>emb|CR716596.2|CNS0GFVH Tetraodon nigroviridis full-length cDNA
          Length = 1193

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 87  tggccgtgatgacacacttgccctcactg 115
           |||| ||||||||||||||||||||||||
Sbjct: 540 tggctgtgatgacacacttgccctcactg 568

>emb|CR705172.2|CNS0G728 Tetraodon nigroviridis full-length cDNA
          Length = 1193

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 87  tggccgtgatgacacacttgccctcactg 115
           |||| ||||||||||||||||||||||||
Sbjct: 540 tggctgtgatgacacacttgccctcactg 568

>emb|CR668944.2|CNS0FF4M Tetraodon nigroviridis full-length cDNA
          Length = 706

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 87  tggccgtgatgacacacttgccctcactg 115
           |||| ||||||||||||||||||||||||
Sbjct: 325 tggctgtgatgacacacttgccctcactg 353

>emb|CR655863.2|CNS0F519 Tetraodon nigroviridis full-length cDNA
          Length = 564

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 87  tggccgtgatgacacacttgccctcactg 115
           |||| ||||||||||||||||||||||||
Sbjct: 313 tggctgtgatgacacacttgccctcactg 341

>emb|CR647753.2|CNS0EYRZ Tetraodon nigroviridis full-length cDNA
          Length = 564

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 87  tggccgtgatgacacacttgccctcactg 115
           |||| ||||||||||||||||||||||||
Sbjct: 313 tggctgtgatgacacacttgccctcactg 341

>dbj|AK135917.1| Mus musculus in vitro fertilized eggs cDNA, RIKEN full-length
           enriched library, clone:7420437H22
           product:unclassifiable, full insert sequence
          Length = 1399

 Score = 46.1 bits (23), Expect = 0.044
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 85  tctggccgtgatgacacacttgccctcactg 115
           |||||| |||||||| |||||||||||||||
Sbjct: 474 tctggcggtgatgacccacttgccctcactg 444

>emb|AL627104.16| Mouse DNA sequence from clone RP23-412B2 on chromosome 4, complete
             sequence
          Length = 193363

 Score = 46.1 bits (23), Expect = 0.044
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                            
Query: 85    tctggccgtgatgacacacttgccctcactg 115
             |||||| |||||||| |||||||||||||||
Sbjct: 25023 tctggcggtgatgacccacttgccctcactg 25053



 Score = 46.1 bits (23), Expect = 0.044
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                            
Query: 85    tctggccgtgatgacacacttgccctcactg 115
             |||||| |||||||| |||||||||||||||
Sbjct: 15613 tctggcggtgatgacccacttgccctcactg 15643

>gb|AC122931.4| Mus musculus BAC clone RP23-15C15 from 9, complete sequence
          Length = 192274

 Score = 42.1 bits (21), Expect = 0.69
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 38    ctgttaatattgaggtaatacatgt 62
             |||| ||||||||||||||||||||
Sbjct: 17211 ctgtgaatattgaggtaatacatgt 17187

>emb|CR674738.2|CNS0FJLK Tetraodon nigroviridis full-length cDNA
          Length = 731

 Score = 42.1 bits (21), Expect = 0.69
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 87  tggccgtgatgacacacttgccctcactg 115
           |||| ||||| ||||||||||||||||||
Sbjct: 249 tggctgtgataacacacttgccctcactg 277

>gb|AC153011.4| Mus musculus BAC clone RP23-316O20 from chromosome 9, complete sequence
          Length = 190332

 Score = 42.1 bits (21), Expect = 0.69
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 38     ctgttaatattgaggtaatacatgt 62
              |||| ||||||||||||||||||||
Sbjct: 104279 ctgtgaatattgaggtaatacatgt 104255

>ref|XM_723080.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY07333)
           partial mRNA
          Length = 1140

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 30  atttgaaactgttaatattg 49
           ||||||||||||||||||||
Sbjct: 195 atttgaaactgttaatattg 176

>emb|AL121900.26|HSBA379J5 Human DNA sequence from clone RP11-379J5 on chromosome 20 Contains the
             3' end of the SEC23B gene for Sec23 (S. cerevisiae)
             homolog B, two novel genes, the 5' end of the HARS2 gene
             for histidyl-tRNA synthetase 2, a pseudogene similar to
             part of homeobox proteins and two CpG islands, complete
             sequence
          Length = 149933

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 44    atattgaggtaatacatgtt 63
             ||||||||||||||||||||
Sbjct: 70362 atattgaggtaatacatgtt 70381

>emb|AL121949.13|HSDJ407E4 Human DNA sequence from clone RP3-407E4 on chromosome 6q12-13, complete
             sequence
          Length = 140287

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 181   atctattgttatgtaataaa 200
             ||||||||||||||||||||
Sbjct: 88522 atctattgttatgtaataaa 88503

>dbj|AK074304.1| Homo sapiens cDNA FLJ23724 fis, clone HEP13989
          Length = 2396

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 44   atattgaggtaatacatgtt 63
            ||||||||||||||||||||
Sbjct: 1074 atattgaggtaatacatgtt 1093


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,706,379
Number of Sequences: 3902068
Number of extensions: 1706379
Number of successful extensions: 110975
Number of sequences better than 10.0: 14
Number of HSP's better than 10.0 without gapping: 14
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 110953
Number of HSP's gapped (non-prelim): 22
length of query: 215
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 193
effective length of database: 17,147,199,772
effective search space: 3309409555996
effective search space used: 3309409555996
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)