>gb|AC182460.2| Gallus gallus BAC clone CH261-132N3 from chromosome ul, complete sequence
          Length = 212965

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 234    attagtgaaggtgaaccaggga 255
              ||||||||||||||||||||||
Sbjct: 198355 attagtgaaggtgaaccaggga 198334

>gb|AC177806.2| Gallus gallus BAC clone CH261-13L12 from chromosome ul, complete sequence
          Length = 250495

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 234    attagtgaaggtgaaccaggga 255
              ||||||||||||||||||||||
Sbjct: 127576 attagtgaaggtgaaccaggga 127555

>gb|AC004893.1|AC004893 Homo sapiens PAC clone RP4-808A1 from 7q21.1-q31.1, complete sequence
          Length = 103738

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 257   aatttaggaagaaaacatttg 277
             |||||||||||||||||||||
Sbjct: 73397 aatttaggaagaaaacatttg 73417

>gb|AC147068.3| Pan troglodytes BAC clone RP43-165E11 from 7, complete sequence
          Length = 177119

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 268   aaaacatttgaatcataccc 287
             ||||||||||||||||||||
Sbjct: 99351 aaaacatttgaatcataccc 99332

>gb|AC146089.2| Pan troglodytes BAC clone RP43-47D18 from 7, complete sequence
          Length = 178573

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 268    aaaacatttgaatcataccc 287
              ||||||||||||||||||||
Sbjct: 152387 aaaacatttgaatcataccc 152406

>gb|AC162031.12| Medicago truncatula clone mth2-194a22, complete sequence
          Length = 123712

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 137   cctatagcactgcatgcatggcat 160
             ||||| ||||||||||||||||||
Sbjct: 24177 cctattgcactgcatgcatggcat 24200

>emb|BX571855.11| Zebrafish DNA sequence from clone DKEY-260N18 in linkage group 9,
             complete sequence
          Length = 114407

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 290   cgccttgttttaaaaaacgt 309
             ||||||||||||||||||||
Sbjct: 87111 cgccttgttttaaaaaacgt 87092

>gb|AC136636.6| Mus musculus BAC clone RP24-183E22 from chromosome 1, complete sequence
          Length = 182542

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 185   gttttcttccagcctgcatg 204
             ||||||||||||||||||||
Sbjct: 63953 gttttcttccagcctgcatg 63934

>gb|AY057907.1| Mus musculus brain-derived neurotrophic factor (Bdnf) gene, complete
             cds, alternatively spliced
          Length = 80945

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 192   tccagcctgcatgtggcaac 211
             ||||||||||||||||||||
Sbjct: 74299 tccagcctgcatgtggcaac 74318

>gb|AC107075.4| Homo sapiens BAC clone RP11-452N17 from 2, complete sequence
          Length = 176425

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 252   gggataatttaggaagaaaa 271
             ||||||||||||||||||||
Sbjct: 32026 gggataatttaggaagaaaa 32007

>gb|AE000657.1| Aquifex aeolicus VF5, complete genome
          Length = 1551335

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 177    tccatgccgttttcttccag 196
              ||||||||||||||||||||
Sbjct: 450760 tccatgccgttttcttccag 450741

>emb|AL732477.10| Mouse DNA sequence from clone RP23-393E8 on chromosome 2, complete
             sequence
          Length = 187993

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 192   tccagcctgcatgtggcaac 211
             ||||||||||||||||||||
Sbjct: 87916 tccagcctgcatgtggcaac 87897


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,339,112
Number of Sequences: 3902068
Number of extensions: 3339112
Number of successful extensions: 61128
Number of sequences better than 10.0: 12
Number of HSP's better than 10.0 without gapping: 12
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 61094
Number of HSP's gapped (non-prelim): 34
length of query: 328
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 306
effective length of database: 17,147,199,772
effective search space: 5247043130232
effective search space used: 5247043130232
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)