ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baal9i23
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC155822.2| Mus musculus BAC clone RP23-319J10 from chromosom... 42 2.0
2gb|AC163223.15| Mus musculus chromosome 8, clone RP24-334B10, co... 42 2.0
3gb|AC130673.10| Mus musculus chromosome 15, clone RP24-97F15, co... 40 7.9
4gb|AC146138.2| Pan troglodytes BAC clone RP43-3D14 from 7, compl... 40 7.9
5gb|AC137681.20| Mus musculus chromosome 14, clone RP23-460H20, c... 40 7.9
6emb|AL358532.11| Human DNA sequence from clone RP11-186O14 on ch... 40 7.9
7emb|AL353113.7| Human DNA sequence from clone RP11-304I5 on chro... 40 7.9
8emb|AL136441.16| Human DNA sequence from clone RP11-19D22 on chr... 40 7.9
9emb|AL928552.7| Mouse DNA sequence from clone RP23-30I12 on chro... 40 7.9
10gb|AC112651.4| Homo sapiens X BAC RP13-302M16 (Roswell Park Canc... 40 7.9
11gb|AF334674.1|AF334674 Oncorhynchus mykiss Wilms' tumor suppress... 40 7.9
12gb|AC048362.14| Mus musculus, clone RP23-105E2, complete sequence 40 7.9
13dbj|AK045169.1| Mus musculus 9.5 days embryo parthenogenote cDNA... 40 7.9
14gb|AC154471.2| Mus musculus BAC clone RP23-195D3 from chromosome... 40 7.9
15emb|CT025521.10| Mouse DNA sequence from clone RP23-337J16 on ch... 40 7.9

>gb|AC155822.2| Mus musculus BAC clone RP23-319J10 from chromosome 16, complete
             sequence
          Length = 192526

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 79    gagtaggaatatttgaacagt 99
             |||||||||||||||||||||
Sbjct: 66702 gagtaggaatatttgaacagt 66722



to top

>gb|AC163223.15| Mus musculus chromosome 8, clone RP24-334B10, complete sequence
          Length = 157069

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 195   aggacccacaagcagcagcaagaga 219
             |||| ||||||||||||||||||||
Sbjct: 52696 aggatccacaagcagcagcaagaga 52720



to top

>gb|AC130673.10| Mus musculus chromosome 15, clone RP24-97F15, complete sequence
          Length = 136395

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 532   atgtacatgttctagccagg 551
             ||||||||||||||||||||
Sbjct: 27574 atgtacatgttctagccagg 27593



to top

>gb|AC146138.2| Pan troglodytes BAC clone RP43-3D14 from 7, complete sequence
          Length = 176823

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 195    aggacccacaagcagcagca 214
              ||||||||||||||||||||
Sbjct: 121376 aggacccacaagcagcagca 121357



to top

>gb|AC137681.20| Mus musculus chromosome 14, clone RP23-460H20, complete sequence
          Length = 212261

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 196    ggacccacaagcagcagcaagaga 219
              ||||||||||||||||| ||||||
Sbjct: 193550 ggacccacaagcagcagaaagaga 193573



to top

>emb|AL358532.11| Human DNA sequence from clone RP11-186O14 on chromosome 10 Contains the
              LIPF gene for gastric lipase, the genes for two novel
              ab-hydrolase associated lipase region domain containing
              proteins and a CHC1L (chromosome condensation 1-like
              RCC1-like G exchanging factor RLG) pseudogene, complete
              sequence
          Length = 161826

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 46     caacagtggttcctgaagga 65
              ||||||||||||||||||||
Sbjct: 161119 caacagtggttcctgaagga 161138



to top

>emb|AL353113.7| Human DNA sequence from clone RP11-304I5 on chromosome 10 Contains
            the gene for a novel lipase and gene MGC22805, complete
            sequence
          Length = 43456

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 46   caacagtggttcctgaagga 65
            ||||||||||||||||||||
Sbjct: 1293 caacagtggttcctgaagga 1312



to top

>emb|AL136441.16| Human DNA sequence from clone RP11-19D22 on chromosome 13q22.1-22.3
              Contains a CpG island, complete sequence
          Length = 180992

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 478    tcttggtcttttgcctttta 497
              ||||||||||||||||||||
Sbjct: 174782 tcttggtcttttgcctttta 174763



to top

>emb|AL928552.7| Mouse DNA sequence from clone RP23-30I12 on chromosome 4, complete
             sequence
          Length = 206507

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 350   tgaaccagccagctccaacctgac 373
             ||||||||||| ||||||||||||
Sbjct: 57979 tgaaccagccatctccaacctgac 58002



to top

>gb|AC112651.4| Homo sapiens X BAC RP13-302M16 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 159274

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 413    atactacactgacacatggtctga 436
              ||||| ||||||||||||||||||
Sbjct: 107008 atacttcactgacacatggtctga 106985



to top

>gb|AF334674.1|AF334674 Oncorhynchus mykiss Wilms' tumor suppressor 2b (WT-t2b) mRNA,
            complete cds
          Length = 2289

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 152  tgacaaggtttgctacagcaagaa 175
            ||||| ||||||||||||||||||
Sbjct: 2243 tgacacggtttgctacagcaagaa 2266



to top

>gb|AC048362.14| Mus musculus, clone RP23-105E2, complete sequence
          Length = 209211

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 348   actgaaccagccagctccaa 367
             ||||||||||||||||||||
Sbjct: 95922 actgaaccagccagctccaa 95903



to top

>dbj|AK045169.1| Mus musculus 9.5 days embryo parthenogenote cDNA, RIKEN full-length
            enriched library, clone:B130042J16
            product:unclassifiable, full insert sequence
          Length = 3013

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 58   ctgaaggaaggtgccaaggc 77
            ||||||||||||||||||||
Sbjct: 2801 ctgaaggaaggtgccaaggc 2820



to top

>gb|AC154471.2| Mus musculus BAC clone RP23-195D3 from chromosome 14, complete sequence
          Length = 192057

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 196    ggacccacaagcagcagcaagaga 219
              ||||||||||||||||| ||||||
Sbjct: 178682 ggacccacaagcagcagaaagaga 178659



to top

>emb|CT025521.10| Mouse DNA sequence from clone RP23-337J16 on chromosome 16, complete
            sequence
          Length = 200017

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 58   ctgaaggaaggtgccaaggc 77
            ||||||||||||||||||||
Sbjct: 1157 ctgaaggaaggtgccaaggc 1138


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,037,579
Number of Sequences: 3902068
Number of extensions: 5037579
Number of successful extensions: 86958
Number of sequences better than 10.0: 15
Number of HSP's better than 10.0 without gapping: 15
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 86933
Number of HSP's gapped (non-prelim): 25
length of query: 580
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 557
effective length of database: 17,143,297,704
effective search space: 9548816821128
effective search space used: 9548816821128
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top