ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags4b15
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|U43498.1|HVU43498 Hordeum vulgare 0-methyltransferase mRNA, p... 204 3e-50
2gb|U54767.1|HVU54767 Hordeum vulgare caffeic acid O-methyltransf... 204 3e-50
3dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 58 5e-06
4emb|AL845348.4|CNS08CBA Oryza sativa chromosome 12, . BAC OSJNBb... 58 5e-06
5gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 58 5e-06
6emb|BX664711.2|CNS09SC1 Oryza sativa chromosome 12, . BAC B1001E... 58 5e-06
7emb|AL713947.3|CNS07YPQ Oryza sativa chromosome 12, . BAC OJ1003... 46 0.019
8emb|AL646053.1| Ralstonia solanacearum GMI1000 megaplasmid compl... 44 0.074
9gb|AY041136.1| Metopus palaeformis clone 4 alpha-tubulin gene, p... 42 0.29
10gb|AY041135.1| Metopus palaeformis clone 3 alpha-tubulin gene, p... 42 0.29
11gb|AY041134.1| Metopus palaeformis clone 2 alpha-tubulin gene, p... 42 0.29
12gb|AY041133.1| Metopus palaeformis clone 1 alpha-tubulin gene, p... 42 0.29
13gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome 42 0.29
14gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, comp... 40 1.2
15gb|AC150386.2| Branchiostoma floridae clone CH302-103G16, comple... 40 1.2
16gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, com... 40 1.2
17emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromos... 40 1.2
18gb|AE006470.1| Chlorobium tepidum TLS, complete genome 40 1.2
19gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, com... 40 1.2
20ref|XM_477999.1| Oryza sativa (japonica cultivar-group), mRNA 38 4.6
21gb|AY390287.1| Paracentrotus lividus alpha2 tubulin (Talpha2) ps... 38 4.6
22gb|AY388463.1| Paracentrotus lividus neural alfa2 tubulin (Talfa... 38 4.6
23gb|AY388462.1| Paracentrotus lividus neural alfa2 tubulin (Talfa... 38 4.6
24gb|CP000058.1| Pseudomonas syringae pv. phaseolicola 1448A, comp... 38 4.6
25gb|AC163198.7| Mus musculus 6 BAC RP23-174M4 (Roswell Park Cance... 38 4.6
26ref|XM_787427.1| PREDICTED: Strongylocentrotus purpuratus simila... 38 4.6
27ref|XM_775900.1| PREDICTED: Strongylocentrotus purpuratus simila... 38 4.6
28emb|CR555306.1| Azoarcus sp. EbN1 complete genome 38 4.6
29dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete ... 38 4.6
30gb|S80438.1| Pl alpha 2=alpha-tubulin isotype 2 [Paracentrotus l... 38 4.6
31dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 38 4.6
32emb|AL928693.9| Mouse DNA sequence from clone RP23-407K8 on chro... 38 4.6
33dbj|AP003916.2| Oryza sativa (japonica cultivar-group) genomic D... 38 4.6
34gb|AF043935.1|AF043935 Chlorarachnion CCMP621 beta-tubulin-5 (bt... 38 4.6
35gb|AE014295.3| Bifidobacterium longum NCC2705, complete genome 38 4.6
36dbj|AB032757.1| Mus musculus gad65 gene for glutamate decarboxyl... 38 4.6

>gb|U43498.1|HVU43498 Hordeum vulgare 0-methyltransferase mRNA, partial cds
          Length = 983

 Score =  204 bits (103), Expect = 3e-50
 Identities = 103/103 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   ctgtgatcctggtcaccaagatgctcgagcgcttcaagggattcgatggtgtgcagcggc 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 283 ctgtgatcctggtcaccaagatgctcgagcgcttcaagggattcgatggtgtgcagcggc 342

                                                      
Query: 61  ttgtggacgtcggtggtggcaccggctccaccctagggatgat 103
           |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 343 ttgtggacgtcggtggtggcaccggctccaccctagggatgat 385



to top

>gb|U54767.1|HVU54767 Hordeum vulgare caffeic acid O-methyltransferase (HvCOMT) gene,
            complete cds
          Length = 5238

 Score =  204 bits (103), Expect = 3e-50
 Identities = 103/103 (100%)
 Strand = Plus / Plus

                                                                        
Query: 1    ctgtgatcctggtcaccaagatgctcgagcgcttcaagggattcgatggtgtgcagcggc 60
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3470 ctgtgatcctggtcaccaagatgctcgagcgcttcaagggattcgatggtgtgcagcggc 3529

                                                       
Query: 61   ttgtggacgtcggtggtggcaccggctccaccctagggatgat 103
            |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3530 ttgtggacgtcggtggtggcaccggctccaccctagggatgat 3572



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
               sequence
          Length = 27566993

 Score = 58.0 bits (29), Expect = 5e-06
 Identities = 83/101 (82%)
 Strand = Plus / Plus

                                                                           
Query: 3       gtgatcctggtcaccaagatgctcgagcgcttcaagggattcgatggtgtgcagcggctt 62
               ||||| ||||||| |||||||||||| |||||| | |||||||| || || |||| ||| 
Sbjct: 5364177 gtgattctggtcagcaagatgctcgaacgcttccaaggattcgacggcgtccagcagctc 5364236

                                                        
Query: 63      gtggacgtcggtggtggcaccggctccaccctagggatgat 103
               || || |||||||| ||   ||| |||||||| ||||||||
Sbjct: 5364237 gtcgatgtcggtgggggtgacggatccaccctggggatgat 5364277



 Score = 46.1 bits (23), Expect = 0.019
 Identities = 71/87 (81%)
 Strand = Plus / Plus

                                                                           
Query: 17      caagatgctcgagcgcttcaagggattcgatggtgtgcagcggcttgtggacgtcggtgg 76
               |||||||||||| |||||| | || ||||||||  | |||||||| || || | ||||||
Sbjct: 5172019 caagatgctcgaacgcttcgaaggtttcgatggcatccagcggctcgtcgatgccggtgg 5172078

                                          
Query: 77      tggcaccggctccaccctagggatgat 103
                |||  ||| |||||||| ||||||||
Sbjct: 5172079 aggcgacggatccaccctggggatgat 5172105



to top

>emb|AL845348.4|CNS08CBA Oryza sativa chromosome 12, . BAC OSJNBb0070A23 of library OSJNBb from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 105645

 Score = 58.0 bits (29), Expect = 5e-06
 Identities = 83/101 (82%)
 Strand = Plus / Plus

                                                                         
Query: 3     gtgatcctggtcaccaagatgctcgagcgcttcaagggattcgatggtgtgcagcggctt 62
             ||||| ||||||| |||||||||||| |||||| | |||||||| || || |||| ||| 
Sbjct: 36244 gtgattctggtcagcaagatgctcgaacgcttccaaggattcgacggcgtccagcagctc 36303

                                                      
Query: 63    gtggacgtcggtggtggcaccggctccaccctagggatgat 103
             || || |||||||| ||   ||| |||||||| ||||||||
Sbjct: 36304 gtcgatgtcggtgggggtgacggatccaccctggggatgat 36344



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 58.0 bits (29), Expect = 5e-06
 Identities = 83/101 (82%)
 Strand = Plus / Plus

                                                                           
Query: 3       gtgatcctggtcaccaagatgctcgagcgcttcaagggattcgatggtgtgcagcggctt 62
               ||||| ||||||| |||||||||||| |||||| | |||||||| || || |||| ||| 
Sbjct: 5364166 gtgattctggtcagcaagatgctcgaacgcttccaaggattcgacggcgtccagcagctc 5364225

                                                        
Query: 63      gtggacgtcggtggtggcaccggctccaccctagggatgat 103
               || || |||||||| ||   ||| |||||||| ||||||||
Sbjct: 5364226 gtcgatgtcggtgggggtgacggatccaccctggggatgat 5364266



 Score = 46.1 bits (23), Expect = 0.019
 Identities = 71/87 (81%)
 Strand = Plus / Plus

                                                                           
Query: 17      caagatgctcgagcgcttcaagggattcgatggtgtgcagcggcttgtggacgtcggtgg 76
               |||||||||||| |||||| | || ||||||||  | |||||||| || || | ||||||
Sbjct: 5172001 caagatgctcgaacgcttcgaaggtttcgatggcatccagcggctcgtcgatgccggtgg 5172060

                                          
Query: 77      tggcaccggctccaccctagggatgat 103
                |||  ||| |||||||| ||||||||
Sbjct: 5172061 aggcgacggatccaccctggggatgat 5172087



to top

>emb|BX664711.2|CNS09SC1 Oryza sativa chromosome 12, . BAC B1001E08 of chromosome 12 of cultivar
              Nipponbare of ssp. japonica of Oryza sativa (rice),
              complete sequence
          Length = 141841

 Score = 58.0 bits (29), Expect = 5e-06
 Identities = 83/101 (82%)
 Strand = Plus / Minus

                                                                          
Query: 3      gtgatcctggtcaccaagatgctcgagcgcttcaagggattcgatggtgtgcagcggctt 62
              ||||| ||||||| |||||||||||| |||||| | |||||||| || || |||| ||| 
Sbjct: 101631 gtgattctggtcagcaagatgctcgaacgcttccaaggattcgacggcgtccagcagctc 101572

                                                       
Query: 63     gtggacgtcggtggtggcaccggctccaccctagggatgat 103
              || || |||||||| ||   ||| |||||||| ||||||||
Sbjct: 101571 gtcgatgtcggtgggggtgacggatccaccctggggatgat 101531



to top

>emb|AL713947.3|CNS07YPQ Oryza sativa chromosome 12, . BAC OJ1003_A04 of library Monsanto from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 124959

 Score = 46.1 bits (23), Expect = 0.019
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                         
Query: 17    caagatgctcgagcgcttcaagggattcgatggtgtgcagcggcttgtggacgtcggtgg 76
             |||||||||||| |||||| | || ||||||||  | |||||||| || || | ||||||
Sbjct: 91580 caagatgctcgaacgcttcgaaggtttcgatggcatccagcggctcgtcgatgccggtgg 91521

                                        
Query: 77    tggcaccggctccaccctagggatgat 103
              |||  ||| |||||||| ||||||||
Sbjct: 91520 aggcgacggatccaccctggggatgat 91494



to top

>emb|AL646053.1| Ralstonia solanacearum GMI1000 megaplasmid complete sequence
          Length = 2094509

 Score = 44.1 bits (22), Expect = 0.074
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 48      ggtgtgcagcggcttgtggacg 69
               ||||||||||||||||||||||
Sbjct: 1987779 ggtgtgcagcggcttgtggacg 1987800



to top

>gb|AY041136.1| Metopus palaeformis clone 4 alpha-tubulin gene, partial cds
          Length = 1095

 Score = 42.1 bits (21), Expect = 0.29
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 68  cgtcggtggtggcaccggctc 88
           |||||||||||||||||||||
Sbjct: 306 cgtcggtggtggcaccggctc 326



to top

>gb|AY041135.1| Metopus palaeformis clone 3 alpha-tubulin gene, partial cds
          Length = 1095

 Score = 42.1 bits (21), Expect = 0.29
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 68  cgtcggtggtggcaccggctc 88
           |||||||||||||||||||||
Sbjct: 306 cgtcggtggtggcaccggctc 326



to top

>gb|AY041134.1| Metopus palaeformis clone 2 alpha-tubulin gene, partial cds
          Length = 1094

 Score = 42.1 bits (21), Expect = 0.29
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 68  cgtcggtggtggcaccggctc 88
           |||||||||||||||||||||
Sbjct: 306 cgtcggtggtggcaccggctc 326



to top

>gb|AY041133.1| Metopus palaeformis clone 1 alpha-tubulin gene, partial cds
          Length = 1082

 Score = 42.1 bits (21), Expect = 0.29
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 68  cgtcggtggtggcaccggctc 88
           |||||||||||||||||||||
Sbjct: 293 cgtcggtggtggcaccggctc 313



to top

>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 42.1 bits (21), Expect = 0.29
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 60      cttgtggacgtcggtggtggc 80
               |||||||||||||||||||||
Sbjct: 4165837 cttgtggacgtcggtggtggc 4165857



to top

>gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, complete sequence
          Length = 3510148

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 21     atgctcgagcgcttcaaggg 40
              ||||||||||||||||||||
Sbjct: 406734 atgctcgagcgcttcaaggg 406715



to top

>gb|AC150386.2| Branchiostoma floridae clone CH302-103G16, complete sequence
          Length = 195926

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 70     tcggtggtggcaccggctcc 89
              ||||||||||||||||||||
Sbjct: 156233 tcggtggtggcaccggctcc 156214



to top

>gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, complete sequence
          Length = 4126292

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 21      atgctcgagcgcttcaaggg 40
               ||||||||||||||||||||
Sbjct: 3254218 atgctcgagcgcttcaaggg 3254199



to top

>emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromosome 1, complete sequence
          Length = 4074542

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 21      atgctcgagcgcttcaaggg 40
               ||||||||||||||||||||
Sbjct: 2984090 atgctcgagcgcttcaaggg 2984071



to top

>gb|AE006470.1| Chlorobium tepidum TLS, complete genome
          Length = 2154946

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 29     gcgcttcaagggattcgatg 48
              ||||||||||||||||||||
Sbjct: 833378 gcgcttcaagggattcgatg 833397



to top

>gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, complete sequence
          Length = 3809201

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 21      atgctcgagcgcttcaaggg 40
               ||||||||||||||||||||
Sbjct: 1888832 atgctcgagcgcttcaaggg 1888851



to top

>ref|XM_477999.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1083

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 60  cttgtggacgtcggtggtggcaccggc 86
           |||||||||||||  ||||||||||||
Sbjct: 586 cttgtggacgtcgcaggtggcaccggc 612



to top

>gb|AY390287.1| Paracentrotus lividus alpha2 tubulin (Talpha2) pseudogene, exon 3
          Length = 1274

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 70  tcggtggtggcaccggctc 88
           |||||||||||||||||||
Sbjct: 230 tcggtggtggcaccggctc 248



to top

>gb|AY388463.1| Paracentrotus lividus neural alfa2 tubulin (Talfa2) gene, exons 1
            through 3 and complete cds
          Length = 3422

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 70   tcggtggtggcaccggctc 88
            |||||||||||||||||||
Sbjct: 2375 tcggtggtggcaccggctc 2393



to top

>gb|AY388462.1| Paracentrotus lividus neural alfa2 tubulin (Talfa2) mRNA, complete
           cds
          Length = 1556

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 70  tcggtggtggcaccggctc 88
           |||||||||||||||||||
Sbjct: 492 tcggtggtggcaccggctc 510



to top

>gb|CP000058.1| Pseudomonas syringae pv. phaseolicola 1448A, complete genome
          Length = 5928787

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 22      tgctcgagcgcttcaaggg 40
               |||||||||||||||||||
Sbjct: 4354031 tgctcgagcgcttcaaggg 4354049



to top

>gb|AC163198.7| Mus musculus 6 BAC RP23-174M4 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 188300

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 45    gatggtgtgcagcggcttg 63
             |||||||||||||||||||
Sbjct: 93858 gatggtgtgcagcggcttg 93876



to top

>ref|XM_787427.1| PREDICTED: Strongylocentrotus purpuratus similar to Tubulin alpha-1
           chain (LOC587716), partial mRNA
          Length = 1437

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 70  tcggtggtggcaccggctc 88
           |||||||||||||||||||
Sbjct: 662 tcggtggtggcaccggctc 680



to top

>ref|XM_775900.1| PREDICTED: Strongylocentrotus purpuratus similar to tubulin, alpha
           1 (LOC575503), mRNA
          Length = 1545

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 70  tcggtggtggcaccggctc 88
           |||||||||||||||||||
Sbjct: 662 tcggtggtggcaccggctc 680



to top

>emb|CR555306.1| Azoarcus sp. EbN1 complete genome
          Length = 4296230

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 13     tcaccaagatgctcgagcgcttc 35
              |||||||| ||||||||||||||
Sbjct: 336648 tcaccaaggtgctcgagcgcttc 336626



to top

>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome
          Length = 4967148

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 3       gtgatcctggtcaccaaga 21
               |||||||||||||||||||
Sbjct: 4841172 gtgatcctggtcaccaaga 4841154



to top

>gb|S80438.1| Pl alpha 2=alpha-tubulin isotype 2 [Paracentrotus lividus=sea
          urchins, blastulas, mRNA Partial, 1131 nt]
          Length = 1131

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                             
Query: 70 tcggtggtggcaccggctc 88
          |||||||||||||||||||
Sbjct: 59 tcggtggtggcaccggctc 77



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                           
Query: 60       cttgtggacgtcggtggtggcaccggc 86
                |||||||||||||  ||||||||||||
Sbjct: 16264672 cttgtggacgtcgcaggtggcaccggc 16264646



to top

>emb|AL928693.9| Mouse DNA sequence from clone RP23-407K8 on chromosome 2, complete
              sequence
          Length = 206478

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 3      gtgatcctggtcaccaaga 21
              |||||||||||||||||||
Sbjct: 137128 gtgatcctggtcaccaaga 137110



to top

>dbj|AP003916.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1634_H04
          Length = 151699

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                        
Query: 60    cttgtggacgtcggtggtggcaccggc 86
             |||||||||||||  ||||||||||||
Sbjct: 85110 cttgtggacgtcgcaggtggcaccggc 85084



to top

>gb|AF043935.1|AF043935 Chlorarachnion CCMP621 beta-tubulin-5 (btub-5) gene, partial cds
          Length = 1889

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 70  tcggtggtggcaccggctc 88
           |||||||||||||||||||
Sbjct: 795 tcggtggtggcaccggctc 813



to top

>gb|AE014295.3| Bifidobacterium longum NCC2705, complete genome
          Length = 2256640

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 44     cgatggtgtgcagcggctt 62
              |||||||||||||||||||
Sbjct: 910536 cgatggtgtgcagcggctt 910554



to top

>dbj|AB032757.1| Mus musculus gad65 gene for glutamate decarboxylase 65, partial cds
          Length = 4113

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 3    gtgatcctggtcaccaaga 21
            |||||||||||||||||||
Sbjct: 2457 gtgatcctggtcaccaaga 2475


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 546,517
Number of Sequences: 3902068
Number of extensions: 546517
Number of successful extensions: 35482
Number of sequences better than 10.0: 36
Number of HSP's better than 10.0 without gapping: 36
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 34900
Number of HSP's gapped (non-prelim): 582
length of query: 103
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 82
effective length of database: 17,151,101,840
effective search space: 1406390350880
effective search space used: 1406390350880
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top