>gb|AC113514.9| Mus musculus chromosome 19, clone RP23-475D11, complete sequence
          Length = 170366

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 320    cccttgctgctatggagcatc 340
              |||||||||||||||||||||
Sbjct: 129324 cccttgctgctatggagcatc 129344



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 476    cccttgctgctatggagcatc 496
              |||||||||||||||||||||
Sbjct: 129324 cccttgctgctatggagcatc 129344

>gb|AC116128.15| Mus musculus chromosome 19, clone RP23-95H3, complete sequence
          Length = 228363

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 476   cccttgctgctatggagcatc 496
             |||||||||||||||||||||
Sbjct: 17444 cccttgctgctatggagcatc 17464



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 320   cccttgctgctatggagcatc 340
             |||||||||||||||||||||
Sbjct: 17444 cccttgctgctatggagcatc 17464

>gb|AE014075.1| Escherichia coli CFT073, complete genome
          Length = 5231428

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 145    gctgcaacgcaacaccgatggcgaa 169
              ||||||||||||| |||||||||||
Sbjct: 886204 gctgcaacgcaacgccgatggcgaa 886180

>gb|CP000243.1| Escherichia coli UTI89, complete genome
          Length = 5065741

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 145    gctgcaacgcaacaccgatggcgaa 169
              ||||||||||||| |||||||||||
Sbjct: 826524 gctgcaacgcaacgccgatggcgaa 826500

>gb|U00096.2| Escherichia coli K-12 MG1655, complete genome
          Length = 4639675

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 145    gctgcaacgcaacaccgatggcgaa 169
              ||||||||||||| |||||||||||
Sbjct: 864532 gctgcaacgcaacgccgatggcgaa 864508

>dbj|AP009048.1| Escherichia coli W3110 DNA, complete genome
          Length = 4646332

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 145    gctgcaacgcaacaccgatggcgaa 169
              ||||||||||||| |||||||||||
Sbjct: 865731 gctgcaacgcaacgccgatggcgaa 865707

>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome
          Length = 9105828

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 208     agcacggttgagatgcgatgcagcc 232
               ||||||||||||| |||||||||||
Sbjct: 7588253 agcacggttgagacgcgatgcagcc 7588229

>gb|CP000034.1| Shigella dysenteriae Sd197, complete genome
          Length = 4369232

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 145    gctgcaacgcaacaccgatggcgaa 169
              ||||||||||||| |||||||||||
Sbjct: 707774 gctgcaacgcaacgccgatggcgaa 707798

>gb|M21151.1|ECOCHLEN E.coli chlEN operon encoding two proteins (chlE and chlN) involved in
            molybdopterin biosynthesis, complete cds
          Length = 2492

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 145  gctgcaacgcaacaccgatggcgaa 169
            ||||||||||||| |||||||||||
Sbjct: 1416 gctgcaacgcaacgccgatggcgaa 1440

>gb|AC006358.6| Homo sapiens PAC clone RP5-1127D14 from 7, complete sequence
          Length = 143216

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 255    tggacaggagctgcacatgc 274
              ||||||||||||||||||||
Sbjct: 125925 tggacaggagctgcacatgc 125906

>emb|AL138832.10| Human DNA sequence from clone RP3-445H2 on chromosome 6q25.1-26
             Contains part of the synaptic nuclei expressed gene 1b
             (SYNE-1) (nesprin-1 beta, MYNE1, SYNE1, KIAA0796) and the
             gene for a novel protein, complete sequence
          Length = 139011

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 262   gagctgcacatgctgctatggagc 285
             |||||||||||| |||||||||||
Sbjct: 42080 gagctgcacatgttgctatggagc 42057


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,667,920
Number of Sequences: 3902068
Number of extensions: 2667920
Number of successful extensions: 57238
Number of sequences better than 10.0: 11
Number of HSP's better than 10.0 without gapping: 11
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 57001
Number of HSP's gapped (non-prelim): 237
length of query: 579
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 556
effective length of database: 17,143,297,704
effective search space: 9531673523424
effective search space used: 9531673523424
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)