	8.7
78	ref|XM_901818.2| PREDICTED: Mus musculus CCR4-NOT transcription ...	40	8.7
79	ref|XM_901801.2| PREDICTED: Mus musculus CCR4-NOT transcription ...	40	8.7
80	ref|XM_001003611.1| PREDICTED: Mus musculus CCR4-NOT transcripti...	40	8.7
81	ref|XM_001003604.1| PREDICTED: Mus musculus CCR4-NOT transcripti...	40	8.7
82	ref|XM_901826.2| PREDICTED: Mus musculus CCR4-NOT transcription ...	40	8.7
83	ref|XM_894673.2| PREDICTED: Mus musculus CCR4-NOT transcription ...	40	8.7
84	ref|XM_571466.1| Cryptococcus neoformans var. neoformans JEC21 m...	40	8.7
85	gb|AC133176.2| Mus musculus BAC clone RP24-111D1 from chromosome...	40	8.7
86	emb|AJ512484.1|CRA512484 Caulerpa racemosa var. racemosa plastid...	40	8.7
87	emb|AJ512483.1|CRA512483 Caulerpa racemosa var. racemosa plastid...	40	8.7
88	emb|AJ512482.1|CRA512482 Caulerpa racemosa var. racemosa plastid...	40	8.7
89	emb|AJ512481.1|CRA512481 Caulerpa racemosa var. racemosa plastid...	40	8.7
90	emb|AJ512480.1|CRA512480 Caulerpa racemosa var. racemosa plastid...	40	8.7
91	emb|AJ512479.1|CSE512479 Caulerpa sertularioides f. brevipes pla...	40	8.7
92	emb|AJ512478.1|CSE512478 Caulerpa sertularioides f. longipes pla...	40	8.7
93	emb|AJ512477.1|CSE512477 Caulerpa sertularioides f. brevipes pla...	40	8.7
94	emb|AJ512476.1|CSE512476 Caulerpa sertularioides f. longipes pla...	40	8.7
95	emb|AJ512475.1|CRA512475 Caulerpa racemosa var. mucronata plasti...	40	8.7
96	emb|AJ512474.1|CRA512474 Caulerpa racemosa var. mucronata plasti...	40	8.7
97	emb|AJ512473.1|CRA512473 Caulerpa racemosa var. laetevirens plas...	40	8.7
98	emb|AJ512472.1|CRA512472 Caulerpa racemosa var. laetevirens plas...	40	8.7
99	emb|AJ512471.1|CCU512471 Caulerpa cupressoides var. lycopodium p...	40	8.7
100	emb|AJ512470.1|CCU512470 Caulerpa cupressoides var. lycopodium p...	40	8.7
101	emb|AJ512469.1|CSE512469 Caulerpa serrulata var. serrulata plast...	40	8.7
102	emb|AJ512468.1|CSE512468 Caulerpa serrulata var. serrulata plast...	40	8.7
103	gb|AC127300.3| Mus musculus BAC clone RP23-264J18 from chromosom...	40	8.7
104	gb|AF203504.2| Sphaerozosma sp. UTCC 284 ribulose 1,5-bisphospha...	40	8.7
105	gb|AY223029.1| Schistosoma japonicum clone ZZD1143 mRNA sequence	40	8.7
106	gb|AC092496.3| Bos taurus clone RP42-394P20, complete sequence	40	8.7
107	gb|AC101910.20| Mus musculus chromosome 7, clone RP24-327I20, co...	40	8.7
108	gb|AC159466.3| Mus musculus 10 BAC RP23-388A21 (Roswell Park Can...	40	8.7
109	gb|BC064677.1| Mus musculus cDNA clone IMAGE:6413892, **** WARNI...	40	8.7
110	gb|BC094620.1| Mus musculus CCR4-NOT transcription complex, subu...	40	8.7
111	ref|XM_794696.1| PREDICTED: Strongylocentrotus purpuratus hypoth...	40	8.7
112	gb|AY942170.1| Caulerpa sertularioides ribulose-1,5-bisphosphate...	40	8.7
113	emb|Z80203.1|MMZ80203 M.myrsinoides rbcL gene	40	8.7
114	gb|AC148205.3| Callicebus moloch clone LB5-314H24, complete sequ...	40	8.7
115	emb|AJ553972.1|STU553972 Staurastrum tumidum chloroplast partial...	40	8.7
116	emb|AJ553971.1|SLU553971 Staurastrum lunatum chloroplast partial...	40	8.7
117	emb|AJ553970.1|SPU553970 Spondylosium pulchrum chloroplast parti...	40	8.7
118	emb|AJ553969.1|SPA553969 Spondylosium panduriforme chloroplast p...	40	8.7
119	emb|AJ553967.1|SSP553967 Spirogyra sp. M-1810 chloroplast partia...	40	8.7
120	emb|AJ553962.1|PNO553962 Phymatodocis nordstedtiana chloroplast ...	40	8.7
121	emb|AJ553961.1|PSP553961 Penium spirostriolatum chloroplast part...	40	8.7
122	emb|AJ553960.1|PEX553960 Penium exiguum chloroplast partial rbcL...	40	8.7
123	emb|AJ553959.1|PCY553959 Penium cylindrus chloroplast partial rb...	40	8.7
124	emb|AJ553957.1|NOB553957 Netrium oblongum chloroplast partial rb...	40	8.7
125	emb|AJ553954.1|MSP553954 Mougeotia sp. SVCK 240 chloroplast part...	40	8.7
126	emb|AJ553953.1|MSP553953 Mougeotia sp. SVCK 417 chloroplast part...	40	8.7
127	emb|AJ553948.1|HPU553948 Heimansia pusilla chloroplast partial r...	40	8.7
128	emb|AJ553947.1|HMI553947 Haplotaenium minutum chloroplast partia...	40	8.7
129	emb|AJ553937.1|CCO553937 Cosmarium contractum chloroplast partia...	40	8.7
130	emb|AJ300474.1|AHI300474 Antirrhinum hispanicum ORF1, ORF2, ORF3...	40	8.7
131	gb|AY964181.1| Cosmarium obtusatum ribulose-1,5-bisphosphate car...	40	8.7
132	gb|AY964180.1| Cosmarium laeve ribulose-1,5-bisphosphate carboxy...	40	8.7
133	gb|AY964179.1| Cosmarium reniforme ribulose-1,5-bisphosphate car...	40	8.7
134	gb|AY964178.1| Cosmarium exiguum ribulose-1,5-bisphosphate carbo...	40	8.7
135	gb|AY964177.1| Cosmarium obsoletum ribulose-1,5-bisphosphate car...	40	8.7
136	gb|AY964175.1| Cosmarium dentatum ribulose-1,5-bisphosphate carb...	40	8.7
137	gb|AY964174.1| Cosmarium sexangulare ribulose-1,5-bisphosphate c...	40	8.7
138	gb|AY964173.1| Cosmarium debaryi ribulose-1,5-bisphosphate carbo...	40	8.7
139	gb|AY964172.1| Cosmarium bisphaericum ribulose-1,5-bisphosphate ...	40	8.7
140	gb|AY964171.1| Actinotaenium curtum ribulose-1,5-bisphosphate ca...	40	8.7
141	gb|AY964170.1| Actinotaenium cucurbita ribulose-1,5-bisphosphate...	40	8.7
142	gb|AY964169.1| Cosmarium isthmium ribulose-1,5-bisphosphate carb...	40	8.7
143	gb|AY964168.1| Cosmarium pseudoconnatum ribulose-1,5-bisphosphat...	40	8.7
144	gb|AY964167.1| Cosmarium blyttii ribulose-1,5-bisphosphate carbo...	40	8.7
145	gb|AY964166.1| Cosmarium subtumidum ribulose-1,5-bisphosphate ca...	40	8.7
146	gb|AY964165.1| Arthrodesmus convergens ribulose-1,5-bisphosphate...	40	8.7
147	gb|AY964164.1| Cosmarium depressum ribulose-1,5-bisphosphate car...	40	8.7
148	gb|AY964163.1| Cosmarium levinotabile ribulose-1,5-bisphosphate ...	40	8.7
149	gb|AY964162.1| Cosmarium borgesenii var. polymorphum ribulose-1,...	40	8.7
150	gb|AY964161.1| Cosmarium sp. ACKU 1232 ribulose-1,5-bisphosphate...	40	8.7
151	gb|AY964160.1| Cosmarium norimbergense var. depressum ribulose-1...	40	8.7
152	gb|AY964159.1| Actinotaenium wollei ribulose-1,5-bisphosphate ca...	40	8.7
153	gb|AY964158.1| Cosmarium subprotumidum ribulose-1,5-bisphosphate...	40	8.7
154	gb|AY964157.1| Cosmarium subprotumidum var. gregorii ribulose-1,...	40	8.7
155	gb|AY964156.1| Cosmarium auriculatum ribulose-1,5-bisphosphate c...	40	8.7
156	gb|AY964155.1| Cosmarium costatum ribulose-1,5-bisphosphate carb...	40	8.7
157	gb|AY964154.1| Cosmarium angulosum f. rotundatum ribulose-1,5-bi...	40	8.7
158	gb|AY051142.1| Coleochaete pulvinata ribulose bisphosphate-1,5-c...	40	8.7
159	gb|AY051139.1| Coleochaete sp. 18a1 ribulose bisphosphate-1,5-ca...	40	8.7
160	gb|AY051138.1| Coleochaete scutata ribulose bisphosphate-1,5-car...	40	8.7
161	gb|AF417289.1| Cosmarium quadrum var. minus ribulose 1,5-bisphos...	40	8.7
162	gb|AF417286.1| Cosmarium furcatospermum ribulose 1,5-bisphosphat...	40	8.7
163	gb|AF417285.1| Cosmarium obtusatum ribulose 1,5-bisphosphate car...	40	8.7
164	gb|AF417284.1| Cosmarium obtusatum ribulose 1,5-bisphosphate car...	40	8.7
165	gb|AF417283.1| Cosmarium subcostatum ribulose 1,5-bisphosphate c...	40	8.7
166	gb|AF417282.1| Cosmarium trilobulatum ribulose 1,5-bisphosphate ...	40	8.7
167	gb|AF417281.1| Cosmarium rectangulare ribulose 1,5-bisphosphate ...	40	8.7
168	gb|AF417280.1| Cosmarium angulosum ribulose 1,5-bisphosphate car...	40	8.7
169	gb|AF417279.1| Cosmarium impressulum ribulose 1,5-bisphosphate c...	40	8.7
170	gb|AF417278.1| Cosmarium hammeri ribulose 1,5-bisphosphate carbo...	40	8.7
171	gb|AF417277.1| Cosmarium granatum ribulose 1,5-bisphosphate carb...	40	8.7
172	gb|AF417276.1| Cosmarium fontarabiense ribulose 1,5-bisphosphate...	40	8.7
173	gb|AF417275.1| Cosmarium bioculatum ribulose 1,5-bisphosphate ca...	40	8.7
174	gb|AF417274.1| Cosmarium pachydermum f. parvum ribulose 1,5-bisp...	40	8.7
175	gb|AF417273.1| Cosmarium subcucumis ribulose 1,5-bisphosphate ca...	40	8.7
176	gb|AF417272.1| Cosmarium cucumis var. magnum ribulose 1,5-bispho...	40	8.7
177	gb|AF428114.1| Staurastrum quadricornutum ribulose-1,5-bisphosph...	40	8.7
178	gb|AF428113.1| Staurastrum galeatum ribulose-1,5-bisphosphate ca...	40	8.7
179	gb|AF428111.1| Staurastrum crenulatum ribulose-1,5-bisphosphate ...	40	8.7
180	gb|AF428110.1| Staurastrum natator ribulose-1,5-bisphosphate car...	40	8.7
181	gb|AF425770.1| Staurastrum orbiculare ribulose-1,5-bisphosphate ...	40	8.7
182	gb|AY057457.1| Stizostedion vitreum clone C1a2 major histocompat...	40	8.7
183	gb|AY004763.1| Caulerpa filiformis chloroplast ribulose 1,5-bisp...	40	8.7
184	gb|AF408252.1| Mougeotia sp. UTEX LB 758 ribulose 1,5-bisphospha...	40	8.7
185	gb|AF408249.1| Coleochaete sieminskiana ribulose 1,5-bisphosphat...	40	8.7
186	gb|AF408247.1| Coleochaete soluta ribulose 1,5-bisphosphate carb...	40	8.7
187	gb|AF215516.2|AF215516 Blakea trinervia ribulose-bisphosphate ca...	40	8.7
188	dbj|AK079464.1| Mus musculus 6 days neonate skin cDNA, RIKEN ful...	40	8.7
189	dbj|AK031357.1| Mus musculus 13 days embryo male testis cDNA, RI...	40	8.7
190	dbj|AK048177.1| Mus musculus 16 days embryo head cDNA, RIKEN ful...	40	8.7
191	dbj|AB038486.1| Caulerpa racemosa chloroplast rbcL gene for ribu...	40	8.7
192	dbj|AB038485.1| Caulerpa racemosa var. macrophysa chloroplast rb...	40	8.7
193	gb|AF203507.1|AF203507 Xanthidium subhastiferum ribulose 1,5-bis...	40	8.7
194	gb|AF203506.1|AF203506 Staurastrum pingue ribulose 1,5-bisphosph...	40	8.7
195	gb|AF203505.1|AF203505 Spondylosium pulchellum ribulose 1,5-bisp...	40	8.7
196	gb|AF203503.1|AF203503 Pleurotaenium trabecula ribulose 1,5-bisp...	40	8.7
197	gb|AF203502.1|AF203502 Penium margaritaceum ribulose 1,5-bisphos...	40	8.7
198	gb|AF203501.1|AF203501 Onychonema sp. UTEX LB 832 ribulose 1,5-b...	40	8.7
199	gb|AF203500.1|AF203500 Micrasterias rotata ribulose 1,5-bisphosp...	40	8.7
200	gb|AF203499.1|AF203499 Hyalotheca dissiliens ribulose 1,5-bispho...	40	8.7
201	gb|AF203498.1|AF203498 Groenbladia undulata ribulose 1,5-bisphos...	40	8.7
202	gb|AF203497.1|AF203497 Euastrum pectinatum ribulose 1,5-bisphosp...	40	8.7
203	gb|AF203493.1|AF203493 Cosmarium botrytis ribulose 1,5-bisphosph...	40	8.7
204	gb|AF203491.1|AF203491 Staurodesmus sp. UTEX LB 2508 ribulose 1,...	40	8.7
205	gb|AC156276.6| Mus musculus 10 BAC RP24-323L12 (Roswell Park Can...	40	8.7
206	gb|AY082330.1| Coleochaete divergens ribulose-1,5-bisphosphate c...	40	8.7
207	gb|AY082329.1| Coleochaete scutata ribulose-1,5-bisphosphate car...	40	8.7
208	gb|AY082328.1| Coleochaete sp. 327d3 ribulose-1,5-bisphosphate c...	40	8.7
209	dbj|AB038483.1| Caulerpa brachypus chloroplast rbcL gene for rib...	40	8.7
210	dbj|AK129258.1| Mus musculus mRNA for mKIAA1007 protein	40	8.7
211	gb|AY111789.1| Zea mays CL3071_3 mRNA sequence	40	8.7
212	gb|AY557630.1| Cosmarium borgesenii var. polymorphum ribulose-1,...	40	8.7
213	gb|AC113951.13| Mus musculus chromosome 8, clone RP24-161A21, co...	40	8.7
214	gb|U96650.1|U96650 Maesa ternata ribulose 1,5-biphosphate carbox...	40	8.7
215	gb|AC163702.3| Gallus gallus BAC clone CH261-124A8 from chromoso...	40	8.7
216	gb|BC099150.1| Rattus norvegicus similar to KIAA1007 protein; ad...	40	8.7
217	gb|BC086325.1| Rattus norvegicus similar to KIAA1007 protein; ad...	40	8.7
218	gb|BC027147.1| Mus musculus CCR4-NOT transcription complex, subu...	40	8.7
219	gb|AY609850.1| Sus scrofa clone Clu_3547.scr.msk.p1.Contig4, mRN...	40	8.7
220	emb|CT025624.11| Mouse DNA sequence from clone RP24-212N20 on ch...	40	8.7
221	gb|BC058249.1| Mus musculus cDNA clone IMAGE:6314537, containing...	40	8.7
222	gb|DP000019.1| Callicebus moloch target 1 genomic scaffold	40	8.7
223	gb|U38700.1|SCU38700 Spirotaenia condensata ribulose bisphosphat...	40	8.7
224	emb|AJ390035.1|VVI390035 Ventilago viminalis chloroplast partial...	40	8.7
225	emb|AL671977.8| Mouse DNA sequence from clone RP23-171A16 on chr...	40	8.7
226	gb|L13477.1|COOCPRBCL Coleochaete orbicularis chloroplast ribulo...	40	8.7
227	gb|AY067462.1| Schmidtea mediterranea clone H.6.11f unknown mRNA...	40	8.7

---

>ref|XM_475538.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1518

 Score =  165 bits (83), Expect = 2e-37
 Identities = 143/163 (87%)
 Strand = Plus / Plus

                                                                       
Query: 43  catctacaagctcgtacatctgctttgcctgcctgagatgaagatcttcttggacaccac 102
           ||||||||||||| | ||||||||||| ||||||||||||||||| ||||||||||| ||
Sbjct: 738 catctacaagctcatccatctgctttgtctgcctgagatgaagattttcttggacacgac 797

                                                                       
Query: 103 tagatcgcttgcagctcacactgataatgtagttgatgagctctggaattacatcaagca 162
            |||  |||||||| | |||| |||||| | ||||||||||| ||||| ||||||||| |
Sbjct: 798 aagactgcttgcagataacacagataatattgttgatgagctatggaactacatcaagga 857

                                                      
Query: 163 ggggaagcttgttcctgctgctattttgcttcttgcagctcaa 205
           ||||| |||||| | ||||||||||||||| ||||||||||||
Sbjct: 858 ggggaggcttgtccatgctgctattttgctccttgcagctcaa 900

---

>dbj|AK105314.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-117-D11, full
           insert sequence
          Length = 2151

 Score =  165 bits (83), Expect = 2e-37
 Identities = 143/163 (87%)
 Strand = Plus / Plus

                                                                       
Query: 43  catctacaagctcgtacatctgctttgcctgcctgagatgaagatcttcttggacaccac 102
           ||||||||||||| | ||||||||||| ||||||||||||||||| ||||||||||| ||
Sbjct: 829 catctacaagctcatccatctgctttgtctgcctgagatgaagattttcttggacacgac 888

                                                                       
Query: 103 tagatcgcttgcagctcacactgataatgtagttgatgagctctggaattacatcaagca 162
            |||  |||||||| | |||| |||||| | ||||||||||| ||||| ||||||||| |
Sbjct: 889 aagactgcttgcagataacacagataatattgttgatgagctatggaactacatcaagga 948

                                                      
Query: 163 ggggaagcttgttcctgctgctattttgcttcttgcagctcaa 205
           ||||| |||||| | ||||||||||||||| ||||||||||||
Sbjct: 949 ggggaggcttgtccatgctgctattttgctccttgcagctcaa 991

---

>ref|XM_475546.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 807

 Score =  149 bits (75), Expect = 1e-32
 Identities = 141/163 (86%)
 Strand = Plus / Plus

                                                                       
Query: 43  catctacaagctcgtacatctgctttgcctgcctgagatgaagatcttcttggacaccac 102
           |||||||||||| || ||||||||||| ||||||||||||||||||||||||||||| ||
Sbjct: 363 catctacaagcttgtccatctgctttgtctgcctgagatgaagatcttcttggacacgac 422

                                                                       
Query: 103 tagatcgcttgcagctcacactgataatgtagttgatgagctctggaattacatcaagca 162
            |||  ||||||||   |||| ||||||||  ||||||| || ||||||||||| ||| |
Sbjct: 423 cagactgcttgcagactacacagataatgttcttgatgaactatggaattacattaagga 482

                                                      
Query: 163 ggggaagcttgttcctgctgctattttgcttcttgcagctcaa 205
           ||| |||||||| | ||| ||||||||||| ||||||||||||
Sbjct: 483 gggaaagcttgtccatgcagctattttgctccttgcagctcaa 525



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 366 aagctggtgaagctcttgaggcatatattcaaactcactcagagg 410
           ||||||||||||||||||| | |||||| || ||||| |||||||
Sbjct: 740 aagctggtgaagctcttgatgaatatatccagactcattcagagg 784

---

>gb|AC079021.5| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0008A07,
             complete sequence
          Length = 135809

 Score =  111 bits (56), Expect = 3e-21
 Identities = 107/124 (86%)
 Strand = Plus / Minus

                                                                         
Query: 82    gaagatcttcttggacaccactagatcgcttgcagctcacactgataatgtagttgatga 141
             |||||| ||||||||||| || |||  |||||||| | |||| |||||| | ||||||||
Sbjct: 85741 gaagattttcttggacacgacaagactgcttgcagataacacagataatattgttgatga 85682

                                                                         
Query: 142   gctctggaattacatcaagcaggggaagcttgttcctgctgctattttgcttcttgcagc 201
             ||| ||||| ||||||||| |||||| |||||| | ||||||||||||||| ||||||||
Sbjct: 85681 gctatggaactacatcaaggaggggaggcttgtccatgctgctattttgctccttgcagc 85622

                 
Query: 202   tcaa 205
             ||||
Sbjct: 85621 tcaa 85618



 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 98/117 (83%)
 Strand = Plus / Minus

                                                                          
Query: 89     ttcttggacaccactagatcgcttgcagctcacactgataatgtagttgatgagctctgg 148
              ||||||||||| || |||  ||||||||   |||| ||||||||  ||||||| || |||
Sbjct: 135809 ttcttggacacgaccagactgcttgcagactacacagataatgttcttgatgaactatgg 135750

                                                                       
Query: 149    aattacatcaagcaggggaagcttgttcctgctgctattttgcttcttgcagctcaa 205
              |||||||| ||| |||| |||||||| | ||| ||||||||||| ||||||||||||
Sbjct: 135749 aattacattaaggagggaaagcttgtccatgcagctattttgctccttgcagctcaa 135693



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                     
Query: 43    catctacaagctcgtacatctgctttgcctgcctgagatg 82
             ||||||||||||| | ||||||||||| ||||||||||||
Sbjct: 86043 catctacaagctcatccatctgctttgtctgcctgagatg 86004



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                           
Query: 366    aagctggtgaagctcttgaggcatatattcaaactcactcagagg 410
              ||||||||||||||||||| | |||||| || ||||| |||||||
Sbjct: 135478 aagctggtgaagctcttgatgaatatatccagactcattcagagg 135434

---

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
               sequence
          Length = 29737217

 Score =  111 bits (56), Expect = 3e-21
 Identities = 107/124 (86%)
 Strand = Plus / Minus

                                                                           
Query: 82      gaagatcttcttggacaccactagatcgcttgcagctcacactgataatgtagttgatga 141
               |||||| ||||||||||| || |||  |||||||| | |||| |||||| | ||||||||
Sbjct: 1290928 gaagattttcttggacacgacaagactgcttgcagataacacagataatattgttgatga 1290869

                                                                           
Query: 142     gctctggaattacatcaagcaggggaagcttgttcctgctgctattttgcttcttgcagc 201
               ||| ||||| ||||||||| |||||| |||||| | ||||||||||||||| ||||||||
Sbjct: 1290868 gctatggaactacatcaaggaggggaggcttgtccatgctgctattttgctccttgcagc 1290809

                   
Query: 202     tcaa 205
               ||||
Sbjct: 1290808 tcaa 1290805



 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 105/124 (84%)
 Strand = Plus / Minus

                                                                           
Query: 82      gaagatcttcttggacaccactagatcgcttgcagctcacactgataatgtagttgatga 141
               |||||||||||||||||| || |||  ||||||||   |||| ||||||||  |||||||
Sbjct: 1341003 gaagatcttcttggacacgaccagactgcttgcagactacacagataatgttcttgatga 1340944

                                                                           
Query: 142     gctctggaattacatcaagcaggggaagcttgttcctgctgctattttgcttcttgcagc 201
                || ||||||||||| ||| |||| |||||||| | ||| ||||||||||| ||||||||
Sbjct: 1340943 actatggaattacattaaggagggaaagcttgtccatgcagctattttgctccttgcagc 1340884

                   
Query: 202     tcaa 205
               ||||
Sbjct: 1340883 tcaa 1340880



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                       
Query: 43      catctacaagctcgtacatctgctttgcctgcctgagatg 82
               |||||||||||| || ||||||||||| ||||||||||||
Sbjct: 1341419 catctacaagcttgtccatctgctttgtctgcctgagatg 1341380



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                       
Query: 43      catctacaagctcgtacatctgctttgcctgcctgagatg 82
               ||||||||||||| | ||||||||||| ||||||||||||
Sbjct: 1291230 catctacaagctcatccatctgctttgtctgcctgagatg 1291191



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                            
Query: 366     aagctggtgaagctcttgaggcatatattcaaactcactcagagg 410
               ||||||||||||||||||| | |||||| || ||||| |||||||
Sbjct: 1340665 aagctggtgaagctcttgatgaatatatccagactcattcagagg 1340621

---

>gb|AC134931.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone
            OSJNBb0079L11, complete sequence
          Length = 124104

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 105/124 (84%)
 Strand = Plus / Minus

                                                                        
Query: 82   gaagatcttcttggacaccactagatcgcttgcagctcacactgataatgtagttgatga 141
            |||||||||||||||||| || |||  ||||||||   |||| ||||||||  |||||||
Sbjct: 2665 gaagatcttcttggacacgaccagactgcttgcagactacacagataatgttcttgatga 2606

                                                                        
Query: 142  gctctggaattacatcaagcaggggaagcttgttcctgctgctattttgcttcttgcagc 201
             || ||||||||||| ||| |||| |||||||| | ||| ||||||||||| ||||||||
Sbjct: 2605 actatggaattacattaaggagggaaagcttgtccatgcagctattttgctccttgcagc 2546

                
Query: 202  tcaa 205
            ||||
Sbjct: 2545 tcaa 2542



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 43   catctacaagctcgtacatctgctttgcctgcctgagatg 82
            |||||||||||| || ||||||||||| ||||||||||||
Sbjct: 3081 catctacaagcttgtccatctgctttgtctgcctgagatg 3042



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                         
Query: 366  aagctggtgaagctcttgaggcatatattcaaactcactcagagg 410
            ||||||||||||||||||| | |||||| || ||||| |||||||
Sbjct: 2327 aagctggtgaagctcttgatgaatatatccagactcattcagagg 2283

---

>ref|NM_194490.1| Oryza sativa (japonica cultivar-group) putative polyprotein
           (OSJNBa0096E22.1), mRNA
          Length = 2682

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 109/134 (81%)
 Strand = Plus / Plus

                                                                       
Query: 41  tacatctacaagctcgtacatctgctttgcctgcctgagatgaagatcttcttggacacc 100
           ||||||||||||||| | ||||| || ||||| |||||||||||| | |||||||| || 
Sbjct: 700 tacatctacaagctcattcatctcctctgcctacctgagatgaaggttttcttggatacg 759

                                                                       
Query: 101 actagatcgcttgcagctcacactgataatgtagttgatgagctctggaattacatcaag 160
           | ||||   ||||| |   | || |||||| | ||||||||||||||||||||||| |||
Sbjct: 760 attagacttcttgccgagaaaacagataatcttgttgatgagctctggaattacatgaag 819

                         
Query: 161 caggggaagcttgt 174
            | || ||||||||
Sbjct: 820 aacggcaagcttgt 833

---

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
               sequence
          Length = 35954743

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                                
Query: 125     gataatgtagttgatgagctctggaattacatcaagcaggggaagcttg 173
               ||||||||||| |||||||||||||||||||| ||| | || |||||||
Sbjct: 8920018 gataatgtagtcgatgagctctggaattacatgaagaacggcaagcttg 8919970

---

>dbj|AP004801.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0613F08
          Length = 142937

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                               
Query: 125    gataatgtagttgatgagctctggaattacatcaagcaggggaagcttg 173
              ||||||||||| |||||||||||||||||||| ||| | || |||||||
Sbjct: 125036 gataatgtagtcgatgagctctggaattacatgaagaacggcaagcttg 124988

---

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12,
              complete sequence
          Length = 27566993

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                     
Query: 364    caaagctggtgaagctcttgaggcatatattcaaactca 402
              |||||| |||||||||||||||| ||| |||||||||||
Sbjct: 925396 caaagccggtgaagctcttgagggatacattcaaactca 925358

---

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11,
              complete sequence
          Length = 28386948

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                     
Query: 364    caaagctggtgaagctcttgaggcatatattcaaactca 402
              ||||||||||||||||||||| | ||| |||||||||||
Sbjct: 384987 caaagctggtgaagctcttgacggatacattcaaactca 384949

---

>dbj|AK063302.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-113-F04, full
            insert sequence
          Length = 3264

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                   
Query: 364  caaagctggtgaagctcttgaggcatatattcaaactca 402
            |||||| |||||||||||||||| ||| |||||||||||
Sbjct: 1245 caaagccggtgaagctcttgagggatacattcaaactca 1283



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 65  ctttgcctgcctgagatgaagatcttcttggacaccactagat 107
           ||||| || ||||||||||| || ||||||||||| |||||||
Sbjct: 892 ctttgtcttcctgagatgaaaatgttcttggacacgactagat 934

---

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                     
Query: 364    caaagctggtgaagctcttgaggcatatattcaaactca 402
              ||||||||||||||||||||| | ||| |||||||||||
Sbjct: 384987 caaagctggtgaagctcttgacggatacattcaaactca 384949

---

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                     
Query: 364    caaagctggtgaagctcttgaggcatatattcaaactca 402
              |||||| |||||||||||||||| ||| |||||||||||
Sbjct: 925396 caaagccggtgaagctcttgagggatacattcaaactca 925358

---

>emb|BX000505.1|CNS08CDV Oryza sativa chromosome 12, . BAC OJ1126_F08 of library Monsanto from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 134217

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                    
Query: 364   caaagctggtgaagctcttgaggcatatattcaaactca 402
             |||||| |||||||||||||||| ||| |||||||||||
Sbjct: 62981 caaagccggtgaagctcttgagggatacattcaaactca 62943

---

>emb|BX000497.1|CNS08CDN Oryza sativa chromosome 11, . BAC OSJNBa0010K05 of library OSJNBa from
             chromosome 11 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 164143

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                    
Query: 364   caaagctggtgaagctcttgaggcatatattcaaactca 402
             ||||||||||||||||||||| | ||| |||||||||||
Sbjct: 92305 caaagctggtgaagctcttgacggatacattcaaactca 92267

---

>gb|AC079632.4| Oryza sativa (japonica cultivar-group) chromosome 10 clone OSJNBa0046L02,
              complete sequence
          Length = 142381

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                                
Query: 125    gataatgtagttgatgagctctggaattacatcaagcaggggaagcttgt 174
              |||||| | ||||||||||||||||||||||| ||| | || ||||||||
Sbjct: 141809 gataatcttgttgatgagctctggaattacatgaagaacggcaagcttgt 141858



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                        
Query: 41     tacatctacaagctcgtacatctgctttgcctgcctgagatg 82
              ||||||||||||||| | ||||| || ||||| |||||||||
Sbjct: 141424 tacatctacaagctcattcatctcctctgcctacctgagatg 141465

---

>gb|AC145127.1| Oryza sativa (japonica cultivar-group) chromosome 10 clone
              Pseudo10p0.0-10p4.4, complete sequence
          Length = 2331000

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                                
Query: 125    gataatgtagttgatgagctctggaattacatcaagcaggggaagcttgt 174
              |||||| | ||||||||||||||||||||||| ||| | || ||||||||
Sbjct: 155915 gataatcttgttgatgagctctggaattacatgaagaacggcaagcttgt 155964



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                        
Query: 41     tacatctacaagctcgtacatctgctttgcctgcctgagatg 82
              ||||||||||||||| | ||||| || ||||| |||||||||
Sbjct: 155530 tacatctacaagctcattcatctcctctgcctacctgagatg 155571

---

>gb|AC099400.2| Oryza sativa (japonica cultivar-group) chromosome 10 clone
            OSJNBa0096E22, complete sequence
          Length = 133846

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                              
Query: 125  gataatgtagttgatgagctctggaattacatcaagcaggggaagcttgt 174
            |||||| | ||||||||||||||||||||||| ||| | || ||||||||
Sbjct: 5578 gataatcttgttgatgagctctggaattacatgaagaacggcaagcttgt 5627



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                      
Query: 41   tacatctacaagctcgtacatctgctttgcctgcctgagatg 82
            ||||||||||||||| | ||||| || ||||| |||||||||
Sbjct: 5193 tacatctacaagctcattcatctcctctgcctacctgagatg 5234

---

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10,
              complete sequence
          Length = 22685906

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                                
Query: 125    gataatgtagttgatgagctctggaattacatcaagcaggggaagcttgt 174
              |||||| | ||||||||||||||||||||||| ||| | || ||||||||
Sbjct: 155915 gataatcttgttgatgagctctggaattacatgaagaacggcaagcttgt 155964



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                        
Query: 41     tacatctacaagctcgtacatctgctttgcctgcctgagatg 82
              ||||||||||||||| | ||||| || ||||| |||||||||
Sbjct: 155530 tacatctacaagctcattcatctcctctgcctacctgagatg 155571

---

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                                
Query: 125    gataatgtagttgatgagctctggaattacatcaagcaggggaagcttgt 174
              |||||| | ||||||||||||||||||||||| ||| | || ||||||||
Sbjct: 155913 gataatcttgttgatgagctctggaattacatgaagaacggcaagcttgt 155962



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                        
Query: 41     tacatctacaagctcgtacatctgctttgcctgcctgagatg 82
              ||||||||||||||| | ||||| || ||||| |||||||||
Sbjct: 155528 tacatctacaagctcattcatctcctctgcctacctgagatg 155569

---

>dbj|AK069731.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023028M23, full
           insert sequence
          Length = 2370

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 91/113 (80%)
 Strand = Plus / Plus

                                                                       
Query: 44  atctacaagctcgtacatctgctttgcctgcctgagatgaagatcttcttggacaccact 103
           |||||||||||| | |||||||| || || |||||||||||| | || ||||| ||   |
Sbjct: 859 atctacaagctcattcatctgctgtgtctacctgagatgaaggtttttttggatacagtt 918

                                                                
Query: 104 agatcgcttgcagctcacactgataatgtagttgatgagctctggaattacat 156
           |||  |||||| |   | || |||||| ||| |||||||||||||||||||||
Sbjct: 919 agactgcttgctgaaaaaacagataatctagctgatgagctctggaattacat 971

---

>dbj|AK059510.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-029-B04, full
            insert sequence
          Length = 2055

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 91/113 (80%)
 Strand = Plus / Plus

                                                                        
Query: 44   atctacaagctcgtacatctgctttgcctgcctgagatgaagatcttcttggacaccact 103
            |||||||||||| | |||||||| || || |||||||||||| | || ||||| ||   |
Sbjct: 896  atctacaagctcattcatctgctgtgtctacctgagatgaaggtttttttggatacagtt 955

                                                                 
Query: 104  agatcgcttgcagctcacactgataatgtagttgatgagctctggaattacat 156
            |||  |||||| |   | || |||||| ||| |||||||||||||||||||||
Sbjct: 956  agactgcttgctgaaaaaacagataatctagctgatgagctctggaattacat 1008

---

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                                
Query: 125      gataatgtagttgatgagctctggaattacat 156
                |||||| ||| |||||||||||||||||||||
Sbjct: 41465649 gataatctagctgatgagctctggaattacat 41465680



 Score = 48.1 bits (24), Expect = 0.036
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                                
Query: 125      gataatgtagttgatgagctctggaattacat 156
                |||||| ||| |||||||||||||||||||||
Sbjct: 41434675 gataatctagctgatgagctctggaattacat 41434706

---

>dbj|AP004031.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0432C03
          Length = 164394

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                              
Query: 125    gataatgtagttgatgagctctggaattacat 156
              |||||| ||| |||||||||||||||||||||
Sbjct: 157142 gataatctagctgatgagctctggaattacat 157173



 Score = 48.1 bits (24), Expect = 0.036
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                              
Query: 125    gataatgtagttgatgagctctggaattacat 156
              |||||| ||| |||||||||||||||||||||
Sbjct: 126168 gataatctagctgatgagctctggaattacat 126199

---

>dbj|AP004073.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0614D08
          Length = 147548

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                             
Query: 125   gataatgtagttgatgagctctggaattacat 156
             |||||| ||| |||||||||||||||||||||
Sbjct: 21942 gataatctagctgatgagctctggaattacat 21973

---

>dbj|AP003687.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0660F12
          Length = 147203

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                             
Query: 125   gataatgtagttgatgagctctggaattacat 156
             |||||| ||| |||||||||||||||||||||
Sbjct: 33848 gataatctagctgatgagctctggaattacat 33879



 Score = 48.1 bits (24), Expect = 0.036
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                            
Query: 125  gataatgtagttgatgagctctggaattacat 156
            |||||| ||| |||||||||||||||||||||
Sbjct: 2874 gataatctagctgatgagctctggaattacat 2905

---

>ref|NM_184900.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2649

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 125 gataatgtagttgatgagctctggaattacatcaagcaggggaagcttgt 174
           |||||| | ||||||||||| ||||||||||| ||| | || ||||||||
Sbjct: 649 gataatcttgttgatgagctatggaattacatgaaggatggcaagcttgt 698

---

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                                  
Query: 125      gataatgtagttgatgagctctggaattacatcaagcaggggaagcttgt 174
                |||||| | ||||||||||| ||||||||||| ||| | || ||||||||
Sbjct: 31824350 gataatcttgttgatgagctatggaattacatgaaggatggcaagcttgt 31824301

---

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 76       tgagatgaagatcttcttggac 97
                ||||||||||||||||||||||
Sbjct: 20821732 tgagatgaagatcttcttggac 20821753

---

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                                  
Query: 125      gataatgtagttgatgagctctggaattacatcaagcaggggaagcttgt 174
                |||||| | ||||||||||| ||||||||||| ||| | || ||||||||
Sbjct: 31914866 gataatcttgttgatgagctatggaattacatgaaggatggcaagcttgt 31914817

---

>dbj|AP003868.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8,
          BAC clone:OJ1111_B08
          Length = 131184

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                
Query: 76 tgagatgaagatcttcttggac 97
          ||||||||||||||||||||||
Sbjct: 33 tgagatgaagatcttcttggac 54

---

>emb|AL929061.31| Mouse DNA sequence from clone RP23-402A18 on chromosome X, complete
              sequence
          Length = 146071

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 315    agatgaaagtacatcttatcaa 336
              ||||||||||||||||||||||
Sbjct: 106860 agatgaaagtacatcttatcaa 106881

---

>dbj|AP003881.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1124_B05
          Length = 109917

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 76    tgagatgaagatcttcttggac 97
             ||||||||||||||||||||||
Sbjct: 52865 tgagatgaagatcttcttggac 52886

---

>gb|AC091494.9| Oryza sativa chromosome 3 BAC OSJNBa0070N04 genomic sequence, complete
             sequence
          Length = 150663

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                               
Query: 125   gataatgtagttgatgagctctggaattacatcaagcaggggaagcttgt 174
             |||||| | ||||||||||| ||||||||||| ||| | || ||||||||
Sbjct: 25603 gataatcttgttgatgagctatggaattacatgaaggatggcaagcttgt 25554

---

>emb|AL365333.13| Mouse DNA sequence from clone RP21-490L20 on chromosome X, complete
             sequence
          Length = 151792

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 315   agatgaaagtacatcttatcaa 336
             ||||||||||||||||||||||
Sbjct: 46914 agatgaaagtacatcttatcaa 46935

---

>ref|XM_518688.1| PREDICTED: Pan troglodytes similar to solute carrier family 22,
            member 16; fly-like putative organic ion transporter 2;
            organic cation transporter 6; carnitine transporter 2
            (LOC462937), mRNA
          Length = 2727

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 613  accacgagatagccacttgca 633
            |||||||||||||||||||||
Sbjct: 1394 accacgagatagccacttgca 1374

---

>gb|CP000067.1| Trypanosoma brucei chromosome 4, complete sequence
          Length = 1590432

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 389    tatattcaaactcactcagaggcat 413
              |||||||| ||||||||||||||||
Sbjct: 724621 tatattcatactcactcagaggcat 724645

---

>gb|AC087606.2| Trypanosoma brucei chromosome 4 clone RPCI93-4J6, complete sequence
          Length = 37931

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 389   tatattcaaactcactcagaggcat 413
             |||||||| ||||||||||||||||
Sbjct: 23343 tatattcatactcactcagaggcat 23367

---

>gb|AC080131.9| Trypanosoma brucei chromosome 4 clone RPCI93-2H8, complete sequence
          Length = 163689

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 389    tatattcaaactcactcagaggcat 413
              |||||||| ||||||||||||||||
Sbjct: 157958 tatattcatactcactcagaggcat 157934

---

>gb|U64607.1| Caenorhabditis elegans cosmid F43E12, complete sequence
          Length = 10502

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 297  caaaaaagcagctgaaggagatgaa 321
            |||||||||||||||||||| ||||
Sbjct: 5862 caaaaaagcagctgaaggaggtgaa 5886

---

>emb|AL365269.23| Human DNA sequence from clone RP11-516J14 on chromosome 10, complete
            sequence
          Length = 19414

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 306  agctgaaggagatgaaagtac 326
            |||||||||||||||||||||
Sbjct: 4994 agctgaaggagatgaaagtac 5014

---

>gb|AF417288.1| Cosmarium humile var. substriatum ribulose 1,5-bisphosphate
           carboxylase/oxygenase large subunit gene, partial cds;
           chloroplast gene for chloroplast product
          Length = 1354

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 416 catgaggaggtccttggaaaagttt 440
           |||||||||||||||||||| ||||
Sbjct: 434 catgaggaggtccttggaaaggttt 410

---

>gb|BC018281.1| Mus musculus CCR4-NOT transcription complex, subunit 1, mRNA (cDNA
            clone IMAGE:3500852), complete cds
          Length = 3686

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 329  cttatcaatgcattggtgctt 349
            |||||||||||||||||||||
Sbjct: 2899 cttatcaatgcattggtgctt 2919

---

>emb|AL807763.7| Mouse DNA sequence from clone RP23-28B24 on chromosome 4, complete
              sequence
          Length = 219463

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 249    gtatagaggattgtatgtgtg 269
              |||||||||||||||||||||
Sbjct: 176600 gtatagaggattgtatgtgtg 176620

---

>gb|CP000036.1| Shigella boydii Sb227, complete genome
          Length = 4519823

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 196     tgcagctcaaaggcaataccg 216
               |||||||||||||||||||||
Sbjct: 2361640 tgcagctcaaaggcaataccg 2361620

---

>gb|M75140.1|HYDATPASE H.vulgaris Na,K-ATPase alpha subunit mRNA, complete cds
          Length = 3328

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 269 ggattaggaagtggtaaaact 289
           |||||||||||||||||||||
Sbjct: 869 ggattaggaagtggtaaaact 889

---

>gb|AC160389.4| Mus musculus chromosome 7, clone RP23-257G13, complete sequence
          Length = 237741

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 462   atgttggtcctagtggaaaa 481
             ||||||||||||||||||||
Sbjct: 29066 atgttggtcctagtggaaaa 29085

---

>gb|DQ015936.1| Spirogyra condensata strain UTEX LB 1744 ribulose-1,5-bisphosphate
           carboxylase/oxygenase large subunit (rbcL) gene, partial
           cds; chloroplast
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AC148460.2| Xenopus tropicalis clone CH216-3L17, complete sequence
          Length = 194144

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 219   atctcaatgggtttgatatcatca 242
             ||||||||| ||||||||||||||
Sbjct: 66335 atctcaatgagtttgatatcatca 66358

---

>gb|BT017434.1| Zea mays clone EL01N0403G04.c mRNA sequence
          Length = 1218

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 1   ttcggcacgagggagaacta 20
           ||||||||||||||||||||
Sbjct: 335 ttcggcacgagggagaacta 316

---

>gb|AE017346.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 6, complete
            sequence
          Length = 1438950

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 66   tttgcctgcctgagatgaag 85
            ||||||||||||||||||||
Sbjct: 3355 tttgcctgcctgagatgaag 3336

---

>gb|BT014927.1| Drosophila melanogaster AT15894 full insert cDNA
          Length = 3200

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 1    ttcggcacgagggagaacta 20
            ||||||||||||||||||||
Sbjct: 1688 ttcggcacgagggagaacta 1669

---

>gb|AC156577.3| Ornithorhynchus anatinus BAC clone OABb-470C16 from chromosome unknown,
             complete sequence
          Length = 153725

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 530   ccggccgggaacacaggttt 549
             ||||||||||||||||||||
Sbjct: 59561 ccggccgggaacacaggttt 59580

---

>ref|XM_974133.1| PREDICTED: Mus musculus similar to CCR4-NOT transcription complex,
           subunit 1 isoform a (LOC620499), mRNA
          Length = 1257

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 329 cttatcaatgcattggtgct 348
           ||||||||||||||||||||
Sbjct: 493 cttatcaatgcattggtgct 512

---

>ref|XM_974632.1| PREDICTED: Mus musculus similar to CCR4-NOT transcription complex,
           subunit 1 isoform a (LOC665105), mRNA
          Length = 1275

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 329 cttatcaatgcattggtgct 348
           ||||||||||||||||||||
Sbjct: 511 cttatcaatgcattggtgct 530

---

>ref|XM_974591.1| PREDICTED: Mus musculus similar to CCR4-NOT transcription complex,
           subunit 1 isoform a (LOC665100), mRNA
          Length = 684

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 329 cttatcaatgcattggtgct 348
           ||||||||||||||||||||
Sbjct: 406 cttatcaatgcattggtgct 425

---

>ref|XM_484354.4| PREDICTED: Mus musculus similar to CCR4-NOT transcription complex,
           subunit 1 isoform a (LOC620499), mRNA
          Length = 1257

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 329 cttatcaatgcattggtgct 348
           ||||||||||||||||||||
Sbjct: 493 cttatcaatgcattggtgct 512

---

>gb|AY082315.1| Coleochaete conchata ribulose-1,5-bisphosphate
           carboxylase/oxygenase (rbcL) gene, partial cds;
           chloroplast gene for chloroplast product
          Length = 1309

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AY082314.1| Coleochaete scutata strain 54a6 ribulose-1,5-bisphosphate
           carboxylase/oxygenase (rbcL) gene, partial cds;
           chloroplast gene for chloroplast product
          Length = 1309

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AY082313.1| Coleochaete scutata strain 531a4 ribulose-1,5-bisphosphate
           carboxylase/oxygenase (rbcL) gene, partial cds;
           chloroplast gene for chloroplast product
          Length = 1309

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AY082312.1| Coleochaete sp. 40D2 ribulose-1,5-bisphosphate
           carboxylase/oxygenase (rbcL) gene, partial cds;
           chloroplast gene for chloroplast product
          Length = 1306

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>ref|XM_001002332.1| PREDICTED: Mus musculus CCR4-NOT transcription complex, subunit 1,
            transcript variant 5 (Cnot1), mRNA
          Length = 3662

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 329  cttatcaatgcattggtgct 348
            ||||||||||||||||||||
Sbjct: 2215 cttatcaatgcattggtgct 2234

---

>ref|XM_001002371.1| PREDICTED: Mus musculus CCR4-NOT transcription complex, subunit 1,
            transcript variant 7 (Cnot1), mRNA
          Length = 5260

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 329  cttatcaatgcattggtgct 348
            ||||||||||||||||||||
Sbjct: 3813 cttatcaatgcattggtgct 3832

---

>ref|XM_001002356.1| PREDICTED: Mus musculus CCR4-NOT transcription complex, subunit 1,
            transcript variant 6 (Cnot1), mRNA
          Length = 7605

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 329  cttatcaatgcattggtgct 348
            ||||||||||||||||||||
Sbjct: 6947 cttatcaatgcattggtgct 6966

---

>ref|XM_001002393.1| PREDICTED: Mus musculus CCR4-NOT transcription complex, subunit 1,
            transcript variant 9 (Cnot1), mRNA
          Length = 8328

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 329  cttatcaatgcattggtgct 348
            ||||||||||||||||||||
Sbjct: 6881 cttatcaatgcattggtgct 6900

---

>ref|XM_001002382.1| PREDICTED: Mus musculus CCR4-NOT transcription complex, subunit 1,
            transcript variant 8 (Cnot1), mRNA
          Length = 8322

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 329  cttatcaatgcattggtgct 348
            ||||||||||||||||||||
Sbjct: 6875 cttatcaatgcattggtgct 6894

---

>ref|XM_001002409.1| PREDICTED: Mus musculus CCR4-NOT transcription complex, subunit 1,
            transcript variant 10 (Cnot1), mRNA
          Length = 8415

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 329  cttatcaatgcattggtgct 348
            ||||||||||||||||||||
Sbjct: 6968 cttatcaatgcattggtgct 6987

---

>ref|XM_001002423.1| PREDICTED: Mus musculus CCR4-NOT transcription complex, subunit 1,
            transcript variant 11 (Cnot1), mRNA
          Length = 8391

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 329  cttatcaatgcattggtgct 348
            ||||||||||||||||||||
Sbjct: 6944 cttatcaatgcattggtgct 6963

---

>ref|XM_923182.2| PREDICTED: Mus musculus CCR4-NOT transcription complex, subunit 1,
            transcript variant 25 (Cnot1), mRNA
          Length = 3663

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 329  cttatcaatgcattggtgct 348
            ||||||||||||||||||||
Sbjct: 2215 cttatcaatgcattggtgct 2234

---

>ref|XM_923199.2| PREDICTED: Mus musculus CCR4-NOT transcription complex, subunit 1,
            transcript variant 27 (Cnot1), mRNA
          Length = 5261

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 329  cttatcaatgcattggtgct 348
            ||||||||||||||||||||
Sbjct: 3813 cttatcaatgcattggtgct 3832

---

>ref|XM_923156.2| PREDICTED: Mus musculus CCR4-NOT transcription complex, subunit 1,
            transcript variant 21 (Cnot1), mRNA
          Length = 7605

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 329  cttatcaatgcattggtgct 348
            ||||||||||||||||||||
Sbjct: 6947 cttatcaatgcattggtgct 6966

---

>ref|XM_001002486.1| PREDICTED: Mus musculus CCR4-NOT transcription complex, subunit 1,
            transcript variant 32 (Cnot1), mRNA
          Length = 8329

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 329  cttatcaatgcattggtgct 348
            ||||||||||||||||||||
Sbjct: 6881 cttatcaatgcattggtgct 6900

---

>ref|XM_001002473.1| PREDICTED: Mus musculus CCR4-NOT transcription complex, subunit 1,
            transcript variant 31 (Cnot1), mRNA
          Length = 8323

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 329  cttatcaatgcattggtgct 348
            ||||||||||||||||||||
Sbjct: 6875 cttatcaatgcattggtgct 6894

---

>ref|XM_923215.2| PREDICTED: Mus musculus CCR4-NOT transcription complex, subunit 1,
            transcript variant 30 (Cnot1), mRNA
          Length = 8416

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 329  cttatcaatgcattggtgct 348
            ||||||||||||||||||||
Sbjct: 6968 cttatcaatgcattggtgct 6987

---

>ref|XM_914270.2| PREDICTED: Mus musculus CCR4-NOT transcription complex, subunit 1,
            transcript variant 16 (Cnot1), mRNA
          Length = 8392

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 329  cttatcaatgcattggtgct 348
            ||||||||||||||||||||
Sbjct: 6944 cttatcaatgcattggtgct 6963

---

>ref|XM_901816.2| PREDICTED: Mus musculus CCR4-NOT transcription complex, subunit 1,
            transcript variant 11 (Cnot1), mRNA
          Length = 3662

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 329  cttatcaatgcattggtgct 348
            ||||||||||||||||||||
Sbjct: 2215 cttatcaatgcattggtgct 2234

---

>ref|XM_901818.2| PREDICTED: Mus musculus CCR4-NOT transcription complex, subunit 1,
            transcript variant 12 (Cnot1), mRNA
          Length = 5260

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 329  cttatcaatgcattggtgct 348
            ||||||||||||||||||||
Sbjct: 3813 cttatcaatgcattggtgct 3832

---

>ref|XM_901801.2| PREDICTED: Mus musculus CCR4-NOT transcription complex, subunit 1,
            transcript variant 7 (Cnot1), mRNA
          Length = 7605

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 329  cttatcaatgcattggtgct 348
            ||||||||||||||||||||
Sbjct: 6947 cttatcaatgcattggtgct 6966

---

>ref|XM_001003611.1| PREDICTED: Mus musculus CCR4-NOT transcription complex, subunit 1,
            transcript variant 17 (Cnot1), mRNA
          Length = 8328

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 329  cttatcaatgcattggtgct 348
            ||||||||||||||||||||
Sbjct: 6881 cttatcaatgcattggtgct 6900

---

>ref|XM_001003604.1| PREDICTED: Mus musculus CCR4-NOT transcription complex, subunit 1,
            transcript variant 16 (Cnot1), mRNA
          Length = 8322

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 329  cttatcaatgcattggtgct 348
            ||||||||||||||||||||
Sbjct: 6875 cttatcaatgcattggtgct 6894

---

>ref|XM_901826.2| PREDICTED: Mus musculus CCR4-NOT transcription complex, subunit 1,
            transcript variant 15 (Cnot1), mRNA
          Length = 8415

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 329  cttatcaatgcattggtgct 348
            ||||||||||||||||||||
Sbjct: 6968 cttatcaatgcattggtgct 6987

---

>ref|XM_894673.2| PREDICTED: Mus musculus CCR4-NOT transcription complex, subunit 1,
            transcript variant 2 (Cnot1), mRNA
          Length = 8391

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 329  cttatcaatgcattggtgct 348
            ||||||||||||||||||||
Sbjct: 6944 cttatcaatgcattggtgct 6963

---

>ref|XM_571466.1| Cryptococcus neoformans var. neoformans JEC21 maltose porter
            (CNF00020) partial mRNA
          Length = 1720

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 66   tttgcctgcctgagatgaag 85
            ||||||||||||||||||||
Sbjct: 1505 tttgcctgcctgagatgaag 1524

---

>gb|AC133176.2| Mus musculus BAC clone RP24-111D1 from chromosome 14, complete sequence
          Length = 171069

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 281   ggtaaaactgccaaggcaaa 300
             ||||||||||||||||||||
Sbjct: 97863 ggtaaaactgccaaggcaaa 97882

---

>emb|AJ512484.1|CRA512484 Caulerpa racemosa var. racemosa plastid partial rbcL gene for
           rubisco large subunit, variety racemosa, individual no.5
          Length = 903

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 55  catgaggaggtccttggaaa 36

---

>emb|AJ512483.1|CRA512483 Caulerpa racemosa var. racemosa plastid partial rbcL gene for
           rubisco large subunit, variety racemosa, individual no.4
          Length = 903

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 55  catgaggaggtccttggaaa 36

---

>emb|AJ512482.1|CRA512482 Caulerpa racemosa var. racemosa plastid partial rbcL gene for
           rubisco large subunit, variety racemosa, individual no.3
          Length = 903

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 55  catgaggaggtccttggaaa 36

---

>emb|AJ512481.1|CRA512481 Caulerpa racemosa var. racemosa plastid partial rbcL gene for
           rubisco large subunit, variety racemosa, individual no.2
          Length = 903

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 55  catgaggaggtccttggaaa 36

---

>emb|AJ512480.1|CRA512480 Caulerpa racemosa var. racemosa plastid partial rbcL gene for
           rubisco large subunit, variety racemosa, individual no.1
          Length = 903

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 55  catgaggaggtccttggaaa 36

---

>emb|AJ512479.1|CSE512479 Caulerpa sertularioides f. brevipes plastid partial rbcL gene for
           rubisco large subunit, individual no.2
          Length = 903

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 55  catgaggaggtccttggaaa 36

---

>emb|AJ512478.1|CSE512478 Caulerpa sertularioides f. longipes plastid partial rbcL gene for
           rubisco large subunit, individual no.2
          Length = 903

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 55  catgaggaggtccttggaaa 36

---

>emb|AJ512477.1|CSE512477 Caulerpa sertularioides f. brevipes plastid partial rbcL gene for
           rubisco large subunit, individual no.1
          Length = 903

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 55  catgaggaggtccttggaaa 36

---

>emb|AJ512476.1|CSE512476 Caulerpa sertularioides f. longipes plastid partial rbcL gene for
           rubisco large subunit, individual no.1
          Length = 903

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 55  catgaggaggtccttggaaa 36

---

>emb|AJ512475.1|CRA512475 Caulerpa racemosa var. mucronata plastid partial rbcL gene for
           rubisco large subunit, variety mucronata, individual
           no.2
          Length = 903

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 55  catgaggaggtccttggaaa 36

---

>emb|AJ512474.1|CRA512474 Caulerpa racemosa var. mucronata plastid partial rbcL gene for
           rubisco large subunit, variety mucronata, individual
           no.1
          Length = 903

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 55  catgaggaggtccttggaaa 36

---

>emb|AJ512473.1|CRA512473 Caulerpa racemosa var. laetevirens plastid partial rbcL gene for
           rubisco large subunit, variety laetevirens, individual
           no.2
          Length = 903

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 55  catgaggaggtccttggaaa 36

---

>emb|AJ512472.1|CRA512472 Caulerpa racemosa var. laetevirens plastid partial rbcL gene for
           rubisco large subunit, variety laetevirens, individual
           no.1
          Length = 903

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 55  catgaggaggtccttggaaa 36

---

>emb|AJ512471.1|CCU512471 Caulerpa cupressoides var. lycopodium plastid partial rbcL gene for
           rubisco large subunit, variety lycopodium, individual
           no.2
          Length = 903

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 55  catgaggaggtccttggaaa 36

---

>emb|AJ512470.1|CCU512470 Caulerpa cupressoides var. lycopodium plastid partial rbcL gene for
           rubisco large subunit, variety lycopodium, individual
           no.1
          Length = 903

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 55  catgaggaggtccttggaaa 36

---

>emb|AJ512469.1|CSE512469 Caulerpa serrulata var. serrulata plastid partial rbcL gene for
           rubisco large subunit, variety serrulata, individual
           no.2
          Length = 903

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 55  catgaggaggtccttggaaa 36

---

>emb|AJ512468.1|CSE512468 Caulerpa serrulata var. serrulata plastid partial rbcL gene for
           rubisco large subunit, variety serrulata, individual
           no.1
          Length = 903

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 55  catgaggaggtccttggaaa 36

---

>gb|AC127300.3| Mus musculus BAC clone RP23-264J18 from chromosome 8, complete sequence
          Length = 178649

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 329    cttatcaatgcattggtgct 348
              ||||||||||||||||||||
Sbjct: 175227 cttatcaatgcattggtgct 175246

---

>gb|AF203504.2| Sphaerozosma sp. UTCC 284 ribulose 1,5-bisphosphate
           carboxylase/oxygenase large subunit (rbcL) gene, partial
           cds; chloroplast gene for chloroplast product
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AY223029.1| Schistosoma japonicum clone ZZD1143 mRNA sequence
          Length = 1290

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 1    ttcggcacgagggagaacta 20
            ||||||||||||||||||||
Sbjct: 1098 ttcggcacgagggagaacta 1079

---

>gb|AC092496.3| Bos taurus clone RP42-394P20, complete sequence
          Length = 216538

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 306    agctgaaggagatgaaagta 325
              ||||||||||||||||||||
Sbjct: 157531 agctgaaggagatgaaagta 157512

---

>gb|AC101910.20| Mus musculus chromosome 7, clone RP24-327I20, complete sequence
          Length = 197719

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 462   atgttggtcctagtggaaaa 481
             ||||||||||||||||||||
Sbjct: 73212 atgttggtcctagtggaaaa 73193

---

>gb|AC159466.3| Mus musculus 10 BAC RP23-388A21 (Roswell Park Cancer Institute
             (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 190140

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 138   atgagctctggaattacatc 157
             ||||||||||||||||||||
Sbjct: 83229 atgagctctggaattacatc 83210

---

>gb|BC064677.1| Mus musculus cDNA clone IMAGE:6413892, **** WARNING: chimeric clone
            ****
          Length = 6765

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 329  cttatcaatgcattggtgct 348
            ||||||||||||||||||||
Sbjct: 6007 cttatcaatgcattggtgct 6026

---

>gb|BC094620.1| Mus musculus CCR4-NOT transcription complex, subunit 1, mRNA (cDNA
           clone IMAGE:1224854), partial cds
          Length = 848

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 329 cttatcaatgcattggtgct 348
           ||||||||||||||||||||
Sbjct: 78  cttatcaatgcattggtgct 97

---

>ref|XM_794696.1| PREDICTED: Strongylocentrotus purpuratus hypothetical protein
           LOC575310 (LOC575310), mRNA
          Length = 1622

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 305 cagctgaaggagatgaaagt 324
           ||||||||||||||||||||
Sbjct: 761 cagctgaaggagatgaaagt 780

---

>gb|AY942170.1| Caulerpa sertularioides ribulose-1,5-bisphosphate
           carboxylase/oxygenase large subunit (rbcL) gene, partial
           cds; chloroplast
          Length = 1269

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 400 catgaggaggtccttggaaa 381

---

>emb|Z80203.1|MMZ80203 M.myrsinoides rbcL gene
          Length = 1387

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 440 catgaggaggtccttggaaa 421

---

>gb|AC148205.3| Callicebus moloch clone LB5-314H24, complete sequence
          Length = 153386

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 373   tgaagctcttgaggcatata 392
             ||||||||||||||||||||
Sbjct: 93817 tgaagctcttgaggcatata 93836

---

>emb|AJ553972.1|STU553972 Staurastrum tumidum chloroplast partial rbcL gene for ribulose
           1,5-bisphosphate carboxylase/oxygenase large subunit,
           strain SVCK 85
          Length = 1353

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 433 catgaggaggtccttggaaa 414

---

>emb|AJ553971.1|SLU553971 Staurastrum lunatum chloroplast partial rbcL gene for ribulose
           1,5-bisphosphate carboxylase/oxygenase large subunit,
           strain SVCK 15
          Length = 1353

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 433 catgaggaggtccttggaaa 414

---

>emb|AJ553970.1|SPU553970 Spondylosium pulchrum chloroplast partial rbcL gene for ribulose
           1,5-bisphosphate carboxylase/oxygenase large subunit,
           strain SVCK 331
          Length = 1353

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 433 catgaggaggtccttggaaa 414

---

>emb|AJ553969.1|SPA553969 Spondylosium panduriforme chloroplast partial rbcL gene for
           ribulose 1,5-bisphosphate carboxylase/oxygenase large
           subunit, strain SAG 52.88
          Length = 1353

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 433 catgaggaggtccttggaaa 414

---

>emb|AJ553967.1|SSP553967 Spirogyra sp. M-1810 chloroplast partial rbcL gene for ribulose
           1,5-bisphosphate carboxylase/oxygenase large subunit,
           strain M 1810
          Length = 1353

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 433 catgaggaggtccttggaaa 414

---

>emb|AJ553962.1|PNO553962 Phymatodocis nordstedtiana chloroplast partial rbcL gene for
           ribulose 1,5-bisphosphate carboxylase/oxygenase large
           subunit, strain SVCK 327
          Length = 1353

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 433 catgaggaggtccttggaaa 414

---

>emb|AJ553961.1|PSP553961 Penium spirostriolatum chloroplast partial rbcL gene for ribulose
           1,5-bisphosphate carboxylase/oxygenase large subunit,
           strain SVCK 189
          Length = 1353

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 433 catgaggaggtccttggaaa 414

---

>emb|AJ553960.1|PEX553960 Penium exiguum chloroplast partial rbcL gene for ribulose
           1,5-bisphosphate carboxylase/oxygenase large subunit,
           strain M 2159
          Length = 1353

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 433 catgaggaggtccttggaaa 414

---

>emb|AJ553959.1|PCY553959 Penium cylindrus chloroplast partial rbcL gene for ribulose
           1,5-bisphosphate carboxylase/oxygenase large subunit,
           strain ACOI 780
          Length = 1353

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 433 catgaggaggtccttggaaa 414

---

>emb|AJ553957.1|NOB553957 Netrium oblongum chloroplast partial rbcL gene for ribulose
           1,5-bisphosphate carboxylase/oxygenase large subunit,
           strain SVCK 255
          Length = 1353

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 433 catgaggaggtccttggaaa 414

---

>emb|AJ553954.1|MSP553954 Mougeotia sp. SVCK 240 chloroplast partial rbcL gene for ribulose
           1,5-bisphosphate carboxylase/oxygenase large subunit,
           strain SVCK 240
          Length = 1353

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 433 catgaggaggtccttggaaa 414

---

>emb|AJ553953.1|MSP553953 Mougeotia sp. SVCK 417 chloroplast partial rbcL gene for ribulose
           1,5-bisphosphate carboxylase/oxygenase large subunit,
           strain SVCK 417
          Length = 1353

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 433 catgaggaggtccttggaaa 414

---

>emb|AJ553948.1|HPU553948 Heimansia pusilla chloroplast partial rbcL gene for ribulose
           1,5-bisphosphate carboxylase/oxygenase large subunit,
           strain SVCK 428
          Length = 1353

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 433 catgaggaggtccttggaaa 414

---

>emb|AJ553947.1|HMI553947 Haplotaenium minutum chloroplast partial rbcL gene for ribulose
           1,5-bisphosphate carboxylase/oxygenase large subunit,
           strain SVCK 302
          Length = 1353

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 433 catgaggaggtccttggaaa 414

---

>emb|AJ553937.1|CCO553937 Cosmarium contractum chloroplast partial rbcL gene for ribulose
           1,5-bisphosphate carboxylase/oxygenase large subunit,
           strain SVCK 396
          Length = 1353

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 433 catgaggaggtccttggaaa 414

---

>emb|AJ300474.1|AHI300474 Antirrhinum hispanicum ORF1, ORF2, ORF3, ORF4, ORF5, ORF6, ORF7, ORF8,
             s2-RNase gene, ORF9 and slf-S2 gene
          Length = 63687

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 299   aaaaagcagctgaaggagatgaaa 322
             |||||||||| |||||||||||||
Sbjct: 25477 aaaaagcagcagaaggagatgaaa 25454

---

>gb|AY964181.1| Cosmarium obtusatum ribulose-1,5-bisphosphate carboxylase/oxygenase
           large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AY964180.1| Cosmarium laeve ribulose-1,5-bisphosphate carboxylase/oxygenase
           large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AY964179.1| Cosmarium reniforme ribulose-1,5-bisphosphate carboxylase/oxygenase
           large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AY964178.1| Cosmarium exiguum ribulose-1,5-bisphosphate carboxylase/oxygenase
           large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AY964177.1| Cosmarium obsoletum ribulose-1,5-bisphosphate carboxylase/oxygenase
           large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AY964175.1| Cosmarium dentatum ribulose-1,5-bisphosphate carboxylase/oxygenase
           large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AY964174.1| Cosmarium sexangulare ribulose-1,5-bisphosphate
           carboxylase/oxygenase large subunit (rbcL) gene, partial
           cds; chloroplast
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AY964173.1| Cosmarium debaryi ribulose-1,5-bisphosphate carboxylase/oxygenase
           large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AY964172.1| Cosmarium bisphaericum ribulose-1,5-bisphosphate
           carboxylase/oxygenase large subunit-like (rbcL) gene,
           partial sequence; chloroplast
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AY964171.1| Actinotaenium curtum ribulose-1,5-bisphosphate
           carboxylase/oxygenase large subunit (rbcL) gene, partial
           cds; chloroplast
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AY964170.1| Actinotaenium cucurbita ribulose-1,5-bisphosphate
           carboxylase/oxygenase large subunit (rbcL) gene, partial
           cds; chloroplast
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AY964169.1| Cosmarium isthmium ribulose-1,5-bisphosphate carboxylase/oxygenase
           large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AY964168.1| Cosmarium pseudoconnatum ribulose-1,5-bisphosphate
           carboxylase/oxygenase large subunit (rbcL) gene, partial
           cds; chloroplast
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AY964167.1| Cosmarium blyttii ribulose-1,5-bisphosphate carboxylase/oxygenase
           large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AY964166.1| Cosmarium subtumidum ribulose-1,5-bisphosphate
           carboxylase/oxygenase large subunit (rbcL) gene, partial
           cds; chloroplast
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AY964165.1| Arthrodesmus convergens ribulose-1,5-bisphosphate
           carboxylase/oxygenase large subunit (rbcL) gene, partial
           cds; chloroplast
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AY964164.1| Cosmarium depressum ribulose-1,5-bisphosphate carboxylase/oxygenase
           large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AY964163.1| Cosmarium levinotabile ribulose-1,5-bisphosphate
           carboxylase/oxygenase large subunit (rbcL) gene, partial
           cds; chloroplast
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AY964162.1| Cosmarium borgesenii var. polymorphum ribulose-1,5-bisphosphate
           carboxylase/oxygenase large subunit (rbcL) gene, partial
           cds; chloroplast
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AY964161.1| Cosmarium sp. ACKU 1232 ribulose-1,5-bisphosphate
           carboxylase/oxygenase large subunit (rbcL) gene, partial
           cds; chloroplast
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AY964160.1| Cosmarium norimbergense var. depressum ribulose-1,5-bisphosphate
           carboxylase/oxygenase large subunit (rbcL) gene, partial
           cds; chloroplast
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AY964159.1| Actinotaenium wollei ribulose-1,5-bisphosphate
           carboxylase/oxygenase large subunit (rbcL) gene, partial
           cds; chloroplast
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AY964158.1| Cosmarium subprotumidum ribulose-1,5-bisphosphate
           carboxylase/oxygenase large subunit (rbcL) gene, partial
           cds; chloroplast
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AY964157.1| Cosmarium subprotumidum var. gregorii ribulose-1,5-bisphosphate
           carboxylase/oxygenase large subunit (rbcL) gene, partial
           cds; chloroplast
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AY964156.1| Cosmarium auriculatum ribulose-1,5-bisphosphate
           carboxylase/oxygenase large subunit (rbcL) gene, partial
           cds; chloroplast
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AY964155.1| Cosmarium costatum ribulose-1,5-bisphosphate carboxylase/oxygenase
           large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AY964154.1| Cosmarium angulosum f. rotundatum ribulose-1,5-bisphosphate
           carboxylase/oxygenase large subunit (rbcL) gene, partial
           cds; chloroplast
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AY051142.1| Coleochaete pulvinata ribulose
           bisphosphate-1,5-carboxylase/oxygenase large subunit
           (rbcL) gene, partial cds; chloroplast gene for
           chloroplast product
          Length = 1309

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AY051139.1| Coleochaete sp. 18a1 ribulose
           bisphosphate-1,5-carboxylase/oxygenase large subunit
           (rbcL) gene, partial cds; chloroplast gene for
           chloroplast product
          Length = 1349

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AY051138.1| Coleochaete scutata ribulose bisphosphate-1,5-carboxylase/oxygenase
           large subunit (rbcL) gene, partial cds; chloroplast gene
           for chloroplast product
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AF417289.1| Cosmarium quadrum var. minus ribulose 1,5-bisphosphate
           carboxylase/oxygenase large subunit gene, partial cds;
           chloroplast gene for chloroplast product
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AF417286.1| Cosmarium furcatospermum ribulose 1,5-bisphosphate
           carboxylase/oxygenase large subunit gene, partial cds;
           chloroplast gene for chloroplast product
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AF417285.1| Cosmarium obtusatum ribulose 1,5-bisphosphate carboxylase/oxygenase
           large subunit gene, partial cds; chloroplast gene for
           chloroplast product
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AF417284.1| Cosmarium obtusatum ribulose 1,5-bisphosphate carboxylase/oxygenase
           large subunit gene, partial cds; chloroplast gene for
           chloroplast product
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AF417283.1| Cosmarium subcostatum ribulose 1,5-bisphosphate
           carboxylase/oxygenase large subunit gene, partial cds;
           chloroplast gene for chloroplast product
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AF417282.1| Cosmarium trilobulatum ribulose 1,5-bisphosphate
           carboxylase/oxygenase large subunit gene, partial cds;
           chloroplast gene for chloroplast product
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AF417281.1| Cosmarium rectangulare ribulose 1,5-bisphosphate
           carboxylase/oxygenase large subunit gene, partial cds;
           chloroplast gene for chloroplast product
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AF417280.1| Cosmarium angulosum ribulose 1,5-bisphosphate carboxylase/oxygenase
           large subunit-like protein gene, partial sequence;
           chloroplast gene for chloroplast product
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AF417279.1| Cosmarium impressulum ribulose 1,5-bisphosphate
           carboxylase/oxygenase large subunit gene, partial cds;
           chloroplast gene for chloroplast product
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AF417278.1| Cosmarium hammeri ribulose 1,5-bisphosphate carboxylase/oxygenase
           large subunit gene, partial cds; chloroplast gene for
           chloroplast product
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AF417277.1| Cosmarium granatum ribulose 1,5-bisphosphate carboxylase/oxygenase
           large subunit gene, partial cds; chloroplast gene for
           chloroplast product
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AF417276.1| Cosmarium fontarabiense ribulose 1,5-bisphosphate
           carboxylase/oxygenase large subunit gene, partial cds;
           chloroplast gene for chloroplast product
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AF417275.1| Cosmarium bioculatum ribulose 1,5-bisphosphate
           carboxylase/oxygenase large subunit gene, partial cds;
           chloroplast gene for chloroplast product
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AF417274.1| Cosmarium pachydermum f. parvum ribulose 1,5-bisphosphate
           carboxylase/oxygenase large subunit gene, partial cds;
           chloroplast gene for chloroplast product
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AF417273.1| Cosmarium subcucumis ribulose 1,5-bisphosphate
           carboxylase/oxygenase large subunit gene, partial cds;
           chloroplast gene for chloroplast product
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AF417272.1| Cosmarium cucumis var. magnum ribulose 1,5-bisphosphate
           carboxylase/oxygenase large subunit gene, partial cds;
           chloroplast gene for chloroplast product
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AF428114.1| Staurastrum quadricornutum ribulose-1,5-bisphosphate
           carboxylase/oxygenase large subunit (rbcL) gene, partial
           cds; chloroplast gene for chloroplast product
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AF428113.1| Staurastrum galeatum ribulose-1,5-bisphosphate
           carboxylase/oxygenase large subunit (rbcL) gene, partial
           cds; chloroplast gene for chloroplast product
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AF428111.1| Staurastrum crenulatum ribulose-1,5-bisphosphate
           carboxylase/oxygenase large subunit (rbcL) gene, partial
           cds; chloroplast gene for chloroplast product
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AF428110.1| Staurastrum natator ribulose-1,5-bisphosphate carboxylase/oxygenase
           large subunit (rbcL) gene, partial cds; chloroplast gene
           for chloroplast product
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AF425770.1| Staurastrum orbiculare ribulose-1,5-bisphosphate
           carboxylase/oxygenase large subunit (rbcL) gene, partial
           cds; chloroplast gene for chloroplast product
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AY057457.1| Stizostedion vitreum clone C1a2 major histocompatibility class I
            receptor mRNA, complete cds
          Length = 2224

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 1    ttcggcacgagggagaacta 20
            ||||||||||||||||||||
Sbjct: 1134 ttcggcacgagggagaacta 1115

---

>gb|AY004763.1| Caulerpa filiformis chloroplast ribulose 1,5-bisphosphate
           carboxylase large subunit-like gene, partial sequence
          Length = 1356

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 412 catgaggaggtccttggaaa 393

---

>gb|AF408252.1| Mougeotia sp. UTEX LB 758 ribulose 1,5-bisphosphate
           carboxylase/oxygenase large subunit (rbcL) gene, partial
           cds; chloroplast gene for chloroplast product
          Length = 1353

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 433 catgaggaggtccttggaaa 414

---

>gb|AF408249.1| Coleochaete sieminskiana ribulose 1,5-bisphosphate
           carboxylase/oxygenase large subunit (rbcL) gene, partial
           cds; chloroplast gene for chloroplast product
          Length = 1353

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 433 catgaggaggtccttggaaa 414

---

>gb|AF408247.1| Coleochaete soluta ribulose 1,5-bisphosphate carboxylase/oxygenase
           large subunit (rbcL) gene, partial cds; chloroplast gene
           for chloroplast product
          Length = 1353

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 433 catgaggaggtccttggaaa 414

---

>gb|AF215516.2|AF215516 Blakea trinervia ribulose-bisphosphate carboxylase large subunit
           (rbcL) gene, partial cds; chloroplast gene for
           chloroplast product
          Length = 1467

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 430 catgaggaggtccttggaaa 411

---

>dbj|AK079464.1| Mus musculus 6 days neonate skin cDNA, RIKEN full-length enriched
           library, clone:A030004P22 product:similar to ADRENAL
           GLAND PROTEIN AD-005 homolog [Homo sapiens], full insert
           sequence
          Length = 1525

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 329 cttatcaatgcattggtgct 348
           ||||||||||||||||||||
Sbjct: 792 cttatcaatgcattggtgct 811

---

>dbj|AK031357.1| Mus musculus 13 days embryo male testis cDNA, RIKEN full-length
            enriched library, clone:6030411K04 product:ADRENAL GLAND
            PROTEIN AD-005 homolog [Homo sapiens], full insert
            sequence
          Length = 2450

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 329  cttatcaatgcattggtgct 348
            ||||||||||||||||||||
Sbjct: 1184 cttatcaatgcattggtgct 1203

---

>dbj|AK048177.1| Mus musculus 16 days embryo head cDNA, RIKEN full-length enriched
            library, clone:C130038P19 product:ADRENAL GLAND PROTEIN
            AD-005 homolog [Homo sapiens], full insert sequence
          Length = 3809

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 329  cttatcaatgcattggtgct 348
            ||||||||||||||||||||
Sbjct: 1657 cttatcaatgcattggtgct 1676

---

>dbj|AB038486.1| Caulerpa racemosa chloroplast rbcL gene for
           ribulose-1,5-bisphosphate carboxylase/oxygenase large
           subunit, partial cds
          Length = 1333

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>dbj|AB038485.1| Caulerpa racemosa var. macrophysa chloroplast rbcL gene for
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit, partial cds
          Length = 2068

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 416  catgaggaggtccttggaaa 435
            ||||||||||||||||||||
Sbjct: 1169 catgaggaggtccttggaaa 1150

---

>gb|AF203507.1|AF203507 Xanthidium subhastiferum ribulose 1,5-bisphosphate
           carboxylase/oxygenase large subunit (rbcL) gene, partial
           cds; chloroplast gene for chloroplast product
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AF203506.1|AF203506 Staurastrum pingue ribulose 1,5-bisphosphate carboxylase/oxygenase
           large subunit (rbcL) gene, partial cds; chloroplast gene
           for chloroplast product
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AF203505.1|AF203505 Spondylosium pulchellum ribulose 1,5-bisphosphate
           carboxylase/oxygenase large subunit (rbcL) gene, partial
           cds; chloroplast gene for chloroplast product
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AF203503.1|AF203503 Pleurotaenium trabecula ribulose 1,5-bisphosphate
           carboxylase/oxygenase large subunit (rbcL) gene, partial
           cds; chloroplast gene for chloroplast product
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AF203502.1|AF203502 Penium margaritaceum ribulose 1,5-bisphosphate
           carboxylase/oxygenase large subunit (rbcL) gene, partial
           cds; chloroplast gene for chloroplast product
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AF203501.1|AF203501 Onychonema sp. UTEX LB 832 ribulose 1,5-bisphosphate
           carboxylase/oxygenase large subunit (rbcL) gene, partial
           cds; chloroplast gene for chloroplast product
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AF203500.1|AF203500 Micrasterias rotata ribulose 1,5-bisphosphate carboxylase/oxygenase
           large subunit (rbcL) gene, partial cds; chloroplast gene
           for chloroplast product
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AF203499.1|AF203499 Hyalotheca dissiliens ribulose 1,5-bisphosphate
           carboxylase/oxygenase large subunit (rbcL) gene, partial
           cds; chloroplast gene for chloroplast product
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AF203498.1|AF203498 Groenbladia undulata ribulose 1,5-bisphosphate
           carboxylase/oxygenase large subunit-like gene, partial
           sequence
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AF203497.1|AF203497 Euastrum pectinatum ribulose 1,5-bisphosphate carboxylase/oxygenase
           large subunit (rbcL) gene, partial cds; chloroplast gene
           for chloroplast product
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AF203493.1|AF203493 Cosmarium botrytis ribulose 1,5-bisphosphate carboxylase/oxygenase
           large subunit (rbcL) gene, partial cds; chloroplast gene
           for chloroplast product
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AF203491.1|AF203491 Staurodesmus sp. UTEX LB 2508 ribulose 1,5-bisphosphate
           carboxylase/oxygenase large subunit (rbcL) gene, partial
           cds; chloroplast gene for chloroplast product
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AC156276.6| Mus musculus 10 BAC RP24-323L12 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 199119

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 138    atgagctctggaattacatc 157
              ||||||||||||||||||||
Sbjct: 199085 atgagctctggaattacatc 199104

---

>gb|AY082330.1| Coleochaete divergens ribulose-1,5-bisphosphate
           carboxylase/oxygenase (rbcL) gene, partial cds;
           chloroplast gene for chloroplast product
          Length = 1309

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AY082329.1| Coleochaete scutata ribulose-1,5-bisphosphate carboxylase/oxygenase
           (rbcL) gene, partial cds; chloroplast gene for
           chloroplast product
          Length = 1309

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AY082328.1| Coleochaete sp. 327d3 ribulose-1,5-bisphosphate
           carboxylase/oxygenase (rbcL) gene, partial cds;
           chloroplast gene for chloroplast product
          Length = 1309

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>dbj|AB038483.1| Caulerpa brachypus chloroplast rbcL gene for
           ribulose-1,5-bisphosphate carboxylase/oxygenase large
           subunit, partial cds
          Length = 1333

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>dbj|AK129258.1| Mus musculus mRNA for mKIAA1007 protein
          Length = 5409

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 329  cttatcaatgcattggtgct 348
            ||||||||||||||||||||
Sbjct: 4665 cttatcaatgcattggtgct 4684

---

>gb|AY111789.1| Zea mays CL3071_3 mRNA sequence
          Length = 996

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 1   ttcggcacgagggagaacta 20
           ||||||||||||||||||||
Sbjct: 269 ttcggcacgagggagaacta 288

---

>gb|AY557630.1| Cosmarium borgesenii var. polymorphum ribulose-1,5-bisphosphate
           carboxylase/oxygenase large subunit (rbcL) gene, partial
           cds; chloroplast
          Length = 1359

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AC113951.13| Mus musculus chromosome 8, clone RP24-161A21, complete sequence
          Length = 166298

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 329   cttatcaatgcattggtgct 348
             ||||||||||||||||||||
Sbjct: 36598 cttatcaatgcattggtgct 36617

---

>gb|U96650.1|U96650 Maesa ternata ribulose 1,5-biphosphate carboxylase large subunit
           (rbcL) gene, chloroplast gene encoding chloroplast
           protein, partial cds
          Length = 1402

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>gb|AC163702.3| Gallus gallus BAC clone CH261-124A8 from chromosome ul, complete
             sequence
          Length = 179537

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 310   gaaggagatgaaagtacatc 329
             ||||||||||||||||||||
Sbjct: 79243 gaaggagatgaaagtacatc 79224

---

>gb|BC099150.1| Rattus norvegicus similar to KIAA1007 protein; adrenal gland protein
            AD-005, mRNA (cDNA clone IMAGE:7367094), complete cds
          Length = 2994

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 329  cttatcaatgcattggtgct 348
            ||||||||||||||||||||
Sbjct: 2215 cttatcaatgcattggtgct 2234

---

>gb|BC086325.1| Rattus norvegicus similar to KIAA1007 protein; adrenal gland
           protein AD-005, mRNA (cDNA clone IMAGE:7107420), partial
           cds
          Length = 1660

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 329 cttatcaatgcattggtgct 348
           ||||||||||||||||||||
Sbjct: 877 cttatcaatgcattggtgct 896

---

>gb|BC027147.1| Mus musculus CCR4-NOT transcription complex, subunit 1, mRNA (cDNA
            clone IMAGE:4946131)
          Length = 2220

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 329  cttatcaatgcattggtgct 348
            ||||||||||||||||||||
Sbjct: 1452 cttatcaatgcattggtgct 1471

---

>gb|AY609850.1| Sus scrofa clone Clu_3547.scr.msk.p1.Contig4, mRNA sequence
          Length = 2407

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 1   ttcggcacgagggagaacta 20
           ||||||||||||||||||||
Sbjct: 664 ttcggcacgagggagaacta 645

---

>emb|CT025624.11| Mouse DNA sequence from clone RP24-212N20 on chromosome 14,
           complete sequence
          Length = 198113

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 329 cttatcaatgcattggtgct 348
           ||||||||||||||||||||
Sbjct: 273 cttatcaatgcattggtgct 254

---

>gb|BC058249.1| Mus musculus cDNA clone IMAGE:6314537, containing frame-shift errors
          Length = 7518

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 329  cttatcaatgcattggtgct 348
            ||||||||||||||||||||
Sbjct: 6738 cttatcaatgcattggtgct 6757

---

>gb|DP000019.1| Callicebus moloch target 1 genomic scaffold
          Length = 2105003

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 373     tgaagctcttgaggcatata 392
               ||||||||||||||||||||
Sbjct: 1008369 tgaagctcttgaggcatata 1008388

---

>gb|U38700.1|SCU38700 Spirotaenia condensata ribulose
           bisphosphate-1,5-carboxylase/oxygenase (rbcL) gene,
           chloroplast gene encoding chloroplast protein, partial
           cds
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 434 catgaggaggtccttggaaa 415

---

>emb|AJ390035.1|VVI390035 Ventilago viminalis chloroplast partial rbcL gene
          Length = 1400

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 432 catgaggaggtccttggaaa 413

---

>emb|AL671977.8| Mouse DNA sequence from clone RP23-171A16 on chromosome X, complete
             sequence
          Length = 193108

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 179   gctgctattttgcttcttgcagct 202
             ||||||||||||||| ||||||||
Sbjct: 40645 gctgctattttgctttttgcagct 40668

---

>gb|L13477.1|COOCPRBCL Coleochaete orbicularis chloroplast ribulosebisphosphate
           carboxylase (rbcL) gene, complete cds
          Length = 1428

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 416 catgaggaggtccttggaaa 435
           ||||||||||||||||||||
Sbjct: 460 catgaggaggtccttggaaa 441

---

>gb|AY067462.1| Schmidtea mediterranea clone H.6.11f unknown mRNA sequence
          Length = 426

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 1   ttcggcacgagggagaacta 20
           ||||||||||||||||||||
Sbjct: 390 ttcggcacgagggagaacta 409


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,173,592
Number of Sequences: 3902068
Number of extensions: 6173592
Number of successful extensions: 113405
Number of sequences better than 10.0: 228
Number of HSP's better than 10.0 without gapping: 228
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 112696
Number of HSP's gapped (non-prelim): 707
length of query: 641
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 618
effective length of database: 17,143,297,704
effective search space: 10594557981072
effective search space used: 10594557981072
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---