ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags4g10
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|U36939.1|HVU36939 Hordeum vulgare vacuolar ATPase catalytic s... 329 2e-87
2dbj|AB032840.1| Hordeum vulgare HVA/68 mRNA for vacuolar proton-... 329 2e-87
3gb|DQ432014.1| Triticum aestivum vacuolar proton-ATPase subunit ... 313 1e-82
4dbj|AK069821.1| Oryza sativa (japonica cultivar-group) cDNA clon... 194 7e-47
5dbj|AK067063.1| Oryza sativa (japonica cultivar-group) cDNA clon... 149 3e-33
6gb|BT024092.1| Zea mays clone EL01N0551D01 mRNA sequence 145 5e-32
7gb|U36436.1|ZMU36436 Zea mays vacuolar ATPase 69 kDa subunit mRN... 145 5e-32
8gb|AY104754.1| Zea mays PCO134411 mRNA sequence 115 5e-23
9dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 109 3e-21
10dbj|AP004744.2| Oryza sativa (japonica cultivar-group) genomic D... 109 3e-21
11dbj|AP005769.3| Oryza sativa (japonica cultivar-group) genomic D... 109 3e-21
12gb|AF212304.1|AF212304 Allium cepa vacuolar H+-ATPase catalytic ... 109 3e-21
13gb|L03186.1|COTATPASE Gossypium hirsutum vacuolar H+-ATPase cata... 105 5e-20
14gb|AY037143.1| Pisum sativum V-type H+-ATPase subunit A mRNA, pa... 101 7e-19
15gb|BT014583.1| Lycopersicon esculentum clone 134040F, mRNA sequence 98 1e-17
16gb|AY177247.1| Lycopersicon esculentum vacuolar H+-ATPase A1 sub... 98 1e-17
17emb|AJ278021.1|LES278021 Lycopersicon esculentum partial mRNA fo... 98 1e-17
18dbj|AB189963.1| Pyrus communis PcVHA-A1 mRNA for vacuolar H+-ATP... 96 4e-17
19gb|U26709.1|VRU26709 Vigna radiata vacuolar H+-ATPase subunit A ... 94 2e-16
20gb|AF050673.1|AF050673 Gossypium hirsutum vacuolar H+-ATPase cat... 90 3e-15
21gb|BC044025.1| Xenopus laevis ATPase, H+ transporting, lysosomal... 88 1e-14
22gb|U36438.1|APU36438 Acer pseudoplatanus V-ATPase 66 kDa subunit... 88 1e-14
23dbj|AB004247.1| Citrus unshiu mRNA for H+-ATPase catalytic subun... 88 1e-14
24gb|DQ056751.1| Vigna unguiculata vacuolar H+-ATPase subunit A mR... 86 4e-14
25emb|AJ276326.1|MCR276326 Mesembryanthemum crystallinum mRNA for ... 86 4e-14
26ref|NM_001036222.1| Arabidopsis thaliana VHA-A; ATP binding / hy... 82 7e-13
27ref|NM_106539.3| Arabidopsis thaliana VHA-A; ATP binding / hydro... 82 7e-13
28gb|BT008383.1| Arabidopsis thaliana At1g78900 gene, complete cds 82 7e-13
29gb|AY081296.1| Arabidopsis thaliana ATPase subunit A mRNA, compl... 82 7e-13
30gb|AY059909.1| Arabidopsis thaliana vacuolar type ATPase subunit... 82 7e-13
31dbj|AK221853.1| Arabidopsis thaliana mRNA for vacuolar-type H+-A... 82 7e-13
32emb|BX817720.1|CNS0AALL Arabidopsis thaliana Full-length cDNA Co... 82 7e-13
33gb|AY085759.1| Arabidopsis thaliana clone 17815 mRNA, complete s... 82 7e-13
34gb|BT002589.1| Arabidopsis thaliana vacuolar type ATPase subunit... 82 7e-13
35emb|X98767.1|BVVATPASE B.vulgaris mRNA for subunit A of the V-ty... 82 7e-13
36gb|U65638.1|ATU65638 Arabidopsis thaliana vacuolar type ATPase s... 82 7e-13
37dbj|AB033377.1| Nepenthes alata NaVHA1 mRNA for vacuolar H+-ATPa... 82 7e-13
38gb|J03769.1|DARVHATPA Daucus carota 70kD vacuolar H+-ATPase mRNA... 80 3e-12
39emb|X58386.1|BTBVATPA B.taurus mRNA for bovine vacuolar ATPase s... 80 3e-12
40gb|BC105145.1| Bos taurus ATPase, H+ transporting, lysosomal (va... 80 3e-12
41dbj|AB189964.1| Pyrus communis PcVHA-A2 mRNA for vacuolar H+-ATP... 80 3e-12
42ref|NM_174504.2| Bos taurus ATPase, H+ transporting, lysosomal (... 80 3e-12
43emb|X61612.1|BTRNAATP B.taurus mRNA for vacuolar H+ATPase Mr 700... 80 3e-12
44gb|M80430.1|BOVATPASEV Bovine vacuolar H+-ATPase A subunit mRNA,... 80 3e-12
45dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 78 1e-11
46dbj|AP003992.2| Oryza sativa (japonica cultivar-group) genomic D... 78 1e-11
47gb|U15604.1|BNU15604 Brassica napus tonoplast ATPase 70 kDa subu... 78 1e-11
48ref|XM_526445.1| PREDICTED: Pan troglodytes similar to ATPase, H... 74 2e-10
49gb|BC013138.1| Homo sapiens ATPase, H+ transporting, lysosomal 7... 74 2e-10
50gb|BT008024.1| Synthetic construct Homo sapiens ATPase, H+ trans... 74 2e-10
51gb|BT006672.1| Homo sapiens ATPase, H+ transporting, lysosomal 7... 74 2e-10
52emb|CR859606.1| Pongo pygmaeus mRNA; cDNA DKFZp459K064 (from clo... 74 2e-10
53emb|CR860887.1| Pongo pygmaeus mRNA; cDNA DKFZp469D0420 (from cl... 74 2e-10
54dbj|AB220510.1| Macaca fascicularis mRNA, clone QnpA-16745: simi... 74 2e-10
55gb|AY891448.1| Synthetic construct Homo sapiens clone FLH013978.... 74 2e-10
56gb|AY891447.1| Synthetic construct Homo sapiens clone FLH013977.... 74 2e-10
57gb|AY888804.1| Synthetic construct Homo sapiens clone FLH013981.... 74 2e-10
58gb|AF113129.1|AF113129 Homo sapiens vacuolar ATPase isoform VA68... 74 2e-10
59ref|NM_001690.2| Homo sapiens ATPase, H+ transporting, lysosomal... 74 2e-10
60gb|L09235.1|HUMATPAVAD Human vacuolar ATPase (isoform VA68) mRNA... 74 2e-10
61gb|AF367445.1| Prunus persica clone AtpvA1 V-ATPase catalytic su... 72 6e-10
62gb|AY178911.1| Lycopersicon esculentum vacuolar H+-ATPase A2 sub... 70 3e-09
63emb|X68580.1|SPVATPA S.pombe gene for vacuolar H+-ATPase, subunit A 68 1e-08
64emb|AL109739.1|SPAC343 S.pombe chromosome I cosmid c343 68 1e-08
65ref|NM_001018858.1| Schizosaccharomyces pombe 972h- hypothetical... 68 1e-08
66gb|AY813539.1| Schistosoma japonicum SJCHGC09310 protein mRNA, c... 66 4e-08
67ref|XM_971095.1| PREDICTED: Tribolium castaneum similar to Vacuo... 66 4e-08
68ref|XM_962857.1| PREDICTED: Tribolium castaneum similar to Vacuo... 66 4e-08
69gb|AC079944.17| Homo sapiens 3 BAC RP11-435F17 (Roswell Park Can... 66 4e-08
70gb|L08200.1|PFAVAPA Plasmodium falciparum vacuolar proton adenos... 66 4e-08
71gb|AY089512.1| Drosophila melanogaster GH21132 full insert cDNA 64 2e-07
72ref|NM_078836.2| Drosophila melanogaster Vha68-1 CG12403-RA (Vha... 64 2e-07
73gb|AC008332.11|AC008332 Drosophila melanogaster, chromosome 2L, ... 64 2e-07
74gb|AF185049.1|AF185049 Drosophila melanogaster vacuolar ATPase s... 64 2e-07
75gb|U19745.2|U19745 Drosophila melanogaster V-ATPase A subunit (v... 64 2e-07
76gb|AE003638.2| Drosophila melanogaster chromosome 2L, section 47... 64 2e-07
77gb|U19742.1|DMU19742 Drosophila melanogaster vacuolar ATPase sub... 64 2e-07
78emb|AM050349.1| Trichostrongylus vitrinus partial ORF for putati... 62 6e-07
79gb|AC005679.1|F9K20 Arabidopsis thaliana chromosome 1 BAC F9K20 ... 60 2e-06
80dbj|AB036926.1| Citrus unshiu Cit-VATP A-1 gene for vacuolar H+-... 60 2e-06
81ref|XM_724242.1| Plasmodium yoelii yoelii str. 17XNL V-type ATPa... 58 1e-05
82ref|XM_738011.1| Plasmodium chabaudi chabaudi hypothetical prote... 58 1e-05
83gb|DQ440543.1| Ostertagia ostertagi ATPase beta-subunit mRNA, pa... 56 4e-05
84dbj|D50528.1| Acetabularia acetabulum clone pVAL V type adenosin... 56 4e-05
85gb|AY864912.1| Aedes albopictus V-ATPase subunit A mRNA, complet... 56 4e-05
86emb|CR764095.1| Paramecium tetraurelia, complete gene 54 2e-04
87emb|CR764094.1| Paramecium tetraurelia, complete gene 54 2e-04
88ref|XM_687539.1| PREDICTED: Danio rerio similar to ATPase, H+ tr... 54 2e-04
89ref|NM_201135.1| Danio rerio ATPase, H+ transporting, lysosomal ... 54 2e-04
90gb|BC055130.1| Danio rerio ATPase, H+ transporting, lysosomal 70... 54 2e-04
91ref|XM_340987.2| PREDICTED: Rattus norvegicus ATPase, H+ transpo... 54 2e-04
92emb|BX119902.4| Zebrafish DNA sequence from clone CH211-137I24 i... 54 2e-04
93ref|XM_632259.1| Dictyostelium discoideum vacuolar H+-ATPase sub... 52 6e-04
94gb|BC063915.1| Xenopus tropicalis ATPase, H+ transporting, lysos... 52 6e-04
95gb|AF389404.1|AF389404 Saccharomyces sp. DH1-1A VMA1 (VMA1) gene... 52 6e-04
96gb|U49169.1|DDU49169 Dictyostelium discoideum V-ATPase A subunit... 52 6e-04
97ref|XM_647533.1| Entamoeba histolytica HM-1:IMSS V-type ATPase, ... 50 0.002
98ref|XM_675040.1| Plasmodium berghei strain ANKA vacuolar ATP syn... 50 0.002
99gb|U04849.1|EHU04849 Entamoeba histolytica HM-1-IMSS putative va... 50 0.002
100gb|BC072086.1| Xenopus laevis cDNA clone IMAGE:4406247, containi... 48 0.009
101ref|XM_545103.2| PREDICTED: Canis familiaris similar to ATPase, ... 48 0.009
102ref|XM_850941.1| PREDICTED: Canis familiaris similar to ATPase, ... 48 0.009
103ref|XM_850903.1| PREDICTED: Canis familiaris similar to ATPase, ... 48 0.009
104gb|BC098963.1| Xenopus laevis cDNA clone MGC:114675 IMAGE:551635... 48 0.009
105ref|XM_623528.1| PREDICTED: Apis mellifera similar to Vacuolar A... 48 0.009
106ref|XM_623492.1| PREDICTED: Apis mellifera similar to Vacuolar A... 48 0.009
107gb|U13837.1|MMU13837 Mus musculus vacuolar adenosine triphosphat... 48 0.009
108emb|CR764097.1| Paramecium tetraurelia, complete gene 46 0.037
109emb|CR764096.1| Paramecium tetraurelia, complete gene 46 0.037
110dbj|D50529.1| Acetabularia acetabulum clone pVA6 V type adenosin... 46 0.037
111gb|AE009951.2| Fusobacterium nucleatum subsp. nucleatum ATCC 255... 46 0.037
112dbj|AB093507.1| Saccharomyces castellii VMA1 gene for vacuolar m... 46 0.037
113emb|AL845359.15| Zebrafish DNA sequence from clone CH211-11M22 i... 46 0.037
114gb|CP000067.1| Trypanosoma brucei chromosome 4, complete sequence 44 0.15
115gb|AC103580.4| Trypanosoma brucei chromosome 4 clone RPCI93-5E12... 44 0.15
116ref|XM_455325.1| Kluyveromyces lactis NRRL Y-1140, KLLA0F05401g ... 44 0.15
117ref|XM_821703.1| Trypanosoma brucei TREU927 clone RPCI93-5E12 V-... 44 0.15
118emb|X64233.1|MSATPRNA M.sexta mRNA for vacuolar ATPase subunit A 44 0.15
119emb|CR382126.1| Kluyveromyces lactis strain NRRL Y-1140 chromoso... 44 0.15
120ref|NM_165022.1| Drosophila melanogaster Vha68-2 CG3762-RC, tran... 44 0.15
121ref|NM_165021.1| Drosophila melanogaster Vha68-2 CG3762-RB, tran... 44 0.15
122ref|NM_143747.2| Drosophila melanogaster Vha68-2 CG3762-RA, tran... 44 0.15
123gb|AY084150.1| Drosophila melanogaster RE30552 full insert cDNA 44 0.15
124gb|AC009352.5| Drosophila melanogaster, chromosome 2L, region 34... 44 0.15
125dbj|AB093513.1| Saccharomyces pastorianus VMA1 gene for vacuolar... 44 0.15
126dbj|AB093506.1| Kluyveromyces lactis VMA1 gene for vacuolar memb... 44 0.15
127dbj|AB093504.1| Saccharomyces cerevisiae VMA1 gene for vacuolar ... 44 0.15
128dbj|AB093502.1| Saccharomyces cerevisiae VMA1 gene for vacuolar ... 44 0.15
129dbj|AB093501.1| Saccharomyces cerevisiae VMA1 gene for vacuolar ... 44 0.15
130dbj|AB093500.1| Saccharomyces cerevisiae VMA1 gene for vacuolar ... 44 0.15
131dbj|AB093499.1| Saccharomyces cerevisiae VMA1 gene for vacuolar ... 44 0.15
132dbj|AB093498.1| Saccharomyces cerevisiae VMA1 gene for vacuolar ... 44 0.15
133dbj|AB093497.1| Saccharomyces cerevisiae VMA1 gene for vacuolar ... 44 0.15
134dbj|AB093496.1| Saccharomyces cerevisiae VMA1 gene for vacuolar ... 44 0.15
135gb|L09234.1|HUMATPAVAC Human vacuolar ATPase (isoform HO68) mRNA... 44 0.15
136ref|XM_688134.1| PREDICTED: Danio rerio similar to ATPase, H+ tr... 42 0.58
137gb|AE010299.1| Methanosarcina acetivorans str. C2A, complete genome 42 0.58
138emb|BX323052.5| Zebrafish DNA sequence from clone CH211-234A12 i... 42 0.58
139gb|AE008384.1| Methanosarcina mazei strain Goe1, complete genome 42 0.58
140gb|U47274.1|MMU47274 Methanosarcina mazeii A1AO H+ ATPase, subun... 42 0.58
141dbj|D17462.1|ENENTP Enterococcus hirae ntp genes for Na+ -ATPase... 42 0.58
142dbj|D13816.1|ENENAABS E. hirae DNA for Na+ -ATPase alpha and bet... 42 0.58
143gb|BC079948.1| Xenopus tropicalis MGC79685 protein, mRNA (cDNA c... 40 2.3
144emb|X62338.1|SSHATP S.scrofa mRNA for H+ ATPase 40 2.3
145dbj|AK140873.1| Mus musculus 16 days embryo head cDNA, RIKEN ful... 40 2.3
146dbj|AK150742.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 40 2.3
147dbj|AK149833.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 40 2.3
148dbj|AK154869.1| Mus musculus NOD-derived CD11c +ve dendritic cel... 40 2.3
149dbj|AK153403.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 40 2.3
150dbj|AK160792.1| Mus musculus 14, 17 days embryo head cDNA, RIKEN... 40 2.3
151dbj|AK170721.1| Mus musculus NOD-derived CD11c +ve dendritic cel... 40 2.3
152dbj|AK166857.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 40 2.3
153emb|BX321896.13| Zebrafish DNA sequence from clone RP71-49B22 in... 40 2.3
154gb|BC038392.1| Mus musculus ATPase, H+ transporting, lysosomal V... 40 2.3
155gb|AF017149.2| Hendra virus, complete genome 40 2.3
156ref|NM_001007511.1| Xenopus tropicalis MGC79685 protein (MGC7968... 40 2.3
157ref|NM_001004042.1| Sus scrofa H+ ATPase (ATP6V1A1), mRNA 40 2.3
158ref|NM_007508.2| Mus musculus ATPase, H+ transporting, lysosomal... 40 2.3
159dbj|AB093514.1| Saccharomyces pastorianus VMA1 gene for vacuolar... 40 2.3
160dbj|AB093512.1| Saccharomyces pastorianus VMA1 gene for vacuolar... 40 2.3
161gb|U59147.1|DMU59147 Drosophila melanogaster Oregon R vacuolar A... 40 2.3
162gb|U59146.1|DMU59146 Drosophila melanogaster Canton S vacuolar A... 40 2.3
163emb|Z25814.1|TCVACATPA T.congolense mRNA for vacuolar ATPase (ca... 40 2.3
164ref|XM_322437.1| Neurospora crassa OR74A hypothetical protein (N... 38 9.1
165ref|XM_952730.1| Neurospora crassa OR74A hypothetical protein (N... 38 9.1
166gb|AE017261.1| Picrophilus torridus DSM 9790, complete genome 38 9.1
167gb|AC125098.4| Mus musculus BAC clone RP24-195M13 from chromosom... 38 9.1
168ref|NM_204974.1| Gallus gallus ATPase, H+ transporting, lysosoma... 38 9.1
169emb|BX005087.5| Zebrafish DNA sequence from clone CH211-91A7 in ... 38 9.1
170gb|U22077.1|GGU22077 Gallus gallus A1 isoform of vacuolar H+-ATP... 38 9.1
171gb|U22076.1|GGU22076 Gallus gallus A2 isoform of vacuolar H+-ATP... 38 9.1

>gb|U36939.1|HVU36939 Hordeum vulgare vacuolar ATPase catalytic subunit mRNA, partial cds
          Length = 2089

 Score =  329 bits (166), Expect = 2e-87
 Identities = 178/184 (96%)
 Strand = Plus / Plus

                                                                        
Query: 1    tacttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggcc 60
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 887  tacttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggcc 946

                                                                        
Query: 61   gaagcattgcgtgaaatttcaggacgtttggctgaaatgcctgcggatagtggntaccct 120
            ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 947  gaagcattgcgtgaaatttcaggacgtttggctgaaatgcctgcggatagtggttaccct 1006

                                                                        
Query: 121  gcgtatttggcttcacggntggcatccttctatgaacgngccgnnaaggngcaatgtctt 180
            |||||||||||||||||| ||||||||||||||||||| ||||  |||| ||||||||||
Sbjct: 1007 gcgtatttggcttcacggttggcatccttctatgaacgtgccgggaaggtgcaatgtctt 1066

                
Query: 181  ggca 184
            ||||
Sbjct: 1067 ggca 1070



to top

>dbj|AB032840.1| Hordeum vulgare HVA/68 mRNA for vacuolar proton-ATPase, complete cds
          Length = 2281

 Score =  329 bits (166), Expect = 2e-87
 Identities = 178/184 (96%)
 Strand = Plus / Plus

                                                                        
Query: 1    tacttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggcc 60
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1064 tacttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggcc 1123

                                                                        
Query: 61   gaagcattgcgtgaaatttcaggacgtttggctgaaatgcctgcggatagtggntaccct 120
            ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 1124 gaagcattgcgtgaaatttcaggacgtttggctgaaatgcctgcggatagtggttaccct 1183

                                                                        
Query: 121  gcgtatttggcttcacggntggcatccttctatgaacgngccgnnaaggngcaatgtctt 180
            |||||||||||||||||| ||||||||||||||||||| ||||  |||| ||||||||||
Sbjct: 1184 gcgtatttggcttcacggttggcatccttctatgaacgtgccgggaaggtgcaatgtctt 1243

                
Query: 181  ggca 184
            ||||
Sbjct: 1244 ggca 1247



to top

>gb|DQ432014.1| Triticum aestivum vacuolar proton-ATPase subunit A mRNA, complete cds
          Length = 2358

 Score =  313 bits (158), Expect = 1e-82
 Identities = 176/184 (95%)
 Strand = Plus / Plus

                                                                        
Query: 1    tacttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggcc 60
            |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 1119 tacttccgtgacatgggctacaatgttagtatgatggctgattccacgtccaggtgggcc 1178

                                                                        
Query: 61   gaagcattgcgtgaaatttcaggacgtttggctgaaatgcctgcggatagtggntaccct 120
            ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 1179 gaagcattgcgtgaaatttcaggacgtttggctgaaatgcctgcggatagtggttaccct 1238

                                                                        
Query: 121  gcgtatttggcttcacggntggcatccttctatgaacgngccgnnaaggngcaatgtctt 180
            |||||||||||||||||| ||||||||||||||||||| || |  |||| ||||||||||
Sbjct: 1239 gcgtatttggcttcacggttggcatccttctatgaacgtgctgggaaggtgcaatgtctt 1298

                
Query: 181  ggca 184
            ||||
Sbjct: 1299 ggca 1302



to top

>dbj|AK069821.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023028L13, full
            insert sequence
          Length = 2315

 Score =  194 bits (98), Expect = 7e-47
 Identities = 161/184 (87%)
 Strand = Plus / Plus

                                                                        
Query: 1    tacttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggcc 60
            |||||||||||||||||||||||||| ||||||||||||||||| || ||  ||||||| 
Sbjct: 1154 tacttccgtgacatgggctataatgtcagtatgatggctgattctacttctcggtgggct 1213

                                                                        
Query: 61   gaagcattgcgtgaaatttcaggacgtttggctgaaatgcctgcggatagtggntaccct 120
            ||||| |||||||| |||||||||||| ||||||||||||||||||||||||| ||||||
Sbjct: 1214 gaagctttgcgtgagatttcaggacgtctggctgaaatgcctgcggatagtggttaccct 1273

                                                                        
Query: 121  gcgtatttggcttcacggntggcatccttctatgaacgngccgnnaaggngcaatgtctt 180
            || ||||||||| ||||  |||||||||| || ||||| || |  |||| | ||||||| 
Sbjct: 1274 gcatatttggctgcacgtttggcatccttttacgaacgtgctggtaaggtgaaatgtctc 1333

                
Query: 181  ggca 184
            ||||
Sbjct: 1334 ggca 1337



to top

>dbj|AK067063.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013089J10, full
            insert sequence
          Length = 2295

 Score =  149 bits (75), Expect = 3e-33
 Identities = 133/153 (86%)
 Strand = Plus / Plus

                                                                        
Query: 6    ccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggccgaagc 65
            |||||||||||| || ||||| || ||||||||||||||||| ||  | ||||| || ||
Sbjct: 1113 ccgtgacatgggttacaatgtcagcatgatggctgattccacctcacgatgggctgaggc 1172

                                                                        
Query: 66   attgcgtgaaatttcaggacgtttggctgaaatgcctgcggatagtggntaccctgcgta 125
            ||||||||||||||| || |||||||||||||||||||| |||||||| |||||||| ||
Sbjct: 1173 attgcgtgaaatttctgggcgtttggctgaaatgcctgcagatagtggttaccctgctta 1232

                                             
Query: 126  tttggcttcacggntggcatccttctatgaacg 158
            ||||||| || |  ||||||| |||||||||||
Sbjct: 1233 tttggctgcaagactggcatctttctatgaacg 1265



to top

>gb|BT024092.1| Zea mays clone EL01N0551D01 mRNA sequence
          Length = 2273

 Score =  145 bits (73), Expect = 5e-32
 Identities = 134/155 (86%)
 Strand = Plus / Plus

                                                                        
Query: 4    ttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggccgaa 63
            |||||||| |||||||| || || |||||||||||||| ||||| ||| ||||||| || 
Sbjct: 1120 ttccgtgatatgggctacaacgtcagtatgatggctgactccacctcccggtgggctgag 1179

                                                                        
Query: 64   gcattgcgtgaaatttcaggacgtttggctgaaatgcctgcggatagtggntaccctgcg 123
            ||||||||||| || ||||| |||||||||||||||||||| |||||||| ||||| || 
Sbjct: 1180 gcattgcgtgagatctcagggcgtttggctgaaatgcctgctgatagtggttacccagct 1239

                                               
Query: 124  tatttggcttcacggntggcatccttctatgaacg 158
            || |||||| ||||  |||||||||| ||||||||
Sbjct: 1240 tacttggctgcacgtttggcatccttttatgaacg 1274



to top

>gb|U36436.1|ZMU36436 Zea mays vacuolar ATPase 69 kDa subunit mRNA, partial cds
          Length = 2000

 Score =  145 bits (73), Expect = 5e-32
 Identities = 134/155 (86%)
 Strand = Plus / Plus

                                                                       
Query: 4   ttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggccgaa 63
           |||||||| |||||||| || || |||||||||||||| ||||| ||| ||||||| || 
Sbjct: 832 ttccgtgatatgggctacaacgtcagtatgatggctgactccacctcccggtgggctgag 891

                                                                       
Query: 64  gcattgcgtgaaatttcaggacgtttggctgaaatgcctgcggatagtggntaccctgcg 123
           ||||||||||| || ||||| |||||||||||||||||||| |||||||| ||||| || 
Sbjct: 892 gcattgcgtgagatctcagggcgtttggctgaaatgcctgctgatagtggttacccagct 951

                                              
Query: 124 tatttggcttcacggntggcatccttctatgaacg 158
           || |||||| ||||  |||||||||| ||||||||
Sbjct: 952 tacttggctgcacgtttggcatccttttatgaacg 986



to top

>gb|AY104754.1| Zea mays PCO134411 mRNA sequence
          Length = 2254

 Score =  115 bits (58), Expect = 5e-23
 Identities = 128/152 (84%)
 Strand = Plus / Plus

                                                                        
Query: 7    cgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggccgaagca 66
            ||||| |||||||| || ||||||||||||||||| ||||| ||  | ||||| || || 
Sbjct: 1112 cgtgatatgggctacaacgttagtatgatggctgactccacctcacgatgggctgaggct 1171

                                                                        
Query: 67   ttgcgtgaaatttcaggacgtttggctgaaatgcctgcggatagtggntaccctgcgtat 126
            |||||||| || ||||| |||||||||||||||||||| |||||||| ||||| || || 
Sbjct: 1172 ttgcgtgagatctcagggcgtttggctgaaatgcctgctgatagtggttacccagcttac 1231

                                            
Query: 127  ttggcttcacggntggcatccttctatgaacg 158
            |||||| | ||  |||||||||| ||||||||
Sbjct: 1232 ttggctgcgcgtttggcatccttttatgaacg 1263



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score =  109 bits (55), Expect = 3e-21
 Identities = 79/87 (90%)
 Strand = Plus / Minus

                                                                            
Query: 1        tacttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggcc 60
                |||||||||||||||||||||||||| ||||||||||||||||| || ||  ||||||| 
Sbjct: 26905979 tacttccgtgacatgggctataatgtcagtatgatggctgattctacttctcggtgggct 26905920

                                           
Query: 61       gaagcattgcgtgaaatttcaggacgt 87
                ||||| |||||||| ||||||||||||
Sbjct: 26905919 gaagctttgcgtgagatttcaggacgt 26905893



 Score = 89.7 bits (45), Expect = 3e-15
 Identities = 81/95 (85%)
 Strand = Plus / Minus

                                                                            
Query: 90       ggctgaaatgcctgcggatagtggntaccctgcgtatttggcttcacggntggcatcctt 149
                |||||||||||||||||||||||| |||||||| ||||||||| ||||  ||||||||||
Sbjct: 26905413 ggctgaaatgcctgcggatagtggttaccctgcatatttggctgcacgtttggcatcctt 26905354

                                                   
Query: 150      ctatgaacgngccgnnaaggngcaatgtcttggca 184
                 || ||||| || |  |||| | ||||||| ||||
Sbjct: 26905353 ttacgaacgtgctggtaaggtgaaatgtctcggca 26905319



to top

>dbj|AP004744.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
             clone:OSJNBb0065C04
          Length = 165270

 Score =  109 bits (55), Expect = 3e-21
 Identities = 79/87 (90%)
 Strand = Plus / Minus

                                                                         
Query: 1     tacttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggcc 60
             |||||||||||||||||||||||||| ||||||||||||||||| || ||  ||||||| 
Sbjct: 29740 tacttccgtgacatgggctataatgtcagtatgatggctgattctacttctcggtgggct 29681

                                        
Query: 61    gaagcattgcgtgaaatttcaggacgt 87
             ||||| |||||||| ||||||||||||
Sbjct: 29680 gaagctttgcgtgagatttcaggacgt 29654



 Score = 89.7 bits (45), Expect = 3e-15
 Identities = 81/95 (85%)
 Strand = Plus / Minus

                                                                         
Query: 90    ggctgaaatgcctgcggatagtggntaccctgcgtatttggcttcacggntggcatcctt 149
             |||||||||||||||||||||||| |||||||| ||||||||| ||||  ||||||||||
Sbjct: 29174 ggctgaaatgcctgcggatagtggttaccctgcatatttggctgcacgtttggcatcctt 29115

                                                
Query: 150   ctatgaacgngccgnnaaggngcaatgtcttggca 184
              || ||||| || |  |||| | ||||||| ||||
Sbjct: 29114 ttacgaacgtgctggtaaggtgaaatgtctcggca 29080



to top

>dbj|AP005769.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
              clone:OSJNBa0051O02
          Length = 169532

 Score =  109 bits (55), Expect = 3e-21
 Identities = 79/87 (90%)
 Strand = Plus / Minus

                                                                          
Query: 1      tacttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggcc 60
              |||||||||||||||||||||||||| ||||||||||||||||| || ||  ||||||| 
Sbjct: 160605 tacttccgtgacatgggctataatgtcagtatgatggctgattctacttctcggtgggct 160546

                                         
Query: 61     gaagcattgcgtgaaatttcaggacgt 87
              ||||| |||||||| ||||||||||||
Sbjct: 160545 gaagctttgcgtgagatttcaggacgt 160519



 Score = 89.7 bits (45), Expect = 3e-15
 Identities = 81/95 (85%)
 Strand = Plus / Minus

                                                                          
Query: 90     ggctgaaatgcctgcggatagtggntaccctgcgtatttggcttcacggntggcatcctt 149
              |||||||||||||||||||||||| |||||||| ||||||||| ||||  ||||||||||
Sbjct: 160039 ggctgaaatgcctgcggatagtggttaccctgcatatttggctgcacgtttggcatcctt 159980

                                                 
Query: 150    ctatgaacgngccgnnaaggngcaatgtcttggca 184
               || ||||| || |  |||| | ||||||| ||||
Sbjct: 159979 ttacgaacgtgctggtaaggtgaaatgtctcggca 159945



to top

>gb|AF212304.1|AF212304 Allium cepa vacuolar H+-ATPase catalytic subunit mRNA, partial cds
          Length = 592

 Score =  109 bits (55), Expect = 3e-21
 Identities = 96/110 (87%)
 Strand = Plus / Plus

                                                                       
Query: 13  atgggctataatgttagtatgatggctgattccacgtccaggtgggccgaagcattgcgt 72
           ||||| |||||||| || |||||||||||||| || ||| | ||||||||||| ||||||
Sbjct: 450 atgggatataatgtaagcatgatggctgattctacatcccgttgggccgaagctttgcgt 509

                                                             
Query: 73  gaaatttcaggacgtttggctgaaatgcctgcggatagtggntaccctgc 122
           ||||||||||| || ||||| ||||||||||| || ||||| ||||||||
Sbjct: 510 gaaatttcagggcgattggccgaaatgcctgcagacagtggttaccctgc 559



to top

>gb|L03186.1|COTATPASE Gossypium hirsutum vacuolar H+-ATPase catalytic subunit mRNA,
            complete cds
          Length = 2244

 Score =  105 bits (53), Expect = 5e-20
 Identities = 103/120 (85%)
 Strand = Plus / Plus

                                                                        
Query: 13   atgggctataatgttagtatgatggctgattccacgtccaggtgggccgaagcattgcgt 72
            |||||||| ||||||||||||||||| || || || ||  | ||||||||||||||||||
Sbjct: 1197 atgggctacaatgttagtatgatggcagactcaacatctcgatgggccgaagcattgcgt 1256

                                                                        
Query: 73   gaaatttcaggacgtttggctgaaatgcctgcggatagtggntaccctgcgtatttggct 132
            |||||||| |||||  |||| ||||||||||| |||||||| || ||||| ||| |||||
Sbjct: 1257 gaaatttctggacggctggcagaaatgcctgctgatagtggatatcctgcttatctggct 1316



to top

>gb|AY037143.1| Pisum sativum V-type H+-ATPase subunit A mRNA, partial cds
          Length = 454

 Score =  101 bits (51), Expect = 7e-19
 Identities = 95/110 (86%)
 Strand = Plus / Plus

                                                                       
Query: 13  atgggctataatgttagtatgatggctgattccacgtccaggtgggccgaagcattgcgt 72
           ||||| || ||||| ||||||||||| ||||| || || || ||||| ||||||||||||
Sbjct: 118 atgggttacaatgtcagtatgatggcagattcaacatctagatgggcagaagcattgcgt 177

                                                             
Query: 73  gaaatttcaggacgtttggctgaaatgcctgcggatagtggntaccctgc 122
           ||||| |||||||| ||||| ||||||||||| |||||||| || |||||
Sbjct: 178 gaaatctcaggacgattggcggaaatgcctgctgatagtggatatcctgc 227



to top

>gb|BT014583.1| Lycopersicon esculentum clone 134040F, mRNA sequence
          Length = 2415

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 128/155 (82%)
 Strand = Plus / Plus

                                                                        
Query: 1    tacttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggcc 60
            |||||| | |||||||| || ||||| ||||||||||| ||||| || ||  | ||||||
Sbjct: 1128 tacttcagagacatgggatacaatgtcagtatgatggcagattcgacctctcgctgggcc 1187

                                                                        
Query: 61   gaagcattgcgtgaaatttcaggacgtttggctgaaatgcctgcggatagtggntaccct 120
            ||||| || |||||||| ||||| || ||||| ||||||||||| || ||||| || |||
Sbjct: 1188 gaagctttacgtgaaatctcaggtcgattggcagaaatgcctgcagacagtggatatcct 1247

                                               
Query: 121  gcgtatttggcttcacggntggcatccttctatga 155
            || ||||||||  ||||  ||||||| ||||||||
Sbjct: 1248 gcttatttggcagcacgtttggcatctttctatga 1282



to top

>gb|AY177247.1| Lycopersicon esculentum vacuolar H+-ATPase A1 subunit isoform mRNA,
            complete cds
          Length = 2370

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 128/155 (82%)
 Strand = Plus / Plus

                                                                        
Query: 1    tacttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggcc 60
            |||||| | |||||||| || ||||| ||||||||||| ||||| || ||  | ||||||
Sbjct: 1089 tacttcagagacatgggatacaatgtcagtatgatggcagattcgacctctcgctgggcc 1148

                                                                        
Query: 61   gaagcattgcgtgaaatttcaggacgtttggctgaaatgcctgcggatagtggntaccct 120
            ||||| || |||||||| ||||| || ||||| ||||||||||| || ||||| || |||
Sbjct: 1149 gaagctttacgtgaaatctcaggtcgattggcagaaatgcctgcagacagtggatatcct 1208

                                               
Query: 121  gcgtatttggcttcacggntggcatccttctatga 155
            || ||||||||  ||||  ||||||| ||||||||
Sbjct: 1209 gcttatttggcagcacgtttggcatctttctatga 1243



to top

>emb|AJ278021.1|LES278021 Lycopersicon esculentum partial mRNA for putative V-type H+-ATPase
           catalytic subunit A
          Length = 777

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 128/155 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   tacttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggcc 60
           |||||| | |||||||| || ||||| ||||||||||| ||||| || ||  | ||||||
Sbjct: 151 tacttcagagacatgggatacaatgtcagtatgatggcagattcgacctctcgctgggcc 210

                                                                       
Query: 61  gaagcattgcgtgaaatttcaggacgtttggctgaaatgcctgcggatagtggntaccct 120
           ||||| || |||||||| ||||| || ||||| ||||||||||| || ||||| || |||
Sbjct: 211 gaagctttacgtgaaatctcaggtcgattggcagaaatgcctgcagacagtggatatcct 270

                                              
Query: 121 gcgtatttggcttcacggntggcatccttctatga 155
           || ||||||||  ||||  ||||||| ||||||||
Sbjct: 271 gcttatttggcagcacgtttggcatctttctatga 305



to top

>dbj|AB189963.1| Pyrus communis PcVHA-A1 mRNA for vacuolar H+-ATPase catalytic
            subunit, complete cds
          Length = 2236

 Score = 95.6 bits (48), Expect = 4e-17
 Identities = 101/119 (84%)
 Strand = Plus / Plus

                                                                        
Query: 13   atgggctataatgttagtatgatggctgattccacgtccaggtgggccgaagcattgcgt 72
            |||||||| ||||| || |||||||| ||||| || ||  | |||||||| |||||||||
Sbjct: 1096 atgggctacaatgtcagcatgatggcagattcaacatctcgatgggccgaggcattgcgt 1155

                                                                       
Query: 73   gaaatttcaggacgtttggctgaaatgcctgcggatagtggntaccctgcgtatttggc 131
            || ||||| || ||  |||||||||||||||| |||||||| |||||||| ||||||||
Sbjct: 1156 gagatttctgggcggctggctgaaatgcctgcagatagtggataccctgcttatttggc 1214



to top

>gb|U26709.1|VRU26709 Vigna radiata vacuolar H+-ATPase subunit A mRNA, complete cds
          Length = 2371

 Score = 93.7 bits (47), Expect = 2e-16
 Identities = 94/110 (85%)
 Strand = Plus / Plus

                                                                        
Query: 13   atgggctataatgttagtatgatggctgattccacgtccaggtgggccgaagcattgcgt 72
            ||||| || ||||| ||||||||||||||||| || || || ||||| ||||||||||||
Sbjct: 1111 atgggttacaatgtcagtatgatggctgattctacatctagatgggcagaagcattgcgt 1170

                                                              
Query: 73   gaaatttcaggacgtttggctgaaatgcctgcggatagtggntaccctgc 122
            |||||||| |||||  |||| || |||||||| |||||||| || |||||
Sbjct: 1171 gaaatttctggacgactggcagagatgcctgcagatagtggatatcctgc 1220



to top

>gb|AF050673.1|AF050673 Gossypium hirsutum vacuolar H+-ATPase catalytic subunit mRNA,
            complete cds
          Length = 2378

 Score = 89.7 bits (45), Expect = 3e-15
 Identities = 87/101 (86%)
 Strand = Plus / Plus

                                                                        
Query: 13   atgggctataatgttagtatgatggctgattccacgtccaggtgggccgaagcattgcgt 72
            |||||||| ||||||||||||||||| ||||| || ||  | ||||| ||||||||||||
Sbjct: 1248 atgggctacaatgttagtatgatggcagattcaacatctcgttgggcagaagcattgcgt 1307

                                                     
Query: 73   gaaatttcaggacgtttggctgaaatgcctgcggatagtgg 113
            |||||||| || ||  |||| ||||||||||| ||||||||
Sbjct: 1308 gaaatttctgggcggctggcagaaatgcctgctgatagtgg 1348



to top

>gb|BC044025.1| Xenopus laevis ATPase, H+ transporting, lysosomal 70kDa, V1 subunit
            A, isoform 1, mRNA (cDNA clone MGC:54007 IMAGE:5571458),
            complete cds
          Length = 2383

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 85/99 (85%)
 Strand = Plus / Plus

                                                                        
Query: 28   agtatgatggctgattccacgtccaggtgggccgaagcattgcgtgaaatttcaggacgt 87
            ||||||||||| |||||||| || || ||||||||||| ||  | |||||||| ||||| 
Sbjct: 1085 agtatgatggccgattccacctctagatgggccgaagccttaagagaaatttctggacgc 1144

                                                   
Query: 88   ttggctgaaatgcctgcggatagtggntaccctgcgtat 126
             |||||||||||||||| || ||||| ||||||||||||
Sbjct: 1145 ctggctgaaatgcctgctgacagtggataccctgcgtat 1183



to top

>gb|U36438.1|APU36438 Acer pseudoplatanus V-ATPase 66 kDa subunit mRNA, partial cds
          Length = 1011

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 100/119 (84%)
 Strand = Plus / Plus

                                                                       
Query: 13  atgggctataatgttagtatgatggctgattccacgtccaggtgggccgaagcattgcgt 72
           ||||| || |||||||| |||||||| ||||| || ||  | ||||| ||||| ||||||
Sbjct: 717 atgggttacaatgttagcatgatggcagattcaacttctcgttgggcagaagctttgcgt 776

                                                                      
Query: 73  gaaatttcaggacgtttggctgaaatgcctgcggatagtggntaccctgcgtatttggc 131
           ||||||||||| ||  |||| ||||||||||| |||||||| || ||||| ||||||||
Sbjct: 777 gaaatttcagggcggctggcagaaatgcctgcagatagtggatatcctgcttatttggc 835



to top

>dbj|AB004247.1| Citrus unshiu mRNA for H+-ATPase catalytic subunit, complete cds
          Length = 2304

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 120/146 (82%)
 Strand = Plus / Plus

                                                                        
Query: 13   atgggctataatgttagtatgatggctgattccacgtccaggtgggccgaagcattgcgt 72
            ||||| || |||||||| |||||||| ||||| || ||  | ||||| ||||| ||||||
Sbjct: 1071 atggggtacaatgttagcatgatggcagattcaacttctcgttgggcagaagcgttgcgt 1130

                                                                        
Query: 73   gaaatttcaggacgtttggctgaaatgcctgcggatagtggntaccctgcgtatttggct 132
            ||||||||||||||  |||| ||||||||||| |||||||| || ||||| ||  |||||
Sbjct: 1131 gaaatttcaggacggctggcagaaatgcctgcagatagtggatatcctgcttacctggct 1190

                                      
Query: 133  tcacggntggcatccttctatgaacg 158
             ||||  |||| || || ||||||||
Sbjct: 1191 gcacgtttggcctcattttatgaacg 1216



to top

>gb|DQ056751.1| Vigna unguiculata vacuolar H+-ATPase subunit A mRNA, partial cds
          Length = 1125

 Score = 85.7 bits (43), Expect = 4e-14
 Identities = 93/110 (84%)
 Strand = Plus / Plus

                                                                       
Query: 13  atgggctataatgttagtatgatggctgattccacgtccaggtgggccgaagcattgcgt 72
           ||||| || ||||| ||||||||||||||||| || || || ||||| ||||||||||||
Sbjct: 518 atgggttacaatgtcagtatgatggctgattctacatctagatgggcagaagcattgcgt 577

                                                             
Query: 73  gaaatttcaggacgtttggctgaaatgcctgcggatagtggntaccctgc 122
           ||||| || |||||  |||| || |||||||| |||||||| || |||||
Sbjct: 578 gaaatctctggacgactggcagagatgcctgcagatagtggatatcctgc 627



to top

>emb|AJ276326.1|MCR276326 Mesembryanthemum crystallinum mRNA for putative vacuolar ATP synthase
            subunit A (vatA gene)
          Length = 2396

 Score = 85.7 bits (43), Expect = 4e-14
 Identities = 93/110 (84%)
 Strand = Plus / Plus

                                                                        
Query: 13   atgggctataatgttagtatgatggctgattccacgtccaggtgggccgaagcattgcgt 72
            |||||||| ||||| ||||||||||| || || || ||  | ||||| |||||  |||||
Sbjct: 1178 atgggctacaatgtcagtatgatggcagactcaacttctcgatgggcagaagctctgcgt 1237

                                                              
Query: 73   gaaatttcaggacgtttggctgaaatgcctgcggatagtggntaccctgc 122
            |||||||||||||| ||||| ||||||||||| |||||||| || |||||
Sbjct: 1238 gaaatttcaggacgattggcggaaatgcctgcagatagtggatatcctgc 1287



to top

>ref|NM_001036222.1| Arabidopsis thaliana VHA-A; ATP binding / hydrogen-transporting ATP
            synthase, rotational mechanism / hydrogen-transporting
            ATPase, rotational mechan> AT1G78900 (VHA-A) transcript
            variant AT1G78900.2 mRNA, complete cds
          Length = 2512

 Score = 81.8 bits (41), Expect = 7e-13
 Identities = 86/101 (85%)
 Strand = Plus / Plus

                                                                        
Query: 13   atgggctataatgttagtatgatggctgattccacgtccaggtgggccgaagcattgcgt 72
            |||||||| ||||||||||||||||| || || || ||| | ||||| ||||||||  | 
Sbjct: 1292 atgggctacaatgttagtatgatggcagactcaacttcccgttgggcagaagcattaaga 1351

                                                     
Query: 73   gaaatttcaggacgtttggctgaaatgcctgcggatagtgg 113
            ||||||||||||||  |||||||||||||||| || |||||
Sbjct: 1352 gaaatttcaggacggctggctgaaatgcctgctgacagtgg 1392



to top

>ref|NM_106539.3| Arabidopsis thaliana VHA-A; ATP binding / hydrogen-transporting ATP
            synthase, rotational mechanism / hydrogen-transporting
            ATPase, rotational mechan> AT1G78900 (VHA-A) transcript
            variant AT1G78900.1 mRNA, complete cds
          Length = 2373

 Score = 81.8 bits (41), Expect = 7e-13
 Identities = 86/101 (85%)
 Strand = Plus / Plus

                                                                        
Query: 13   atgggctataatgttagtatgatggctgattccacgtccaggtgggccgaagcattgcgt 72
            |||||||| ||||||||||||||||| || || || ||| | ||||| ||||||||  | 
Sbjct: 1153 atgggctacaatgttagtatgatggcagactcaacttcccgttgggcagaagcattaaga 1212

                                                     
Query: 73   gaaatttcaggacgtttggctgaaatgcctgcggatagtgg 113
            ||||||||||||||  |||||||||||||||| || |||||
Sbjct: 1213 gaaatttcaggacggctggctgaaatgcctgctgacagtgg 1253



to top

>gb|BT008383.1| Arabidopsis thaliana At1g78900 gene, complete cds
          Length = 1872

 Score = 81.8 bits (41), Expect = 7e-13
 Identities = 86/101 (85%)
 Strand = Plus / Plus

                                                                        
Query: 13   atgggctataatgttagtatgatggctgattccacgtccaggtgggccgaagcattgcgt 72
            |||||||| ||||||||||||||||| || || || ||| | ||||| ||||||||  | 
Sbjct: 1027 atgggctacaatgttagtatgatggcagactcaacttcccgttgggcagaagcattaaga 1086

                                                     
Query: 73   gaaatttcaggacgtttggctgaaatgcctgcggatagtgg 113
            ||||||||||||||  |||||||||||||||| || |||||
Sbjct: 1087 gaaatttcaggacggctggctgaaatgcctgctgacagtgg 1127



to top

>gb|AY081296.1| Arabidopsis thaliana ATPase subunit A mRNA, complete cds
          Length = 2314

 Score = 81.8 bits (41), Expect = 7e-13
 Identities = 86/101 (85%)
 Strand = Plus / Plus

                                                                        
Query: 13   atgggctataatgttagtatgatggctgattccacgtccaggtgggccgaagcattgcgt 72
            |||||||| ||||||||||||||||| || || || ||| | ||||| ||||||||  | 
Sbjct: 1152 atgggctacaatgttagtatgatggcagactcaacttcccgttgggcagaagcattaaga 1211

                                                     
Query: 73   gaaatttcaggacgtttggctgaaatgcctgcggatagtgg 113
            ||||||||||||||  |||||||||||||||| || |||||
Sbjct: 1212 gaaatttcaggacggctggctgaaatgcctgctgacagtgg 1252



to top

>gb|AY059909.1| Arabidopsis thaliana vacuolar type ATPase subunit A (F9K20.5) mRNA,
            complete cds
          Length = 2248

 Score = 81.8 bits (41), Expect = 7e-13
 Identities = 86/101 (85%)
 Strand = Plus / Plus

                                                                        
Query: 13   atgggctataatgttagtatgatggctgattccacgtccaggtgggccgaagcattgcgt 72
            |||||||| ||||||||||||||||| || || || ||| | ||||| ||||||||  | 
Sbjct: 1152 atgggctacaatgttagtatgatggcagactcaacttcccgttgggcagaagcattaaga 1211

                                                     
Query: 73   gaaatttcaggacgtttggctgaaatgcctgcggatagtgg 113
            ||||||||||||||  |||||||||||||||| || |||||
Sbjct: 1212 gaaatttcaggacggctggctgaaatgcctgctgacagtgg 1252



to top

>dbj|AK221853.1| Arabidopsis thaliana mRNA for vacuolar-type H+-ATPase subunit A,
           complete cds, clone: RAFL22-08-A11
          Length = 1319

 Score = 81.8 bits (41), Expect = 7e-13
 Identities = 86/101 (85%)
 Strand = Plus / Plus

                                                                       
Query: 13  atgggctataatgttagtatgatggctgattccacgtccaggtgggccgaagcattgcgt 72
           |||||||| ||||||||||||||||| || || || ||| | ||||| ||||||||  | 
Sbjct: 146 atgggctacaatgttagtatgatggcagactcaacttcccgttgggcagaagcattaaga 205

                                                    
Query: 73  gaaatttcaggacgtttggctgaaatgcctgcggatagtgg 113
           ||||||||||||||  |||||||||||||||| || |||||
Sbjct: 206 gaaatttcaggacggctggctgaaatgcctgctgacagtgg 246



to top

>emb|BX817720.1|CNS0AALL Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTSIL38ZG04 of Silique of strain col-0 of Arabidopsis
            thaliana (thale cress)
          Length = 2261

 Score = 81.8 bits (41), Expect = 7e-13
 Identities = 86/101 (85%)
 Strand = Plus / Plus

                                                                        
Query: 13   atgggctataatgttagtatgatggctgattccacgtccaggtgggccgaagcattgcgt 72
            |||||||| ||||||||||||||||| || || || ||| | ||||| ||||||||  | 
Sbjct: 1132 atgggctacaatgttagtatgatggcagactcaacttcccgttgggcagaagcattaaga 1191

                                                     
Query: 73   gaaatttcaggacgtttggctgaaatgcctgcggatagtgg 113
            ||||||||||||||  |||||||||||||||| || |||||
Sbjct: 1192 gaaatttcaggacggctggctgaaatgcctgctgacagtgg 1232



to top

>gb|AY085759.1| Arabidopsis thaliana clone 17815 mRNA, complete sequence
          Length = 2314

 Score = 81.8 bits (41), Expect = 7e-13
 Identities = 86/101 (85%)
 Strand = Plus / Plus

                                                                        
Query: 13   atgggctataatgttagtatgatggctgattccacgtccaggtgggccgaagcattgcgt 72
            |||||||| ||||||||||||||||| || || || ||| | ||||| ||||||||  | 
Sbjct: 1152 atgggctacaatgttagtatgatggcagactcaacttcccgttgggcagaagcattaaga 1211

                                                     
Query: 73   gaaatttcaggacgtttggctgaaatgcctgcggatagtgg 113
            ||||||||||||||  |||||||||||||||| || |||||
Sbjct: 1212 gaaatttcaggacggctggctgaaatgcctgctgacagtgg 1252



to top

>gb|BT002589.1| Arabidopsis thaliana vacuolar type ATPase subunit A (At1g78900) mRNA,
            complete cds
          Length = 1927

 Score = 81.8 bits (41), Expect = 7e-13
 Identities = 86/101 (85%)
 Strand = Plus / Plus

                                                                        
Query: 13   atgggctataatgttagtatgatggctgattccacgtccaggtgggccgaagcattgcgt 72
            |||||||| ||||||||||||||||| || || || ||| | ||||| ||||||||  | 
Sbjct: 1027 atgggctacaatgttagtatgatggcagactcaacttcccgttgggcagaagcattaaga 1086

                                                     
Query: 73   gaaatttcaggacgtttggctgaaatgcctgcggatagtgg 113
            ||||||||||||||  |||||||||||||||| || |||||
Sbjct: 1087 gaaatttcaggacggctggctgaaatgcctgctgacagtgg 1127



to top

>emb|X98767.1|BVVATPASE B.vulgaris mRNA for subunit A of the V-type ATPase
          Length = 2394

 Score = 81.8 bits (41), Expect = 7e-13
 Identities = 100/120 (83%)
 Strand = Plus / Plus

                                                                        
Query: 13   atgggctataatgttagtatgatggctgattccacgtccaggtgggccgaagcattgcgt 72
            ||||| || ||||| ||||||||||| || ||   |||  ||||||| ||||| ||||||
Sbjct: 1120 atggggtacaatgtcagtatgatggcagactcagggtctcggtgggcagaagctttgcgt 1179

                                                                        
Query: 73   gaaatttcaggacgtttggctgaaatgcctgcggatagtggntaccctgcgtatttggct 132
            |||||||||||||| ||||| || |||||||| || ||||| || ||||| |||||||||
Sbjct: 1180 gaaatttcaggacgattggcggagatgcctgctgacagtggatatcctgcttatttggct 1239



to top

>gb|U65638.1|ATU65638 Arabidopsis thaliana vacuolar type ATPase subunit A mRNA, complete
            cds
          Length = 2283

 Score = 81.8 bits (41), Expect = 7e-13
 Identities = 86/101 (85%)
 Strand = Plus / Plus

                                                                        
Query: 13   atgggctataatgttagtatgatggctgattccacgtccaggtgggccgaagcattgcgt 72
            |||||||| ||||||||||||||||| || || || ||| | ||||| ||||||||  | 
Sbjct: 1055 atgggctacaatgttagtatgatggcagactcaacttcccgttgggcagaagcattaaga 1114

                                                     
Query: 73   gaaatttcaggacgtttggctgaaatgcctgcggatagtgg 113
            ||||||||||||||  |||||||||||||||| || |||||
Sbjct: 1115 gaaatttcaggacggctggctgaaatgcctgctgacagtgg 1155



to top

>dbj|AB033377.1| Nepenthes alata NaVHA1 mRNA for vacuolar H+-ATPase subunit A,
           partial cds
          Length = 304

 Score = 81.8 bits (41), Expect = 7e-13
 Identities = 137/171 (80%)
 Strand = Plus / Plus

                                                                       
Query: 13  atgggctataatgttagtatgatggctgattccacgtccaggtgggccgaagcattgcgt 72
           |||||||| ||||||||||||||||| ||||| || ||  | ||||| |||||  |||||
Sbjct: 61  atgggctacaatgttagtatgatggcagattcaacatctcgttgggctgaagctctgcgt 120

                                                                       
Query: 73  gaaatttcaggacgtttggctgaaatgcctgcggatagtggntaccctgcgtatttggct 132
           ||||||||||||||  ||||||| ||||| || || ||||| || || || ||| |||||
Sbjct: 121 gaaatttcaggacggctggctgagatgcccgcagacagtggctatcccgcttatctggct 180

                                                              
Query: 133 tcacggntggcatccttctatgaacgngccgnnaaggngcaatgtcttggc 183
            ||||  | || || ||||| ||||| || |  |||| | |||||||||||
Sbjct: 181 gcacgtttagcctctttctacgaacgtgctggaaaggtgaaatgtcttggc 231



to top

>gb|J03769.1|DARVHATPA Daucus carota 70kD vacuolar H+-ATPase mRNA, complete cds
          Length = 2397

 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 99/119 (83%)
 Strand = Plus / Plus

                                                                        
Query: 13   atgggctataatgttagtatgatggctgattccacgtccaggtgggccgaagcattgcgt 72
            ||||| || ||||||||||||||||| ||||| || ||| | ||||| ||||| ||  | 
Sbjct: 1180 atgggttacaatgttagtatgatggcagattcaacatcccgatgggcagaagctttaaga 1239

                                                                       
Query: 73   gaaatttcaggacgtttggctgaaatgcctgcggatagtggntaccctgcgtatttggc 131
            ||||||||||| || ||||| ||||||||||| |||||||| || ||||| || |||||
Sbjct: 1240 gaaatttcagggcgattggcagaaatgcctgctgatagtgggtatcctgcttacttggc 1298



to top

>emb|X58386.1|BTBVATPA B.taurus mRNA for bovine vacuolar ATPase subunit A
          Length = 3106

 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 99/119 (83%)
 Strand = Plus / Plus

                                                                        
Query: 4    ttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggccgaa 63
            |||||||||||||||||| |||| |||||||||||||| ||||| ||  | ||||| || 
Sbjct: 1060 ttccgtgacatgggctatcatgtcagtatgatggctgactccacctctcgatgggctgag 1119

                                                                       
Query: 64   gcattgcgtgaaatttcaggacgtttggctgaaatgcctgcggatagtggntaccctgc 122
            ||  |  | ||||| || || |||||||||||||||||||| |||||||| || |||||
Sbjct: 1120 gctcttagagaaatctctggtcgtttggctgaaatgcctgcagatagtggatatcctgc 1178



to top

>gb|BC105145.1| Bos taurus ATPase, H+ transporting, lysosomal (vacuolar proton pump),
            alpha polypeptide, 70kD, isoform 1, mRNA (cDNA clone
            MGC:126942 IMAGE:7928844), complete cds
          Length = 4184

 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 99/119 (83%)
 Strand = Plus / Plus

                                                                        
Query: 4    ttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggccgaa 63
            |||||||||||||||||| |||| |||||||||||||| ||||| ||  | ||||| || 
Sbjct: 1068 ttccgtgacatgggctatcatgtcagtatgatggctgactccacctctcgatgggctgag 1127

                                                                       
Query: 64   gcattgcgtgaaatttcaggacgtttggctgaaatgcctgcggatagtggntaccctgc 122
            ||  |  | ||||| || || |||||||||||||||||||| |||||||| || |||||
Sbjct: 1128 gctcttagagaaatctctggtcgtttggctgaaatgcctgcagatagtggatatcctgc 1186



to top

>dbj|AB189964.1| Pyrus communis PcVHA-A2 mRNA for vacuolar H+-ATPase catalytic
            subunit, complete cds
          Length = 2322

 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 99/119 (83%)
 Strand = Plus / Plus

                                                                        
Query: 13   atgggctataatgttagtatgatggctgattccacgtccaggtgggccgaagcattgcgt 72
            |||||||| ||||| || |||||||| ||||| || ||  | ||||| || |||||||||
Sbjct: 1181 atgggctacaatgtcagcatgatggcagattcaacatctcgatgggctgaggcattgcgt 1240

                                                                       
Query: 73   gaaatttcaggacgtttggctgaaatgcctgcggatagtggntaccctgcgtatttggc 131
            || ||||| || ||  | |||||||||||||| |||||||| |||||||| ||||||||
Sbjct: 1241 gagatttctgggcggctagctgaaatgcctgcagatagtggataccctgcttatttggc 1299



to top

>ref|NM_174504.2| Bos taurus ATPase, H+ transporting, lysosomal (vacuolar proton pump),
            alpha polypeptide, 70kD, isoform 1 (ATP6A1), mRNA
          Length = 4184

 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 99/119 (83%)
 Strand = Plus / Plus

                                                                        
Query: 4    ttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggccgaa 63
            |||||||||||||||||| |||| |||||||||||||| ||||| ||  | ||||| || 
Sbjct: 1068 ttccgtgacatgggctatcatgtcagtatgatggctgactccacctctcgatgggctgag 1127

                                                                       
Query: 64   gcattgcgtgaaatttcaggacgtttggctgaaatgcctgcggatagtggntaccctgc 122
            ||  |  | ||||| || || |||||||||||||||||||| |||||||| || |||||
Sbjct: 1128 gctcttagagaaatctctggtcgtttggctgaaatgcctgcagatagtggatatcctgc 1186



to top

>emb|X61612.1|BTRNAATP B.taurus mRNA for vacuolar H+ATPase Mr 70000 subunit
          Length = 3091

 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 99/119 (83%)
 Strand = Plus / Plus

                                                                        
Query: 4    ttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggccgaa 63
            |||||||||||||||||| |||| |||||||||||||| ||||| ||  | ||||| || 
Sbjct: 1060 ttccgtgacatgggctatcatgtcagtatgatggctgactccacctctcgatgggctgag 1119

                                                                       
Query: 64   gcattgcgtgaaatttcaggacgtttggctgaaatgcctgcggatagtggntaccctgc 122
            ||  |  | ||||| || || |||||||||||||||||||| |||||||| || |||||
Sbjct: 1120 gctcttagagaaatctctggtcgtttggctgaaatgcctgcagatagtggatatcctgc 1178



to top

>gb|M80430.1|BOVATPASEV Bovine vacuolar H+-ATPase A subunit mRNA, complete cds
          Length = 4037

 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 99/119 (83%)
 Strand = Plus / Plus

                                                                        
Query: 4    ttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggccgaa 63
            |||||||||||||||||| |||| |||||||||||||| ||||| ||  | ||||| || 
Sbjct: 1050 ttccgtgacatgggctatcatgtcagtatgatggctgactccacctctcgatgggctgag 1109

                                                                       
Query: 64   gcattgcgtgaaatttcaggacgtttggctgaaatgcctgcggatagtggntaccctgc 122
            ||  |  | ||||| || || |||||||||||||||||||| |||||||| || |||||
Sbjct: 1110 gctcttagagaaatctctggtcgtttggctgaaatgcctgcagatagtggatatcctgc 1168



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
               sequence
          Length = 35954743

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 61/69 (88%)
 Strand = Plus / Plus

                                                                           
Query: 90      ggctgaaatgcctgcggatagtggntaccctgcgtatttggcttcacggntggcatcctt 149
               ||||||||||||||| |||||||| |||||||| ||||||||| || |  ||||||| ||
Sbjct: 4124496 ggctgaaatgcctgcagatagtggttaccctgcttatttggctgcaagactggcatcttt 4124555

                        
Query: 150     ctatgaacg 158
               |||||||||
Sbjct: 4124556 ctatgaacg 4124564



 Score = 75.8 bits (38), Expect = 4e-11
 Identities = 74/86 (86%)
 Strand = Plus / Plus

                                                                           
Query: 6       ccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggccgaagc 65
               |||||||||||| || ||||| || ||||||||||||||||| ||  | ||||| || ||
Sbjct: 4124010 ccgtgacatgggttacaatgtcagcatgatggctgattccacctcacgatgggctgaggc 4124069

                                         
Query: 66      attgcgtgaaatttcaggacgtttgg 91
               ||||||||||||||| || |||||||
Sbjct: 4124070 attgcgtgaaatttctgggcgtttgg 4124095



to top

>dbj|AP003992.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1077_E05
          Length = 116305

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 61/69 (88%)
 Strand = Plus / Plus

                                                                         
Query: 90    ggctgaaatgcctgcggatagtggntaccctgcgtatttggcttcacggntggcatcctt 149
             ||||||||||||||| |||||||| |||||||| ||||||||| || |  ||||||| ||
Sbjct: 34510 ggctgaaatgcctgcagatagtggttaccctgcttatttggctgcaagactggcatcttt 34569

                      
Query: 150   ctatgaacg 158
             |||||||||
Sbjct: 34570 ctatgaacg 34578



 Score = 75.8 bits (38), Expect = 4e-11
 Identities = 74/86 (86%)
 Strand = Plus / Plus

                                                                         
Query: 6     ccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggccgaagc 65
             |||||||||||| || ||||| || ||||||||||||||||| ||  | ||||| || ||
Sbjct: 34024 ccgtgacatgggttacaatgtcagcatgatggctgattccacctcacgatgggctgaggc 34083

                                       
Query: 66    attgcgtgaaatttcaggacgtttgg 91
             ||||||||||||||| || |||||||
Sbjct: 34084 attgcgtgaaatttctgggcgtttgg 34109



to top

>gb|U15604.1|BNU15604 Brassica napus tonoplast ATPase 70 kDa subunit mRNA, complete cds
          Length = 2201

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 92/110 (83%)
 Strand = Plus / Plus

                                                                        
Query: 13   atgggctataatgttagtatgatggctgattccacgtccaggtgggccgaagcattgcgt 72
            ||||| || ||||||||||||||||| || || || ||| | ||||| ||||||||| | 
Sbjct: 1069 atgggatacaatgttagtatgatggcagactcaacttcccgttgggcagaagcattgaga 1128

                                                              
Query: 73   gaaatttcaggacgtttggctgaaatgcctgcggatagtggntaccctgc 122
            |||||||| |||||  ||||||| ||||||||||| ||||| || |||||
Sbjct: 1129 gaaatttctggacggctggctgagatgcctgcggacagtggatatcctgc 1178



to top

>ref|XM_526445.1| PREDICTED: Pan troglodytes similar to ATPase, H+ transporting, V1
           subunit A, isoform 1; 70-kDa subunit; lysosomal 70kDa;
           ATPase, H+ transporting, lysosomal (vacuolar proton
           pump), alpha 70 kDa, isoform 2; ATPase, H+ transporting,
           lysosomal (vacuolar proton pump), alpha 70 kD...
           (LOC471061), mRNA
          Length = 900

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 94/113 (83%)
 Strand = Plus / Plus

                                                                       
Query: 1   tacttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggcc 60
           ||||||||||||||||||||| |||| |||||||||||||| || || || || ||||| 
Sbjct: 382 tacttccgtgacatgggctatcatgtcagtatgatggctgactctacctctagatgggct 441

                                                                
Query: 61  gaagcattgcgtgaaatttcaggacgtttggctgaaatgcctgcggatagtgg 113
           || ||  |  | ||||| || || ||||| |||||||||||||| ||||||||
Sbjct: 442 gaggcccttagagaaatctctggtcgtttagctgaaatgcctgcagatagtgg 494



to top

>gb|BC013138.1| Homo sapiens ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A,
            mRNA (cDNA clone MGC:21189 IMAGE:4454722), complete cds
          Length = 2907

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 94/113 (83%)
 Strand = Plus / Plus

                                                                        
Query: 1    tacttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggcc 60
            ||||||||||||||||||||| |||| |||||||||||||| || || || || ||||| 
Sbjct: 1062 tacttccgtgacatgggctatcatgtcagtatgatggctgactctacctctagatgggct 1121

                                                                 
Query: 61   gaagcattgcgtgaaatttcaggacgtttggctgaaatgcctgcggatagtgg 113
            || ||  |  | ||||| || || ||||| |||||||||||||| ||||||||
Sbjct: 1122 gaggcccttagagaaatctctggtcgtttagctgaaatgcctgcagatagtgg 1174



to top

>gb|BT008024.1| Synthetic construct Homo sapiens ATPase, H+ transporting, lysosomal
            70kDa, V1 subunit A, isoform 1 mRNA, partial cds
          Length = 1854

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 94/113 (83%)
 Strand = Plus / Plus

                                                                        
Query: 1    tacttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggcc 60
            ||||||||||||||||||||| |||| |||||||||||||| || || || || ||||| 
Sbjct: 1006 tacttccgtgacatgggctatcatgtcagtatgatggctgactctacctctagatgggct 1065

                                                                 
Query: 61   gaagcattgcgtgaaatttcaggacgtttggctgaaatgcctgcggatagtgg 113
            || ||  |  | ||||| || || ||||| |||||||||||||| ||||||||
Sbjct: 1066 gaggcccttagagaaatctctggtcgtttagctgaaatgcctgcagatagtgg 1118



to top

>gb|BT006672.1| Homo sapiens ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A,
            isoform 1 mRNA, complete cds
          Length = 1854

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 94/113 (83%)
 Strand = Plus / Plus

                                                                        
Query: 1    tacttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggcc 60
            ||||||||||||||||||||| |||| |||||||||||||| || || || || ||||| 
Sbjct: 1006 tacttccgtgacatgggctatcatgtcagtatgatggctgactctacctctagatgggct 1065

                                                                 
Query: 61   gaagcattgcgtgaaatttcaggacgtttggctgaaatgcctgcggatagtgg 113
            || ||  |  | ||||| || || ||||| |||||||||||||| ||||||||
Sbjct: 1066 gaggcccttagagaaatctctggtcgtttagctgaaatgcctgcagatagtgg 1118



to top

>emb|CR859606.1| Pongo pygmaeus mRNA; cDNA DKFZp459K064 (from clone DKFZp459K064)
          Length = 4585

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 94/113 (83%)
 Strand = Plus / Plus

                                                                        
Query: 1    tacttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggcc 60
            ||||||||||||||||||||| |||| |||||||||||||| || || || || ||||| 
Sbjct: 1106 tacttccgtgacatgggctatcatgtcagtatgatggctgactctacctctagatgggct 1165

                                                                 
Query: 61   gaagcattgcgtgaaatttcaggacgtttggctgaaatgcctgcggatagtgg 113
            || ||  |  | ||||| || || ||||| |||||||||||||| ||||||||
Sbjct: 1166 gaggcccttagagaaatctctggtcgtttagctgaaatgcctgcagatagtgg 1218



to top

>emb|CR860887.1| Pongo pygmaeus mRNA; cDNA DKFZp469D0420 (from clone DKFZp469D0420)
          Length = 3141

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 94/113 (83%)
 Strand = Plus / Plus

                                                                        
Query: 1    tacttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggcc 60
            ||||||||||||||||||||| |||| |||||||||||||| || || || || ||||| 
Sbjct: 1297 tacttccgtgacatgggctatcatgtcagtatgatggctgactctacctctagatgggct 1356

                                                                 
Query: 61   gaagcattgcgtgaaatttcaggacgtttggctgaaatgcctgcggatagtgg 113
            || ||  |  | ||||| || || ||||| |||||||||||||| ||||||||
Sbjct: 1357 gaggcccttagagaaatctctggtcgtttagctgaaatgcctgcagatagtgg 1409



to top

>dbj|AB220510.1| Macaca fascicularis mRNA, clone QnpA-16745: similar to Homo sapiens
           ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A
           (ATP6V1A), mRNA, NM_001690.2
          Length = 1717

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 94/113 (83%)
 Strand = Plus / Plus

                                                                       
Query: 1   tacttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggcc 60
           ||||||||||||||||||||| |||| |||||||||||||| || || || || ||||| 
Sbjct: 15  tacttccgtgacatgggctatcatgtcagtatgatggctgactctacctctagatgggct 74

                                                                
Query: 61  gaagcattgcgtgaaatttcaggacgtttggctgaaatgcctgcggatagtgg 113
           || ||  |  | ||||| || || ||||| |||||||||||||| ||||||||
Sbjct: 75  gaggcccttagagaaatctctggtcgtttagctgaaatgcctgcagatagtgg 127



to top

>gb|AY891448.1| Synthetic construct Homo sapiens clone FLH013978.01L ATPase H+
            transporting lysosomal 70kDa V1 subunit A (ATP6V1A1)
            mRNA, partial cds
          Length = 1854

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 94/113 (83%)
 Strand = Plus / Plus

                                                                        
Query: 1    tacttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggcc 60
            ||||||||||||||||||||| |||| |||||||||||||| || || || || ||||| 
Sbjct: 1006 tacttccgtgacatgggctatcatgtcagtatgatggctgactctacctctagatgggct 1065

                                                                 
Query: 61   gaagcattgcgtgaaatttcaggacgtttggctgaaatgcctgcggatagtgg 113
            || ||  |  | ||||| || || ||||| |||||||||||||| ||||||||
Sbjct: 1066 gaggcccttagagaaatctctggtcgtttagctgaaatgcctgcagatagtgg 1118



to top

>gb|AY891447.1| Synthetic construct Homo sapiens clone FLH013977.01L ATPase H+
            transporting lysosomal 70kDa V1 subunit A (ATP6V1A1)
            mRNA, partial cds
          Length = 1854

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 94/113 (83%)
 Strand = Plus / Plus

                                                                        
Query: 1    tacttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggcc 60
            ||||||||||||||||||||| |||| |||||||||||||| || || || || ||||| 
Sbjct: 1006 tacttccgtgacatgggctatcatgtcagtatgatggctgactctacctctagatgggct 1065

                                                                 
Query: 61   gaagcattgcgtgaaatttcaggacgtttggctgaaatgcctgcggatagtgg 113
            || ||  |  | ||||| || || ||||| |||||||||||||| ||||||||
Sbjct: 1066 gaggcccttagagaaatctctggtcgtttagctgaaatgcctgcagatagtgg 1118



to top

>gb|AY888804.1| Synthetic construct Homo sapiens clone FLH013981.01X ATPase H+
            transporting lysosomal 70kDa V1 subunit A (ATP6V1A1)
            mRNA, complete cds
          Length = 1854

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 94/113 (83%)
 Strand = Plus / Plus

                                                                        
Query: 1    tacttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggcc 60
            ||||||||||||||||||||| |||| |||||||||||||| || || || || ||||| 
Sbjct: 1006 tacttccgtgacatgggctatcatgtcagtatgatggctgactctacctctagatgggct 1065

                                                                 
Query: 61   gaagcattgcgtgaaatttcaggacgtttggctgaaatgcctgcggatagtgg 113
            || ||  |  | ||||| || || ||||| |||||||||||||| ||||||||
Sbjct: 1066 gaggcccttagagaaatctctggtcgtttagctgaaatgcctgcagatagtgg 1118



to top

>gb|AF113129.1|AF113129 Homo sapiens vacuolar ATPase isoform VA68 mRNA, complete cds
          Length = 4540

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 94/113 (83%)
 Strand = Plus / Plus

                                                                        
Query: 1    tacttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggcc 60
            ||||||||||||||||||||| |||| |||||||||||||| || || || || ||||| 
Sbjct: 1041 tacttccgtgacatgggctatcatgtcagtatgatggctgactctacctctagatgggct 1100

                                                                 
Query: 61   gaagcattgcgtgaaatttcaggacgtttggctgaaatgcctgcggatagtgg 113
            || ||  |  | ||||| || || ||||| |||||||||||||| ||||||||
Sbjct: 1101 gaggcccttagagaaatctctggtcgtttagctgaaatgcctgcagatagtgg 1153



to top

>ref|NM_001690.2| Homo sapiens ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A
            (ATP6V1A), mRNA
          Length = 4567

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 94/113 (83%)
 Strand = Plus / Plus

                                                                        
Query: 1    tacttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggcc 60
            ||||||||||||||||||||| |||| |||||||||||||| || || || || ||||| 
Sbjct: 1072 tacttccgtgacatgggctatcatgtcagtatgatggctgactctacctctagatgggct 1131

                                                                 
Query: 61   gaagcattgcgtgaaatttcaggacgtttggctgaaatgcctgcggatagtgg 113
            || ||  |  | ||||| || || ||||| |||||||||||||| ||||||||
Sbjct: 1132 gaggcccttagagaaatctctggtcgtttagctgaaatgcctgcagatagtgg 1184



to top

>gb|L09235.1|HUMATPAVAD Human vacuolar ATPase (isoform VA68) mRNA, complete cds
          Length = 1924

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 94/113 (83%)
 Strand = Plus / Plus

                                                                        
Query: 1    tacttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggcc 60
            ||||||||||||||||||||| |||| |||||||||||||| || || || || ||||| 
Sbjct: 1021 tacttccgtgacatgggctatcatgtcagtatgatggctgactctacctctagatgggct 1080

                                                                 
Query: 61   gaagcattgcgtgaaatttcaggacgtttggctgaaatgcctgcggatagtgg 113
            || ||  |  | ||||| || || ||||| |||||||||||||| ||||||||
Sbjct: 1081 gaggcccttagagaaatctctggtcgtttagctgaaatgcctgcagatagtgg 1133



to top

>gb|AF367445.1| Prunus persica clone AtpvA1 V-ATPase catalytic subunit A (atpvA1)
            mRNA, complete cds
          Length = 2336

 Score = 71.9 bits (36), Expect = 6e-10
 Identities = 98/119 (82%)
 Strand = Plus / Plus

                                                                        
Query: 13   atgggctataatgttagtatgatggctgattccacgtccaggtgggccgaagcattgcgt 72
            |||||||| ||||| || |||||||| ||||| || ||  | ||||| ||||||||||||
Sbjct: 1163 atgggctacaatgtcagcatgatggcagattcaacttctcgatgggctgaagcattgcgt 1222

                                                                       
Query: 73   gaaatttcaggacgtttggctgaaatgcctgcggatagtggntaccctgcgtatttggc 131
            || ||||| || ||  |||| |||||||| || |||||||| || ||||| ||||||||
Sbjct: 1223 gagatttctgggcggctggcagaaatgccagcagatagtggatatcctgcttatttggc 1281



to top

>gb|AY178911.1| Lycopersicon esculentum vacuolar H+-ATPase A2 subunit isoform mRNA,
            complete cds
          Length = 2401

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 120/149 (80%)
 Strand = Plus / Plus

                                                                        
Query: 10   gacatgggctataatgttagtatgatggctgattccacgtccaggtgggccgaagcattg 69
            |||||||| || ||||| || |||||||| ||||| || ||  | ||||||||||| || 
Sbjct: 1161 gacatggggtacaatgtgagcatgatggcagattctacatctcgttgggccgaagcttta 1220

                                                                        
Query: 70   cgtgaaatttcaggacgtttggctgaaatgcctgcggatagtggntaccctgcgtatttg 129
            |||||||||||||| ||  |||| || |||||||| || ||||| || ||||| ||| | 
Sbjct: 1221 cgtgaaatttcaggtcggctggcagagatgcctgcagacagtggatatcctgcttatctt 1280

                                         
Query: 130  gcttcacggntggcatccttctatgaacg 158
            ||| ||||  ||||||| || ||||||||
Sbjct: 1281 gctgcacgtttggcatctttttatgaacg 1309



to top

>emb|X68580.1|SPVATPA S.pombe gene for vacuolar H+-ATPase, subunit A
          Length = 3054

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 64/74 (86%)
 Strand = Plus / Plus

                                                                        
Query: 31   atgatggctgattccacgtccaggtgggccgaagcattgcgtgaaatttcaggacgtttg 90
            |||||||||||||| || ||  | ||||| ||||| |||||||||||||| || ||||||
Sbjct: 2053 atgatggctgattctacatctcgttgggctgaagctttgcgtgaaatttctggtcgtttg 2112

                          
Query: 91   gctgaaatgcctgc 104
            ||||| ||||||||
Sbjct: 2113 gctgagatgcctgc 2126



to top

>emb|AL109739.1|SPAC343 S.pombe chromosome I cosmid c343
          Length = 42947

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 64/74 (86%)
 Strand = Plus / Plus

                                                                        
Query: 31   atgatggctgattccacgtccaggtgggccgaagcattgcgtgaaatttcaggacgtttg 90
            |||||||||||||| || ||  | ||||| ||||| |||||||||||||| || ||||||
Sbjct: 8937 atgatggctgattctacatctcgttgggctgaagctttgcgtgaaatttctggtcgtttg 8996

                          
Query: 91   gctgaaatgcctgc 104
            ||||| ||||||||
Sbjct: 8997 gctgagatgcctgc 9010



to top

>ref|NM_001018858.1| Schizosaccharomyces pombe 972h- hypothetical protein (SPAC343.05),
            partial mRNA
          Length = 1860

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 64/74 (86%)
 Strand = Plus / Plus

                                                                        
Query: 31   atgatggctgattccacgtccaggtgggccgaagcattgcgtgaaatttcaggacgtttg 90
            |||||||||||||| || ||  | ||||| ||||| |||||||||||||| || ||||||
Sbjct: 1060 atgatggctgattctacatctcgttgggctgaagctttgcgtgaaatttctggtcgtttg 1119

                          
Query: 91   gctgaaatgcctgc 104
            ||||| ||||||||
Sbjct: 1120 gctgagatgcctgc 1133



to top

>gb|AY813539.1| Schistosoma japonicum SJCHGC09310 protein mRNA, complete cds
          Length = 2513

 Score = 65.9 bits (33), Expect = 4e-08
 Identities = 84/101 (83%)
 Strand = Plus / Plus

                                                                        
Query: 4    ttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggccgaa 63
            |||||||| ||||| |||||||||||||||||||| ||||| ||     | ||||| |||
Sbjct: 1061 ttccgtgatatgggttataatgttagtatgatggccgattcaactagtcgttgggctgaa 1120

                                                     
Query: 64   gcattgcgtgaaatttcaggacgtttggctgaaatgcctgc 104
            ||||| |||||||| || || || || ||||||||||||||
Sbjct: 1121 gcattacgtgaaatatctggtcgattagctgaaatgcctgc 1161



to top

>ref|XM_971095.1| PREDICTED: Tribolium castaneum similar to Vacuolar ATP synthase
            catalytic subunit A, osteoclast isoform (V-ATPase A
            subunit 2) (Vacuolar proton pump alpha subunit 2)
            (V-ATPase 69 kDa subunit 2) (Isoform HO68), transcript
            variant 2 (LOC663322), mRNA
          Length = 2330

 Score = 65.9 bits (33), Expect = 4e-08
 Identities = 83/100 (83%)
 Strand = Plus / Plus

                                                                        
Query: 31   atgatggctgattccacgtccaggtgggccgaagcattgcgtgaaatttcaggacgtttg 90
            |||||||| |||||||| ||  | ||||||||||| ||| | |||||||| || ||||| 
Sbjct: 1113 atgatggccgattccacctcgcgttgggccgaagctttgagagaaatttccggtcgttta 1172

                                                    
Query: 91   gctgaaatgcctgcggatagtggntaccctgcgtatttgg 130
            ||||||||||| || |||  ||| ||||| ||||||||||
Sbjct: 1173 gctgaaatgcccgccgattctgggtaccccgcgtatttgg 1212



to top

>ref|XM_962857.1| PREDICTED: Tribolium castaneum similar to Vacuolar ATP synthase
            catalytic subunit A, osteoclast isoform (V-ATPase A
            subunit 2) (Vacuolar proton pump alpha subunit 2)
            (V-ATPase 69 kDa subunit 2) (Isoform HO68), transcript
            variant 1 (LOC663322), mRNA
          Length = 2375

 Score = 65.9 bits (33), Expect = 4e-08
 Identities = 83/100 (83%)
 Strand = Plus / Plus

                                                                        
Query: 31   atgatggctgattccacgtccaggtgggccgaagcattgcgtgaaatttcaggacgtttg 90
            |||||||| |||||||| ||  | ||||||||||| ||| | |||||||| || ||||| 
Sbjct: 1158 atgatggccgattccacctcgcgttgggccgaagctttgagagaaatttccggtcgttta 1217

                                                    
Query: 91   gctgaaatgcctgcggatagtggntaccctgcgtatttgg 130
            ||||||||||| || |||  ||| ||||| ||||||||||
Sbjct: 1218 gctgaaatgcccgccgattctgggtaccccgcgtatttgg 1257



to top

>gb|AC079944.17| Homo sapiens 3 BAC RP11-435F17 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 126295

 Score = 65.9 bits (33), Expect = 4e-08
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                       
Query: 1      tacttccgtgacatgggctataatgttagtatgatggctga 41
              ||||||||||||||||||||| |||| ||||||||||||||
Sbjct: 121334 tacttccgtgacatgggctatcatgtcagtatgatggctga 121294



to top

>gb|L08200.1|PFAVAPA Plasmodium falciparum vacuolar proton adenosine triphosphatase (vapA)
            gene, complete cds
          Length = 2305

 Score = 65.9 bits (33), Expect = 4e-08
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                     
Query: 73   gaaatttcaggacgtttggctgaaatgcctgcggatagtgg 113
            ||||||||||||||||| |||||||||||||| ||||||||
Sbjct: 1357 gaaatttcaggacgtttagctgaaatgcctgcagatagtgg 1397



to top

>gb|AY089512.1| Drosophila melanogaster GH21132 full insert cDNA
          Length = 2610

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 86/104 (82%)
 Strand = Plus / Plus

                                                                        
Query: 1    tacttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggcc 60
            ||||||||||| |||||||| || ||    ||||||||||||||||| ||| | ||||| 
Sbjct: 1095 tacttccgtgatatgggctacaacgtagccatgatggctgattccacctcccgttgggct 1154

                                                        
Query: 61   gaagcattgcgtgaaatttcaggacgtttggctgaaatgcctgc 104
            || ||| | ||||| ||||| || ||||||||||| ||||||||
Sbjct: 1155 gaggcacttcgtgagatttcgggtcgtttggctgagatgcctgc 1198



to top

>ref|NM_078836.2| Drosophila melanogaster Vha68-1 CG12403-RA (Vha68-1), mRNA
          Length = 2650

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 86/104 (82%)
 Strand = Plus / Plus

                                                                        
Query: 1    tacttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggcc 60
            ||||||||||| |||||||| || ||    ||||||||||||||||| ||| | ||||| 
Sbjct: 1155 tacttccgtgatatgggctacaacgtagccatgatggctgattccacctcccgttgggct 1214

                                                        
Query: 61   gaagcattgcgtgaaatttcaggacgtttggctgaaatgcctgc 104
            || ||| | ||||| ||||| || ||||||||||| ||||||||
Sbjct: 1215 gaggcacttcgtgagatttcgggtcgtttggctgagatgcctgc 1258



to top

>gb|AC008332.11|AC008332 Drosophila melanogaster, chromosome 2L, region 34A-34A, BAC clone
              BACR48D10, complete sequence
          Length = 153250

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 86/104 (82%)
 Strand = Plus / Minus

                                                                          
Query: 1      tacttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggcc 60
              ||||||||||| |||||||| || ||    ||||||||||||||||| ||| | ||||| 
Sbjct: 132595 tacttccgtgatatgggctacaacgtagccatgatggctgattccacctcccgttgggct 132536

                                                          
Query: 61     gaagcattgcgtgaaatttcaggacgtttggctgaaatgcctgc 104
              || ||| | ||||| ||||| || ||||||||||| ||||||||
Sbjct: 132535 gaggcacttcgtgagatttcgggtcgtttggctgagatgcctgc 132492



 Score = 44.1 bits (22), Expect = 0.15
 Identities = 61/74 (82%)
 Strand = Plus / Plus

                                                                          
Query: 31     atgatggctgattccacgtccaggtgggccgaagcattgcgtgaaatttcaggacgtttg 90
              ||||||||||||||||| ||| | ||||| || ||  | ||||||||||| || ||| | 
Sbjct: 107464 atgatggctgattccacctcccgttgggctgaggctcttcgtgaaatttctggtcgtctc 107523

                            
Query: 91     gctgaaatgcctgc 104
              ||||| ||||||||
Sbjct: 107524 gctgagatgcctgc 107537



to top

>gb|AF185049.1|AF185049 Drosophila melanogaster vacuolar ATPase subunit A (Vha68-1) gene,
            complete cds
          Length = 3851

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 86/104 (82%)
 Strand = Plus / Plus

                                                                        
Query: 1    tacttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggcc 60
            ||||||||||| |||||||| || ||    ||||||||||||||||| ||| | ||||| 
Sbjct: 2051 tacttccgtgatatgggctacaacgtagccatgatggctgattccacctcccgttgggct 2110

                                                        
Query: 61   gaagcattgcgtgaaatttcaggacgtttggctgaaatgcctgc 104
            || ||| | ||||| ||||| || ||||||||||| ||||||||
Sbjct: 2111 gaggcacttcgtgagatttcgggtcgtttggctgagatgcctgc 2154



to top

>gb|U19745.2|U19745 Drosophila melanogaster V-ATPase A subunit (vha68-1) mRNA, complete
            cds
          Length = 2590

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 86/104 (82%)
 Strand = Plus / Plus

                                                                        
Query: 1    tacttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggcc 60
            ||||||||||| |||||||| || ||    ||||||||||||||||| ||| | ||||| 
Sbjct: 1095 tacttccgtgatatgggctacaacgtagccatgatggctgattccacctcccgttgggct 1154

                                                        
Query: 61   gaagcattgcgtgaaatttcaggacgtttggctgaaatgcctgc 104
            || ||| | ||||| ||||| || ||||||||||| ||||||||
Sbjct: 1155 gaggcacttcgtgagatttcgggtcgtttggctgagatgcctgc 1198



to top

>gb|AE003638.2| Drosophila melanogaster chromosome 2L, section 47 of 83 of the complete
              sequence
          Length = 254309

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 86/104 (82%)
 Strand = Plus / Minus

                                                                          
Query: 1      tacttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggcc 60
              ||||||||||| |||||||| || ||    ||||||||||||||||| ||| | ||||| 
Sbjct: 135843 tacttccgtgatatgggctacaacgtagccatgatggctgattccacctcccgttgggct 135784

                                                          
Query: 61     gaagcattgcgtgaaatttcaggacgtttggctgaaatgcctgc 104
              || ||| | ||||| ||||| || ||||||||||| ||||||||
Sbjct: 135783 gaggcacttcgtgagatttcgggtcgtttggctgagatgcctgc 135740



 Score = 44.1 bits (22), Expect = 0.15
 Identities = 61/74 (82%)
 Strand = Plus / Plus

                                                                          
Query: 31     atgatggctgattccacgtccaggtgggccgaagcattgcgtgaaatttcaggacgtttg 90
              ||||||||||||||||| ||| | ||||| || ||  | ||||||||||| || ||| | 
Sbjct: 110712 atgatggctgattccacctcccgttgggctgaggctcttcgtgaaatttctggtcgtctc 110771

                            
Query: 91     gctgaaatgcctgc 104
              ||||| ||||||||
Sbjct: 110772 gctgagatgcctgc 110785



to top

>gb|U19742.1|DMU19742 Drosophila melanogaster vacuolar ATPase subunit A gene, complete cds
          Length = 2414

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 86/104 (82%)
 Strand = Plus / Plus

                                                                        
Query: 1    tacttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggcc 60
            ||||||||||| |||||||| || ||    ||||||||||||||||| ||| | ||||| 
Sbjct: 1406 tacttccgtgatatgggctacaacgtagccatgatggctgattccacctcccgttgggct 1465

                                                        
Query: 61   gaagcattgcgtgaaatttcaggacgtttggctgaaatgcctgc 104
            || ||| | ||||| ||||| || ||||||||||| ||||||||
Sbjct: 1466 gaggcacttcgtgagatttcgggtcgtttggctgagatgcctgc 1509



to top

>emb|AM050349.1| Trichostrongylus vitrinus partial ORF for putative ATP synthase
          Length = 359

 Score = 61.9 bits (31), Expect = 6e-07
 Identities = 64/75 (85%)
 Strand = Plus / Plus

                                                                       
Query: 30  tatgatggctgattccacgtccaggtgggccgaagcattgcgtgaaatttcaggacgttt 89
           ||||||||||||||| || ||  | |||||||||||| | || |||||||| ||||||||
Sbjct: 111 tatgatggctgattcaacttcacgatgggccgaagcacttcgagaaatttctggacgttt 170

                          
Query: 90  ggctgaaatgcctgc 104
           ||  |||||||||||
Sbjct: 171 gggagaaatgcctgc 185



to top

>gb|AC005679.1|F9K20 Arabidopsis thaliana chromosome 1 BAC F9K20 sequence, complete sequence
          Length = 90425

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                         
Query: 13    atgggctataatgttagtatgatggctgattccacgtccaggtgggccgaagcattgcgt 72
             |||||||| ||||||||||||||||| || || || ||| | ||||| ||||||||  | 
Sbjct: 15021 atgggctacaatgttagtatgatggcagactcaacttcccgttgggcagaagcattaaga 14962

                           
Query: 73    gaaatttcaggacg 86
             ||||||||||||||
Sbjct: 14961 gaaatttcaggacg 14948



to top

>dbj|AB036926.1| Citrus unshiu Cit-VATP A-1 gene for vacuolar H+-ATPase A subunit,
           partial cds
          Length = 3431

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 63/74 (85%)
 Strand = Plus / Plus

                                                                       
Query: 13  atgggctataatgttagtatgatggctgattccacgtccaggtgggccgaagcattgcgt 72
           ||||| || |||||||| |||||||| ||||| || ||  | ||||| ||||| ||||||
Sbjct: 316 atggggtacaatgttagcatgatggcagattcaacttctcgttgggcagaagcgttgcgt 375

                         
Query: 73  gaaatttcaggacg 86
           ||||||||||||||
Sbjct: 376 gaaatttcaggacg 389



 Score = 38.2 bits (19), Expect = 9.1
 Identities = 53/65 (81%)
 Strand = Plus / Plus

                                                                        
Query: 94   gaaatgcctgcggatagtggntaccctgcgtatttggcttcacggntggcatccttctat 153
            ||||||||||| |||||||| || ||||| ||  ||||| ||||  |||| || || |||
Sbjct: 1227 gaaatgcctgcagatagtggatatcctgcttacctggctgcacgtttggcctcattttat 1286

                 
Query: 154  gaacg 158
            |||||
Sbjct: 1287 gaacg 1291



to top

>ref|XM_724242.1| Plasmodium yoelii yoelii str. 17XNL V-type ATPase subunit A (PY01556)
            partial mRNA
          Length = 1836

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                    
Query: 73   gaaatttcaggacgtttggctgaaatgcctgcggatagtggntaccctgcgtattt 128
            ||||||||||| ||||| ||||||||||| || |||||||| || ||||| |||||
Sbjct: 1060 gaaatttcagggcgtttagctgaaatgccagcagatagtggttatcctgcctattt 1115



to top

>ref|XM_738011.1| Plasmodium chabaudi chabaudi hypothetical protein (PC001143.02.0)
           partial mRNA
          Length = 804

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 73  gaaatttcaggacgtttggctgaaatgcctgcggatagtggntaccctgcgtattt 128
           ||||| ||||||||||| ||||||||||| || |||||||| || ||||| |||||
Sbjct: 28  gaaatatcaggacgtttagctgaaatgccagcagatagtggttatcctgcctattt 83



to top

>gb|DQ440543.1| Ostertagia ostertagi ATPase beta-subunit mRNA, partial cds
          Length = 319

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 78/95 (82%)
 Strand = Plus / Plus

                                                                       
Query: 31  atgatggctgattccacgtccaggtgggccgaagcattgcgtgaaatttcaggacgtttg 90
           ||||||||||| || || ||  | ||||| |||||| | || |||||||| |||||||||
Sbjct: 92  atgatggctgactcaacttcacgatgggctgaagcacttcgagaaatttctggacgtttg 151

                                              
Query: 91  gctgaaatgcctgcggatagtggntaccctgcgta 125
           | |||||||||||| |||  ||| || ||||||||
Sbjct: 152 ggtgaaatgcctgctgattctggttatcctgcgta 186



to top

>dbj|D50528.1| Acetabularia acetabulum clone pVAL V type adenosine triphosphatase A
            subunit mRNA, complete cds
          Length = 2169

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                   
Query: 76   atttcaggacgtttggctgaaatgcctgcggatagtggntaccctgcgtatttgg 130
            ||||||||||||||||| ||||||||||| |||   || ||||||||||| ||||
Sbjct: 1128 atttcaggacgtttggcagaaatgcctgctgattcaggttaccctgcgtacttgg 1182



to top

>gb|AY864912.1| Aedes albopictus V-ATPase subunit A mRNA, complete cds
          Length = 2971

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 85/104 (81%)
 Strand = Plus / Plus

                                                                        
Query: 1    tacttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggcc 60
            ||||||||||| ||||| || || ||   ||||||||||||||| || ||  | ||||||
Sbjct: 997  tacttccgtgatatgggttacaacgtatctatgatggctgattcgacctctcgttgggcc 1056

                                                        
Query: 61   gaagcattgcgtgaaatttcaggacgtttggctgaaatgcctgc 104
            |||||  | || |||||||| || ||| ||||||||||||||||
Sbjct: 1057 gaagctcttcgagaaatttccggtcgtctggctgaaatgcctgc 1100



to top

>emb|CR764095.1| Paramecium tetraurelia, complete gene
          Length = 2412

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 63/75 (84%)
 Strand = Plus / Plus

                                                                        
Query: 30   tatgatggctgattccacgtccaggtgggccgaagcattgcgtgaaatttcaggacgttt 89
            ||||||||||||||| || || || ||||| ||||||||| | ||||| || ||  | ||
Sbjct: 1320 tatgatggctgattcaacttcaagatgggcagaagcattgagagaaatctctggtagatt 1379

                           
Query: 90   ggctgaaatgcctgc 104
            |||||||||||||||
Sbjct: 1380 ggctgaaatgcctgc 1394



to top

>emb|CR764094.1| Paramecium tetraurelia, complete gene
          Length = 2413

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 63/75 (84%)
 Strand = Plus / Plus

                                                                        
Query: 30   tatgatggctgattccacgtccaggtgggccgaagcattgcgtgaaatttcaggacgttt 89
            ||||||||||||||| || || || ||||| ||||||||| | ||||| || ||  | ||
Sbjct: 1320 tatgatggctgattcaacttcaagatgggcagaagcattgagagaaatctctggtagatt 1379

                           
Query: 90   ggctgaaatgcctgc 104
            |||||||||||||||
Sbjct: 1380 ggctgaaatgcctgc 1394



to top

>ref|XM_687539.1| PREDICTED: Danio rerio similar to ATPase, H+ transporting, lysosomal
            70kDa, V1 subunit A (LOC573347), mRNA
          Length = 1473

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                           
Query: 1    tacttccgtgacatgggctataatgttagtatgatggctgattccac 47
            |||||| | ||||||||||||||||| ||||||||||| || |||||
Sbjct: 1093 tacttcagggacatgggctataatgtcagtatgatggccgactccac 1139



to top

>ref|NM_201135.1| Danio rerio ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A,
            like (atp6v1al), mRNA
          Length = 2627

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                           
Query: 1    tacttccgtgacatgggctataatgttagtatgatggctgattccac 47
            |||||| | ||||||||||||||||| ||||||||||| || |||||
Sbjct: 1073 tacttcagggacatgggctataatgtcagtatgatggccgactccac 1119



to top

>gb|BC055130.1| Danio rerio ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A,
            like, mRNA (cDNA clone MGC:63516 IMAGE:2644055), complete
            cds
          Length = 2627

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                           
Query: 1    tacttccgtgacatgggctataatgttagtatgatggctgattccac 47
            |||||| | ||||||||||||||||| ||||||||||| || |||||
Sbjct: 1073 tacttcagggacatgggctataatgtcagtatgatggccgactccac 1119



to top

>ref|XM_340987.2| PREDICTED: Rattus norvegicus ATPase, H+ transporting, V1 subunit A,
            isoform 1 (predicted) (Atp6v1a1_predicted), mRNA
          Length = 2515

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 98/122 (80%)
 Strand = Plus / Plus

                                                                        
Query: 1    tacttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggcc 60
            ||||||||||||||||| ||  | || |||||||||||||| || || || || ||||| 
Sbjct: 1056 tacttccgtgacatggggtaccacgtcagtatgatggctgactctacctctagatgggct 1115

                                                                        
Query: 61   gaagcattgcgtgaaatttcaggacgtttggctgaaatgcctgcggatagtggntaccct 120
            || ||  |  | ||||| || || || || |||||||||||||| |||||||| ||||||
Sbjct: 1116 gaggccctcagagaaatctctggtcgcttagctgaaatgcctgcagatagtggataccct 1175

              
Query: 121  gc 122
            ||
Sbjct: 1176 gc 1177



to top

>emb|BX119902.4| Zebrafish DNA sequence from clone CH211-137I24 in linkage group 5,
             complete sequence
          Length = 170241

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                            
Query: 1     tacttccgtgacatgggctataatgttagtatgatggctgattccac 47
             |||||| | ||||||||||||||||| ||||||||||| || |||||
Sbjct: 65156 tacttcagggacatgggctataatgtcagtatgatggccgactccac 65110



to top

>ref|XM_632259.1| Dictyostelium discoideum vacuolar H+-ATPase subunit A (DDB0201563),
            partial mRNA
          Length = 1857

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 80/98 (81%)
 Strand = Plus / Plus

                                                                        
Query: 4    ttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggccgaa 63
            |||||||| ||||| |  ||||||  ||||||||||||||| || ||  | ||||| |||
Sbjct: 1012 ttccgtgatatgggtttaaatgttgctatgatggctgattctacctctcgttgggctgaa 1071

                                                  
Query: 64   gcattgcgtgaaatttcaggacgtttggctgaaatgcc 101
            ||  | ||||||||||| || ||||| |||||||||||
Sbjct: 1072 gctcttcgtgaaatttctggtcgtttagctgaaatgcc 1109



to top

>gb|BC063915.1| Xenopus tropicalis ATPase, H+ transporting, lysosomal 70kDa, V1
            subunit A, mRNA (cDNA clone IMAGE:5335464), partial cds
          Length = 2314

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 53/62 (85%)
 Strand = Plus / Plus

                                                                        
Query: 4    ttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggccgaa 63
            ||||| || ||||| || ||||| ||||||||||| |||||||| ||||| ||||| |||
Sbjct: 946  ttccgagatatgggatacaatgtcagtatgatggccgattccacttccagatgggcagaa 1005

              
Query: 64   gc 65
            ||
Sbjct: 1006 gc 1007



to top

>gb|AF389404.1|AF389404 Saccharomyces sp. DH1-1A VMA1 (VMA1) gene, complete cds
          Length = 1854

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                              
Query: 55   tgggccgaagcattgcgtgaaatttcaggacgtttggctgaaatgcctgc 104
            ||||||||||| ||| | |||||||| || ||||||| ||||||||||||
Sbjct: 1081 tgggccgaagctttgagagaaatttctggtcgtttgggtgaaatgcctgc 1130



to top

>gb|U49169.1|DDU49169 Dictyostelium discoideum V-ATPase A subunit (vatA) mRNA, complete cds
          Length = 1967

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 80/98 (81%)
 Strand = Plus / Plus

                                                                        
Query: 4    ttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggccgaa 63
            |||||||| ||||| |  ||||||  ||||||||||||||| || ||  | ||||| |||
Sbjct: 1021 ttccgtgatatgggtttaaatgttgctatgatggctgattctacctctcgttgggctgaa 1080

                                                  
Query: 64   gcattgcgtgaaatttcaggacgtttggctgaaatgcc 101
            ||  | ||||||||||| || ||||| |||||||||||
Sbjct: 1081 gctcttcgtgaaatttctggtcgtttagctgaaatgcc 1118



to top

>ref|XM_647533.1| Entamoeba histolytica HM-1:IMSS V-type ATPase, A subunit, putative
            (111.t00022) partial mRNA
          Length = 1824

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 73/89 (82%)
 Strand = Plus / Plus

                                                                        
Query: 13   atgggctataatgttagtatgatggctgattccacgtccaggtgggccgaagcattgcgt 72
            ||||| |||||||||  ||||||||| ||||| || || || ||||| |||||| |  | 
Sbjct: 994  atgggatataatgttgctatgatggcagattcaacatcaagatgggctgaagcacttaga 1053

                                         
Query: 73   gaaatttcaggacgtttggctgaaatgcc 101
            ||||||||||||||| | || ||||||||
Sbjct: 1054 gaaatttcaggacgtcttgcagaaatgcc 1082



to top

>ref|XM_675040.1| Plasmodium berghei strain ANKA vacuolar ATP synthase catalytic
            subunit A (PB000844.02.0) partial mRNA
          Length = 1833

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                    
Query: 73   gaaatttcaggacgtttggctgaaatgcctgcggatagtggntaccctgcgtattt 128
            ||||| ||||| ||||| ||||||||||| || |||||||| || ||||| |||||
Sbjct: 1057 gaaatatcagggcgtttagctgaaatgccagcagatagtggttatcctgcctattt 1112



to top

>gb|U04849.1|EHU04849 Entamoeba histolytica HM-1-IMSS putative vacuolar proton-transporting
            ATPase catalytic  subunit gene, complete cds
          Length = 1966

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 73/89 (82%)
 Strand = Plus / Plus

                                                                        
Query: 13   atgggctataatgttagtatgatggctgattccacgtccaggtgggccgaagcattgcgt 72
            ||||| |||||||||  ||||||||| ||||| || || || ||||| |||||| |  | 
Sbjct: 1074 atgggatataatgttgctatgatggcagattcaacatcaagatgggctgaagcacttaga 1133

                                         
Query: 73   gaaatttcaggacgtttggctgaaatgcc 101
            ||||||||||||||| | || ||||||||
Sbjct: 1134 gaaatttcaggacgtcttgcagaaatgcc 1162



to top

>gb|BC072086.1| Xenopus laevis cDNA clone IMAGE:4406247, containing frame-shift
            errors
          Length = 2793

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 95/119 (79%)
 Strand = Plus / Plus

                                                                        
Query: 4    ttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggccgaa 63
            ||||| |||||||||||  | || ||||||||||| |||||||| ||  | ||||| || 
Sbjct: 1153 ttccgagacatgggctaccacgtcagtatgatggccgattccacatctcgatgggcagag 1212

                                                                       
Query: 64   gcattgcgtgaaatttcaggacgtttggctgaaatgcctgcggatagtggntaccctgc 122
            ||  | || ||||| ||||| ||| ||||||||||||| || || ||||| || |||||
Sbjct: 1213 gctctccgagaaatctcagggcgtctggctgaaatgcccgctgacagtggttatcctgc 1271



to top

>ref|XM_545103.2| PREDICTED: Canis familiaris similar to ATPase, H+ transporting,
            lysosomal 70kD, V1 subunit A, isoform 1, transcript
            variant 1 (LOC487981), mRNA
          Length = 1868

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 95/119 (79%)
 Strand = Plus / Plus

                                                                        
Query: 4    ttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggccgaa 63
            |||||||||||||| ||| | || |||||||||||||| || || || || ||||| || 
Sbjct: 1019 ttccgtgacatgggttatcacgtcagtatgatggctgactctacctctagatgggcagag 1078

                                                                       
Query: 64   gcattgcgtgaaatttcaggacgtttggctgaaatgcctgcggatagtggntaccctgc 122
            ||  |  | ||||| || || || || |||||||||||||| |||||||| || |||||
Sbjct: 1079 gcccttagagaaatctctggtcgcttagctgaaatgcctgcagatagtggatatcctgc 1137



to top

>ref|XM_850941.1| PREDICTED: Canis familiaris similar to ATPase, H+ transporting,
            lysosomal 70kD, V1 subunit A, isoform 1, transcript
            variant 3 (LOC487981), mRNA
          Length = 1795

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 95/119 (79%)
 Strand = Plus / Plus

                                                                        
Query: 4    ttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggccgaa 63
            |||||||||||||| ||| | || |||||||||||||| || || || || ||||| || 
Sbjct: 1018 ttccgtgacatgggttatcacgtcagtatgatggctgactctacctctagatgggcagag 1077

                                                                       
Query: 64   gcattgcgtgaaatttcaggacgtttggctgaaatgcctgcggatagtggntaccctgc 122
            ||  |  | ||||| || || || || |||||||||||||| |||||||| || |||||
Sbjct: 1078 gcccttagagaaatctctggtcgcttagctgaaatgcctgcagatagtggatatcctgc 1136



to top

>ref|XM_850903.1| PREDICTED: Canis familiaris similar to ATPase, H+ transporting,
            lysosomal 70kD, V1 subunit A, isoform 1, transcript
            variant 2 (LOC487981), mRNA
          Length = 1870

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 95/119 (79%)
 Strand = Plus / Plus

                                                                        
Query: 4    ttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggccgaa 63
            |||||||||||||| ||| | || |||||||||||||| || || || || ||||| || 
Sbjct: 1021 ttccgtgacatgggttatcacgtcagtatgatggctgactctacctctagatgggcagag 1080

                                                                       
Query: 64   gcattgcgtgaaatttcaggacgtttggctgaaatgcctgcggatagtggntaccctgc 122
            ||  |  | ||||| || || || || |||||||||||||| |||||||| || |||||
Sbjct: 1081 gcccttagagaaatctctggtcgcttagctgaaatgcctgcagatagtggatatcctgc 1139



to top

>gb|BC098963.1| Xenopus laevis cDNA clone MGC:114675 IMAGE:5516350, complete cds
          Length = 4567

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 95/119 (79%)
 Strand = Plus / Plus

                                                                        
Query: 4    ttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggccgaa 63
            ||||| |||||||||||  | || ||||||||||| |||||||| ||  | ||||| || 
Sbjct: 1179 ttccgagacatgggctaccacgtcagtatgatggcagattccacatctcgatgggcagag 1238

                                                                       
Query: 64   gcattgcgtgaaatttcaggacgtttggctgaaatgcctgcggatagtggntaccctgc 122
            ||  | || ||||| ||||| ||| ||||||||||||| || || ||||| || |||||
Sbjct: 1239 gctctccgagaaatctcagggcgtctggctgaaatgcccgctgacagtggttatcctgc 1297



to top

>ref|XM_623528.1| PREDICTED: Apis mellifera similar to Vacuolar ATP synthase catalytic
            subunit A, osteoclast isoform (V-ATPase A subunit 2)
            (Vacuolar proton pump alpha subunit 2) (V-ATPase 69 kDa
            subunit 2) (Isoform HO68) (LOC551093), mRNA
          Length = 2590

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 75/92 (81%)
 Strand = Plus / Plus

                                                                        
Query: 13   atgggctataatgttagtatgatggctgattccacgtccaggtgggccgaagcattgcgt 72
            ||||| ||||||||   ||||||||| ||||| || ||  | ||||| |||||| | |||
Sbjct: 1468 atgggttataatgtatctatgatggccgattcaacatctcgttgggcagaagcacttcgt 1527

                                            
Query: 73   gaaatttcaggacgtttggctgaaatgcctgc 104
            |||||||| || || || ||||||||||||||
Sbjct: 1528 gaaatttctggtcgattagctgaaatgcctgc 1559



to top

>ref|XM_623492.1| PREDICTED: Apis mellifera similar to Vacuolar ATP synthase catalytic
            subunit A, osteoclast isoform (V-ATPase A subunit 2)
            (Vacuolar proton pump alpha subunit 2) (V-ATPase 69 kDa
            subunit 2) (Isoform HO68) (LOC551093), mRNA
          Length = 2256

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 75/92 (81%)
 Strand = Plus / Plus

                                                                        
Query: 13   atgggctataatgttagtatgatggctgattccacgtccaggtgggccgaagcattgcgt 72
            ||||| ||||||||   ||||||||| ||||| || ||  | ||||| |||||| | |||
Sbjct: 1134 atgggttataatgtatctatgatggccgattcaacatctcgttgggcagaagcacttcgt 1193

                                            
Query: 73   gaaatttcaggacgtttggctgaaatgcctgc 104
            |||||||| || || || ||||||||||||||
Sbjct: 1194 gaaatttctggtcgattagctgaaatgcctgc 1225



to top

>gb|U13837.1|MMU13837 Mus musculus vacuolar adenosine triphosphatase subunit A gene,
            complete cds
          Length = 3007

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 95/119 (79%)
 Strand = Plus / Plus

                                                                        
Query: 4    ttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggccgaa 63
            |||||||||||||||||  | || ||||||||||| || || || || || ||||| || 
Sbjct: 1027 ttccgtgacatgggctaccacgtcagtatgatggccgactctacctctagatgggctgag 1086

                                                                       
Query: 64   gcattgcgtgaaatttcaggacgtttggctgaaatgcctgcggatagtggntaccctgc 122
            ||  |  | ||||| || || ||||| ||||| |||||||| |||||||| ||||||||
Sbjct: 1087 gccctcagagaaatctctggtcgtttagctgagatgcctgcagatagtggataccctgc 1145



to top

>emb|CR764097.1| Paramecium tetraurelia, complete gene
          Length = 2409

 Score = 46.1 bits (23), Expect = 0.037
 Identities = 62/75 (82%)
 Strand = Plus / Plus

                                                                        
Query: 30   tatgatggctgattccacgtccaggtgggccgaagcattgcgtgaaatttcaggacgttt 89
            ||||||||||||||| || ||||| ||||| ||||| ||| | ||||| || ||  | ||
Sbjct: 1316 tatgatggctgattctacttccagatgggcagaagccttgagagaaatctctggtagatt 1375

                           
Query: 90   ggctgaaatgcctgc 104
            ||| |||||||||||
Sbjct: 1376 ggcagaaatgcctgc 1390



to top

>emb|CR764096.1| Paramecium tetraurelia, complete gene
          Length = 2410

 Score = 46.1 bits (23), Expect = 0.037
 Identities = 62/75 (82%)
 Strand = Plus / Plus

                                                                        
Query: 30   tatgatggctgattccacgtccaggtgggccgaagcattgcgtgaaatttcaggacgttt 89
            ||||||||||||||| || ||||| ||||| ||||| ||| | ||||| || ||  | ||
Sbjct: 1317 tatgatggctgattctacttccagatgggcagaagccttgagagaaatctctggtagatt 1376

                           
Query: 90   ggctgaaatgcctgc 104
            ||| |||||||||||
Sbjct: 1377 ggcagaaatgcctgc 1391



to top

>dbj|D50529.1| Acetabularia acetabulum clone pVA6 V type adenosine triphosphatase A
            subunit mRNA, complete cds
          Length = 2084

 Score = 46.1 bits (23), Expect = 0.037
 Identities = 62/75 (82%)
 Strand = Plus / Plus

                                                                        
Query: 30   tatgatggctgattccacgtccaggtgggccgaagcattgcgtgaaatttcaggacgttt 89
            |||||||||||| ||||| ||  | ||||| || || ||| | |||||||| ||||||||
Sbjct: 1053 tatgatggctgactccacttctcgatgggctgaggctttgagagaaatttctggacgttt 1112

                           
Query: 90   ggctgaaatgcctgc 104
            ||| || ||||||||
Sbjct: 1113 ggcagagatgcctgc 1127



to top

>gb|AE009951.2| Fusobacterium nucleatum subsp. nucleatum ATCC 25586, complete genome
          Length = 2174500

 Score = 46.1 bits (23), Expect = 0.037
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                             
Query: 55     tgggccgaagcattgcgtgaaatttcaggacgtttggctgaaatgcc 101
              ||||| |||||| | |||||||| |||||||||||||  ||||||||
Sbjct: 235114 tgggcagaagcacttcgtgaaatgtcaggacgtttggaagaaatgcc 235068



to top

>dbj|AB093507.1| Saccharomyces castellii VMA1 gene for vacuolar membrane ATPase
            subunit a precursor, partial cds, strain:IFO1992
          Length = 3303

 Score = 46.1 bits (23), Expect = 0.037
 Identities = 62/75 (82%)
 Strand = Plus / Plus

                                                                        
Query: 30   tatgatggctgattccacgtccaggtgggccgaagcattgcgtgaaatttcaggacgttt 89
            |||||| ||||||||  | || || ||||| ||||||||  | ||||||||||| |||||
Sbjct: 2553 tatgattgctgattcatcttcaagatgggctgaagcattaagagaaatttcaggtcgttt 2612

                           
Query: 90   ggctgaaatgcctgc 104
             | ||||||||||||
Sbjct: 2613 aggtgaaatgcctgc 2627



to top

>emb|AL845359.15| Zebrafish DNA sequence from clone CH211-11M22 in linkage group 20,
              complete sequence
          Length = 175932

 Score = 46.1 bits (23), Expect = 0.037
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 19     tataatgttagtatgatggctga 41
              |||||||||||||||||||||||
Sbjct: 134117 tataatgttagtatgatggctga 134139



to top

>gb|CP000067.1| Trypanosoma brucei chromosome 4, complete sequence
          Length = 1590432

 Score = 44.1 bits (22), Expect = 0.15
 Identities = 61/74 (82%)
 Strand = Plus / Minus

                                                                          
Query: 31     atgatggctgattccacgtccaggtgggccgaagcattgcgtgaaatttcaggacgtttg 90
              |||||||| ||||| || ||| | ||||| || || |||||||| ||||| || ||| | 
Sbjct: 288947 atgatggccgattcaacctcccgctgggctgaggctttgcgtgagatttccggtcgtctt 288888

                            
Query: 91     gctgaaatgcctgc 104
              ||||||||||||||
Sbjct: 288887 gctgaaatgcctgc 288874



to top

>gb|AC103580.4| Trypanosoma brucei chromosome 4 clone RPCI93-5E12, complete sequence
          Length = 174832

 Score = 44.1 bits (22), Expect = 0.15
 Identities = 61/74 (82%)
 Strand = Plus / Plus

                                                                         
Query: 31    atgatggctgattccacgtccaggtgggccgaagcattgcgtgaaatttcaggacgtttg 90
             |||||||| ||||| || ||| | ||||| || || |||||||| ||||| || ||| | 
Sbjct: 42948 atgatggccgattcaacctcccgctgggctgaggctttgcgtgagatttccggtcgtctt 43007

                           
Query: 91    gctgaaatgcctgc 104
             ||||||||||||||
Sbjct: 43008 gctgaaatgcctgc 43021



to top

>ref|XM_455325.1| Kluyveromyces lactis NRRL Y-1140, KLLA0F05401g predicted mRNA
          Length = 3084

 Score = 44.1 bits (22), Expect = 0.15
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                              
Query: 55   tgggccgaagcattgcgtgaaatttcaggacgtttggctgaaatgcctgc 104
            ||||| ||||| ||| | ||||||||||| ||||| | ||||||||||||
Sbjct: 2311 tgggctgaagctttgagagaaatttcaggtcgtttaggtgaaatgcctgc 2360



to top

>ref|XM_821703.1| Trypanosoma brucei TREU927 clone RPCI93-5E12 V-type ATPase subunit A
            (Tb927.4.1080) partial mRNA
          Length = 1833

 Score = 44.1 bits (22), Expect = 0.15
 Identities = 61/74 (82%)
 Strand = Plus / Plus

                                                                        
Query: 31   atgatggctgattccacgtccaggtgggccgaagcattgcgtgaaatttcaggacgtttg 90
            |||||||| ||||| || ||| | ||||| || || |||||||| ||||| || ||| | 
Sbjct: 1021 atgatggccgattcaacctcccgctgggctgaggctttgcgtgagatttccggtcgtctt 1080

                          
Query: 91   gctgaaatgcctgc 104
            ||||||||||||||
Sbjct: 1081 gctgaaatgcctgc 1094



to top

>emb|X64233.1|MSATPRNA M.sexta mRNA for vacuolar ATPase subunit A
          Length = 2860

 Score = 44.1 bits (22), Expect = 0.15
 Identities = 99/125 (79%)
 Strand = Plus / Plus

                                                                        
Query: 1    tacttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggcc 60
            ||||||||||||||||| || |||||    ||||||||||| || || ||| | ||||||
Sbjct: 1058 tacttccgtgacatgggttacaatgtgtccatgatggctgactcgacctcccgttgggcc 1117

                                                                        
Query: 61   gaagcattgcgtgaaatttcaggacgtttggctgaaatgcctgcggatagtggntaccct 120
            || ||  | ||||| || ||||| ||| | ||||| |||||||| |||   || ||||||
Sbjct: 1118 gaggctcttcgtgagatctcaggtcgtctagctgagatgcctgccgattccggttaccct 1177

                 
Query: 121  gcgta 125
            |||||
Sbjct: 1178 gcgta 1182



to top

>emb|CR382126.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome F of strain NRRL
              Y-1140 of Kluyveromyces lactis
          Length = 2602197

 Score = 44.1 bits (22), Expect = 0.15
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                                
Query: 55     tgggccgaagcattgcgtgaaatttcaggacgtttggctgaaatgcctgc 104
              ||||| ||||| ||| | ||||||||||| ||||| | ||||||||||||
Sbjct: 531582 tgggctgaagctttgagagaaatttcaggtcgtttaggtgaaatgcctgc 531631



to top

>ref|NM_165022.1| Drosophila melanogaster Vha68-2 CG3762-RC, transcript variant C
            (Vha68-2), mRNA
          Length = 2533

 Score = 44.1 bits (22), Expect = 0.15
 Identities = 61/74 (82%)
 Strand = Plus / Plus

                                                                        
Query: 31   atgatggctgattccacgtccaggtgggccgaagcattgcgtgaaatttcaggacgtttg 90
            ||||||||||||||||| ||| | ||||| || ||  | ||||||||||| || ||| | 
Sbjct: 1175 atgatggctgattccacctcccgttgggctgaggctcttcgtgaaatttctggtcgtctc 1234

                          
Query: 91   gctgaaatgcctgc 104
            ||||| ||||||||
Sbjct: 1235 gctgagatgcctgc 1248



to top

>ref|NM_165021.1| Drosophila melanogaster Vha68-2 CG3762-RB, transcript variant B
            (Vha68-2), mRNA
          Length = 2445

 Score = 44.1 bits (22), Expect = 0.15
 Identities = 61/74 (82%)
 Strand = Plus / Plus

                                                                        
Query: 31   atgatggctgattccacgtccaggtgggccgaagcattgcgtgaaatttcaggacgtttg 90
            ||||||||||||||||| ||| | ||||| || ||  | ||||||||||| || ||| | 
Sbjct: 1087 atgatggctgattccacctcccgttgggctgaggctcttcgtgaaatttctggtcgtctc 1146

                          
Query: 91   gctgaaatgcctgc 104
            ||||| ||||||||
Sbjct: 1147 gctgagatgcctgc 1160



to top

>ref|NM_143747.2| Drosophila melanogaster Vha68-2 CG3762-RA, transcript variant A
            (Vha68-2), mRNA
          Length = 2536

 Score = 44.1 bits (22), Expect = 0.15
 Identities = 61/74 (82%)
 Strand = Plus / Plus

                                                                        
Query: 31   atgatggctgattccacgtccaggtgggccgaagcattgcgtgaaatttcaggacgtttg 90
            ||||||||||||||||| ||| | ||||| || ||  | ||||||||||| || ||| | 
Sbjct: 1172 atgatggctgattccacctcccgttgggctgaggctcttcgtgaaatttctggtcgtctc 1231

                          
Query: 91   gctgaaatgcctgc 104
            ||||| ||||||||
Sbjct: 1232 gctgagatgcctgc 1245



to top

>gb|AY084150.1| Drosophila melanogaster RE30552 full insert cDNA
          Length = 2544

 Score = 44.1 bits (22), Expect = 0.15
 Identities = 61/74 (82%)
 Strand = Plus / Plus

                                                                        
Query: 31   atgatggctgattccacgtccaggtgggccgaagcattgcgtgaaatttcaggacgtttg 90
            ||||||||||||||||| ||| | ||||| || ||  | ||||||||||| || ||| | 
Sbjct: 1172 atgatggctgattccacctcccgttgggctgaggctcttcgtgaaatttctggtcgtctc 1231

                          
Query: 91   gctgaaatgcctgc 104
            ||||| ||||||||
Sbjct: 1232 gctgagatgcctgc 1245



to top

>gb|AC009352.5| Drosophila melanogaster, chromosome 2L, region 34A-34A, BAC clone
              BACR11M13, complete sequence
          Length = 190301

 Score = 44.1 bits (22), Expect = 0.15
 Identities = 61/74 (82%)
 Strand = Plus / Plus

                                                                          
Query: 31     atgatggctgattccacgtccaggtgggccgaagcattgcgtgaaatttcaggacgtttg 90
              ||||||||||||||||| ||| | ||||| || ||  | ||||||||||| || ||| | 
Sbjct: 167276 atgatggctgattccacctcccgttgggctgaggctcttcgtgaaatttctggtcgtctc 167335

                            
Query: 91     gctgaaatgcctgc 104
              ||||| ||||||||
Sbjct: 167336 gctgagatgcctgc 167349



to top

>dbj|AB093513.1| Saccharomyces pastorianus VMA1 gene for vacuolar membrane ATPase
            subunit a precursor, partial cds, strain:IFO11023
          Length = 3140

 Score = 44.1 bits (22), Expect = 0.15
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                              
Query: 55   tgggccgaagcattgcgtgaaatttcaggacgtttggctgaaatgcctgc 104
            ||||| ||||| ||| | |||||||| || ||||||| ||||||||||||
Sbjct: 2402 tgggctgaagctttgagagaaatttctggtcgtttgggtgaaatgcctgc 2451



to top

>dbj|AB093506.1| Kluyveromyces lactis VMA1 gene for vacuolar membrane ATPase subunit a
            precursor, partial cds, strain:IFO1267
          Length = 2935

 Score = 44.1 bits (22), Expect = 0.15
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                              
Query: 55   tgggccgaagcattgcgtgaaatttcaggacgtttggctgaaatgcctgc 104
            ||||| ||||| ||| | ||||||||||| ||||| | ||||||||||||
Sbjct: 2290 tgggctgaagctttgagagaaatttcaggtcgtttaggtgaaatgcctgc 2339



to top

>dbj|AB093504.1| Saccharomyces cerevisiae VMA1 gene for vacuolar membrane ATPase
            subunit a, partial cds, strain:NKY278(1)
          Length = 1776

 Score = 44.1 bits (22), Expect = 0.15
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                              
Query: 55   tgggccgaagcattgcgtgaaatttcaggacgtttggctgaaatgcctgc 104
            ||||| ||||| ||| | |||||||| || ||||||| ||||||||||||
Sbjct: 1043 tgggctgaagctttgagagaaatttctggtcgtttgggtgaaatgcctgc 1092



to top

>dbj|AB093502.1| Saccharomyces cerevisiae VMA1 gene for vacuolar membrane ATPase
            subunit a precursor, partial cds, strain:OUT7903
          Length = 3067

 Score = 44.1 bits (22), Expect = 0.15
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                              
Query: 55   tgggccgaagcattgcgtgaaatttcaggacgtttggctgaaatgcctgc 104
            ||||| ||||| ||| | |||||||| || ||||||| ||||||||||||
Sbjct: 2368 tgggctgaagctttgagagaaatttctggtcgtttgggtgaaatgcctgc 2417



to top

>dbj|AB093501.1| Saccharomyces cerevisiae VMA1 gene for vacuolar membrane ATPase
            subunit a precursor, partial cds, strain:OUT7900
          Length = 3067

 Score = 44.1 bits (22), Expect = 0.15
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                              
Query: 55   tgggccgaagcattgcgtgaaatttcaggacgtttggctgaaatgcctgc 104
            ||||| ||||| ||| | |||||||| || ||||||| ||||||||||||
Sbjct: 2368 tgggctgaagctttgagagaaatttctggtcgtttgggtgaaatgcctgc 2417



to top

>dbj|AB093500.1| Saccharomyces cerevisiae VMA1 gene for vacuolar membrane ATPase
            subunit a precursor, partial cds, strain:OUT7112
          Length = 3067

 Score = 44.1 bits (22), Expect = 0.15
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                              
Query: 55   tgggccgaagcattgcgtgaaatttcaggacgtttggctgaaatgcctgc 104
            ||||| ||||| ||| | |||||||| || ||||||| ||||||||||||
Sbjct: 2368 tgggctgaagctttgagagaaatttctggtcgtttgggtgaaatgcctgc 2417



to top

>dbj|AB093499.1| Saccharomyces cerevisiae VMA1 gene for vacuolar membrane ATPase
            subunit a precursor, partial cds, strain:OUT7091
          Length = 3067

 Score = 44.1 bits (22), Expect = 0.15
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                              
Query: 55   tgggccgaagcattgcgtgaaatttcaggacgtttggctgaaatgcctgc 104
            ||||| ||||| ||| | |||||||| || ||||||| ||||||||||||
Sbjct: 2368 tgggctgaagctttgagagaaatttctggtcgtttgggtgaaatgcctgc 2417



to top

>dbj|AB093498.1| Saccharomyces cerevisiae VMA1 gene for vacuolar membrane ATPase
            subunit a precursor, partial cds, strain:OUT7064
          Length = 3067

 Score = 44.1 bits (22), Expect = 0.15
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                              
Query: 55   tgggccgaagcattgcgtgaaatttcaggacgtttggctgaaatgcctgc 104
            ||||| ||||| ||| | |||||||| || ||||||| ||||||||||||
Sbjct: 2368 tgggctgaagctttgagagaaatttctggtcgtttgggtgaaatgcctgc 2417



to top

>dbj|AB093497.1| Saccharomyces cerevisiae VMA1 gene for vacuolar membrane ATPase
            subunit a precursor, partial cds, strain:OUT7045
          Length = 3067

 Score = 44.1 bits (22), Expect = 0.15
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                              
Query: 55   tgggccgaagcattgcgtgaaatttcaggacgtttggctgaaatgcctgc 104
            ||||| ||||| ||| | |||||||| || ||||||| ||||||||||||
Sbjct: 2368 tgggctgaagctttgagagaaatttctggtcgtttgggtgaaatgcctgc 2417



to top

>dbj|AB093496.1| Saccharomyces cerevisiae VMA1 gene for vacuolar membrane ATPase
            subunit a precursor, partial cds, strain:OUT7043
          Length = 3067

 Score = 44.1 bits (22), Expect = 0.15
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                              
Query: 55   tgggccgaagcattgcgtgaaatttcaggacgtttggctgaaatgcctgc 104
            ||||| ||||| ||| | |||||||| || ||||||| ||||||||||||
Sbjct: 2368 tgggctgaagctttgagagaaatttctggtcgtttgggtgaaatgcctgc 2417



to top

>gb|L09234.1|HUMATPAVAC Human vacuolar ATPase (isoform HO68) mRNA, complete cds
          Length = 3118

 Score = 44.1 bits (22), Expect = 0.15
 Identities = 61/74 (82%)
 Strand = Plus / Plus

                                                                        
Query: 31   atgatggctgattccacgtccaggtgggccgaagcattgcgtgaaatttcaggacgtttg 90
            ||||||||||| || || ||  | |||||||||||  | || ||||| ||||| || |||
Sbjct: 1089 atgatggctgactcaacttcacgatgggccgaagctcttcgagaaatctcaggtcgattg 1148

                          
Query: 91   gctgaaatgcctgc 104
            ||||||||||||||
Sbjct: 1149 gctgaaatgcctgc 1162



to top

>ref|XM_688134.1| PREDICTED: Danio rerio similar to ATPase, H+ transporting,
           lysosomal 70kDa, V1 subunit A (LOC564804), mRNA
          Length = 1880

 Score = 42.1 bits (21), Expect = 0.58
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 10  gacatgggctataatgttagtatgatggctgattccacgtc 50
           ||||||||||| ||||| || ||||||||||| || |||||
Sbjct: 493 gacatgggctacaatgtgagcatgatggctgactctacgtc 533



to top

>gb|AE010299.1| Methanosarcina acetivorans str. C2A, complete genome
          Length = 5751492

 Score = 42.1 bits (21), Expect = 0.58
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                           
Query: 1       tacttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggcc 60
               ||||||||||||||||| ||||| ||     ||||||| || ||||| ||||||||||| 
Sbjct: 5075274 tacttccgtgacatggggtataacgtctccctgatggcagactccacctccaggtgggca 5075333

                    
Query: 61      gaagc 65
               |||||
Sbjct: 5075334 gaagc 5075338



to top

>emb|BX323052.5| Zebrafish DNA sequence from clone CH211-234A12 in linkage group 24,
            complete sequence
          Length = 173982

 Score = 42.1 bits (21), Expect = 0.58
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                     
Query: 10   gacatgggctataatgttagtatgatggctgattccacgtc 50
            ||||||||||| ||||| || ||||||||||| || |||||
Sbjct: 3469 gacatgggctacaatgtgagcatgatggctgactctacgtc 3509



to top

>gb|AE008384.1| Methanosarcina mazei strain Goe1, complete genome
          Length = 4096345

 Score = 42.1 bits (21), Expect = 0.58
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 1      tacttccgtgacatgggctat 21
              |||||||||||||||||||||
Sbjct: 933818 tacttccgtgacatgggctat 933798



to top

>gb|U47274.1|MMU47274 Methanosarcina mazeii A1AO H+ ATPase, subunits H-G (ahaH-ahaG) genes
            and hydrogenase assembly (hypF) gene, complete cds
          Length = 11995

 Score = 42.1 bits (21), Expect = 0.58
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 1    tacttccgtgacatgggctat 21
            |||||||||||||||||||||
Sbjct: 6831 tacttccgtgacatgggctat 6851



to top

>dbj|D17462.1|ENENTP Enterococcus hirae ntp genes for Na+ -ATPase subunits, complete cds
          Length = 11288

 Score = 42.1 bits (21), Expect = 0.58
 Identities = 63/77 (81%)
 Strand = Plus / Plus

                                                                        
Query: 1    tacttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggcc 60
            ||||||||||||||||| ||| ||||    || ||||| |||||||| ||  | ||||| 
Sbjct: 6208 tacttccgtgacatggggtatgatgtagcaatcatggcagattccacttctcgttgggca 6267

                             
Query: 61   gaagcattgcgtgaaat 77
            |||||| ||||||||||
Sbjct: 6268 gaagcactgcgtgaaat 6284



to top

>dbj|D13816.1|ENENAABS E. hirae DNA for Na+ -ATPase alpha and beta subunits, complete cds
          Length = 3226

 Score = 42.1 bits (21), Expect = 0.58
 Identities = 63/77 (81%)
 Strand = Plus / Plus

                                                                        
Query: 1    tacttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggcc 60
            ||||||||||||||||| ||| ||||    || ||||| |||||||| ||  | ||||| 
Sbjct: 1003 tacttccgtgacatggggtatgatgtagcaatcatggcagattccacttctcgttgggca 1062

                             
Query: 61   gaagcattgcgtgaaat 77
            |||||| ||||||||||
Sbjct: 1063 gaagcactgcgtgaaat 1079



to top

>gb|BC079948.1| Xenopus tropicalis MGC79685 protein, mRNA (cDNA clone MGC:79685
            IMAGE:6980744), complete cds
          Length = 4190

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 94/119 (78%)
 Strand = Plus / Plus

                                                                        
Query: 4    ttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggccgaa 63
            ||||| |||||||||||  | || || |||||||| |||||||| ||  | ||||| || 
Sbjct: 1148 ttccgagacatgggctaccacgtcagcatgatggcagattccacatcacgatgggcagag 1207

                                                                       
Query: 64   gcattgcgtgaaatttcaggacgtttggctgaaatgcctgcggatagtggntaccctgc 122
            ||  | || ||||| ||||| ||| |||| ||||||||||| || ||||| || |||||
Sbjct: 1208 gctctccgagaaatctcagggcgtctggccgaaatgcctgctgacagtggttatcctgc 1266



to top

>emb|X62338.1|SSHATP S.scrofa mRNA for H+ ATPase
          Length = 2098

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                
Query: 4    ttccgtgacatgggctataatgttagtatgatggct 39
            |||||||||||||||||  | || ||||||||||||
Sbjct: 1045 ttccgtgacatgggctaccacgtcagtatgatggct 1080



to top

>dbj|AK140873.1| Mus musculus 16 days embryo head cDNA, RIKEN full-length enriched
            library, clone:C130053N23 product:ATPase, H+
            transporting, V1 subunit A, isoform 1, full insert
            sequence
          Length = 3094

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 94/119 (78%)
 Strand = Plus / Plus

                                                                        
Query: 4    ttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggccgaa 63
            |||||||||||||||||  | || ||||||||||| || || || || || ||||| || 
Sbjct: 1057 ttccgtgacatgggctaccacgtcagtatgatggccgactctacctctagatgggctgag 1116

                                                                       
Query: 64   gcattgcgtgaaatttcaggacgtttggctgaaatgcctgcggatagtggntaccctgc 122
            ||  |  | ||||| || || || || ||||| |||||||| |||||||| ||||||||
Sbjct: 1117 gccctcagagaaatctctggtcgcttagctgagatgcctgcagatagtggataccctgc 1175



to top

>dbj|AK150742.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched
            library, clone:I830014L17 product:ATPase, H+
            transporting, V1 subunit A, isoform 1, full insert
            sequence
          Length = 3926

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 94/119 (78%)
 Strand = Plus / Plus

                                                                        
Query: 4    ttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggccgaa 63
            |||||||||||||||||  | || ||||||||||| || || || || || ||||| || 
Sbjct: 1067 ttccgtgacatgggctaccacgtcagtatgatggccgactctacctctagatgggctgag 1126

                                                                       
Query: 64   gcattgcgtgaaatttcaggacgtttggctgaaatgcctgcggatagtggntaccctgc 122
            ||  |  | ||||| || || || || ||||| |||||||| |||||||| ||||||||
Sbjct: 1127 gccctcagagaaatctctggtcgcttagctgagatgcctgcagatagtggataccctgc 1185



to top

>dbj|AK149833.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched
            library, clone:G530021N06 product:ATPase, H+
            transporting, V1 subunit A, isoform 1, full insert
            sequence
          Length = 1702

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 94/119 (78%)
 Strand = Plus / Plus

                                                                        
Query: 4    ttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggccgaa 63
            |||||||||||||||||  | || ||||||||||| || || || || || ||||| || 
Sbjct: 1096 ttccgtgacatgggctaccacgtcagtatgatggccgactctacctctagatgggctgag 1155

                                                                       
Query: 64   gcattgcgtgaaatttcaggacgtttggctgaaatgcctgcggatagtggntaccctgc 122
            ||  |  | ||||| || || || || ||||| |||||||| |||||||| ||||||||
Sbjct: 1156 gccctcagagaaatctctggtcgcttagctgagatgcctgcagatagtggataccctgc 1214



to top

>dbj|AK154869.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN
            full-length enriched library, clone:F630110C09
            product:ATPase, H+ transporting, V1 subunit A, isoform 1,
            full insert sequence
          Length = 3947

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 94/119 (78%)
 Strand = Plus / Plus

                                                                        
Query: 4    ttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggccgaa 63
            |||||||||||||||||  | || ||||||||||| || || || || || ||||| || 
Sbjct: 1082 ttccgtgacatgggctaccacgtcagtatgatggccgactctacctctagatgggctgag 1141

                                                                       
Query: 64   gcattgcgtgaaatttcaggacgtttggctgaaatgcctgcggatagtggntaccctgc 122
            ||  |  | ||||| || || || || ||||| |||||||| |||||||| ||||||||
Sbjct: 1142 gccctcagagaaatctctggtcgcttagctgagatgcctgcagatagtggataccctgc 1200



to top

>dbj|AK153403.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched
            library, clone:I830155J08 product:ATPase, H+
            transporting, V1 subunit A, isoform 1, full insert
            sequence
          Length = 2636

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 94/119 (78%)
 Strand = Plus / Plus

                                                                        
Query: 4    ttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggccgaa 63
            |||||||||||||||||  | || ||||||||||| || || || || || ||||| || 
Sbjct: 1082 ttccgtgacatgggctaccacgtcagtatgatggccgactctacctctagatgggctgag 1141

                                                                       
Query: 64   gcattgcgtgaaatttcaggacgtttggctgaaatgcctgcggatagtggntaccctgc 122
            ||  |  | ||||| || || || || ||||| |||||||| |||||||| ||||||||
Sbjct: 1142 gccctcagagaaatctctggtcgcttagctgagatgcctgcagatagtggataccctgc 1200



to top

>dbj|AK160792.1| Mus musculus 14, 17 days embryo head cDNA, RIKEN full-length enriched
            library, clone:3221404K17 product:ATPase, H+
            transporting, V1 subunit A, isoform 1, full insert
            sequence
          Length = 3720

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 94/119 (78%)
 Strand = Plus / Plus

                                                                        
Query: 4    ttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggccgaa 63
            |||||||||||||||||  | || ||||||||||| || || || || || ||||| || 
Sbjct: 1096 ttccgtgacatgggctaccacgtcagtatgatggccgactctacctctagatgggctgag 1155

                                                                       
Query: 64   gcattgcgtgaaatttcaggacgtttggctgaaatgcctgcggatagtggntaccctgc 122
            ||  |  | ||||| || || || || ||||| |||||||| |||||||| ||||||||
Sbjct: 1156 gccctcagagaaatctctggtcgcttagctgagatgcctgcagatagtggataccctgc 1214



to top

>dbj|AK170721.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN
            full-length enriched library, clone:F630116E13
            product:ATPase, H+ transporting, V1 subunit A, isoform 1,
            full insert sequence
          Length = 2556

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 94/119 (78%)
 Strand = Plus / Plus

                                                                        
Query: 4    ttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggccgaa 63
            |||||||||||||||||  | || ||||||||||| || || || || || ||||| || 
Sbjct: 1082 ttccgtgacatgggctaccacgtcagtatgatggccgactctacctctagatgggctgag 1141

                                                                       
Query: 64   gcattgcgtgaaatttcaggacgtttggctgaaatgcctgcggatagtggntaccctgc 122
            ||  |  | ||||| || || || || ||||| |||||||| |||||||| ||||||||
Sbjct: 1142 gccctcagagaaatctctggtcgcttagctgagatgcctgcagatagtggataccctgc 1200



to top

>dbj|AK166857.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched
            library, clone:I1C0017M12 product:ATPase, H+
            transporting, V1 subunit A, isoform 1, full insert
            sequence
          Length = 3047

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 94/119 (78%)
 Strand = Plus / Plus

                                                                        
Query: 4    ttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggccgaa 63
            |||||||||||||||||  | || ||||||||||| || || || || || ||||| || 
Sbjct: 1071 ttccgtgacatgggctaccacgtcagtatgatggccgactctacctctagatgggctgag 1130

                                                                       
Query: 64   gcattgcgtgaaatttcaggacgtttggctgaaatgcctgcggatagtggntaccctgc 122
            ||  |  | ||||| || || || || ||||| |||||||| |||||||| ||||||||
Sbjct: 1131 gccctcagagaaatctctggtcgcttagctgagatgcctgcagatagtggataccctgc 1189



to top

>emb|BX321896.13| Zebrafish DNA sequence from clone RP71-49B22 in linkage group 23,
              complete sequence
          Length = 165985

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 24     tgttagtatgatggctgatt 43
              ||||||||||||||||||||
Sbjct: 143541 tgttagtatgatggctgatt 143560



to top

>gb|BC038392.1| Mus musculus ATPase, H+ transporting, lysosomal V1 subunit A, mRNA
            (cDNA clone MGC:6531 IMAGE:2651677), complete cds
          Length = 2548

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 94/119 (78%)
 Strand = Plus / Plus

                                                                        
Query: 4    ttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggccgaa 63
            |||||||||||||||||  | || ||||||||||| || || || || || ||||| || 
Sbjct: 1059 ttccgtgacatgggctaccacgtcagtatgatggcggactctacctctagatgggctgag 1118

                                                                       
Query: 64   gcattgcgtgaaatttcaggacgtttggctgaaatgcctgcggatagtggntaccctgc 122
            ||  |  | ||||| || || || || ||||| |||||||| |||||||| ||||||||
Sbjct: 1119 gccctcagagaaatctctggtcgcttagctgagatgcctgcagatagtggataccctgc 1177



to top

>gb|AF017149.2| Hendra virus, complete genome
          Length = 18234

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 27   tagtatgatggctgattcca 46
            ||||||||||||||||||||
Sbjct: 8909 tagtatgatggctgattcca 8928



to top

>ref|NM_001007511.1| Xenopus tropicalis MGC79685 protein (MGC79685), mRNA
          Length = 4190

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 94/119 (78%)
 Strand = Plus / Plus

                                                                        
Query: 4    ttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggccgaa 63
            ||||| |||||||||||  | || || |||||||| |||||||| ||  | ||||| || 
Sbjct: 1148 ttccgagacatgggctaccacgtcagcatgatggcagattccacatcacgatgggcagag 1207

                                                                       
Query: 64   gcattgcgtgaaatttcaggacgtttggctgaaatgcctgcggatagtggntaccctgc 122
            ||  | || ||||| ||||| ||| |||| ||||||||||| || ||||| || |||||
Sbjct: 1208 gctctccgagaaatctcagggcgtctggccgaaatgcctgctgacagtggttatcctgc 1266



to top

>ref|NM_001004042.1| Sus scrofa H+ ATPase (ATP6V1A1), mRNA
          Length = 2098

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                
Query: 4    ttccgtgacatgggctataatgttagtatgatggct 39
            |||||||||||||||||  | || ||||||||||||
Sbjct: 1045 ttccgtgacatgggctaccacgtcagtatgatggct 1080



to top

>ref|NM_007508.2| Mus musculus ATPase, H+ transporting, lysosomal V1 subunit A
            (Atp6v1a), mRNA
          Length = 2548

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 94/119 (78%)
 Strand = Plus / Plus

                                                                        
Query: 4    ttccgtgacatgggctataatgttagtatgatggctgattccacgtccaggtgggccgaa 63
            |||||||||||||||||  | || ||||||||||| || || || || || ||||| || 
Sbjct: 1059 ttccgtgacatgggctaccacgtcagtatgatggcggactctacctctagatgggctgag 1118

                                                                       
Query: 64   gcattgcgtgaaatttcaggacgtttggctgaaatgcctgcggatagtggntaccctgc 122
            ||  |  | ||||| || || || || ||||| |||||||| |||||||| ||||||||
Sbjct: 1119 gccctcagagaaatctctggtcgcttagctgagatgcctgcagatagtggataccctgc 1177



to top

>dbj|AB093514.1| Saccharomyces pastorianus VMA1 gene for vacuolar membrane ATPase
            subunit a precursor, partial cds, strain:IFO11023
          Length = 1782

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 73   gaaatttcaggacgtttggctgaaatgcctgc 104
            |||||||| || ||||||| ||||||||||||
Sbjct: 1071 gaaatttctggtcgtttgggtgaaatgcctgc 1102



to top

>dbj|AB093512.1| Saccharomyces pastorianus VMA1 gene for vacuolar membrane ATPase
            subunit a, partial cds, strain:IFO11024
          Length = 1771

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 73   gaaatttcaggacgtttggctgaaatgcctgc 104
            |||||||| || ||||||| ||||||||||||
Sbjct: 1061 gaaatttctggtcgtttgggtgaaatgcctgc 1092



to top

>gb|U59147.1|DMU59147 Drosophila melanogaster Oregon R vacuolar ATPase subunit A (vha68-2)
            gene, complete cds
          Length = 4405

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 59/72 (81%)
 Strand = Plus / Plus

                                                                        
Query: 31   atgatggctgattccacgtccaggtgggccgaagcattgcgtgaaatttcaggacgtttg 90
            ||||||||||||||||| ||| | ||||| || ||  | ||||||||||| || ||| | 
Sbjct: 2827 atgatggctgattccacctcccgttgggctgaggctcttcgtgaaatttctggtcgtctc 2886

                        
Query: 91   gctgaaatgcct 102
            ||||| ||||||
Sbjct: 2887 gctgagatgcct 2898



to top

>gb|U59146.1|DMU59146 Drosophila melanogaster Canton S vacuolar ATPase subunit A (vha68-2)
            mRNA, complete cds
          Length = 2474

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 59/72 (81%)
 Strand = Plus / Plus

                                                                        
Query: 31   atgatggctgattccacgtccaggtgggccgaagcattgcgtgaaatttcaggacgtttg 90
            ||||||||||||||||| ||| | ||||| || ||  | ||||||||||| || ||| | 
Sbjct: 1114 atgatggctgattccacctcccgttgggctgaggctcttcgtgaaatttctggtcgtctc 1173

                        
Query: 91   gctgaaatgcct 102
            ||||| ||||||
Sbjct: 1174 gctgagatgcct 1185



to top

>emb|Z25814.1|TCVACATPA T.congolense mRNA for vacuolar ATPase (catalytic (A) subunit)
          Length = 2313

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 31/35 (88%)
 Strand = Plus / Plus

                                               
Query: 91   gctgaaatgcctgcggatagtggntaccctgcgta 125
            ||||||||||| || ||| |||| |||||||||||
Sbjct: 1274 gctgaaatgcccgctgatggtggttaccctgcgta 1308



to top

>ref|XM_322437.1| Neurospora crassa OR74A hypothetical protein (NCU00352.1) partial
           mRNA
          Length = 4083

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 83  gacgtttggctgaaatgcc 101
           |||||||||||||||||||
Sbjct: 332 gacgtttggctgaaatgcc 314



to top

>ref|XM_952730.1| Neurospora crassa OR74A hypothetical protein (NCU00352.1) partial
           mRNA
          Length = 4083

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 83  gacgtttggctgaaatgcc 101
           |||||||||||||||||||
Sbjct: 332 gacgtttggctgaaatgcc 314



to top

>gb|AE017261.1| Picrophilus torridus DSM 9790, complete genome
          Length = 1545895

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                         
Query: 51     caggtgggccgaagcattgcgtgaaat 77
              |||||||||||| ||| ||||||||||
Sbjct: 519551 caggtgggccgaggcactgcgtgaaat 519525



to top

>gb|AC125098.4| Mus musculus BAC clone RP24-195M13 from chromosome 16, complete sequence
          Length = 182685

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 31/35 (88%)
 Strand = Plus / Plus

                                                 
Query: 4      ttccgtgacatgggctataatgttagtatgatggc 38
              |||||||||||||||||  | || |||||||||||
Sbjct: 110427 ttccgtgacatgggctaccacgtcagtatgatggc 110461



to top

>ref|NM_204974.1| Gallus gallus ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A
            (ATP6V1A), mRNA
          Length = 3986

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 31/35 (88%)
 Strand = Plus / Plus

                                               
Query: 4    ttccgtgacatgggctataatgttagtatgatggc 38
            ||||| |||||||||||  |||| |||||||||||
Sbjct: 1009 ttccgagacatgggctaccatgtcagtatgatggc 1043



to top

>emb|BX005087.5| Zebrafish DNA sequence from clone CH211-91A7 in linkage group 10,
             complete sequence
          Length = 88649

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 19    tataatgttagtatgatggctga 41
             ||||||||||||||| |||||||
Sbjct: 53474 tataatgttagtatggtggctga 53452



to top

>gb|U22077.1|GGU22077 Gallus gallus A1 isoform of vacuolar H+-ATPase subunit A mRNA,
            complete cds
          Length = 3139

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 31/35 (88%)
 Strand = Plus / Plus

                                               
Query: 4    ttccgtgacatgggctataatgttagtatgatggc 38
            ||||| |||||||||||  |||| |||||||||||
Sbjct: 1119 ttccgagacatgggctaccatgtcagtatgatggc 1153



to top

>gb|U22076.1|GGU22076 Gallus gallus A2 isoform of vacuolar H+-ATPase subunit A mRNA,
            complete cds
          Length = 3986

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 31/35 (88%)
 Strand = Plus / Plus

                                               
Query: 4    ttccgtgacatgggctataatgttagtatgatggc 38
            ||||| |||||||||||  |||| |||||||||||
Sbjct: 1009 ttccgagacatgggctaccatgtcagtatgatggc 1043


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 756,121
Number of Sequences: 3902068
Number of extensions: 756121
Number of successful extensions: 42027
Number of sequences better than 10.0: 171
Number of HSP's better than 10.0 without gapping: 168
Number of HSP's successfully gapped in prelim test: 3
Number of HSP's that attempted gapping in prelim test: 41693
Number of HSP's gapped (non-prelim): 322
length of query: 184
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 162
effective length of database: 17,147,199,772
effective search space: 2777846363064
effective search space used: 2777846363064
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top