>emb|BX511234.7| Zebrafish DNA sequence from clone DKEY-96I8 in linkage group 10,
             complete sequence
          Length = 112069

 Score = 42.1 bits (21), Expect = 0.30
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 19    cttgcccatttatcagtctat 39
             |||||||||||||||||||||
Sbjct: 20332 cttgcccatttatcagtctat 20352

>gb|AC167972.3| Mus musculus BAC clone RP24-73H24 from chromosome 13, complete sequence
          Length = 224330

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 39    tggtaccagctgttcctacttata 62
             ||||||||||||||||| ||||||
Sbjct: 74366 tggtaccagctgttcctccttata 74389

>gb|AC154413.3| Mus musculus BAC clone RP24-230J5 from chromosome 13, complete
            sequence
          Length = 174730

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 39   tggtaccagctgttcctacttata 62
            ||||||||||||||||| ||||||
Sbjct: 9579 tggtaccagctgttcctccttata 9556

>dbj|AK051610.1| Mus musculus 12 days embryo spinal ganglion cDNA, RIKEN full-length
            enriched library, clone:D130059P19 product:inferred: Mus
            musculus, Similar to hypothetical protein DKFZp761J139,
            clone MGC:11924 IMAGE:3599595, mRNA, complete cds, full
            insert sequence
          Length = 3423

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 39   tggtaccagctgttcctacttata 62
            ||||||||||||||||| ||||||
Sbjct: 2442 tggtaccagctgttcctccttata 2419

>gb|AC119969.15| Mus musculus chromosome 7, clone RP24-474K16, complete sequence
          Length = 145231

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 57     cttataacaccccaaaatg 75
              |||||||||||||||||||
Sbjct: 116304 cttataacaccccaaaatg 116286

>gb|AC146435.3| Pan troglodytes BAC clone RP43-15P23 from 7, complete sequence
          Length = 192805

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 71     aaatgttcaggagagctattgct 93
              |||||||||||||||| ||||||
Sbjct: 184010 aaatgttcaggagagcaattgct 183988

>gb|AC147331.3| Pan troglodytes BAC clone RP43-10H17 from 7, complete sequence
          Length = 189220

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 71     aaatgttcaggagagctattgct 93
              |||||||||||||||| ||||||
Sbjct: 148457 aaatgttcaggagagcaattgct 148435

>gb|AC153926.10| Mus musculus 10 BAC RP23-68M7 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 191655

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 72    aatgttcaggagagctattgctg 94
             |||||||||||||| ||||||||
Sbjct: 57770 aatgttcaggagaggtattgctg 57792

>dbj|AB229198.1| Aspergillus oryzae cDNA, contig sequence: AoEST6077
          Length = 372

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 42  taccagctgttcctactta 60
           |||||||||||||||||||
Sbjct: 113 taccagctgttcctactta 131

>dbj|AP007166.1| Aspergillus oryzae RIB40 genomic DNA, SC113
          Length = 1841713

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 42     taccagctgttcctactta 60
              |||||||||||||||||||
Sbjct: 923988 taccagctgttcctactta 923970

>gb|AC158604.5| Mus musculus 10 BAC RP23-130B2 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 190024

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 72     aatgttcaggagagctattgctg 94
              |||||||||||||| ||||||||
Sbjct: 176918 aatgttcaggagaggtattgctg 176940

>emb|BX255965.12| Zebrafish DNA sequence from clone CH211-270C19, complete sequence
          Length = 148298

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 69     caaaatgttcaggagagct 87
              |||||||||||||||||||
Sbjct: 100716 caaaatgttcaggagagct 100734

>gb|AC073200.6| Homo sapiens BAC clone RP11-261L16 from 7, complete sequence
          Length = 165929

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 71    aaatgttcaggagagctattgct 93
             |||||||||||||||| ||||||
Sbjct: 50094 aaatgttcaggagagcaattgct 50072

>emb|CR386077.1| Gallus gallus finished cDNA, clone ChEST1035k6
          Length = 759

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                 
Query: 64 caccccaaaatgttcaggagagc 86
          ||||||||||||||||| |||||
Sbjct: 9  caccccaaaatgttcagcagagc 31

>emb|AL663100.12| Human DNA sequence from clone RP5-1052J3 on chromosome 1, complete
             sequence
          Length = 80421

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 63    acaccccaaaatgttcagg 81
             |||||||||||||||||||
Sbjct: 10118 acaccccaaaatgttcagg 10100


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 728,519
Number of Sequences: 3902068
Number of extensions: 728519
Number of successful extensions: 46668
Number of sequences better than 10.0: 15
Number of HSP's better than 10.0 without gapping: 15
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 46641
Number of HSP's gapped (non-prelim): 27
length of query: 104
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 83
effective length of database: 17,151,101,840
effective search space: 1423541452720
effective search space used: 1423541452720
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)