>gb|AE015928.1| Bacteroides thetaiotaomicron VPI-5482, complete genome
          Length = 6260361

 Score = 38.2 bits (19), Expect = 0.62
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 1     aaagccttgagatgcatgg 19
             |||||||||||||||||||
Sbjct: 66562 aaagccttgagatgcatgg 66580

>gb|AC009460.4|AC009460 Drosophila melanogaster, chromosome 2R, region 60B-60C, BAC clone
              BACR04P18, complete sequence
          Length = 159455

 Score = 38.2 bits (19), Expect = 0.62
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 10     agatgcatggctgggacca 28
              |||||||||||||||||||
Sbjct: 109037 agatgcatggctgggacca 109055

>emb|X82148.1|TAVDAC3 T.aestivum VDAC3 mRNA for voltage dependent anion channel
          Length = 1208

 Score = 38.2 bits (19), Expect = 0.62
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 1   aaagccttgagatgcatggctgggacc 27
           ||||||||||||||||  |||||||||
Sbjct: 897 aaagccttgagatgcacagctgggacc 923

>gb|AE003463.2| Drosophila melanogaster chromosome 2R, section 70 of 73 of the complete
              sequence
          Length = 298827

 Score = 38.2 bits (19), Expect = 0.62
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 10     agatgcatggctgggacca 28
              |||||||||||||||||||
Sbjct: 208438 agatgcatggctgggacca 208456

>gb|AC124202.3| Mus musculus BAC clone RP23-337F21 from chromosome 14, complete
             sequence
          Length = 189556

 Score = 36.2 bits (18), Expect = 2.4
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 11    gatgcatggctgggacca 28
             ||||||||||||||||||
Sbjct: 93180 gatgcatggctgggacca 93163

>emb|AL645910.8| Mouse DNA sequence from clone RP23-173M6 on chromosome 11 Contains the 5'
              end of a novel gene, the Mtmr3 gene for myotubularin
              related protein 3 and a glyceraldehyde-3-phosphate
              dehydrogenase (Gapd) pseudogene, complete sequence
          Length = 204413

 Score = 36.2 bits (18), Expect = 2.4
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 2      aagccttgagatgcatgg 19
              ||||||||||||||||||
Sbjct: 105793 aagccttgagatgcatgg 105776

>gb|CP000112.1| Desulfovibrio desulfuricans G20, complete genome
          Length = 3730232

 Score = 34.2 bits (17), Expect = 9.6
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                                
Query: 3       agccttgagatgcatgg 19
               |||||||||||||||||
Sbjct: 2594299 agccttgagatgcatgg 2594283

>gb|AC138300.8| Mus musculus chromosome 14, clone RP23-187B20, complete sequence
          Length = 213955

 Score = 34.2 bits (17), Expect = 9.6
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                               
Query: 6      cttgagatgcatggctg 22
              |||||||||||||||||
Sbjct: 172983 cttgagatgcatggctg 172999

>ref|NM_011511.1| Mus musculus ATP-binding cassette, sub-family C (CFTR/MRP), member 9
            (Abcc9), transcript variant 1, mRNA
          Length = 6034

 Score = 34.2 bits (17), Expect = 9.6
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                             
Query: 9    gagatgcatggctggga 25
            |||||||||||||||||
Sbjct: 5832 gagatgcatggctggga 5816

>ref|NM_021041.1| Mus musculus ATP-binding cassette, sub-family C (CFTR/MRP), member 9
            (Abcc9), transcript variant 2, mRNA
          Length = 6210

 Score = 34.2 bits (17), Expect = 9.6
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                             
Query: 9    gagatgcatggctggga 25
            |||||||||||||||||
Sbjct: 6008 gagatgcatggctggga 5992

>gb|AC124421.4| Mus musculus BAC clone RP24-323H7 from chromosome 10, complete sequence
          Length = 187081

 Score = 34.2 bits (17), Expect = 9.6
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                               
Query: 3      agccttgagatgcatgg 19
              |||||||||||||||||
Sbjct: 135939 agccttgagatgcatgg 135923

>gb|AC124369.4| Mus musculus BAC clone RP24-549O12 from chromosome 7, complete sequence
          Length = 147686

 Score = 34.2 bits (17), Expect = 9.6
 Identities = 20/21 (95%)
 Strand = Plus / Plus

                                  
Query: 2     aagccttgagatgcatggctg 22
             ||||||||| |||||||||||
Sbjct: 81970 aagccttgatatgcatggctg 81990

>gb|AC121611.3| Mus musculus BAC clone RP23-330I2 from chromosome 6, complete sequence
          Length = 197889

 Score = 34.2 bits (17), Expect = 9.6
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                              
Query: 9     gagatgcatggctggga 25
             |||||||||||||||||
Sbjct: 34077 gagatgcatggctggga 34093

>gb|AC098615.2| Homo sapiens chromosome 3 clone RP11-268I20, complete sequence
          Length = 167486

 Score = 34.2 bits (17), Expect = 9.6
 Identities = 23/25 (92%)
 Strand = Plus / Minus

                                       
Query: 7      ttgagatgcatggctgggaccaatg 31
              |||| ||||||||||| ||||||||
Sbjct: 153783 ttgatatgcatggctgtgaccaatg 153759

>dbj|AK036423.1| Mus musculus adult male bone cDNA, RIKEN full-length enriched
           library, clone:9830106A05 product:ATP-binding cassette,
           sub-family C (CFTR/MRP), member 9, full insert sequence
          Length = 2122

 Score = 34.2 bits (17), Expect = 9.6
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                            
Query: 9   gagatgcatggctggga 25
           |||||||||||||||||
Sbjct: 732 gagatgcatggctggga 716

>gb|AE016817.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome IV,
              complete sequence
          Length = 1466886

 Score = 34.2 bits (17), Expect = 9.6
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                               
Query: 6      cttgagatgcatggctg 22
              |||||||||||||||||
Sbjct: 922377 cttgagatgcatggctg 922361

>dbj|AK052291.1| Mus musculus 13 days embryo heart cDNA, RIKEN full-length enriched
            library, clone:D330021O06 product:ATP-binding cassette,
            sub-family C (CFTR/MRP), member 9, full insert sequence
          Length = 3935

 Score = 34.2 bits (17), Expect = 9.6
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                             
Query: 9    gagatgcatggctggga 25
            |||||||||||||||||
Sbjct: 2470 gagatgcatggctggga 2454

>dbj|AK048665.1| Mus musculus 16 days embryo head cDNA, RIKEN full-length enriched
            library, clone:C130098D15 product:ATP-binding cassette,
            sub-family C (CFTR/MRP), member 9, full insert sequence
          Length = 3487

 Score = 34.2 bits (17), Expect = 9.6
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                             
Query: 9    gagatgcatggctggga 25
            |||||||||||||||||
Sbjct: 2014 gagatgcatggctggga 1998

>gb|AC158134.8| Mus musculus chromosome 3, clone RP24-384O20, complete sequence
          Length = 209278

 Score = 34.2 bits (17), Expect = 9.6
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                              
Query: 7     ttgagatgcatggctgg 23
             |||||||||||||||||
Sbjct: 29026 ttgagatgcatggctgg 29042

>dbj|AP000051.1| Homo sapiens genomic DNA, chromosome 21q22.1, segment 22/28, complete
             sequence
          Length = 100000

 Score = 34.2 bits (17), Expect = 9.6
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                              
Query: 2     aagccttgagatgcatg 18
             |||||||||||||||||
Sbjct: 83352 aagccttgagatgcatg 83336

>dbj|BS000188.1| Pan troglodytes chromosome 22 clone:RP43-084B17, map 22, complete
             sequences
          Length = 170687

 Score = 34.2 bits (17), Expect = 9.6
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                              
Query: 2     aagccttgagatgcatg 18
             |||||||||||||||||
Sbjct: 65588 aagccttgagatgcatg 65572

>gb|AC102012.7| Mus musculus chromosome 3, clone RP24-542B2, complete sequence
          Length = 155366

 Score = 34.2 bits (17), Expect = 9.6
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                               
Query: 7      ttgagatgcatggctgg 23
              |||||||||||||||||
Sbjct: 110726 ttgagatgcatggctgg 110742

>dbj|AP000317.2| Homo sapiens genomic DNA, chromosome 21 clone:RP1-24517, complete
             sequence
          Length = 97831

 Score = 34.2 bits (17), Expect = 9.6
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                              
Query: 2     aagccttgagatgcatg 18
             |||||||||||||||||
Sbjct: 83352 aagccttgagatgcatg 83336

>dbj|AP001719.1| Homo sapiens genomic DNA, chromosome 21q, section 63/105
          Length = 340000

 Score = 34.2 bits (17), Expect = 9.6
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                               
Query: 2      aagccttgagatgcatg 18
              |||||||||||||||||
Sbjct: 204561 aagccttgagatgcatg 204545

>dbj|D86038.2| Mus musculus mRNA for sulfonylurea receptor 2B, complete cds
          Length = 6034

 Score = 34.2 bits (17), Expect = 9.6
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                             
Query: 9    gagatgcatggctggga 25
            |||||||||||||||||
Sbjct: 5832 gagatgcatggctggga 5816

>dbj|D86037.2| Mus musculus mRNA for sulfonylurea receptor 2A, complete cds
          Length = 6210

 Score = 34.2 bits (17), Expect = 9.6
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                             
Query: 9    gagatgcatggctggga 25
            |||||||||||||||||
Sbjct: 6008 gagatgcatggctggga 5992

>dbj|AP000166.1| Homo sapiens genomic DNA, chromosome 21q22.1, D21S226-AML region, clone
             B2344F14-f50E8, segment 2/9, complete sequence
          Length = 100000

 Score = 34.2 bits (17), Expect = 9.6
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                              
Query: 2     aagccttgagatgcatg 18
             |||||||||||||||||
Sbjct: 75320 aagccttgagatgcatg 75304


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 175,095
Number of Sequences: 3902068
Number of extensions: 175095
Number of successful extensions: 46767
Number of sequences better than 10.0: 27
Number of HSP's better than 10.0 without gapping: 27
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 46718
Number of HSP's gapped (non-prelim): 49
length of query: 31
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 11
effective length of database: 17,155,003,908
effective search space: 188705042988
effective search space used: 188705042988
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)