ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags1g17
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AC015689.12| Homo sapiens chromosome 11, clone RP11-23F23, co... 46 0.10
2gb|AC157702.2| Xenopus tropicalis clone ISB1-219F7, complete seq... 44 0.41
3gb|AC011496.7| Homo sapiens chromosome 19 clone CTB-3M11, comple... 44 0.41
4gb|AC157727.2| Xenopus tropicalis clone ISB1-295B19, complete se... 44 0.41
5gb|AC121785.3| Mus musculus BAC clone RP23-382K4 from chromosome... 42 1.6
6gb|AC122941.3| Mus musculus BAC clone RP23-1E3 from chromosome 8... 42 1.6
7emb|CT025158.5| Mouse DNA sequence from clone RP23-178N11 on chr... 42 1.6
8gb|AC135362.3| Mus musculus BAC clone RP23-286J13 from chromosom... 42 1.6
9gb|AC073928.5| Homo sapiens BAC clone RP11-745P9 from 2, complet... 42 1.6
10emb|BX000358.11| Zebrafish DNA sequence from clone DKEY-77A20 in... 42 1.6
11gb|AY689436.1| Deerpox virus W-848-83, complete genome 40 6.5
12gb|AY731540.1| Arachis hypogaea clone PM723 microsatellite sequence 40 6.5
13gb|AC127951.4| Rattus norvegicus 18 BAC CH230-150D9 (Children's ... 40 6.5
14gb|AY526428.1| Arachis hypogaea clone PM672 microsatellite sequence 40 6.5
15gb|AY526385.1| Arachis hypogaea clone PM629 microsatellite sequence 40 6.5
16gb|AC096226.12| Rattus norvegicus 18 BAC CH230-26M18 (Children's... 40 6.5
17ref|XM_387760.1| Gibberella zeae PH-1 chromosome 4 hypothetical ... 40 6.5
18ref|XM_950425.1| Theileria annulata strain Ankara GPI anchor tra... 40 6.5
19emb|AL589931.14| Human DNA sequence from clone RP11-507C10 on ch... 40 6.5
20emb|AL365210.13| Human DNA sequence from clone RP11-398H15 on ch... 40 6.5
21emb|AL354950.8| Human DNA sequence from clone RP11-234G16 on chr... 40 6.5
22emb|AL022159.1|HS333H9 Human DNA sequence from clone RP3-333H9 o... 40 6.5
23emb|X99655.1|BPMADS5GN Betula pendula mRNA for MADS box protein ... 40 6.5
24emb|CR937532.1| Single read from an extremity of a cDNA clone ma... 40 6.5
25emb|CR937379.1| Single read from an extremity of a cDNA clone ma... 40 6.5
26emb|CR937378.1| Single read from an extremity of a cDNA clone ma... 40 6.5
27emb|CR937340.1| Single read from an extremity of a cDNA clone ma... 40 6.5
28emb|AL645969.20| Mouse DNA sequence from clone RP23-101H2 on chr... 40 6.5
29emb|BX323842.8| Zebrafish DNA sequence from clone CH211-1M7, com... 40 6.5
30gb|AC091953.3| Homo sapiens chromosome 5 clone RP11-417J1, compl... 40 6.5
31gb|AF207563.1| Brassica rapa acidic endochitinase (ChiA) gene, p... 40 6.5
32gb|AF207562.1| Brassica oleracea acidic endochitinase (ChiA) gen... 40 6.5
33gb|AF207561.1| Brassica napus acidic endochitinase (ChiA-2) gene... 40 6.5
34gb|AF207560.1| Brassica napus acidic endochitinase (ChiA-1) gene... 40 6.5
35gb|AC009471.5| Homo sapiens BAC clone RP11-168K7 from 2, complet... 40 6.5
36gb|AC006385.3|AC006385 Homo sapiens BAC clone RP11-559J5 from 2,... 40 6.5
37gb|AC027123.7| Homo sapiens chromosome 3 clone RP11-392M7 map 3p... 40 6.5
38gb|AC002087.1|HSAC002087 Human BAC clone GS1-113D4 from 5p15.2, ... 40 6.5
39gb|AC021092.1|AC021092 Homo sapiens chromosome 19, cosmid R29827... 40 6.5
40gb|AC004827.1|AC004827 Homo sapiens PAC clone RP1-44L15 from Xq2... 40 6.5
41gb|AC006272.1|AC006272 Homo sapiens chromosome 19, cosmid F23276... 40 6.5
42gb|AC005920.1|AC005920 Homo sapiens chromosome 17, clone hRPK.70... 40 6.5
43gb|AC005946.1|AC005946 Homo sapiens chromosome 19, cosmid R28782... 40 6.5
44gb|AC130103.4| Rattus norvegicus BAC CH230-41L20 (Children's Ho... 40 6.5
45dbj|AP006634.1| Lotus japonicus genomic DNA, chromosome 5, clone... 40 6.5
46emb|AL831752.7| Mouse DNA sequence from clone RP23-414J22 on chr... 40 6.5
47emb|AL713880.1|CNS07YOW Mus musculus chromosome 11 region in the... 40 6.5
48emb|AL713838.1|CNS07YOS Mus musculus chromosome 11 region in the... 40 6.5
49emb|AL603867.7| Mouse DNA sequence from clone RP23-237G11 on chr... 40 6.5 
>gb|AC015689.12| Homo sapiens chromosome 11, clone RP11-23F23, complete sequence
          Length = 182522

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 456    atgtgctattgaaatgaaatata 478
              |||||||||||||||||||||||
Sbjct: 158419 atgtgctattgaaatgaaatata 158441



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 454    tgatgtgctattgaaatgaaatata 478
              |||| ||||||||||||||||||||
Sbjct: 157279 tgatatgctattgaaatgaaatata 157303
to top
>gb|AC157702.2| Xenopus tropicalis clone ISB1-219F7, complete sequence
          Length = 75949

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 344   gcacttgcagaagtattctttt 365
             ||||||||||||||||||||||
Sbjct: 41434 gcacttgcagaagtattctttt 41413
to top
>gb|AC011496.7| Homo sapiens chromosome 19 clone CTB-3M11, complete sequence
          Length = 98069

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 347  cttgcagaagtattcttttgtg 368
            ||||||||||||||||||||||
Sbjct: 9056 cttgcagaagtattcttttgtg 9077
to top
>gb|AC157727.2| Xenopus tropicalis clone ISB1-295B19, complete sequence
          Length = 79860

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 344   gcacttgcagaagtattctttt 365
             ||||||||||||||||||||||
Sbjct: 16775 gcacttgcagaagtattctttt 16796
to top
>gb|AC121785.3| Mus musculus BAC clone RP23-382K4 from chromosome 3, complete
            sequence
          Length = 197272

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 244  gaggaagaggatgagaagaaa 264
            |||||||||||||||||||||
Sbjct: 5596 gaggaagaggatgagaagaaa 5576
to top
>gb|AC122941.3| Mus musculus BAC clone RP23-1E3 from chromosome 8, complete sequence
          Length = 244220

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 238    tgtgcagaggaagaggatgag 258
              |||||||||||||||||||||
Sbjct: 148913 tgtgcagaggaagaggatgag 148893
to top
>emb|CT025158.5| Mouse DNA sequence from clone RP23-178N11 on chromosome 16, complete
              sequence
          Length = 194555

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 379    ttattttgatgtgcacttgtt 399
              |||||||||||||||||||||
Sbjct: 188675 ttattttgatgtgcacttgtt 188655
to top
>gb|AC135362.3| Mus musculus BAC clone RP23-286J13 from chromosome 8, complete sequence
          Length = 173357

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 238    tgtgcagaggaagaggatgag 258
              |||||||||||||||||||||
Sbjct: 104560 tgtgcagaggaagaggatgag 104580
to top
>gb|AC073928.5| Homo sapiens BAC clone RP11-745P9 from 2, complete sequence
          Length = 138943

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 348    ttgcagaagtattcttttgtg 368
              |||||||||||||||||||||
Sbjct: 122817 ttgcagaagtattcttttgtg 122837
to top
>emb|BX000358.11| Zebrafish DNA sequence from clone DKEY-77A20 in linkage group 2, complete
              sequence
          Length = 181081

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 446    atgtcatgtgatgtgctattg 466
              |||||||||||||||||||||
Sbjct: 140587 atgtcatgtgatgtgctattg 140567
to top
>gb|AY689436.1| Deerpox virus W-848-83, complete genome
          Length = 166259

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 94    aattaaactattgtgtaaaagcta 117
             |||||||| |||||||||||||||
Sbjct: 45409 aattaaacgattgtgtaaaagcta 45386
to top
>gb|AY731540.1| Arachis hypogaea clone PM723 microsatellite sequence
          Length = 350

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 241 gcagaggaagaggatgagaa 260
           ||||||||||||||||||||
Sbjct: 201 gcagaggaagaggatgagaa 220
to top
>gb|AC127951.4| Rattus norvegicus 18 BAC CH230-150D9 (Children's Hospital Oakland
              Research Institute) complete sequence
          Length = 164101

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 244    gaggaagaggatgagaagaa 263
              ||||||||||||||||||||
Sbjct: 163341 gaggaagaggatgagaagaa 163360
to top
>gb|AY526428.1| Arachis hypogaea clone PM672 microsatellite sequence
          Length = 439

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 241 gcagaggaagaggatgagaa 260
           ||||||||||||||||||||
Sbjct: 236 gcagaggaagaggatgagaa 255
to top
>gb|AY526385.1| Arachis hypogaea clone PM629 microsatellite sequence
          Length = 450

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 241 gcagaggaagaggatgagaa 260
           ||||||||||||||||||||
Sbjct: 181 gcagaggaagaggatgagaa 162
to top
>gb|AC096226.12| Rattus norvegicus 18 BAC CH230-26M18 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 232962

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 244   gaggaagaggatgagaagaa 263
             ||||||||||||||||||||
Sbjct: 50902 gaggaagaggatgagaagaa 50921
to top
>ref|XM_387760.1| Gibberella zeae PH-1 chromosome 4 hypothetical protein (FG07584.1)
           partial mRNA
          Length = 1500

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 250 gaggatgagaagaaacttgt 269
           ||||||||||||||||||||
Sbjct: 94  gaggatgagaagaaacttgt 113
to top
>ref|XM_950425.1| Theileria annulata strain Ankara GPI anchor transamidase (TA17465)
           partial mRNA
          Length = 1218

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 260 agaaacttgtgcttctcatccaat 283
           |||||||||||||| |||||||||
Sbjct: 309 agaaacttgtgcttgtcatccaat 332
to top
>emb|AL589931.14| Human DNA sequence from clone RP11-507C10 on chromosome 6q25.2-26
              Contains the 5' end of the TCTEL1 gene for
              t-complex-associated-testis-expressed 1-like 1, the SYTL3
              gene for synaptotagmin-like 3, a novel pseudogene, the VIL2
              gene for villin 2, a novel gene, the 3' end of a novel gene
              and two CpG islands, complete sequence
          Length = 215705

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 243    agaggaagaggatgagaaga 262
              ||||||||||||||||||||
Sbjct: 210318 agaggaagaggatgagaaga 210299
to top
>emb|AL365210.13| Human DNA sequence from clone RP11-398H15 on chromosome 10, complete
             sequence
          Length = 30749

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 23    tatgtttatggcactgtcca 42
             ||||||||||||||||||||
Sbjct: 18700 tatgtttatggcactgtcca 18719
to top
>emb|AL354950.8| Human DNA sequence from clone RP11-234G16 on chromosome 10 Contains the
             EBF3 gene for early B-cell factor 3, a novel gene and two
             CpG islands, complete sequence
          Length = 166022

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 457   tgtgctattgaaatgaaata 476
             ||||||||||||||||||||
Sbjct: 64099 tgtgctattgaaatgaaata 64118
to top
>emb|AL022159.1|HS333H9 Human DNA sequence from clone RP3-333H9 on chromosome Xq26.1-26.3,
             complete sequence
          Length = 42098

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 378   attattttgatgtgcacttg 397
             ||||||||||||||||||||
Sbjct: 12912 attattttgatgtgcacttg 12893
to top
>emb|X99655.1|BPMADS5GN Betula pendula mRNA for MADS box protein (MADS5 gene)
          Length = 966

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 94  aattaaactattgtgtaaaagcta 117
           |||||||||||||||| |||||||
Sbjct: 46  aattaaactattgtgtgaaagcta 23
to top
>emb|CR937532.1| Single read from an extremity of a cDNA clone made from Aedes
           aegypti total adult females. 5-prime end of clone
           KW0AAB1YO09AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 147

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 336 atgcacttgcacttgcagaa 355
           ||||||||||||||||||||
Sbjct: 70  atgcacttgcacttgcagaa 51
to top
>emb|CR937379.1| Single read from an extremity of a cDNA clone made from Aedes
           aegypti total adult females. 5-prime end of clone
           KW0AAB2YD24AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 148

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 336 atgcacttgcacttgcagaa 355
           ||||||||||||||||||||
Sbjct: 74  atgcacttgcacttgcagaa 55
to top
>emb|CR937378.1| Single read from an extremity of a cDNA clone made from Aedes
           aegypti total adult females. 3-prime end of clone
           KW0AAB2YD24BBM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 131

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 336 atgcacttgcacttgcagaa 355
           ||||||||||||||||||||
Sbjct: 57  atgcacttgcacttgcagaa 76
to top
>emb|CR937340.1| Single read from an extremity of a cDNA clone made from Aedes
           aegypti total adult females. 3-prime end of clone
           KW0AAB2YF06BBM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 130

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 336 atgcacttgcacttgcagaa 355
           ||||||||||||||||||||
Sbjct: 56  atgcacttgcacttgcagaa 75
to top
>emb|AL645969.20| Mouse DNA sequence from clone RP23-101H2 on chromosome 11 Contains a
             novel gene, complete sequence
          Length = 154687

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 244   gaggaagaggatgagaagaa 263
             ||||||||||||||||||||
Sbjct: 58518 gaggaagaggatgagaagaa 58499
to top
>emb|BX323842.8| Zebrafish DNA sequence from clone CH211-1M7, complete sequence
          Length = 162929

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 248    aagaggatgagaagaaactt 267
              ||||||||||||||||||||
Sbjct: 101008 aagaggatgagaagaaactt 100989
to top
>gb|AC091953.3| Homo sapiens chromosome 5 clone RP11-417J1, complete sequence
          Length = 172738

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 347    cttgcagaagtattcttttgtgca 370
              |||||||||||||| |||||||||
Sbjct: 114095 cttgcagaagtatttttttgtgca 114118
to top
>gb|AF207563.1| Brassica rapa acidic endochitinase (ChiA) gene, partial cds
          Length = 830

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 370 attgtaaaattattttgatg 389
           ||||||||||||||||||||
Sbjct: 451 attgtaaaattattttgatg 432
to top
>gb|AF207562.1| Brassica oleracea acidic endochitinase (ChiA) gene, partial cds
          Length = 853

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 370 attgtaaaattattttgatg 389
           ||||||||||||||||||||
Sbjct: 475 attgtaaaattattttgatg 456
to top
>gb|AF207561.1| Brassica napus acidic endochitinase (ChiA-2) gene, partial cds
          Length = 828

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 370 attgtaaaattattttgatg 389
           ||||||||||||||||||||
Sbjct: 452 attgtaaaattattttgatg 433
to top
>gb|AF207560.1| Brassica napus acidic endochitinase (ChiA-1) gene, partial cds
          Length = 853

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 370 attgtaaaattattttgatg 389
           ||||||||||||||||||||
Sbjct: 475 attgtaaaattattttgatg 456
to top
>gb|AC009471.5| Homo sapiens BAC clone RP11-168K7 from 2, complete sequence
          Length = 172445

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 247    gaagaggatgagaagaaact 266
              ||||||||||||||||||||
Sbjct: 155839 gaagaggatgagaagaaact 155858
to top
>gb|AC006385.3|AC006385 Homo sapiens BAC clone RP11-559J5 from 2, complete sequence
          Length = 173508

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 51     cagtggccaataatatgcag 70
              ||||||||||||||||||||
Sbjct: 155297 cagtggccaataatatgcag 155278
to top
>gb|AC027123.7| Homo sapiens chromosome 3 clone RP11-392M7 map 3p, complete sequence
          Length = 191566

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 158    acatttcctatgcactttta 177
              ||||||||||||||||||||
Sbjct: 119797 acatttcctatgcactttta 119816
to top
>gb|AC002087.1|HSAC002087 Human BAC clone GS1-113D4 from 5p15.2, complete sequence
          Length = 154028

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 347   cttgcagaagtattcttttgtgca 370
             |||||||||||||| |||||||||
Sbjct: 91847 cttgcagaagtatttttttgtgca 91870
to top
>gb|AC021092.1|AC021092 Homo sapiens chromosome 19, cosmid R29827, complete sequence
          Length = 38897

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 368  gcattgtaaaattattttga 387
            ||||||||||||||||||||
Sbjct: 7438 gcattgtaaaattattttga 7457
to top
>gb|AC004827.1|AC004827 Homo sapiens PAC clone RP1-44L15 from Xq23, complete sequence
          Length = 129690

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 23   tatgtttatggcactgtcca 42
            ||||||||||||||||||||
Sbjct: 9557 tatgtttatggcactgtcca 9538
to top
>gb|AC006272.1|AC006272 Homo sapiens chromosome 19, cosmid F23276, complete sequence
          Length = 41821

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 105  tgtgtaaaagctacagtgat 124
            ||||||||||||||||||||
Sbjct: 3330 tgtgtaaaagctacagtgat 3311
to top
>gb|AC005920.1|AC005920 Homo sapiens chromosome 17, clone hRPK.700_H_6, complete sequence
          Length = 175793

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 152   accagcacatttcctatgca 171
             ||||||||||||||||||||
Sbjct: 14308 accagcacatttcctatgca 14289
to top
>gb|AC005946.1|AC005946 Homo sapiens chromosome 19, cosmid R28782, complete sequence
          Length = 37392

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 105   tgtgtaaaagctacagtgat 124
             ||||||||||||||||||||
Sbjct: 31228 tgtgtaaaagctacagtgat 31209
to top
>gb|AC130103.4| Rattus norvegicus  BAC CH230-41L20 (Children's Hospital Oakland
             Research Institute Rat (BN/SsNHsd/MCW) BAC library)
             complete sequence
          Length = 224716

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 450   catgtgatgtgctattgaaatgaaatat 477
             |||||||||| || ||||||||||||||
Sbjct: 64534 catgtgatgttcttttgaaatgaaatat 64507
to top
>dbj|AP006634.1| Lotus japonicus genomic DNA, chromosome 5, clone:LjT15O18, TM0086,
             complete sequence
          Length = 133572

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 384   ttgatgtgcacttgttaggc 403
             ||||||||||||||||||||
Sbjct: 61097 ttgatgtgcacttgttaggc 61116
to top
>emb|AL831752.7| Mouse DNA sequence from clone RP23-414J22 on chromosome X, complete
             sequence
          Length = 169807

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 244   gaggaagaggatgagaagaa 263
             ||||||||||||||||||||
Sbjct: 52782 gaggaagaggatgagaagaa 52801
to top
>emb|AL713880.1|CNS07YOW Mus musculus chromosome 11 region in the Om locus area (D11Mit37-Scya6)
             clone 366M1 of library Caltech CITB-BAC from chromosome 11
             of Mus musculus (mouse)
          Length = 111702

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 244   gaggaagaggatgagaagaa 263
             ||||||||||||||||||||
Sbjct: 95014 gaggaagaggatgagaagaa 94995
to top
>emb|AL713838.1|CNS07YOS Mus musculus chromosome 11 region in the Om locus area (D11Mit37-Scya6)
              clone 278H24 of library Caltech CITB-BAC from chromosome 11
              of Mus musculus (mouse)
          Length = 150493

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 244    gaggaagaggatgagaagaa 263
              ||||||||||||||||||||
Sbjct: 127482 gaggaagaggatgagaagaa 127501
to top
>emb|AL603867.7| Mouse DNA sequence from clone RP23-237G11 on chromosome 15, complete
             sequence
          Length = 112729

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 245   aggaagaggatgagaagaaa 264
             ||||||||||||||||||||
Sbjct: 29953 aggaagaggatgagaagaaa 29972


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,146,193
Number of Sequences: 3902068
Number of extensions: 5146193
Number of successful extensions: 114419
Number of sequences better than 10.0: 50
Number of HSP's better than 10.0 without gapping: 50
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 114340
Number of HSP's gapped (non-prelim): 79
length of query: 479
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 457
effective length of database: 17,147,199,772
effective search space: 7836270295804
effective search space used: 7836270295804
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top