ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name baal8h06
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|NM_190458.1| Oryza sativa (japonica cultivar-group), predic... 186 6e-44
2dbj|AK068489.1| Oryza sativa (japonica cultivar-group) cDNA clon... 168 1e-38
3dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 153 9e-34
4dbj|AP004366.3| Oryza sativa (japonica cultivar-group) genomic D... 153 9e-34
5ref|XM_475397.1| Oryza sativa (japonica cultivar-group), predic... 88 4e-14
6dbj|AK063502.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 4e-14
7gb|AC121361.3| Oryza sativa (japonica cultivar-group) chromosome... 76 2e-10
8gb|AC108503.4| Oryza sativa (japonica cultivar-group) chromosome... 76 2e-10
9dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 76 2e-10
10gb|AC122698.2| Homo sapiens chromosome 5 clone CTD-2313P7, compl... 46 0.14
11gb|AC091997.3| Homo sapiens chromosome 5 clone RP11-96K8, comple... 46 0.14
12gb|AC164703.3| Mus musculus BAC clone RP23-266K19 from chromosom... 42 2.3
13ref|XM_612795.2| PREDICTED: Bos taurus similar to solute carrier... 42 2.3
14ref|XM_543735.2| PREDICTED: Canis familiaris similar to solute c... 42 2.3
15gb|AC122851.4| Mus musculus BAC clone RP23-171C17 from chromosom... 42 2.3
16gb|AC006478.2| Homo sapiens PAC clone RP5-847G17 from 7, complet... 42 2.3
17gb|AC109455.2| Homo sapiens chromosome 5 clone RP11-221D10, comp... 42 2.3
18gb|AC019089.6| Homo sapiens BAC clone RP11-370L14 from 4, comple... 42 2.3
19gb|AC157948.5| Mus musculus BAC clone RP23-197K17 from chromosom... 42 2.3
20gb|AC149283.2| Mus musculus BAC clone RP23-233O21 from 7, comple... 42 2.3
21dbj|AP004908.1| Lotus japonicus genomic DNA, chromosome 6, clone... 42 2.3
22gb|AC115727.10| Mus musculus chromosome 3, clone RP23-30A13, com... 40 8.9
23ref|NM_102179.1| Arabidopsis thaliana antiporter/ drug transport... 40 8.9
24gb|AC113271.10| Mus musculus chromosome 5, clone RP23-376H8, com... 40 8.9
25gb|AF377946.3| Oryza sativa (japonica cultivar-group) chromosome... 40 8.9
26gb|AC160473.4| Mus musculus BAC clone RP23-123N21 from chromosom... 40 8.9
27gb|AC124103.5| Mus musculus chromosome 15, clone RP24-271M13, co... 40 8.9
28gb|AC183595.3| Pan troglodytes BAC clone CH251-641G8 from chromo... 40 8.9
29gb|AC147426.2| Oryza sativa chromosome 3 B1377B10 genomic seque... 40 8.9
30gb|AC147570.3| Homo sapiens BAC clone RP11-1176F21 from UL, comp... 40 8.9
31gb|AC126437.3| Mus musculus BAC clone RP24-211B22 from chromosom... 40 8.9
32gb|AC182469.3| Pan troglodytes BAC clone CH251-496G17 from chrom... 40 8.9
33gb|AC183765.3| Pan troglodytes BAC clone CH251-521I2 from chromo... 40 8.9
34gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 40 8.9
35gb|AC105457.1| Homo sapiens chromosome 21 clone RP11-271G11 map ... 40 8.9
36gb|AC118038.15| Mus musculus chromosome 15, clone RP23-87G17, co... 40 8.9
37gb|AC092107.5| Homo sapiens BAC clone RP11-755J8 from UL, comple... 40 8.9
38gb|AC146233.2| Pan troglodytes BAC clone RP43-32B21 from 7, comp... 40 8.9
39gb|AC146123.2| Pan troglodytes BAC clone RP43-38F11 from 7, comp... 40 8.9
40gb|AC004866.1| Homo sapiens PAC clone RP4-728H9 from 7, complete... 40 8.9
41gb|AC135414.31| Medicago truncatula clone mth2-8n20, complete se... 40 8.9
42gb|AC148304.3| Medicago truncatula clone mth2-21b19, complete se... 40 8.9
43gb|AC147009.5| Medicago truncatula clone mth2-139j3, complete se... 40 8.9
44emb|AL596322.3| Human DNA sequence from clone RP11-31D17 on chro... 40 8.9
45emb|AL391382.10| Human DNA sequence from clone RP11-38M15 on chr... 40 8.9
46emb|AL390726.19| Human DNA sequence from clone RP11-392E22 on ch... 40 8.9
47emb|AL365361.12| Human DNA sequence from clone RP11-284N8 on chr... 40 8.9
48emb|AL357510.17| Human DNA sequence from clone RP11-195F21 on ch... 40 8.9
49emb|AL359741.9| Human DNA sequence from clone RP11-161P17 on chr... 40 8.9
50emb|AL139008.10| Human DNA sequence from clone RP11-255A11 on ch... 40 8.9
51emb|AL137020.13| Human DNA sequence from clone RP11-146B14 on ch... 40 8.9
52gb|AC138772.4| Homo sapiens BAC clone RP11-1345A16 from UL, comp... 40 8.9
53gb|AC105336.14| Mus musculus chromosome 3, clone RP24-277J22, co... 40 8.9
54gb|AC138771.4| Homo sapiens BAC clone RP11-1338E21 from UL, comp... 40 8.9
55emb|AL606589.3|OSJN00021 Oryza sativa genomic DNA, chromosome 4,... 40 8.9
56emb|AL513412.3|HS403H13 Homo sapiens chromosome 9 BAC RP11-403H1... 40 8.9
57emb|BX901964.13| Zebrafish DNA sequence from clone DKEYP-20A7 in... 40 8.9
58gb|AC182471.3| Pan troglodytes BAC clone CH251-352M13 from chrom... 40 8.9
59gb|AC125394.27| Pan troglodytes clone rp43-45i3, complete sequence 40 8.9
60gb|AC113132.3| Homo sapiens chromosome 18, clone RP11-433F3, com... 40 8.9
61gb|AC093425.2| Homo sapiens chromosome 1 clone RP11-470E16, comp... 40 8.9
62gb|AC024621.8| Homo sapiens chromosome 18, clone RP11-425M2, com... 40 8.9
63ref|NM_074528.2| Caenorhabditis elegans F57A10.4 (F57A10.4) mRNA... 40 8.9
64gb|AC138775.3| Homo sapiens BAC clone RP11-1247B7 from chromosom... 40 8.9
65dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.9
66dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.9
67gb|AC147060.2| Homo sapiens BAC clone RP11-268B15 from 4, comple... 40 8.9
68gb|AC145621.2| Homo sapiens BAC clone RP11-365B19 from 4, comple... 40 8.9
69gb|AC118282.4| Homo sapiens BAC clone RP11-1281K21 from 4, compl... 40 8.9
70gb|AC073464.5| Homo sapiens BAC clone RP11-134N21 from 2, comple... 40 8.9
71gb|AC138777.3| Homo sapiens BAC clone RP11-1220P14 from 2, compl... 40 8.9
72gb|AC005292.4|AC005292 Genomic sequence for Arabidopsis thaliana... 40 8.9
73gb|AC119751.3| Homo sapiens BAC clone RP11-241F15 from 4, comple... 40 8.9
74gb|AC069328.1|AC069328 Genomic Sequence For Arabidopsis thaliana... 40 8.9
75gb|AC051627.4|AC051627 Genomic Sequence For Arabidopsis thaliana... 40 8.9
76emb|BX571672.10| Human DNA sequence from clone RP11-782C8 on chr... 40 8.9
77dbj|BS000003.1| Pan troglodytes chromosome 22 clone:PTB-084L06, ... 40 8.9
78dbj|AK120135.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 8.9
79emb|AL583842.40| Human DNA sequence from clone RP11-417J8 on chr... 40 8.9
80dbj|AK066236.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 8.9
81tpe|BN000872.1| TPA: TPA_exp: Mus musculus immunoglobulin heavy ... 40 8.9
82emb|AL133372.4|CNS01DUX Human chromosome 14 DNA sequence BAC R-2... 40 8.9
83gb|AC163348.5| Mus musculus BAC clone RP23-230L2 from chromosome... 40 8.9
84emb|Z96048.1|CEF57A10 Caenorhabditis elegans Cosmid F57A10, comp... 40 8.9
85emb|BX004987.9| Human DNA sequence from clone RP11-435B5 on chro... 40 8.9
86dbj|AP005212.2| Homo sapiens genomic DNA, chromosome 18 clone:RP... 40 8.9
87dbj|AP007292.1| Lotus japonicus genomic DNA, chromosome 2, clone... 40 8.9
88dbj|AP006120.1| Lotus japonicus genomic DNA, chromosome 2, clone... 40 8.9
89emb|AL845329.5| Human DNA sequence from clone RP11-391H1 on chro... 40 8.9
90emb|AL844558.6| Mouse DNA sequence from clone RP23-378I2 on chro... 40 8.9 
>ref|NM_190458.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 2334

 Score =  186 bits (94), Expect = 6e-44
 Identities = 163/186 (87%)
 Strand = Plus / Plus

                                                                        
Query: 470  tgagaaagaagatccagagtcaaatattgatcagaccgtctctaatttccatcaagaata 529
            |||| ||||| |||||||| ||||| ||||||   |  || |||||||||||| ||||||
Sbjct: 1377 tgaggaagaaaatccagagacaaatgttgatctcgctctcgctaatttccatcgagaata 1436

                                                                        
Query: 530  cgaggtatttgaattgagaattgtccaccgcaagaacagaactggctttgaagaaaacaa 589
             |||||||||||| ||||||||||||||||||||||||| || |||||||||| || |||
Sbjct: 1437 tgaggtatttgaactgagaattgtccaccgcaagaacaggaccggctttgaagtaagcaa 1496

                                                                        
Query: 590  agattttcccattgtcttgaattcagtcatagcaggaagatattatgttactgaatatct 649
            |||||| ||||||||| | |||||||| |||||||||||||||||||| |||||||| ||
Sbjct: 1497 agatttccccattgtcataaattcagttatagcaggaagatattatgtcactgaatacct 1556

                  
Query: 650  tggctc 655
            ||||||
Sbjct: 1557 tggctc 1562



 Score =  153 bits (77), Expect = 9e-34
 Identities = 175/209 (83%), Gaps = 9/209 (4%)
 Strand = Plus / Plus

                                                                        
Query: 37   attctagctctcctgtgtatgggaggtacaagatcatggatgaccagacagagatactag 96
            ||||||||||  |||| |||||||||||| ||||||| |||||||||||||||||||| |
Sbjct: 941  attctagctccactgtctatgggaggtaccagatcattgatgaccagacagagatacttg 1000

                                                                        
Query: 97   atgagtgtggcctggatgtgtttcggatgaa---------ggatgctgtgcttgagtgcg 147
            ||||||||||| |||||| ||||| | ||||         ||||| ||||||||||||  
Sbjct: 1001 atgagtgtggcatggatgggtttcagttgaagcaccctgcggatgttgtgcttgagtgtc 1060

                                                                        
Query: 148  atttgccgagagattctgggcaggtagacgagcgtttggagctgaatgttgtggagaaag 207
            ||||||| |||||||||||| | | ||| ||||| | |||||||| ||| |||||||| |
Sbjct: 1061 atttgccaagagattctggggaaggagatgagcgatcggagctgagtgtagtggagaagg 1120

                                         
Query: 208  agcttcaaatgctcagctcatttgatact 236
            |||||||||||||||| ||||||| ||||
Sbjct: 1121 agcttcaaatgctcagttcatttggtact 1149
to top
>dbj|AK068489.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013155B12, full
            insert sequence
          Length = 2694

 Score =  168 bits (85), Expect = 1e-38
 Identities = 131/145 (90%), Gaps = 1/145 (0%)
 Strand = Plus / Plus

                                                                        
Query: 511  ctaatttccatcaagaatacgaggtatttgaattgagaattgtccaccgcaagaacagaa 570
            |||||||||||| |||||| |||| ||||||| ||||||||||||||||||||||||| |
Sbjct: 1351 ctaatttccatcgagaatatgagg-atttgaactgagaattgtccaccgcaagaacagga 1409

                                                                        
Query: 571  ctggctttgaagaaaacaaagattttcccattgtcttgaattcagtcatagcaggaagat 630
            | |||||||||| || ||||||||| ||||||||| | |||||||| |||||||||||||
Sbjct: 1410 ccggctttgaagtaagcaaagatttccccattgtcataaattcagttatagcaggaagat 1469

                                     
Query: 631  attatgttactgaatatcttggctc 655
            ||||||| |||||||| ||||||||
Sbjct: 1470 attatgtcactgaataccttggctc 1494



 Score =  153 bits (77), Expect = 9e-34
 Identities = 175/209 (83%), Gaps = 9/209 (4%)
 Strand = Plus / Plus

                                                                        
Query: 37   attctagctctcctgtgtatgggaggtacaagatcatggatgaccagacagagatactag 96
            ||||||||||  |||| |||||||||||| ||||||| |||||||||||||||||||| |
Sbjct: 874  attctagctccactgtctatgggaggtaccagatcattgatgaccagacagagatacttg 933

                                                                        
Query: 97   atgagtgtggcctggatgtgtttcggatgaa---------ggatgctgtgcttgagtgcg 147
            ||||||||||| |||||| ||||| | ||||         ||||| ||||||||||||  
Sbjct: 934  atgagtgtggcatggatgggtttcagttgaagcaccctgcggatgttgtgcttgagtgtc 993

                                                                        
Query: 148  atttgccgagagattctgggcaggtagacgagcgtttggagctgaatgttgtggagaaag 207
            ||||||| |||||||||||| | | ||| ||||| | |||||||| ||| |||||||| |
Sbjct: 994  atttgccaagagattctggggaaggagatgagcgatcggagctgagtgtagtggagaagg 1053

                                         
Query: 208  agcttcaaatgctcagctcatttgatact 236
            |||||||||||||||| ||||||| ||||
Sbjct: 1054 agcttcaaatgctcagttcatttggtact 1082
to top
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  153 bits (77), Expect = 9e-34
 Identities = 175/209 (83%), Gaps = 9/209 (4%)
 Strand = Plus / Plus

                                                                            
Query: 37       attctagctctcctgtgtatgggaggtacaagatcatggatgaccagacagagatactag 96
                ||||||||||  |||| |||||||||||| ||||||| |||||||||||||||||||| |
Sbjct: 35647717 attctagctccactgtctatgggaggtaccagatcattgatgaccagacagagatacttg 35647776

                                                                            
Query: 97       atgagtgtggcctggatgtgtttcggatgaa---------ggatgctgtgcttgagtgcg 147
                ||||||||||| |||||| ||||| | ||||         ||||| ||||||||||||  
Sbjct: 35647777 atgagtgtggcatggatgggtttcagttgaagcaccctgcggatgttgtgcttgagtgtc 35647836

                                                                            
Query: 148      atttgccgagagattctgggcaggtagacgagcgtttggagctgaatgttgtggagaaag 207
                ||||||| |||||||||||| | | ||| ||||| | |||||||| ||| |||||||| |
Sbjct: 35647837 atttgccaagagattctggggaaggagatgagcgatcggagctgagtgtagtggagaagg 35647896

                                             
Query: 208      agcttcaaatgctcagctcatttgatact 236
                |||||||||||||||| ||||||| ||||
Sbjct: 35647897 agcttcaaatgctcagttcatttggtact 35647925



 Score =  101 bits (51), Expect = 3e-18
 Identities = 75/83 (90%)
 Strand = Plus / Plus

                                                                            
Query: 573      ggctttgaagaaaacaaagattttcccattgtcttgaattcagtcatagcaggaagatat 632
                |||||||||| || ||||||||| ||||||||| | |||||||| |||||||||||||||
Sbjct: 35649141 ggctttgaagtaagcaaagatttccccattgtcataaattcagttatagcaggaagatat 35649200

                                       
Query: 633      tatgttactgaatatcttggctc 655
                ||||| |||||||| ||||||||
Sbjct: 35649201 tatgtcactgaataccttggctc 35649223



 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 86/99 (86%)
 Strand = Plus / Plus

                                                                            
Query: 470      tgagaaagaagatccagagtcaaatattgatcagaccgtctctaatttccatcaagaata 529
                |||| ||||| |||||||| ||||| ||||||   |  || |||||||||||| ||||||
Sbjct: 35648934 tgaggaagaaaatccagagacaaatgttgatctcgctctcgctaatttccatcgagaata 35648993

                                                       
Query: 530      cgaggtatttgaattgagaattgtccaccgcaagaacag 568
                 |||||||||||| |||||||||||||||||||||||||
Sbjct: 35648994 tgaggtatttgaactgagaattgtccaccgcaagaacag 35649032
to top
>dbj|AP004366.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0460C04
          Length = 189043

 Score =  153 bits (77), Expect = 9e-34
 Identities = 175/209 (83%), Gaps = 9/209 (4%)
 Strand = Plus / Plus

                                                                         
Query: 37    attctagctctcctgtgtatgggaggtacaagatcatggatgaccagacagagatactag 96
             ||||||||||  |||| |||||||||||| ||||||| |||||||||||||||||||| |
Sbjct: 51054 attctagctccactgtctatgggaggtaccagatcattgatgaccagacagagatacttg 51113

                                                                         
Query: 97    atgagtgtggcctggatgtgtttcggatgaa---------ggatgctgtgcttgagtgcg 147
             ||||||||||| |||||| ||||| | ||||         ||||| ||||||||||||  
Sbjct: 51114 atgagtgtggcatggatgggtttcagttgaagcaccctgcggatgttgtgcttgagtgtc 51173

                                                                         
Query: 148   atttgccgagagattctgggcaggtagacgagcgtttggagctgaatgttgtggagaaag 207
             ||||||| |||||||||||| | | ||| ||||| | |||||||| ||| |||||||| |
Sbjct: 51174 atttgccaagagattctggggaaggagatgagcgatcggagctgagtgtagtggagaagg 51233

                                          
Query: 208   agcttcaaatgctcagctcatttgatact 236
             |||||||||||||||| ||||||| ||||
Sbjct: 51234 agcttcaaatgctcagttcatttggtact 51262



 Score =  101 bits (51), Expect = 3e-18
 Identities = 75/83 (90%)
 Strand = Plus / Plus

                                                                         
Query: 573   ggctttgaagaaaacaaagattttcccattgtcttgaattcagtcatagcaggaagatat 632
             |||||||||| || ||||||||| ||||||||| | |||||||| |||||||||||||||
Sbjct: 52478 ggctttgaagtaagcaaagatttccccattgtcataaattcagttatagcaggaagatat 52537

                                    
Query: 633   tatgttactgaatatcttggctc 655
             ||||| |||||||| ||||||||
Sbjct: 52538 tatgtcactgaataccttggctc 52560



 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 86/99 (86%)
 Strand = Plus / Plus

                                                                         
Query: 470   tgagaaagaagatccagagtcaaatattgatcagaccgtctctaatttccatcaagaata 529
             |||| ||||| |||||||| ||||| ||||||   |  || |||||||||||| ||||||
Sbjct: 52271 tgaggaagaaaatccagagacaaatgttgatctcgctctcgctaatttccatcgagaata 52330

                                                    
Query: 530   cgaggtatttgaattgagaattgtccaccgcaagaacag 568
              |||||||||||| |||||||||||||||||||||||||
Sbjct: 52331 tgaggtatttgaactgagaattgtccaccgcaagaacag 52369
to top
>ref|XM_475397.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1488

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 80/92 (86%)
 Strand = Plus / Plus

                                                                       
Query: 525 gaatacgaggtatttgaattgagaattgtccaccgcaagaacagaactggctttgaagaa 584
           ||||| |||||||||||  |||||||| ||||||| |||||||| ||||| ||||| |||
Sbjct: 457 gaatatgaggtatttgagctgagaattttccaccggaagaacaggactggttttgaggaa 516

                                           
Query: 585 aacaaagattttcccattgtcttgaattcagt 616
           |||||||| || || |||||| ||||||||||
Sbjct: 517 aacaaagagttccctattgtcatgaattcagt 548



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 72  atggatgaccagacagagatactagatgagtgtgg 106
           |||||||||||||||||| | || |||||||||||
Sbjct: 1   atggatgaccagacagaggtgctggatgagtgtgg 35
to top
>dbj|AK063502.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-116-E09, full
           insert sequence
          Length = 2090

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 80/92 (86%)
 Strand = Plus / Plus

                                                                       
Query: 525 gaatacgaggtatttgaattgagaattgtccaccgcaagaacagaactggctttgaagaa 584
           ||||| |||||||||||  |||||||| ||||||| |||||||| ||||| ||||| |||
Sbjct: 807 gaatatgaggtatttgagctgagaattttccaccggaagaacaggactggttttgaggaa 866

                                           
Query: 585 aacaaagattttcccattgtcttgaattcagt 616
           |||||||| || || |||||| ||||||||||
Sbjct: 867 aacaaagagttccctattgtcatgaattcagt 898



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 62/70 (88%)
 Strand = Plus / Plus

                                                                       
Query: 37  attctagctctcctgtgtatgggaggtacaagatcatggatgaccagacagagatactag 96
           ||||| ||||| |||| ||||||||||||  |||||||||||||||||||||| | || |
Sbjct: 316 attcttgctctgctgtctatgggaggtacctgatcatggatgaccagacagaggtgctgg 375

                     
Query: 97  atgagtgtgg 106
           ||||||||||
Sbjct: 376 atgagtgtgg 385
to top
>gb|AC121361.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0009E21,
              complete sequence
          Length = 153214

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                          
Query: 37     attctagctctcctgtgtatgggaggtacaagatcatggatgaccagacagagatactag 96
              ||||| ||||| |||| ||||||||||||  |||||||||||||||||||||| | || |
Sbjct: 124796 attcttgctctgctgtctatgggaggtacctgatcatggatgaccagacagaggtgctgg 124737

                        
Query: 97     atgagtgtgg 106
              ||||||||||
Sbjct: 124736 atgagtgtgg 124727



 Score = 48.1 bits (24), Expect = 0.037
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                          
Query: 525    gaatacgaggtatttgaattgagaattgtccaccgcaagaacag 568
              ||||| |||||||||||  |||||||| ||||||| ||||||||
Sbjct: 124113 gaatatgaggtatttgagctgagaattttccaccggaagaacag 124070



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                             
Query: 570    actggctttgaagaaaacaaagattttcccattgtcttgaattcagt 616
              ||||| ||||| ||||||||||| || || |||||| ||||||||||
Sbjct: 123977 actggttttgaggaaaacaaagagttccctattgtcatgaattcagt 123931
to top
>gb|AC108503.4| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1387_F08,
             complete sequence
          Length = 141535

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                         
Query: 37    attctagctctcctgtgtatgggaggtacaagatcatggatgaccagacagagatactag 96
             ||||| ||||| |||| ||||||||||||  |||||||||||||||||||||| | || |
Sbjct: 79047 attcttgctctgctgtctatgggaggtacctgatcatggatgaccagacagaggtgctgg 78988

                       
Query: 97    atgagtgtgg 106
             ||||||||||
Sbjct: 78987 atgagtgtgg 78978



 Score = 48.1 bits (24), Expect = 0.037
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                         
Query: 525   gaatacgaggtatttgaattgagaattgtccaccgcaagaacag 568
             ||||| |||||||||||  |||||||| ||||||| ||||||||
Sbjct: 78364 gaatatgaggtatttgagctgagaattttccaccggaagaacag 78321



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                            
Query: 570   actggctttgaagaaaacaaagattttcccattgtcttgaattcagt 616
             ||||| ||||| ||||||||||| || || |||||| ||||||||||
Sbjct: 78228 actggttttgaggaaaacaaagagttccctattgtcatgaattcagt 78182
to top
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                            
Query: 37       attctagctctcctgtgtatgggaggtacaagatcatggatgaccagacagagatactag 96
                ||||| ||||| |||| ||||||||||||  |||||||||||||||||||||| | || |
Sbjct: 22769597 attcttgctctgctgtctatgggaggtacctgatcatggatgaccagacagaggtgctgg 22769538

                          
Query: 97       atgagtgtgg 106
                ||||||||||
Sbjct: 22769537 atgagtgtgg 22769528



 Score = 48.1 bits (24), Expect = 0.037
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                            
Query: 525      gaatacgaggtatttgaattgagaattgtccaccgcaagaacag 568
                ||||| |||||||||||  |||||||| ||||||| ||||||||
Sbjct: 22768914 gaatatgaggtatttgagctgagaattttccaccggaagaacag 22768871



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                               
Query: 570      actggctttgaagaaaacaaagattttcccattgtcttgaattcagt 616
                ||||| ||||| ||||||||||| || || |||||| ||||||||||
Sbjct: 22768778 actggttttgaggaaaacaaagagttccctattgtcatgaattcagt 22768732
to top
>gb|AC122698.2| Homo sapiens chromosome 5 clone CTD-2313P7, complete sequence
          Length = 107685

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 327   aaaagcagcggtgaaaaagaata 349
             |||||||||||||||||||||||
Sbjct: 28579 aaaagcagcggtgaaaaagaata 28601
to top
>gb|AC091997.3| Homo sapiens chromosome 5 clone RP11-96K8, complete sequence
          Length = 143244

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 327   aaaagcagcggtgaaaaagaata 349
             |||||||||||||||||||||||
Sbjct: 11962 aaaagcagcggtgaaaaagaata 11940
to top
>gb|AC164703.3| Mus musculus BAC clone RP23-266K19 from chromosome 7, complete sequence
          Length = 238433

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 338    tgaaaaagaatatctgaaaga 358
              |||||||||||||||||||||
Sbjct: 119544 tgaaaaagaatatctgaaaga 119564
to top
>ref|XM_612795.2| PREDICTED: Bos taurus similar to solute carrier family 2
           (facilitated glucose transporter), member 13
           (LOC533400), mRNA
          Length = 610

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 245 tgctggaattgctgcaagtcc 265
           |||||||||||||||||||||
Sbjct: 270 tgctggaattgctgcaagtcc 250
to top
>ref|XM_543735.2| PREDICTED: Canis familiaris similar to solute carrier family 2
           (facilitated glucose transporter), member 13
           (LOC486609), mRNA
          Length = 2523

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 245 tgctggaattgctgcaagtcc 265
           |||||||||||||||||||||
Sbjct: 702 tgctggaattgctgcaagtcc 682
to top
>gb|AC122851.4| Mus musculus BAC clone RP23-171C17 from chromosome 3, complete sequence
          Length = 203490

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 473   gaaagaagatccagagtcaaa 493
             |||||||||||||||||||||
Sbjct: 57929 gaaagaagatccagagtcaaa 57909
to top
>gb|AC006478.2| Homo sapiens PAC clone RP5-847G17 from 7, complete sequence
          Length = 173239

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 581   agaaaacaaagattttcccat 601
             |||||||||||||||||||||
Sbjct: 25284 agaaaacaaagattttcccat 25264
to top
>gb|AC109455.2| Homo sapiens chromosome 5 clone RP11-221D10, complete sequence
          Length = 155867

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 203   gaaagagcttcaaatgctcag 223
             |||||||||||||||||||||
Sbjct: 85695 gaaagagcttcaaatgctcag 85715
to top
>gb|AC019089.6| Homo sapiens BAC clone RP11-370L14 from 4, complete sequence
          Length = 177160

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 567   agaactggctttgaagaaaacaaag 591
             ||||||||||||||||||| |||||
Sbjct: 82521 agaactggctttgaagaaatcaaag 82545
to top
>gb|AC157948.5| Mus musculus BAC clone RP23-197K17 from chromosome 7, complete sequence
          Length = 201846

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 338    tgaaaaagaatatctgaaaga 358
              |||||||||||||||||||||
Sbjct: 198742 tgaaaaagaatatctgaaaga 198762
to top
>gb|AC149283.2| Mus musculus BAC clone RP23-233O21 from 7, complete sequence
          Length = 223763

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 338  tgaaaaagaatatctgaaaga 358
            |||||||||||||||||||||
Sbjct: 1553 tgaaaaagaatatctgaaaga 1533
to top
>dbj|AP004908.1| Lotus japonicus genomic DNA, chromosome 6, clone:LjT12N11, TM0066,
             complete sequence
          Length = 79585

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 227   atttgatacttatgatgatgc 247
             |||||||||||||||||||||
Sbjct: 11606 atttgatacttatgatgatgc 11586
to top
>gb|AC115727.10| Mus musculus chromosome 3, clone RP23-30A13, complete sequence
          Length = 183826

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 369   ttgcatcctttccctgagac 388
             ||||||||||||||||||||
Sbjct: 22154 ttgcatcctttccctgagac 22173
to top
>ref|NM_102179.1| Arabidopsis thaliana antiporter/ drug transporter/ transporter
           AT1G23300 mRNA, complete cds
          Length = 1548

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 295 ttgagttggatgctgatgctgaaa 318
           ||||||||| ||||||||||||||
Sbjct: 631 ttgagttggttgctgatgctgaaa 654
to top
>gb|AC113271.10| Mus musculus chromosome 5, clone RP23-376H8, complete sequence
          Length = 185353

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 554   ccaccgcaagaacagaactg 573
             ||||||||||||||||||||
Sbjct: 98992 ccaccgcaagaacagaactg 98973
to top
>gb|AF377946.3| Oryza sativa (japonica cultivar-group) chromosome 3, BAC clone
              OSJNBa0031O09, complete sequence
          Length = 161339

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                              
Query: 564    aacagaactggctttgaagaaaacaaagattt 595
              ||||||||||| ||||||||| ||||| ||||
Sbjct: 132462 aacagaactggttttgaagaagacaaaaattt 132431
to top
>gb|AC160473.4| Mus musculus BAC clone RP23-123N21 from chromosome 12, complete
             sequence
          Length = 198634

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 61    ggtacaagatcatggatgaccagacagagata 92
             |||||||||||||| |||  ||||||||||||
Sbjct: 88649 ggtacaagatcatgaatgtgcagacagagata 88680
to top
>gb|AC124103.5| Mus musculus chromosome 15, clone RP24-271M13, complete sequence
          Length = 177753

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 312   gctgaaaacaatctgaaaagcagc 335
             |||||||||||| |||||||||||
Sbjct: 28247 gctgaaaacaatatgaaaagcagc 28270
to top
>gb|AC183595.3| Pan troglodytes BAC clone CH251-641G8 from chromosome 2, complete
              sequence
          Length = 211457

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 593    ttttcccattgtcttgaatt 612
              ||||||||||||||||||||
Sbjct: 177608 ttttcccattgtcttgaatt 177589
to top
>gb|AC147426.2| Oryza sativa chromosome 3  B1377B10 genomic sequence, complete sequence
          Length = 184366

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 564   aacagaactggctttgaagaaaacaaagattt 595
             ||||||||||| ||||||||| ||||| ||||
Sbjct: 50445 aacagaactggttttgaagaagacaaaaattt 50414
to top
>gb|AC147570.3| Homo sapiens BAC clone RP11-1176F21 from UL, complete sequence
          Length = 191237

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 593    ttttcccattgtcttgaatt 612
              ||||||||||||||||||||
Sbjct: 162217 ttttcccattgtcttgaatt 162198
to top
>gb|AC126437.3| Mus musculus BAC clone RP24-211B22 from chromosome 14, complete sequence
          Length = 167869

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 470    tgagaaagaagatccagagtcaaatatt 497
              ||||||||||||| ||| ||||||||||
Sbjct: 108485 tgagaaagaagatacagtgtcaaatatt 108512
to top
>gb|AC182469.3| Pan troglodytes BAC clone CH251-496G17 from chromosome 4, complete
              sequence
          Length = 191618

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 593    ttttcccattgtcttgaatt 612
              ||||||||||||||||||||
Sbjct: 183380 ttttcccattgtcttgaatt 183361
to top
>gb|AC183765.3| Pan troglodytes BAC clone CH251-521I2 from chromosome 2, complete
             sequence
          Length = 179528

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 593   ttttcccattgtcttgaatt 612
             ||||||||||||||||||||
Sbjct: 27192 ttttcccattgtcttgaatt 27211
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                                
Query: 564      aacagaactggctttgaagaaaacaaagattt 595
                ||||||||||| ||||||||| ||||| ||||
Sbjct: 28867150 aacagaactggttttgaagaagacaaaaattt 28867119
to top
>gb|AC105457.1| Homo sapiens chromosome 21 clone RP11-271G11 map p11-q21.1, complete
             sequence
          Length = 164841

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 593   ttttcccattgtcttgaatt 612
             ||||||||||||||||||||
Sbjct: 28992 ttttcccattgtcttgaatt 29011
to top
>gb|AC118038.15| Mus musculus chromosome 15, clone RP23-87G17, complete sequence
          Length = 209907

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 312    gctgaaaacaatctgaaaagcagc 335
              |||||||||||| |||||||||||
Sbjct: 192495 gctgaaaacaatatgaaaagcagc 192518
to top
>gb|AC092107.5| Homo sapiens BAC clone RP11-755J8 from UL, complete sequence
          Length = 137617

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 593   ttttcccattgtcttgaatt 612
             ||||||||||||||||||||
Sbjct: 17045 ttttcccattgtcttgaatt 17064
to top
>gb|AC146233.2| Pan troglodytes BAC clone RP43-32B21 from 7, complete sequence
          Length = 160147

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 97     atgagtgtggcctggatgtg 116
              ||||||||||||||||||||
Sbjct: 125707 atgagtgtggcctggatgtg 125688
to top
>gb|AC146123.2| Pan troglodytes BAC clone RP43-38F11 from 7, complete sequence
          Length = 185971

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 97    atgagtgtggcctggatgtg 116
             ||||||||||||||||||||
Sbjct: 18474 atgagtgtggcctggatgtg 18455
to top
>gb|AC004866.1| Homo sapiens PAC clone RP4-728H9 from 7, complete sequence
          Length = 138102

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 97    atgagtgtggcctggatgtg 116
             ||||||||||||||||||||
Sbjct: 81501 atgagtgtggcctggatgtg 81482
to top
>gb|AC135414.31| Medicago truncatula clone mth2-8n20, complete sequence
          Length = 127018

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 536   atttgaattgagaattgtcc 555
             ||||||||||||||||||||
Sbjct: 28563 atttgaattgagaattgtcc 28544
to top
>gb|AC148304.3| Medicago truncatula clone mth2-21b19, complete sequence
          Length = 110520

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 536    atttgaattgagaattgtcc 555
              ||||||||||||||||||||
Sbjct: 106195 atttgaattgagaattgtcc 106176
to top
>gb|AC147009.5| Medicago truncatula clone mth2-139j3, complete sequence
          Length = 125303

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 536   atttgaattgagaattgtcc 555
             ||||||||||||||||||||
Sbjct: 98454 atttgaattgagaattgtcc 98473
to top
>emb|AL596322.3| Human DNA sequence from clone RP11-31D17 on chromosome 1 Contains a
             novel gene, complete sequence
          Length = 129044

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 341   aaaagaatatctgaaagaga 360
             ||||||||||||||||||||
Sbjct: 41235 aaaagaatatctgaaagaga 41254
to top
>emb|AL391382.10| Human DNA sequence from clone RP11-38M15 on chromosome 13 Contains a
              chromosome 21 open reading frame 70 (C21orf70) pseudogene,
              two novel genes, a calponin 3 acidic (CNN3) pseudogene, a
              zinc finger protein 267 (ZNF267) pseudogene, two novel
              pseudogenes, a novel gene similar to chromosome 21 open
              reading frame 15 (C21orf15), a pseudogene similar to
              cytochrome P450 subfamily IVF polypeptide 8 (CYP4F8) (CPF8,
              CYPIVF8), a pseudogene similar to sorting nexin 18 (SNX18),
              a melanoma antigen pseudogene and a CpG island, complete
              sequence
          Length = 186458

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 593    ttttcccattgtcttgaatt 612
              ||||||||||||||||||||
Sbjct: 101232 ttttcccattgtcttgaatt 101251
to top
>emb|AL390726.19| Human DNA sequence from clone RP11-392E22 on chromosome 9 Contains a
             pseudogene similar to part of growth arrest-specific 2
             like 1 (GAR22, MGC17243) (GAS2L1), a FKSG83 pseudogene,
             two novel pseudogenes, a novel gene, possible ortholog of
             mouse RIKEN cDNA 2810453I06 gene, a pseudogene similar to
             sorting nexin associated golgi protein 1 (SNAG1) and a CpG
             island, complete sequence
          Length = 84881

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 593   ttttcccattgtcttgaatt 612
             ||||||||||||||||||||
Sbjct: 73696 ttttcccattgtcttgaatt 73715
to top
>emb|AL365361.12| Human DNA sequence from clone RP11-284N8 on chromosome 1 Contains the
             KCNA2 gene for a potassium voltage-gated channel from the
             shaker-related subfamily member 2, the KCNA3 gene for a
             potassium voltage-gated channel from the shaker-related
             subfamily member 3 and two CpG islands, complete sequence
          Length = 193182

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 469   atgagaaagaagatccagagtcaa 492
             |||| |||||||||||||||||||
Sbjct: 24551 atgacaaagaagatccagagtcaa 24528
to top
>emb|AL357510.17| Human DNA sequence from clone RP11-195F21 on chromosome 10 Contains the
              5' end of a novel gene, complete sequence
          Length = 121493

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 461    acttatagatgagaaagaag 480
              ||||||||||||||||||||
Sbjct: 102171 acttatagatgagaaagaag 102190
to top
>emb|AL359741.9| Human DNA sequence from clone RP11-161P17 on chromosome 13 Contains a
             novel pseudogene, complete sequence
          Length = 139877

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 589   aagattttcccattgtcttg 608
             ||||||||||||||||||||
Sbjct: 85237 aagattttcccattgtcttg 85218
to top
>emb|AL139008.10| Human DNA sequence from clone RP11-255A11 on chromosome 9 Contains four
             novel genes, the gene for a novel protein similar to
             suppressor of G2 allele of SKP1 homolog, the gene for a
             novel protein similar to KIAA1074, a melanoma antigen
             pseudogene, a sorting nexin 18 (SNX18) pseudogene, a
             trypsin domain pseudogene, two genes for novel
             immunoglobulin domain containing proteins, the gene for a
             novel protein similar to annexin A2 (ANXA2), the gene for
             a novel protein similar to T-cell receptor beta chain V
             region proteins, a T-cell receptor beta chain V region
             protein LB2 pseudogene and two CpG islands, complete
             sequence
          Length = 159974

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 593   ttttcccattgtcttgaatt 612
             ||||||||||||||||||||
Sbjct: 91060 ttttcccattgtcttgaatt 91041
to top
>emb|AL137020.13| Human DNA sequence from clone RP11-146B14 on chromosome 9 Contains part
             of the JMJD2C gene for jumonji domain containing 2C,
             complete sequence
          Length = 182231

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 577   ttgaagaaaacaaagatttt 596
             ||||||||||||||||||||
Sbjct: 38541 ttgaagaaaacaaagatttt 38522
to top
>gb|AC138772.4| Homo sapiens BAC clone RP11-1345A16 from UL, complete sequence
          Length = 213227

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 593    ttttcccattgtcttgaatt 612
              ||||||||||||||||||||
Sbjct: 113988 ttttcccattgtcttgaatt 114007
to top
>gb|AC105336.14| Mus musculus chromosome 3, clone RP24-277J22, complete sequence
          Length = 176399

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 369    ttgcatcctttccctgagac 388
              ||||||||||||||||||||
Sbjct: 173841 ttgcatcctttccctgagac 173860
to top
>gb|AC138771.4| Homo sapiens BAC clone RP11-1338E21 from UL, complete sequence
          Length = 157733

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 593   ttttcccattgtcttgaatt 612
             ||||||||||||||||||||
Sbjct: 46984 ttttcccattgtcttgaatt 46965
to top
>emb|AL606589.3|OSJN00021 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0008A08,
             complete sequence
          Length = 130521

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 278   ccatgtcaccaacaatgttg 297
             ||||||||||||||||||||
Sbjct: 47242 ccatgtcaccaacaatgttg 47261
to top
>emb|AL513412.3|HS403H13 Homo sapiens chromosome 9 BAC RP11-403H13, complete sequence
          Length = 191668

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 577    ttgaagaaaacaaagatttt 596
              ||||||||||||||||||||
Sbjct: 142024 ttgaagaaaacaaagatttt 142005
to top
>emb|BX901964.13| Zebrafish DNA sequence from clone DKEYP-20A7 in linkage group 24,
             complete sequence
          Length = 82377

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 344   agaatatctgaaagagagtt 363
             ||||||||||||||||||||
Sbjct: 31799 agaatatctgaaagagagtt 31818
to top
>gb|AC182471.3| Pan troglodytes BAC clone CH251-352M13 from chromosome unknown,
             complete sequence
          Length = 170022

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 593   ttttcccattgtcttgaatt 612
             ||||||||||||||||||||
Sbjct: 79568 ttttcccattgtcttgaatt 79549
to top
>gb|AC125394.27| Pan troglodytes clone rp43-45i3, complete sequence
          Length = 214480

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 593   ttttcccattgtcttgaatt 612
             ||||||||||||||||||||
Sbjct: 59231 ttttcccattgtcttgaatt 59250
to top
>gb|AC113132.3| Homo sapiens chromosome 18, clone RP11-433F3, complete sequence
          Length = 170609

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 338   tgaaaaagaatatctgaaag 357
             ||||||||||||||||||||
Sbjct: 37167 tgaaaaagaatatctgaaag 37148
to top
>gb|AC093425.2| Homo sapiens chromosome 1 clone RP11-470E16, complete sequence
          Length = 179499

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 341    aaaagaatatctgaaagaga 360
              ||||||||||||||||||||
Sbjct: 110175 aaaagaatatctgaaagaga 110194
to top
>gb|AC024621.8| Homo sapiens chromosome 18, clone RP11-425M2, complete sequence
          Length = 151162

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 338    tgaaaaagaatatctgaaag 357
              ||||||||||||||||||||
Sbjct: 139480 tgaaaaagaatatctgaaag 139461
to top
>ref|NM_074528.2| Caenorhabditis elegans F57A10.4 (F57A10.4) mRNA, complete cds
          Length = 680

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 311 tgctgaaaacaatctgaaaa 330
           ||||||||||||||||||||
Sbjct: 498 tgctgaaaacaatctgaaaa 479
to top
>gb|AC138775.3| Homo sapiens BAC clone RP11-1247B7 from chromosome 2, complete sequence
          Length = 210658

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 593    ttttcccattgtcttgaatt 612
              ||||||||||||||||||||
Sbjct: 127980 ttttcccattgtcttgaatt 127999
to top
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 278      ccatgtcaccaacaatgttg 297
                ||||||||||||||||||||
Sbjct: 15860677 ccatgtcaccaacaatgttg 15860696
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                                
Query: 564      aacagaactggctttgaagaaaacaaagattt 595
                ||||||||||| ||||||||| ||||| ||||
Sbjct: 28958572 aacagaactggttttgaagaagacaaaaattt 28958541
to top
>gb|AC147060.2| Homo sapiens BAC clone RP11-268B15 from 4, complete sequence
          Length = 174548

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 593   ttttcccattgtcttgaatt 612
             ||||||||||||||||||||
Sbjct: 67124 ttttcccattgtcttgaatt 67143
to top
>gb|AC145621.2| Homo sapiens BAC clone RP11-365B19 from 4, complete sequence
          Length = 167934

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 593   ttttcccattgtcttgaatt 612
             ||||||||||||||||||||
Sbjct: 67124 ttttcccattgtcttgaatt 67143
to top
>gb|AC118282.4| Homo sapiens BAC clone RP11-1281K21 from 4, complete sequence
          Length = 208765

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 593    ttttcccattgtcttgaatt 612
              ||||||||||||||||||||
Sbjct: 148878 ttttcccattgtcttgaatt 148897
to top
>gb|AC073464.5| Homo sapiens BAC clone RP11-134N21 from 2, complete sequence
          Length = 168862

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 593    ttttcccattgtcttgaatt 612
              ||||||||||||||||||||
Sbjct: 116274 ttttcccattgtcttgaatt 116293
to top
>gb|AC138777.3| Homo sapiens BAC clone RP11-1220P14 from 2, complete sequence
          Length = 220281

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 593   ttttcccattgtcttgaatt 612
             ||||||||||||||||||||
Sbjct: 70646 ttttcccattgtcttgaatt 70627
to top
>gb|AC005292.4|AC005292 Genomic sequence for Arabidopsis thaliana BAC F26F24 from chromosome I,
             complete sequence
          Length = 99053

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 295   ttgagttggatgctgatgctgaaa 318
             ||||||||| ||||||||||||||
Sbjct: 41591 ttgagttggttgctgatgctgaaa 41568
to top
>gb|AC119751.3| Homo sapiens BAC clone RP11-241F15 from 4, complete sequence
          Length = 171176

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 593   ttttcccattgtcttgaatt 612
             ||||||||||||||||||||
Sbjct: 84925 ttttcccattgtcttgaatt 84906
to top
>gb|AC069328.1|AC069328 Genomic Sequence For Arabidopsis thaliana Clone T28N17 From Chromosome
             V, complete sequence
          Length = 75593

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 389   tgatgattatgatgacacct 408
             ||||||||||||||||||||
Sbjct: 24647 tgatgattatgatgacacct 24628
to top
>gb|AC051627.4|AC051627 Genomic Sequence For Arabidopsis thaliana Clone T1A4 From Chromosome V,
             complete sequence
          Length = 85746

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 389   tgatgattatgatgacacct 408
             ||||||||||||||||||||
Sbjct: 83686 tgatgattatgatgacacct 83667
to top
>emb|BX571672.10| Human DNA sequence from clone RP11-782C8 on chromosome 1, complete
             sequence
          Length = 175055

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 593   ttttcccattgtcttgaatt 612
             ||||||||||||||||||||
Sbjct: 57234 ttttcccattgtcttgaatt 57253
to top
>dbj|BS000003.1| Pan troglodytes chromosome 22 clone:PTB-084L06, map 22, complete
              sequences
          Length = 183187

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 593    ttttcccattgtcttgaatt 612
              ||||||||||||||||||||
Sbjct: 153359 ttttcccattgtcttgaatt 153378



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 593    ttttcccattgtcttgaatt 612
              ||||||||||||||||||||
Sbjct: 124720 ttttcccattgtcttgaatt 124739
to top
>dbj|AK120135.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013027F03, full
            insert sequence
          Length = 2506

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 564  aacagaactggctttgaagaaaacaaagattt 595
            ||||||||||| ||||||||| ||||| ||||
Sbjct: 1017 aacagaactggttttgaagaagacaaaaattt 1048
to top
>emb|AL583842.40| Human DNA sequence from clone RP11-417J8 on chromosome 1, complete
              sequence
          Length = 195588

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 593    ttttcccattgtcttgaatt 612
              ||||||||||||||||||||
Sbjct: 143091 ttttcccattgtcttgaatt 143110
to top
>dbj|AK066236.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013057F13, full
            insert sequence
          Length = 4559

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 278  ccatgtcaccaacaatgttg 297
            ||||||||||||||||||||
Sbjct: 2386 ccatgtcaccaacaatgttg 2367
to top
>tpe|BN000872.1| TPA: TPA_exp: Mus musculus immunoglobulin heavy chain variable region
              locus, strain C57BL/6
          Length = 2500000

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                              
Query: 61     ggtacaagatcatggatgaccagacagagata 92
              |||||||||||||| |||  ||||||||||||
Sbjct: 303833 ggtacaagatcatgaatgtgcagacagagata 303802
to top
>emb|AL133372.4|CNS01DUX Human chromosome 14 DNA sequence BAC R-269C4 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 190910

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 97     atgagtgtggcctggatgtg 116
              ||||||||||||||||||||
Sbjct: 135944 atgagtgtggcctggatgtg 135925
to top
>gb|AC163348.5| Mus musculus BAC clone RP23-230L2 from chromosome 12, complete
            sequence
          Length = 233932

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 61   ggtacaagatcatggatgaccagacagagata 92
            |||||||||||||| |||  ||||||||||||
Sbjct: 5845 ggtacaagatcatgaatgtgcagacagagata 5814
to top
>emb|Z96048.1|CEF57A10 Caenorhabditis elegans Cosmid F57A10, complete sequence
          Length = 17691

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 311   tgctgaaaacaatctgaaaa 330
             ||||||||||||||||||||
Sbjct: 12531 tgctgaaaacaatctgaaaa 12512
to top
>emb|BX004987.9| Human DNA sequence from clone RP11-435B5 on chromosome 1, complete
             sequence
          Length = 201709

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 593   ttttcccattgtcttgaatt 612
             ||||||||||||||||||||
Sbjct: 70481 ttttcccattgtcttgaatt 70462
to top
>dbj|AP005212.2| Homo sapiens genomic DNA, chromosome 18 clone:RP11-757O6, complete
             sequence
          Length = 174439

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 593   ttttcccattgtcttgaatt 612
             ||||||||||||||||||||
Sbjct: 75814 ttttcccattgtcttgaatt 75795



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 593   ttttcccattgtcttgaatt 612
             ||||||||||||||||||||
Sbjct: 20591 ttttcccattgtcttgaatt 20572
to top
>dbj|AP007292.1| Lotus japonicus genomic DNA, chromosome 2, clone:LjT45D08, TM0313,
             complete sequence
          Length = 98441

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                     
Query: 565   acagaactggctttgaagaaaacaaagattttcccattgt 604
             |||| ||||| |||||||||||||| ||  ||||||||||
Sbjct: 47593 acaggactggatttgaagaaaacaaggaacttcccattgt 47632
to top
>dbj|AP006120.1| Lotus japonicus genomic DNA, chromosome 2, clone:LjT39P22, TM0204,
             complete sequence
          Length = 98532

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                     
Query: 565   acagaactggctttgaagaaaacaaagattttcccattgt 604
             |||| ||||| |||||||||||||| ||  ||||||||||
Sbjct: 62988 acaggactggatttgaagaaaacaaggaacttcccattgt 63027
to top
>emb|AL845329.5| Human DNA sequence from clone RP11-391H1 on chromosome 9, complete
             sequence
          Length = 40742

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 593   ttttcccattgtcttgaatt 612
             ||||||||||||||||||||
Sbjct: 14705 ttttcccattgtcttgaatt 14686
to top
>emb|AL844558.6| Mouse DNA sequence from clone RP23-378I2 on chromosome 2, complete
              sequence
          Length = 149164

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 364    atagcttgcatcctttccct 383
              ||||||||||||||||||||
Sbjct: 131086 atagcttgcatcctttccct 131105


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 7,054,139
Number of Sequences: 3902068
Number of extensions: 7054139
Number of successful extensions: 143980
Number of sequences better than 10.0: 90
Number of HSP's better than 10.0 without gapping: 90
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 143510
Number of HSP's gapped (non-prelim): 469
length of query: 655
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 632
effective length of database: 17,143,297,704
effective search space: 10834564148928
effective search space used: 10834564148928
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top